Microorganism comprising heterologous fructokinase and non-PTS sugar uptake factor, and method for producing l-amino acid using same

By integrating fructokinase from Escherichia and a non-PTS sugar influx factor from Zymomonas into Corynebacterium microorganisms, the production of L-amino acids is significantly enhanced through improved sugar uptake and metabolism, addressing inefficiencies in existing methods.

WO2026121796A1PCT designated stage Publication Date: 2026-06-11CJ CHEILJEDANG CORP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
CJ CHEILJEDANG CORP
Filing Date
2025-12-02
Publication Date
2026-06-11

AI Technical Summary

Technical Problem

Existing methods for producing L-amino acids using microorganisms of the genus Corynebacterium are inefficient and require improvements to enhance production yields.

Method used

Introduction of exogenous fructokinase from the genus Escherichia and a non-PTS sugar influx factor from the genus Zymomonas into Corynebacterium microorganisms to enhance sugar uptake and metabolism, thereby increasing L-amino acid production.

Benefits of technology

High-yield production of L-amino acids is achieved by culturing these modified microorganisms, leveraging the enhanced sugar influx and metabolic pathways.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure relates to a microorganism comprising a heterologous fructokinase and a non-PTS sugar uptake factor, and a method for producing an L-amino acid using same.
Need to check novelty before this filing date? Find Prior Art

Description

Microorganisms containing foreign fructokinase and non-PTS sugar influx factors and methods for producing L-amino acids using the same

[0001] The present disclosure relates to a microorganism comprising an exogenous fructokinase and a non-PTS sugar influx factor, and a method for producing L-amino acids using the same.

[0002]

[0003] Various studies have been conducted on the process of producing target substances (e.g., amino acids) from microorganisms as an environmentally friendly and safe production method; among these, research aimed at producing target substances in large quantities using microorganisms of the genus Corynebacterium has been continuously carried out. Microorganisms of the genus Corynebacterium (*Corynebacterium sp.*) are Gram-positive microorganisms widely used for the production of L-amino acids and other useful substances.

[0004] L-amino acids are the basic building blocks of proteins and are used as important materials for pharmaceutical raw materials, food additives, animal feed, nutritional supplements, insecticides, and fungicides. Various studies are being conducted to develop high-efficiency production microorganisms and fermentation process technologies to produce L-amino acids and other useful substances. For example, target substance-specific approaches are mainly used, such as increasing the expression of genes encoding enzymes involved in L-tryptophan biosynthesis or removing genes unnecessary for biosynthesis (US 8945907 B2).

[0005]

[0006] The problem to be solved by the present disclosure is to provide a microorganism comprising an exogenous fructokinase and a non-PTS sugar influx factor, and a method for producing L-amino acids using the same.

[0007]

[0008] One example of the present disclosure provides a microorganism of the genus Corynebacterium that produces L-amino acids, comprising: a fructokinase derived from a microorganism of the genus Escherichia, a polynucleotide encoding the same, a fructokinase variant polypeptide, or one or more selected from a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from a microorganism of the genus Zymomonas, or one or more selected from a polynucleotide encoding the same.

[0009] Another example of the present disclosure is to provide a composition for producing L-amino acids comprising the microorganism, a culture of the microorganism, a fermented product of the microorganism, or a combination of two or more of these.

[0010] Another example of the present disclosure is to provide a method for producing L-amino acid, comprising the step of culturing the microorganism in a medium.

[0011]

[0012] When culturing a microorganism containing the foreign fructokinase and non-PTS sugar influent of the present disclosure, high-yield L-amino acid production is possible.

[0013]

[0014] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may also be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure should not be considered limited by the specific descriptions provided below.

[0015] In addition, a person skilled in the art can recognize or identify a number of equivalents to the specific embodiments of the present disclosure described herein by using only ordinary experiments. In addition, such equivalents are intended to be included in the present disclosure.

[0016] Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the state of the art to which this disclosure pertains and the content of this disclosure.

[0017]

[0018] definition

[0019]

[0020] As used in the specification and appended claims of this disclosure, singular articles (“a,” “an,” and “the”) may include plural objects unless otherwise noted. Also, unless otherwise noted, singular terms may include plural forms, and plural terms may include singular forms. Additionally, in the specification and appended claims of this disclosure, unless otherwise noted, the use of “or” may be used to mean “and / or”.

[0021]

[0022] In the present disclosure, the term “about” may be placed before a specific numeric value. As used in the present disclosure, the term “about” includes not only the exact number listed after the term, but also a range that is approximately that number or close to that number. Whether the number is close to or nearly that specific number can be determined by considering the context in which the number is presented. For example, the term “about” may refer to a range of -10% to +10% of a numeric value. For another example, the term “about” may refer to a range of -5% to +5% of a given numeric value. However, it is not limited thereto.

[0023]

[0024] In the present disclosure, terms such as “first, second, third,” “i), ii), iii),,” or “(a), (b), (c), (d),,” may be used to distinguish each configuration. When such terms are used in relation to steps of a method, use, or analysis, these terms do not imply that they are performed continuously or in order, for example, there may be no time interval between these steps, they may be performed simultaneously, or they may be performed sequentially, in reverse order, or randomly with intervals of seconds, minutes, hours, days, or months.

[0025]

[0026] In the present disclosure, the term “consisting of” means that the proportion of the specific feature, step, component, or other component(s) described below the term is 100%. The feature, step, component, or other component described below the term “consisting of” may be essential or mandatory. For example, any other feature, step, component, or other component, or a feature, step, component, or other component that is not essential, may be excluded in addition to the feature, step, component, or other component that comes below the term “consisting of”.

[0027] In this disclosure, the term “consisting essentially of” means that one or more unspecified features, steps, components, or other components may be present, where the features, steps, components, or other components of the subject matter claimed in this disclosure are not substantially affected by the presence of said unspecified features, steps, components, or other components.

[0028] In this disclosure, the term “comprising” means the presence of the features, steps, components, or other components described below the above term, and does not exclude the presence of one or more additional features, steps, components, or other components. The features, steps, components, or other components described below the “comprising” in this disclosure may be essential or mandatory, but some embodiments may further include other optional or non-essential features, steps, components, or other components.

[0029]

[0030] Protein, polypeptide, variant protein, variant polypeptide

[0031]

[0032] In this disclosure, the terms “protein” or “polypeptide” refer to a polymer or oligomer of a sequence of amino acid residues. In this disclosure, “polypeptide,” “protein,” and “peptide” may be used interchangeably.

[0033]

[0034] In this application, the term "mature polypeptide or mature protein" refers to a polypeptide or protein in a form that lacks a signal sequence or a propeptide sequence. A mature polypeptide or mature protein may be a functional form of a polypeptide or protein. A mature polypeptide or mature protein refers to a polypeptide in its final form after translation; and / or after posttranslational modification. For example, examples of such posttranslational modification may include, but are not limited to, N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, removal of a leader sequence, etc.

[0035]

[0036] In the present disclosure, amino acid sequences are described in an N-terminal to C-terminal orientation unless otherwise indicated.

[0037] With respect to amino acid sequences in the present disclosure, it is evident that polypeptides or proteins "comprising" the amino acid sequence described by a specific sequence number, polypeptides or proteins "consisting" of the amino acid sequence described by a specific sequence number, or polypeptides or proteins "having" the amino acid sequence described by a specific sequence number may include polypeptides or proteins in which some amino acid(s) are deleted, modified, substituted, or added, provided that they have the same or corresponding activity as the polypeptide or protein composed of the amino acid sequence of the said sequence number. For example, polypeptides or proteins may also include polypeptides or proteins having additions or deletions of amino acid(s) that do not alter the function of the protein, naturally occurring mutations, silent mutations, or conservative substitutions within or before and after (N-terminus or C-terminus) the polypeptide or protein, provided that they have the same or corresponding activity.

[0038] In addition, for example, a polypeptide or protein conjugated with an N-terminal signal (or leader) sequence involved in the co-translational or post-translational translocation of a protein (polypeptide), or a polypeptide or protein conjugated with another sequence or linker to enable identification, purification, or synthesis of the polypeptide or protein, may also be included within the range of the polypeptide or protein of the amino acid sequence described by the specific sequence number.

[0039] In this disclosure, the term “conservative substitution” means substituting an amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids may be arginine, lysine, and histidine; negatively charged (acidic) amino acids may be glutamic acid and aspartic acid; amino acids having a nonpolar side chain (nonpolar amino acids) may be glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids with polar or hydrophilic side chains (polar amino acids) can be classified to include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, they can be classified into electrically charged amino acids with charged side chains (arginine, lysine, histidine, glutamic acid, and aspartic acid) and uncharged amino acids (also referred to as neutral amino acids) with uncharged side chains (glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids.As another example, the 20 amino acids can be classified by size into five groups, starting with the group of amino acids with the smallest volume: glycine, alanine, serine; cysteine, proline, threonine, aspartic acid, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups. Typically, conservative substitutions have little to no effect on the activity of polypeptides or proteins, or may have no effect at all.

[0040]

[0041] In this disclosure, the terms “variant polypeptide,” “variant protein,” or “variant” refer to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, resulting in a sequence of amino acids different from that of the variant prior to modification, while retaining functions or properties. Such a variant can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the capabilities of the variant may be increased, unchanged, or decreased compared to the polypeptide prior to modification. Additionally, some variants may include variants in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the N- and / or C-terminus of a mature protein has been removed. The term "variant" above may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English expressions, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited to these terms as long as they are used with the meaning of being mutated.

[0042] Additionally, variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of a protein involved in the co-translational or post-translational transfer of the protein. Additionally, the polypeptide may be conjugated with another sequence or linker to enable identification, purification, or synthesis of the polypeptide.

[0043]

[0044] The “position N” of the present disclosure may include the position N and an amino acid position corresponding to the position N. Specifically, it may include an amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a specific amino acid sequence. The specific amino acid sequence may be the amino acid sequence of SEQ ID NO. 139.

[0045] In the present disclosure, the term “corresponding to” refers to an amino acid residue at a position listed in the polypeptide, or an amino acid residue that is similar, identical, or homologous to a residue listed in the polypeptide. Identifying the amino acid at the corresponding position may involve determining a specific amino acid of a sequence that references a specific sequence.

[0046] For example, any amino acid sequence can be aligned with SEQ ID NO. 139, and based on this, each amino acid residue of said amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO. 139. For example, a sequence alignment algorithm such as that described in the present disclosure can identify the position of an amino acid, or the position where modifications such as substitution, insertion, or deletion occur, by comparing with a query sequence (also referred to as a “reference sequence”).

[0047] For such alignment, examples such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art can be appropriately used.

[0048]

[0049] Gene, polynucleotide

[0050]

[0051] In the present disclosure, the term “gene” means, in a narrow sense, a polynucleotide encoding a functional molecule, and in a broad sense, a polynucleotide comprising the polynucleotide encoding the functional molecule and the regions preceding and following the polynucleotide. In one embodiment, the functional molecule may be RNA or a protein, and the gene may have a sequence (intron) inserted between each coding region (exon).

[0052]

[0053] In this disclosure, the terms “polynucleotide” or “nucleic acid” refer to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and which is a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of a certain length or longer. In this disclosure, “polynucleotide” and “nucleic acid” may be used interchangeably.

[0054]

[0055] Identity, homology

[0056]

[0057] In this disclosure, the terms “identity” or “homology” refer to the degree of similarity between two given amino acid or base sequences and may be expressed as a percentage. In this disclosure, “homology” and “identity” may often be used interchangeably.

[0058] The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by a standard arrangement algorithm, and a default gap penalty established by the program used may be used together.

[0059] Whether any two polynucleotide or polypeptide sequences have homology or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined by comparing sequence information using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), or by using GAP computer programs such as the Smith-Waterman algorithm (Smith and Waterman, Adv. Appl. Math (1981) 2:482) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET [AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0060]

[0061] Additionally, whether any two polynucleotide sequences are homologous or identical can be determined by Southern hybridization experiments under appropriate hybridization conditions, and said appropriate hybridization conditions can be determined by methods well known to those skilled in the art within the scope of the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto. For example, homologous or identical polynucleotide sequences can generally be hybridized under stringent conditions along the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the total length.

[0062] In the present disclosure, the term “stringent condition” means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, the conditions may include hybridizing polynucleotides with high homology or identity with each other, having homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and not hybridizing polynucleotides with lower homology or identity, or washing conditions equivalent to the washing conditions of normal southern hybridization, such as 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS, and washing once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of normal southern hybridization.

[0063] The hybridization described above may occur between nucleotides having bases of mutually complementary sequences, but hybridized polynucleotides may contain some mismatch between bases depending on the degree of hybridization. The term “complementary” is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present disclosure may include not only substantially similar base sequences but also isolated nucleic acid fragments that are complementary to the entire sequence.

[0064] For example, a polynucleotide having homology or identity with the polynucleotide of the present disclosure can be detected by hybridizing at a Tm value of 55°C. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art.

[0065] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).

[0066]

[0067] Vector, Transformation

[0068]

[0069] As used in this disclosure, the term "vector" refers to a DNA product for delivering a target polynucleotide into a suitable host or host cell.

[0070] For example, a vector may comprise a sequence of nucleotides of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) to enable the expression of the target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell (microorganism), the vector may replicate or function independently of the host genome, or it may be integrated into the genome itself to replicate or function.

[0071] In addition, as an example, the vector of the present disclosure may include a sequence for inserting a target polynucleotide into a chromosome. The insertion of the polynucleotide into the chromosome using said vector may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto.

[0072] The vectors used in this disclosure are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pDC-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. As an example, pDZ, pDC, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors may be used.

[0073] The above vector may additionally include a selection marker to determine whether the vector has been transformed into a host cell or further inserted into a chromosome within the host cell. The selection marker is intended to select cells transformed by the vector or to confirm whether a target polynucleotide has been inserted into a chromosome, and markers conferring selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface polypeptides, may be used. Since only cells expressing the selection marker survive or exhibit other phenotypic traits in an environment treated with a selective agent, the transformed cells can be selected.

[0074] In this disclosure, the term "transformation" means introducing a target polynucleotide, or a vector containing the same, into a host cell (microorganism) to alter the genetic traits of the host cell (microorganism). The transformed polynucleotide may be inserted into the chromosomes of the host cell (microorganism) or located outside the chromosomes. Additionally, the polynucleotide may contain DNA or RNA. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target polypeptide may be introduced into the host cell (microorganism) in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the coding sequence of the target polypeptide. The expression cassette may be in the form of a self-replicating expression vector. In addition, the above polynucleotide may be introduced into a host cell (microorganism) in its own form and operably linked to a sequence required for expression in the host cell (microorganism), but is not limited thereto.

[0075] In the present disclosure, the term “operably linked” means a configuration in which a regulatory sequence is positioned at an appropriate location so that the regulatory sequence controls the expression of a coding sequence. Accordingly, “operably linked” includes a regulatory region of a functional domain having known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, being attached to or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target according to said known or desired activity. For example, it may mean that a promoter sequence and a polynucleotide sequence are functionally linked to initiate and mediate the transcription of a polynucleotide encoding a polypeptide.

[0076] In this disclosure, the term “expression” includes, but is not limited to, any step involved in the generation of a polypeptide, e.g., transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0077] In this disclosure, the term “expression vector” means a linear or circular nucleic acid molecule comprising a target polynucleotide sequence and a regulatory sequence operably linked for the expression thereof. For example, it may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression regulatory region (or expression regulatory sequence) so as to enable the expression of the target polypeptide within a suitable host.

[0078] In this disclosure, the term “regulatory sequence” refers to a polynucleotide sequence required for the regulation of the expression of a target polynucleotide sequence. Each regulatory sequence may be a natural (of the same origin) or foreign (derived from a different gene) sequence with respect to the coding sequence, a variant thereof, or another artificial sequence. Examples of said regulatory sequences include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence coding for a ribosome binding site, and a sequence regulating transcription and translation termination. The minimum unit of said regulatory sequence may include a promoter, a transcription and translation termination sequence.

[0079]

[0080] In this disclosure, the term "genetic recombination" refers to a natural or artificial process in which elements constituting a gene, such as DNA or RNA, are altered from their original sequence during the process of disassembly and reassembly.

[0081] In this disclosure, the term “recombinant gene” refers to a gene having a new genomic composition resulting from genetic recombination, such as chemical synthesis or genetic engineering techniques. In this disclosure, the terms “recombinant gene,” “recombinant DNA,” and “recombinant polynucleotide” may be used interchangeably. For example, the recombinant gene may include an artificial combination of nucleic acid fragments, such as regulatory sequences, that are not found together in nature.

[0082] In this disclosure, the term "recombinant protein" refers to a protein produced as a result of genetic recombination.

[0083]

[0084] microorganism

[0085]

[0086] In this disclosure, the term “microorganism (or strain)” includes both wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone natural or artificial genetic modification, and may be a microorganism in which specific mechanisms are weakened or increased due to causes such as the insertion of external genes or the increase or inactivation of the activity of endogenous genes, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this disclosure, the terms “microorganism,” “strain,” “host,” and “host cell” may be used interchangeably.

[0087] In this disclosure, the term “recombinant microorganism” refers to a microorganism that is genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the nucleic acid sequence coding of the microorganism), and may include both offspring and potential offspring of said microorganism. In this disclosure, the terms “recombinant microorganism,” “genetically modified microorganism,” “recombinant host cell,” “recombinant cell,” and “recombinant strain” may be used interchangeably. The recombinant microorganism may, for example, express a gene not found in its natural (non-recombinant) form; not express a gene expressed in its natural form; or express a natural gene in a manner different from that expressed in its natural form.

[0088] For example, the microorganism of the present disclosure may be a microorganism (e.g., a recombinant microorganism) to which a fructokinase derived from the genus Escherichia, a polynucleotide encoding the same, a fructokinase variant polypeptide, or a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from the genus Zymomonas or a polynucleotide encoding the same have been introduced, but is not limited thereto.

[0089] In the present disclosure, the term "microorganism having L-amino acid production capability" refers to a microorganism capable of producing L-amino acids within a living organism, and may include both microorganisms that inherently lack L-amino acid production capability but are endowed with L-amino acid production capability, and microorganisms that inherently possess L-amino acid production capability. L-amino acid production capability may be endowed or enhanced by species improvement.

[0090] In this disclosure, the term "non-mutated microorganism (strain)" does not exclude microorganisms (strains) containing naturally occurring mutations, and may refer to wild-type microorganisms (strains) or natural-type microorganisms (strains) themselves, or microorganisms (strains) prior to genetic mutations caused by natural or artificial factors. In this disclosure, the term "non-mutated microorganism (strain)" may be used interchangeably with "pre-mutated microorganism (strain)," "non-mutated microorganism (strain)," "parent microorganism," "parent strain," "wild-type microorganism (strain)," "reference microorganism (strain)," or "standard microorganism (strain)." In the present disclosure, the non-modified microorganism may mean a microorganism (strain) prior to the introduction of said protein or polynucleotide, but is not limited thereto, that does not include a fructokinase derived from the genus Escherichia of the present disclosure, a polynucleotide encoding the same, said fructokinase variant polypeptide, or said polynucleotide encoding the same; and / or a non-PTS sugar influx factor derived from the genus Zymomonas of the present disclosure or said polynucleotide encoding the same. For example, in the present disclosure, the non-modified microorganism may be a microorganism of the genus Corynebacterium that does not include a polypeptide consisting of the amino acid sequences of SEQ ID NO. 139, SEQ ID NO. 147, SEQ ID NO. 148 and / or SEQ ID NO. 140 or a polynucleotide encoding the same, but is not limited thereto.

[0091]

[0092] Increase in protein (polypeptide) activity

[0093]

[0094] In the present disclosure, the term “increase” of protein (polypeptide) activity means that the activity of a protein (polypeptide) within a host cell (microorganism) increases relative to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.

[0095] The increase in the above protein (polypeptide) activity may include both the occurrence of protein (polypeptide) activity that the host cell (microorganism) did not inherently possess, and the occurrence of protein (polypeptide) activity that is enhanced compared to the inherent activity or activity prior to modification.

[0096] For example, the above "exhibiting protein (polypeptide) activity that was not inherently possessed" or exhibiting enhanced protein (polypeptide) activity may be due to the "introduction of protein (polypeptide)," but is not limited thereto.

[0097] In this disclosure, the term "introduction" of a protein (polypeptide) means that the activity of a specific protein is exhibited as a result of a gene that was not originally possessed by the microorganism being expressed within the microorganism, or that the polypeptide activity is enhanced, increased, or improved compared to the intrinsic activity of the said protein or its activity prior to modification. For example, this may be due to the introduction of a gene encoding the said protein (polypeptide) into a host cell (microorganism). For example, a polynucleotide encoding the specific protein (polypeptide) may be introduced into a chromosome within the host cell (microorganism), or a vector containing a polynucleotide encoding the specific protein (polypeptide) may be introduced into the host cell (microorganism) to exhibit or improve its activity.

[0098] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism) when a trait changes due to genetic variation caused by natural or artificial factors. This term may be used interchangeably with "pre-transformation activity."

[0099] An increase in the activity of a protein (polypeptide) relative to its intrinsic activity means that the activity and / or concentration (expression level) of the protein (polypeptide) in the host cell (microorganism) has been enhanced compared to the activity and / or concentration (expression level) of the said protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism).

[0100] For example, the above increase may be that the activity of the corresponding protein (polypeptide) was absent, or that the activity or concentration thereof is increased to approximately 1% or more, approximately 10% or more, approximately 25% or more, approximately 50% or more, approximately 75% or more, approximately 100% or more, approximately 150% or more, approximately 200% or more, approximately 300% or more, approximately 400% or more, or approximately 500% or more, up to approximately 1000% or approximately 2000% or more, based on the activity or concentration in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism), but is not limited thereto.

[0101] An increase in the activity of the above protein (polypeptide) can be achieved by introducing an exogenous protein (polypeptide) or by increasing the activity of the intrinsic protein (polypeptide). Whether the activity of the above protein (polypeptide) has increased can be confirmed from an increase in the degree of activity, expression amount, or amount of product attributable to the activity of the said protein (polypeptide).

[0102] Increased activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited to, as long as the activity of the target protein (polypeptide) can be increased compared to that of the host cell (microorganism) before modification. Specifically, it may be, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0103] Specifically, the increase in the activity of the protein (polypeptide) of the present disclosure is

[0104] 1) Increase in the intracellular copy number of polynucleotides encoding proteins (polypeptides);

[0105] 2) Modification of a gene expression regulatory region on a chromosome encoding a protein (polypeptide) (e.g., introduction of a mutation within the expression regulatory region, replacement with a sequence having greater activity, or insertion of a sequence having greater activity);

[0106] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of a gene transcript encoding a protein (polypeptide);

[0107] 4) Modification of the amino acid sequence of the protein (polypeptide) to increase protein (polypeptide) activity;

[0108] 5) Modification of the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide) (e.g., modification of the polynucleotide sequence of the protein (polypeptide) coding gene to code for a modified protein (polypeptide) to increase the activity of the protein (polypeptide);

[0109] 6) Introduction of a foreign protein (polypeptide) exhibiting protein (polypeptide) activity or a foreign polynucleotide encoding the same;

[0110] 7) Codon optimization of polynucleotides encoding proteins (polypeptides);

[0111] 8) Analyze the tertiary structure of the protein (polypeptide) to select and modify or chemically modify the exposed site;

[0112] 9) Regulation of cellular localization of proteins (polypeptides); or

[0113] 10) It may be based on two or more combinations selected from 1) to 9) above, but is not specifically limited thereto.

[0114] for example,

[0115] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described in 1) above may be achieved by introducing a vector containing the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into the chromosomes within the host cell (microorganism). The introduction into the chromosomes may be performed by introducing a vector capable of inserting the polynucleotide into the chromosomes within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural form (of the same origin) or a foreign sequence (derived from a different gene) with respect to the polynucleotide sequence, a variant of these, or another artificial sequence, and may induce the expression of the polynucleotide within the host cell (microorganism).

[0116] The replacement of a gene expression regulatory region (or expression regulatory sequence) on a chromosome encoding a protein (polypeptide) in the above 2) with a sequence having greater activity may, for example, involve introducing a sequence variation by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression regulatory region, or by replacing it with a sequence having greater activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0117] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, and yccA promoter.

[0118] The above 3) modification of the nucleotide sequence of the region coding for the start codon or 5'-UTR of the gene coding for the protein (polypeptide) may be, for example, a modification that codes for another start codon with a higher protein (polypeptide) expression rate compared to the intrinsic start codon, or an RBS sequence with a higher protein (polypeptide) expression rate compared to the intrinsic RBS (ribosome binding site) sequence, but is not limited thereto.

[0119] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) in 4) and 5) above may be the introduction of a sequence variation by deletion, insertion, substitution, or a combination thereof to the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide), or the replacement with an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. The replacement may be performed, for example, by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto.

[0120] The introduction of an exogenous polynucleotide exhibiting the activity of the protein (polypeptide) described in 6) above may be the introduction into a host cell (microorganism) of an exogenous polynucleotide encoding a protein (polypeptide) that exhibits the same or similar activity as the protein (polypeptide). As long as the exogenous polynucleotide exhibits the same or similar activity as the protein (polypeptide), there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the protein (polypeptide) may be produced and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0121] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be a codon optimization of the endogenous polynucleotide so that transcription or translation increases within the host cell (microorganism), or a codon optimization of the exogenous polynucleotide so that optimized transcription and translation occur within the host cell (microorganism).

[0122] 8) Analyzing the tertiary structure of the protein (polypeptide) above to select an exposed site for modification or chemical modification may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the protein (polypeptide) to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select an exposed site to modify or chemically modify.

[0123] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0124] Such an increase in protein (polypeptide) activity may be an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild-type or pre-modification host cell (microorganism), or an increase in the amount of products attributable to the activity of the said protein (polypeptide), but is not limited thereto.

[0125]

[0126] Decrease in protein (polypeptide) activity

[0127]

[0128] In the present disclosure, the term "reduction" of protein (polypeptide) activity encompasses both a decrease in protein (polypeptide) activity relative to intrinsic activity and inactivation within a host cell (microorganism). That is, the reduction of protein (polypeptide) activity may include: protein (polypeptide) activity that is reduced relative to intrinsic activity or activity prior to modification, where the protein (polypeptide) is not completely inactivated within the host cell (microorganism); or protein (polypeptide) activity that is completely inactivated.

[0129] For example, the above reduction may include cases where the protein (polypeptide) activity is lower or absent compared to the protein (polypeptide) possessed by the non-transformed host cell (microorganism) before transformation due to mutations in the polynucleotide encoding the protein (polypeptide); cases where the overall level of protein (polypeptide) expression within the cell is lower compared to the non-transformed host cell (microorganism) before transformation due to inhibition of the expression of the polynucleotide or protein (polypeptide); cases where the expression of the polynucleotide or protein (polypeptide) does not occur at all; and cases where the protein (polypeptide) activity is low or absent even if protein (polypeptide) expression occurs normally.

[0130] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism) when a trait changes due to genetic variation caused by natural or artificial factors. This term may be used interchangeably with "pre-transformation activity."

[0131] The above host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.

[0132] A decrease in the activity of a protein (polypeptide) relative to its intrinsic activity means that the activity and / or concentration (expression level) of the protein (polypeptide) in the host cell (microorganism) has become lower than the activity and / or concentration (expression level) of the said protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism).

[0133] Whether the activity of the above protein (polypeptide) is reduced can be confirmed from the degree of activity, expression amount, or increase in the amount of product attributable to the activity of the said protein (polypeptide).

[0134] For example, the above reduction may be a reduction in the activity or concentration of the corresponding protein (polypeptide) to approximately less than 100%, approximately 90% or less, approximately 80% or less, approximately 70% or less, approximately 60% or less, approximately 50% or less, approximately 40% or less, approximately 30% or less, approximately 20% or less, approximately 10% or less, approximately 5% or less, or 0%, but is not limited thereto.

[0135] The reduction in the activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited to, as long as the activity of the target protein (polypeptide) can be reduced compared to that of the host cell (microorganism) before modification. Specifically, it may be, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0136] Specifically, the reduction in the activity of the protein (polypeptide) of the present disclosure is

[0137] 1) Deletion of all or part of a gene encoding a protein (polypeptide);

[0138] 2) Modification of a gene expression regulatory region on a chromosome encoding a protein (polypeptide) (e.g., introduction of a mutation within the expression regulatory region, replacement with a sequence having expression-inhibiting activity, or insertion of a sequence having expression-inhibiting activity);

[0139] 3) Modification of the amino acid sequence of the protein (polypeptide) so as to reduce the activity of the protein (polypeptide) (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);

[0140] 4) Modification of the polynucleotide sequence encoding the protein (polypeptide) so as to reduce the activity of the protein (polypeptide) (e.g., modification of the polynucleotide sequence of the protein (polypeptide) coding gene to code for a modified protein (polypeptide) so as to reduce the activity of the protein (polypeptide);

[0141] 5) A modification of the nucleotide sequence encoding the start codon or 5'-UTR of a gene encoding a protein (polypeptide);

[0142] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding a protein (polypeptide);

[0143] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a gene encoding a protein (polypeptide) in order to form a secondary structure that prevents ribosome attachment;

[0144] 8) The addition of a reverse-transcribed promoter to the 3' end of the open reading frame (ORF) of a polynucleotide sequence encoding a protein (polypeptide) (Reverse transcription engineering, RTE); or

[0145] 9) Regulation of cellular localization of proteins (polypeptides); or

[0146] 10) It may be based on two or more combinations selected from 1) to 9) above, but is not specifically limited thereto.

[0147] for example,

[0148] The deletion of all or part of the gene encoding the protein (polypeptide) mentioned above 1) may be performed using homologous recombination via a vector for insertion into a chromosome within a microorganism, or using electromagnetic waves such as ultraviolet rays, X-rays, gamma rays, or chemical substances, but is not limited thereto.

[0149] In addition, the replacement of the gene expression regulatory region on the chromosome encoding the above 2) protein (polypeptide) with a sequence having expression-inhibiting activity may, for example, be the introduction of a mutation on the expression regulatory region by deletion, insertion, substitution, or a combination thereof to reduce the expression-inducing activity of the expression regulatory region, or the replacement with a sequence having further expression-inhibiting activity. The expression regulatory region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0150] Additionally, the modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) of 3) and 4) above may involve introducing a sequence variation of deletion, insertion, substitution, or a combination thereof into the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to reduce the activity of the protein (polypeptide), or replacing it with an amino acid sequence or polynucleotide sequence modified to reduce activity, but is not limited thereto. The modification of the sequence may be performed, for example, by inserting a polynucleotide of the modified sequence into a chromosome by homologous recombination, but is not limited thereto. In one embodiment, the protein (polypeptide) may be inactivated by introducing a variation within the polynucleotide sequence encoding the protein (polypeptide) to form a stop codon, but is not limited thereto.

[0151] In addition, the modification of the base sequence coding for the start codon or 5'-UTR of the gene coding for the protein (polypeptide) above 5) may be, for example, a substitution to another start codon with a lower protein (polypeptide) expression rate compared to the intrinsic start codon, or a modification coding for an RBS sequence with a lower protein (polypeptide) expression rate compared to the intrinsic RBS (ribosome binding site) sequence, but is not limited thereto.

[0152] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the protein (polypeptide) mentioned above 6) can be performed, for example, by referring to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986], but is not limited thereto.

[0153] 7) Adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a gene encoding a protein (polypeptide) in order to form a secondary structure that prevents ribosome attachment may make mRNA translation impossible or slow down, but is not limited thereto.

[0154] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the polynucleotide sequence encoding the protein (polypeptide) above may reduce activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide, thereby inhibiting the translation of the protein (polypeptide).

[0155] The above 9) regulation of the intracellular localization of the protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0156] Such a decrease in protein (polypeptide) activity may be a decrease in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild type or host cell (microorganism) prior to modification, but is not limited thereto.

[0157]

[0158] Modification of part or all of the polynucleotides in the host cells (microorganisms) of the present disclosure may be induced by (a) a method using homologous recombination using a chromosome insertion vector or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto.

[0159]

[0160] culture

[0161]

[0162] In this disclosure, the term "culture" means growing microorganisms under appropriately controlled environmental conditions. The culture process may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganisms selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0163] In this disclosure, the term "medium" refers to a substance mixed with nutrients as the main component required for culturing microorganisms, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the microorganisms of this disclosure may be used without special limitations as long as they are media used for culturing microorganisms in general. For example, the microorganisms of this disclosure may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a general medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. For example, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0164] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0165] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0166] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the medium in a batch or continuous manner. However, they are not limited thereto.

[0167] In addition, during the cultivation of the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as a fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0168] In the culture of the present disclosure, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.

[0169] In the present disclosure, the term “culture” means a culture solution, concentrated culture solution, dried culture solution, culture filtrate, concentrated culture filtrate, or dried culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means containing the specific microorganism, and the culture filtrate means not substantially containing the specific microorganism (wherein, substantially means excluding the specific microorganism separated by filtration, etc., and does not mean that the microorganism is completely excluded from the filtrate). The form of the culture is not limited and may be, for example, a liquid, an emulsion, or a solid.

[0170] In this disclosure, the term "fermentation" refers to a process in which microorganisms decompose organic matter using their own enzymes, excluding putrefaction. Although fermentation and putrefaction proceed through similar processes, if useful substances are produced as a result of the decomposition, it is called fermentation, whereas if foul odors are produced or harmful substances are created, it is called putrefaction.

[0171] In the present disclosure, the method of obtaining a fermented product from the microorganism is not particularly limited and can be obtained according to methods commonly used in the relevant technical field or similar fields.

[0172] In the present disclosure, the term "fermented product" includes not only the fermented material itself, but also all types of materials containing a fermented product generated from said microorganisms, such as a material containing a fermented microorganism, a culture produced from a fermented microorganism, a fermented product of a culture, a concentrated fermented product, a dried product of a fermented product, a filtrate of a fermented product, a filtrate of a concentrated fermented product, or a dried product of a filtrate of a fermented product, an extract of a fermented product, or a diluted product of a fermented product.

[0173]

[0174] Specific description of the present disclosure

[0175]

[0176] The embodiments of the present disclosure will be described in more detail below.

[0177]

[0178] One aspect of the present disclosure is a Corynebacterium genus microorganism producing L-amino acids, comprising: a fructokinase derived from a microorganism of the genus Escherichia, a polynucleotide encoding the same, a fructokinase variant polypeptide, or one or more selected from a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from a microorganism of the genus Zymomonas, or one or more selected from a polynucleotide encoding the same.

[0179]

[0180] In the present disclosure, "fructokinase" is a protein having the activity of phosphorylating fructose.

[0181] It is known that in microorganisms expressing fructokinase, sucrose is broken down into 6-phosphorylated glucose and fructose by invertase, then fructose is phosphorylated by fructokinase, and 6-phosphorylated glucose and phosphorylated fructose are used in glycolysis.

[0182] For example, the fructokinase of the present disclosure may be a protein having fructokinase activity encoded by the cscK gene, but is not particularly limited to any type as long as it has activity corresponding to fructokinase. For example, the fructokinase of the present disclosure may be derived from Escherichia coli. For example, the fructokinase of the present disclosure may be encoded by the cscK gene of Escherichia coli.

[0183] cscK from microorganisms derived from Escherichia coli is a fructokinase gene belonging to the csc regulon group and is known to be involved in sucrose metabolism along with cscB (proton symport-type sucrose permease) and cscA (sucrose hydrolase) (J. Bacteriol., 184: 5307-5316, 2002).

[0184] The fructokinase encoded by the above-mentioned cscK gene is known in the art, and the amino acid and polynucleotide sequences of the said fructokinase can be obtained from known databases, such as NCBI’s GenBank, but are not limited thereto.

[0185] For example, the fructokinase protein derived from the genus Escherichia microorganism may include the amino acid sequence of SEQ ID NO. 139 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has fructokinase activity. Specifically, even if it includes a sequence in which some sequences of the amino acid sequence of SEQ ID NO. 139 are deleted, modified, substituted, or added, if it is a protein that exhibits efficacy corresponding to the fructokinase, it may be included in the fructokinase. In addition, any protein that has an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequence of SEQ ID NO. 139, or contains, is composed of, or is essentially composed of, the amino acid sequence, and exhibits an efficacy corresponding to the fructokinase may be included in the fructokinase.

[0186]

[0187]

[0188] Additionally, the sequence of a polynucleotide encoding a fructokinase derived from a microorganism of the genus Escherichia having the amino acid sequence of SEQ ID NO. 139 or an amino acid sequence having 60% or more homology or identity therewith can be obtained, for example, based on codon information known in the art. As an example, the fructokinase may be encoded by a polynucleotide having or including a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO. 11, or which may be composed of or essentially composed of said base sequence, but is not limited thereto. In addition, the nucleotide sequence of SEQ ID NO 11 can be obtained from known databases, such as NCBI’s GenBank, but is not limited thereto.

[0189] In the present disclosure, the polynucleotide (gene) comprising the nucleotide sequence of SEQ ID NO. 11 may be used in combination with the polynucleotide (gene) having the nucleotide sequence of SEQ ID NO. 11, the polynucleotide (gene) consisting of the nucleotide sequence of SEQ ID NO. 11, or cscK.

[0190]

[0191] The variant polypeptide or fructokinase variant polypeptide of the present disclosure refers to a variant polypeptide in which the amino acid corresponding to the 79th or 181st position in the amino acid sequence of SEQ ID NO. 139 is substituted with another amino acid.

[0192] The above "fructokinase variant polypeptide" may be referred to as "fructokinase variant," "variant CscK," "CscK variant," "variant polypeptide," etc. The fructokinase polypeptide to which the variant is introduced in the present disclosure may be used interchangeably with the term "CscK" and is not particularly limited, but may be encoded by the cscK gene and may be a cscK derived from Echerichia coli, but is not limited thereto.

[0193]

[0194] The fructokinase variant polypeptide of the present disclosure may be one in which the amino acid at the position corresponding to the 79th or 181st position in the amino acid sequence of SEQ ID NO. 139 is substituted with an amino acid different from the amino acid before substitution.

[0195] The above "other amino acid" is not limited to any amino acid different from the amino acid before substitution. Meanwhile, when the expression "a specific amino acid has been substituted" is used in the present disclosure, it may be substituted with an amino acid different from the amino acid before substitution, even if it is not separately indicated that it has been substituted with another amino acid.

[0196]

[0197] For example, the above variant polypeptide may be one in which the amino acid corresponding to the 79th position in the amino acid sequence of SEQ ID NO. 139 is substituted with an amino acid other than tryptophan, which is the amino acid before substitution, and the amino acid corresponding to the 181st position in the amino acid sequence of SEQ ID NO. 139 is substituted with an amino acid other than alanine, which is the amino acid before substitution, and may be a combination of the above. The above variant polypeptide may be one in which the amino acid corresponding to the 79th position in the amino acid sequence of SEQ ID NO. 139 is substituted with a substance selected from the group consisting of asparagine, valine, glycine, leucine, arginine, alanine, methionine, threonine, glutamine, proline, isoleucine, serine, phenylalanine, histidine, cysteine, tyrosine, lysine, aspartate, and glutamic acid, but is not limited thereto.

[0198] The above variant polypeptide may be one in which the amino acid corresponding to the 181st position in the amino acid sequence of SEQ ID NO. 139 is substituted with one selected from the group consisting of asparagine, valine, glycine, leucine, arginine, tryptophan, methionine, threonine, glutamine, proline, isoleucine, serine, phenylalanine, histidine, cysteine, tyrosine, lysine, aspartate, and glutamic acid, but is not limited thereto.

[0199] For example, the above variant polypeptide may be one in which the amino acid corresponding to the 79th position in the amino acid sequence of SEQ ID NO. 139 is substituted with cysteine, or the amino acid corresponding to the 181st position in the amino acid sequence of SEQ ID NO. 139 is substituted with valine, or a combination of the above.

[0200] For example, the variant polypeptide provided in the present disclosure may comprise an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or more homology or identity with SEQ ID NO. 139.

[0201]

[0202] For example, the variant polypeptide of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 79th position in the amino acid sequence described in SEQ ID NO. 139 is fixed as cysteine, and which has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or more homology or identity with SEQ ID NO. 139. Additionally, the variant polypeptide of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 181st position in the amino acid sequence described in SEQ ID NO. 139 is fixed as valine, and which has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or more homology or identity with SEQ ID NO. 139. Additionally, the variant polypeptide of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 79th position in the amino acid sequence described in SEQ ID NO. 139 is fixed to cysteine ​​and the amino acid corresponding to the 181st position is fixed to valine, and which has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or more homology or identity with SEQ ID NO. 139. Furthermore, as long as the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the variant polypeptide of the present disclosure, it may be a variant polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, conservedly substituted, or added, but is not limited thereto.

[0203] Meanwhile, a person skilled in the art can identify the amino acid corresponding to the 79th or 181st position of the amino acid sequence of SEQ ID NO. 139 of the present disclosure in any amino acid sequence through sequence alignment known in the art, and even if not separately described in the present disclosure, if "an amino acid at a specific position in a specific SEQ ID NO" is described, it may include, but is not limited to, "an amino acid at a corresponding position" in any amino acid sequence.

[0204]

[0205] For example, the above variant polypeptide may consist of the amino acid sequence of SEQ ID NO. 147 or SEQ ID NO. 148.

[0206] Specifically, the variant polypeptide of the present disclosure may have, include, be composed of, or essentially consist of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 147 or SEQ ID NO. 148.

[0207] Specifically, the variant polypeptide of the present disclosure may have, include, be composed of, or essentially consist of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 147 or the same.

[0208] Specifically, the variant polypeptide of the present disclosure may have, include, be composed of, or essentially consist of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 148 or the same.

[0209] For example, the amino acid sequence may have sequence additions or deletions that do not alter the function of the variant of the present disclosure, naturally occurring mutations, silent mutations, or conservative substitutions.

[0210]

[0211] The polynucleotide encoding the fructokinase variant polypeptide of the present disclosure may be included without limitation as long as it is a polynucleotide sequence encoding a variant polypeptide having fructokinase activity.

[0212] For example, a polynucleotide encoding the fructokinase variant polypeptide of the present disclosure may be a polynucleotide sequence encoding the amino acid sequence of the fructokinase variant polypeptide of the present disclosure, but is not limited thereto.

[0213] For example, it may include a nucleic acid sequence encoding the amino acid sequence described in SEQ ID NO. 147 or SEQ ID NO. 148. As an example of the present disclosure, the polynucleotide of the present disclosure may have or include SEQ ID NO. 149 or SEQ ID NO. 150. Additionally, the polynucleotide of the present disclosure may be composed of or essentially composed of SEQ ID NO. 149 or SEQ ID NO. 150.

[0214]

[0215] For example, the polynucleotide of the present disclosure may include, but is not limited to, all of the above, a base sequence having homology or identity of 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.8% or more with respect to the sequence of SEQ ID NO. 11, wherein a codon encoding tryptophan, which is the amino acid corresponding to the 235th to 237th positions of SEQ ID NO. 11, is substituted with a codon encoding a cysteine ​​amino acid other than tryptophan; or a codon encoding alanine, which is the amino acid corresponding to the 541st to 543rd positions, is substituted with a codon encoding a valine amino acid other than alanine;

[0216] Furthermore, it is obvious that variants having a polynucleotide sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added are included within the scope of the present disclosure, provided that the polynucleotide sequence has such homology or identity and codes for the amino acid sequence of the fructokinase variant polypeptide of the present disclosure.

[0217]

[0218] In the present disclosure, the non-PTS sugar influx factor is a protein having the activity of influxing external sugars into a cell without consuming PEP (phosphoenolpyruvate).

[0219] For example, the non-PTS sugar influx factor of the present disclosure may have the ability to influx glucose and / or fructose.

[0220] Specifically, the above-mentioned non-PTS sugar influx factor may have activity for transporting glucose and / or fructose into the cell, but is not limited thereto.

[0221] In microorganisms, sugar transport proteins can be primarily classified into ABC transporters (ATP binding cassette (ABC) transporters), the Major Facilitator Superfamily (MFS); and the phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). The PTS is also known as the phosphoenolpyruvate (PEP) dependent phosphotransferase transport system and is a sugar transport system in bacteria that is distinct from non-PTS systems.

[0222] ATP-binding cassette transporters are characterized by requiring ATP for sugar molecules entering the cell. MFS are characterized by including H+-linked sympporters, Na+-linked sympporters, antiporters, and uniporters. For example, H+-symporters require extracellular protons for sugar molecules entering the cell. These ABC transporters and MFS are referred to as examples of non-PTS glycotransfer factors. However, non-PTS glycotransfer factors are not limited to these examples.

[0223] For example, the non-PTS sugar influx factor of the present disclosure may be a protein having sugar influx protein activity encoded by the glf gene, and is not particularly limited in type as long as it has sugar influx activity without consuming PEP and can be included in the non-PTS sugar influx factor. For example, the non-PTS sugar influx factor of the present disclosure may be derived from Zymomonas mobilis. For example, the non-PTS sugar influx factor of the present disclosure may be encoded by the glf gene of Zymomonas mobilis, but is not limited thereto.

[0224] The non-PTS sugar influx factor encoded by the above-mentioned glf gene is known in the art, and the amino acid and polynucleotide sequences of the above-mentioned non-PTS sugar influx factor can be obtained from known databases, such as GenBank of NCBI, but are not limited thereto.

[0225] For example, the non-PTS sugar influx factor derived from the genus Zymomonas may include the amino acid sequence of SEQ ID NO. 140 or an amino acid sequence having 60% or more homology or identity with it, but is not limited thereto as long as it has sugar influx activity without consuming PEP. Specifically, even if it includes a sequence in which some sequences of the amino acid sequence of SEQ ID NO. 140 are deleted, modified, substituted, or added, if it is a protein that exhibits efficacy corresponding to the non-PTS sugar influx factor, it may be included in the non-PTS sugar influx factor. In addition, if a protein has an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequence of SEQ ID NO. 140, or includes, is composed of, or is essentially composed of, the amino acid sequence, and exhibits efficacy corresponding to the non-PTS sugar influx factor, it may be included in the non-PTS sugar influx factor.

[0226] Additionally, the sequence of a polynucleotide encoding a non-PTS sugar influx factor derived from a Zymomonas genus microorganism having the amino acid sequence of SEQ ID NO. 140 or an amino acid sequence having 60% or more homology or identity therewith can be obtained, for example, based on codon information known in the art. As an example, the non-PTS sugar influx factor may be encoded by a polynucleotide having or including a sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO. 35, or which may be composed of or essentially composed of said sequence. In addition, the nucleotide sequence of SEQ ID NO 35 can be obtained from known databases, such as NCBI’s GenBank, but is not limited thereto.

[0227] In the present disclosure, the polynucleotide (gene) comprising the base sequence of SEQ ID NO. 35 may be used in combination with the polynucleotide (gene) having the base sequence of SEQ ID NO. 35, the polynucleotide (gene) consisting of the base sequence of SEQ ID NO. 35, or glf.

[0228]

[0229] The polynucleotides of the present disclosure may have various modifications made to their coding regions without altering the amino acid sequence of the protein of the present disclosure, due to codon degeneracy or in consideration of the codons preferred by the organism intended to express the protein of the present disclosure. Accordingly, it is obvious that polynucleotides that can be translated by codon degeneracy into a polypeptide consisting of the amino acid sequence of the fructokinase, fructokinase variant polypeptide, and / or non-PTS sugar influx factor of the present disclosure, or a polypeptide having 60% or more homology or identity therewith, may also be included in the polynucleotides of the present disclosure. For example, the polynucleotides of the present disclosure may be SEQ ID NO. 11, SEQ ID NO. 35, SEQ ID NO. 149, SEQ ID NO. 150, or their degenerated sequences.

[0230]

[0231] In another example, the polynucleotide of the present disclosure may have or include a sequence of SEQ ID NO. 11, SEQ ID NO. 35, SEQ ID NO. 149, or SEQ ID NO. 150; or a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity therewith, or may be composed of, but is not limited to, the sequence of SEQ ID NO. 11, SEQ ID NO. 35, SEQ ID NO. 149, or SEQ ID NO. 150; or a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity therewith.

[0232] Additionally, the polynucleotide of the present disclosure may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence encoding a fructokinase, a fructokinase variant polypeptide, and / or a non-PTS sugar influx factor of the present disclosure, by hybridizing under strict conditions with a sequence complementary to all or part of the polynucleotide sequence of the present disclosure.

[0233]

[0234] The microorganisms of the genus Corynebacterium of the present disclosure have the ability to produce L-amino acids.

[0235] The microorganisms of the present disclosure may include all microorganisms capable of producing a desired L-amino acid, comprising: a fructokinase derived from the genus Escherichia, a polynucleotide encoding the same, a fructokinase variant polypeptide, or a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from the genus Zymomonas, or a polynucleotide encoding the same.

[0236] For example, the microorganism of the present disclosure is characterized by having increased L-amino acid production capacity by including a fructokinase derived from the genus Escherichia, a polynucleotide encoding the same, a fructokinase variant polypeptide, or a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from the genus Zymomonas, or a polynucleotide encoding the same; and may be a genetically modified microorganism or a recombinant microorganism into which the protein or polynucleotide is introduced, but is not limited thereto.

[0237] Specifically, the recombinant strain with increased L-amino acid production capacity may be a microorganism with increased L-amino acid production capacity compared to a non-modified microorganism that does not contain a fructokinase derived from a natural wild-type microorganism or a polynucleotide encoding the same; and a non-PTS sugar influencing factor derived from a microorganism of the genus Zymomonas or a polynucleotide encoding the same, but is not limited thereto.

[0238]

[0239] For example, microorganisms having L-amino acid production ability are microorganisms capable of producing L-amino acids within a living organism, and may include microorganisms that inherently have L-amino acid production ability or parent strains that lack L-amino acid production ability, a fructokinase derived from the genus Escherichia of the present disclosure or a polypeptide thereof; and microorganisms in which L-amino acid production ability is increased or L-amino acid production ability is conferred due to the activity of a non-PTS sugar influx factor derived from the genus Zymomonas. L-amino acid production ability may be conferred or enhanced by species improvement.

[0240] The microorganisms of the present disclosure may include all of the following: one or more selected from fructokinase derived from the genus Escherichia, a polynucleotide encoding the same, said fructokinase variant polypeptide, or a polynucleotide encoding the same, introduced by various known methods; and one or more selected from non-PTS sugar influx factors derived from the genus Zymomonas, or a polynucleotide encoding the same.

[0241]

[0242] For example, the recombinant microorganism having the ability to produce L-amino acids according to the present disclosure may include all microorganisms capable of producing L-amino acids by being transformed through a vector to produce a fructokinase or a variant polypeptide derived from the genus Escherichia microorganism of the present disclosure; and an exogenous gene encoding a non-PTS sugar influx factor derived from the genus Zymomonas microorganism.

[0243] For example, the microorganism producing the L-amino acid may be a microorganism into which a polynucleotide sequence encoding a fructokinase comprising the amino acid sequence of SEQ ID NO. 139 is introduced, or a fructokinase comprising an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO. 139 is introduced.

[0244] For example, the microorganism producing the L-amino acid comprises a fructokinase variant polypeptide comprising a sequence in which the amino acid corresponding to the 79th or 181st position of SEQ ID NO. 139 is substituted with another amino acid; or a fructokinase variant polypeptide comprising a sequence in which the amino acid corresponding to the 79th position of SEQ ID NO. 139 is substituted with cysteine, the amino acid corresponding to the 181st position of SEQ ID NO. 139 is substituted with valine, or a combination thereof; Alternatively, it may be a microorganism into which a polynucleotide sequence encoding a fructokinase variant polypeptide is introduced, comprising an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO. 147 or SEQ ID NO. 148.

[0245] For example, the microorganism producing the L-amino acid may be a microorganism to which the above-mentioned L-amino acid-producing microorganism is introduced, wherein the microorganism comprises a polynucleotide capable of encoding a protein having at least 60% homology with the amino acid sequence of SEQ ID NO. 139; or a polynucleotide having a base sequence of SEQ ID NO. 11, or a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the base sequence of SEQ ID NO. 11.

[0246]

[0247] For example, the microorganism producing the L-amino acid may be a microorganism to which the above-mentioned L-amino acid-producing microorganism is introduced, wherein the polynucleotide capable of encoding a protein comprising an amino acid sequence having at least 60% homology with the amino acid sequence of SEQ ID NO. 147 or SEQ ID NO. 148; or the base sequence of SEQ ID NO. 149 or SEQ ID NO. 150; or the polynucleotide comprising a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the base sequence of SEQ ID NO. 149 or SEQ ID NO. 150.

[0248]

[0249] For example, the microorganism producing the L-amino acid may be a microorganism to which a polynucleotide sequence encoding a non-PTS sugar influent factor comprising the amino acid sequence of SEQ ID NO. 140, or an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more of homology or identity with the amino acid sequence of SEQ ID NO. 140 has been introduced.

[0250] For example, the microorganism producing the L-amino acid may be a microorganism to which the above-mentioned L-amino acid-producing microorganism is introduced, wherein the microorganism may have a polynucleotide capable of encoding a protein comprising an amino acid sequence having at least 60% homology with the amino acid sequence of SEQ ID NO. 140; or a polynucleotide comprising the base sequence of SEQ ID NO. 35, or a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the base sequence of SEQ ID NO. 35.

[0251]

[0252] For example, the microorganism with increased L-amino acid production capacity of the present disclosure may be a microorganism with increased L-amino acid production capacity compared to a non-modified microorganism, but is not limited thereto. For example, the non-modified microorganism, which is the target strain for comparing whether the L-amino acid production capacity is increased, may be ATCC13869, CA04-8357, KCCM11016P, ATCC 13032, CM05-9841, CJH1, or KCCM 12120P strain, but is not limited thereto.

[0253] For example, the above-mentioned microorganism with increased L-amino acid production capacity may be increased by about 1% or more compared to the L-amino acid production capacity of the parent microorganism (parent strain) or the non-mutated microorganism before mutation, specifically about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 15% or more, about 16% or more, about 17% or more, about 18% or more, about 19% or more, about 20% or more, or about 21% or more (there is no special limitation on the upper limit value, for example, it may be about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, or about 25% or less), but is not limited thereto. In another example, the recombinant strain with increased L-amino acid production capacity may have an L-amino acid production capacity that is increased by about 1.1 times or more, about 1.15 times or more, about 1.16 times or more, about 1.17 times or more, about 1.18 times or more, about 1.19 times or more, about 1.2 times or more, or about 1.21 times or more compared to the parent microorganism (parent strain) or non-modified microorganism before mutation (there is no special limitation on the upper limit value, for example, it may be about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, about 1.4 times or less, about 1.3 times or less, or about 1.25 times or less), but is not limited thereto.

[0254]

[0255] The microorganism of the present disclosure may be a microorganism of the genus Corynebacterium.

[0256] As an example of the present disclosure, the microorganism of the present disclosure is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, Corynebacterium imitans It may be imitans), Corynebacterium testudinoris, or Corynebacterium flavescens. Specifically, the microorganism of the present disclosure may be Corynebacterium glutamicum, but is not limited thereto.

[0257] Meanwhile, the microorganisms of the genus Corynebacterium having L-amino acid production capacity of the present disclosure may include the natural wild-type microorganism itself, a microorganism of the genus Corynebacterium that has acquired enhanced L-amino acid production capacity by increasing or decreasing the activity of genes related to the L-amino acid production mechanism, or a microorganism of the genus Corynebacterium that has acquired enhanced L-amino acid production capacity by introducing or increasing the activity of external genes.

[0258] In one example, the microorganism of the present disclosure may have reduced activity of the PEP-dependent phosphotransferase system (PTS). For example, the activity of some or all of the proteins constituting the fructose-acquiring phosphotransferase system may be reduced. In one example, the microorganism of the present disclosure may have reduced expression of the pts-family genes. For example, the expression of the ptsF gene may be reduced, or the expression may be reduced due to a deletion of the ptsF gene, but is not limited thereto.

[0259] For example, the microorganism of the present disclosure may include modifications that increase L-tryptophan production capacity. The microorganism modified to increase L-tryptophan production capacity may have enhanced gene expression encoding anthranilate synthase, tryptophan operon, and transketorase with feedback inhibition released. The microorganism modified to increase L-tryptophan production capacity may include a TrpE comprising an S38R substitution at a position corresponding to 38 from the N-terminus of Corynebacterium TrpE or a TrpE comprising a P21S substitution at a position corresponding to 21 from the N-terminus of Escherichia TrpE. Microorganisms with enhanced tryptophan biosynthetic pathways are incorporated herein by reference into KR 10-2035844 B1.

[0260] For example, the microorganism of the present disclosure may include modifications that increase L-histidine production capacity. The microorganism modified to increase L-histidine production capacity may include HisG (ATP phosphoribosyltransferase) with feedback inhibition released. The HisG may include, for example, substitutions corresponding to G233H and T235Q of the HisG of Corynebacterium glutamicum, for which reference may be made to ACS Synth. Biol., 2014, 3 (1), pp 21-29. The microorganism modified to increase L-histidine production capacity may have enhanced expression of hisE, hisG, hisN, hisD, hisA, hisH, and hisB. Such enhancement of expression may be achieved, for example, through replacement of the start codon, replacement of the promoter, increase in the gene copy number, etc.

[0261] For example, the microorganism of the present disclosure may include modifications that increase L-threonine production capacity. The microorganism modified to increase L-threonine production capacity may include aspartate kinase (LysC) and homoserine dehydrogenase (Hom) with feedback inhibition released. The LysC may include, for example, a substitution corresponding to L377K of the LysC of Corynebacterium glutamicum. The Hom may include, for example, a substitution corresponding to R398Q of the Hom of Corynebacterium glutamicum. For microorganisms with increased threonine production capacity, the contents of US 11236374 B2 are incorporated herein by reference.

[0262]

[0263] Another aspect of the present disclosure provides a method for producing L-amino acids, comprising the step of culturing a microorganism of the genus Corynebacterium in a medium, the mixture comprising: a fructokinase derived from the genus Escherichia of the present disclosure, a polynucleotide encoding the same, a fructokinase variant polypeptide, or a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from the genus Zymomonas or a polynucleotide encoding the same.

[0264] In the present disclosure, in the method for producing L-amino acids, any culture conditions and methods known in the art may be used for the culture of microorganisms. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganism selected.

[0265] The L-amino acid produced by the culture of the present disclosure may be secreted into the medium or remain in the cell.

[0266]

[0267] The L-amino acids of the present disclosure include all L-amino acids that can be produced by microorganisms through metabolic processes from various carbon sources, either by being conferred with production capacity or intrinsically. Specifically, they may be basic amino acids such as L-lysine, L-arginine, and L-histidine; non-polar amino acids such as L-valine, L-leucine, L-glycine, L-isoleucine, L-alanine, L-proline, and L-methionine; polar amino acids such as L-serine, L-threonine, L-cysteine, L-aspartic acid, and L-glutamine; aromatic amino acids such as L-phenylalanine, L-tyrosine, and L-tryptophan; and acidic amino acids such as L-glutamic acid and L-aspartic acid. As an example, the L-amino acids in the present disclosure may be selected from L-tryptophan, L-lysine, L-histidine, and L-threonine.

[0268]

[0269] For example, the method for producing L-amino acids of the present disclosure may additionally include, for example, the step of preparing a microorganism of the present disclosure, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order), prior to the culturing step, but is not limited thereto.

[0270] The method for producing L-amino acids according to the present disclosure may further include a step of recovering a target substance, specifically L-amino acids, from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. The recovery step may be additionally included after the culture step, but is not limited thereto.

[0271] The above recovery may involve collecting the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism disclosed in this disclosure, for example, a batch, continuous, or fed-batch culture method. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the target substance, specifically L-amino acid, can be recovered from the culture medium or microorganism using a suitable method known in the art.

[0272] Additionally, the method for producing L-amino acids of the present disclosure may further include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing L-amino acids of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0273] In the method of the present disclosure, a fructokinase derived from a microorganism of the genus Escherichia, a non-PTS sugar influx factor derived from a microorganism of the genus Zymomonas, a polynucleotide encoding the same, a microorganism of the genus Corynebacterium containing the same, and an L-amino acid, etc., are as described in the other embodiments above.

[0274]

[0275] Another aspect of the present disclosure provides a composition for producing L-amino acids comprising a microorganism of the genus Corynebacterium, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of the following: a fructokinase derived from the genus Escherichia of the present disclosure, a polynucleotide encoding said fructokinase, said fructokinase variant polypeptide, or said polynucleotide encoding said; and a non-PTS sugar influx factor derived from the genus Zymomonas or said polynucleotide encoding said; said microorganism; a culture of said microorganism; said fermented product of said microorganism; or a combination of two or more of the following.

[0276] The composition of the present disclosure may further include any suitable excipients commonly used in compositions for producing L-amino acids, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto.

[0277] In one embodiment, each component present in the composition of the present disclosure may be included in a microbiologically effective amount or in an amount that can be appropriately present in a composition for production.

[0278] In the composition of the present disclosure, the fructokinase derived from a microorganism of the genus Escherichia, the variant polypeptide and the non-PTS sugar influx factor derived from a microorganism of the genus Zymomonas, the polynucleotide encoding the same, the microorganism of the genus Corynebacterium containing the same, and the L-amino acid, etc. are as described in the other embodiments above.

[0279]

[0280] Another aspect of the present disclosure provides a use of a microorganism of the genus Corynebacterium for L-amino acid production, comprising: a fructokinase derived from the genus Escherichia of the present disclosure, a polynucleotide encoding the same, said fructokinase variant polypeptide, or one or more selected from a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from the genus Zymomonas of the present disclosure or one or more selected from a polynucleotide encoding the same.

[0281] In the use of the present disclosure, a fructokinase derived from a microorganism of the genus Escherichia, a variant polypeptide and a non-PTS sugar influx factor derived from a microorganism of the genus Zymomonas, a polynucleotide encoding the same, a microorganism of the genus Corynebacterium containing the same, and L-amino acids, etc., are as described in the other embodiments above.

[0282]

[0283] The present disclosure will be explained in more detail below through examples and experimental examples. However, these examples and experimental examples are intended to illustrate the present disclosure, and the scope of the present disclosure is not limited to these examples and experimental examples.

[0284]

[0285] Example 1. Preparation of a Tryptophan-Producing Strain

[0286]

[0287] CA04-8357, a tryptophan-producing strain developed under Korean Registered Patent No. 10-2035844, was used. To enhance tryptophan production capacity by increasing precursor biosynthesis, deletion was performed on the ptsF gene, a phosphotransferase system that introduces fructose. To construct the deletion vector, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC 13869 as a template and primer pairs SEQ ID NOs. 1 and 2, and SEQ ID NOs. 3 and 4. The polymerase used for the PCR reaction was Solg TM Pfu-X DNA polymerase (SolGent co.) was used, and the PCR amplification conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, and polymerization at 72°C for 1 minute, repeated 27 times, followed by polymerization at 72°C for 5 minutes.

[0288] Sequence No. 1

[0289] - tcgagctcggtacccATACCTCCGACAAGCCACTG

[0290] Sequence No. 2

[0291] - GATTGCCCAGACCACGAAGAATAGCAACTTGACCGGGGAC

[0292] Sequence No. 3

[0293] - GTCCCCGGTCAAGTTGCTATTCTTCGTGGTCTGGGCAATC

[0294] Sequence No. 4

[0295] - ctctagaggatccccAAAAGCAAAAGGCGGTACCA

[0296] As a result, DNA fragments of 719 bp and 738 bp were obtained, respectively. The obtained DNA products were purified using a PCR purification kit (QUIAGEN), and the purified amplification products and the chromosomal transformation vector pDC24 (Sequence No. 138), which was cleaved with SmaI restriction enzyme, were cloned using the Gibson Assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, which was named pDC24△ptsF. Cloning was performed by mixing the Gibson Assembly reagents with each gene fragment in calculated moles and storing at 50°C for 1 hour. After transforming the constructed pDC24△ptsF vector into the CA04-8357 strain by electroporation (Appl.Microbiol.Biotechnol. (1999) 52:541-545), a strain CA04-8357::△ptsF with a ptsF gene deleted on the chromosome was obtained through a secondary crossover process. The genetic manipulation was confirmed by PCR using primers of SEQ ID NO. 5 and SEQ ID NO. 6, which can amplify the external regions of the homologous recombination upstream and downstream regions where the gene is deleted, respectively, and by genome sequencing.

[0297] Sequence No. 5

[0298] - CAGGTGGTAAAGGCATCAA

[0299] Sequence number 6

[0300] - CTCTCGTTTGGTTGCTGT

[0301] The strain CA04-8357::△ptsF obtained in this way was named Corynebacterium glutamicum CM05-9836.

[0302]

[0303] Example 2. Preparation of Corynebacterium strains into which fructokinases of various microorganisms were introduced

[0304]

[0305] Example 2-1. Construction of plasmids for the insertion of fructokinases derived from various microorganisms

[0306] To insert an exogenous fructokinase gene into the Corynebacterium glutamicum chromosome, BBD29_02180-BBD29_02200, known as a gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site. Specifically, to construct a vector for BBD29_02180-BBD29_02200 deletion and target gene insertion, PCR was performed in the same manner as in Example 1 using the ATCC13869 chromosome as a template and primer pairs of SEQ ID NO. 7 and SEQ ID NO. 8, and SEQ ID NO. 9 and SEQ ID NO. 10. Primers of SEQ ID NO. 8 and 9 were designed to include a ScaI cleavage site between the left homologous arm and the right homologous arm.

[0307] Sequence number 7

[0308] - AATTCGAGCTCGGTACCCAGTGGACACGGAGGATTT

[0309] Sequence number 8

[0310] - TGGTGACCGCATTATGGagtactGTTTAGGGTGGGGATAA

[0311] Sequence number 9

[0312] - TTATCCCCACCCTAAACagtactCCATAATGCGGTCACCA

[0313] Sequence number 10

[0314] - GGTCGACTCTAGAGGATCCCCCGTGTAAAGAGCAATCGGG

[0315] As a result, DNA fragments of 823 bp and 813 bp were obtained, respectively. The obtained DNA products were purified using a PCR purification kit, and the purified amplification products and the chromosomal transformation vector pDC24, which was cleaved with SmaI restriction enzyme, were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24△BBD29_02180-BBD29_02200. Gibson cloning was performed in the same manner as in Example 1.

[0316]

[0317] Example 2-2. Production of a Corynebacterium glutamicum microorganism into which the csck gene derived from Escherichia coli was introduced.

[0318] The csck gene (Sequence No. 11), a fructokinase derived from Escherichia coli, was introduced into the CM05-9836 strain prepared in Example 1 above. Information regarding the gene and surrounding nucleotide sequences (Registration No. CP002967.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of Sequence No. 12 and Sequence No. 13 with the chromosomal DNA of the Escherichia coli strain as a template to amplify the csck gene. As a result, a 950 bp DNA fragment containing a 915 bp csck gene was obtained.

[0319] Sequence No. 12

[0320] - CGAAAGGAAACACTCATGTCAGCCAAAGTATGGGT

[0321] Sequence No. 13

[0322] - TGGTGACCGCATTATGGagtCTATTCCAGTTCTTGTCGAC

[0323] To use the CJ7 promoter derived from Corynebacterium stearis (SEQ No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of SEQ No. 15 and SEQ No. 16 with Corynebacterium stearis genomic DNA as a template. As a result, a 353 bp DNA fragment containing a 318 bp CJ7 promoter was obtained.

[0324] Sequence number 15

[0325] - TTATCCCCACCCTAAACagtAGAAACATCCCAGCGCTACT

[0326] Sequence number 16

[0327] - TACTTTGGCTGACATGAGTGTTTCCTTTCGTTGGG

[0328] After treating the pDC24△BBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the csck gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_02180-BBD29_02200:: Pcj7-csck. Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24△BBD29_02180-BBD29_02200:: Pcj7-csck vector into the CM05-9836 strain constructed in Example 1 by electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-csck gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 17 and SEQ ID NO. 18, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9837.

[0329] Sequence number 17

[0330] - TTTTTCTCCCCTCGACCT

[0331] Sequence number 18

[0332] - TCCTCCTTTCTTCTTCAAC

[0333]

[0334] Example 2-3. Production of a Corynebacterium glutamicum microorganism into which the mak gene derived from Escherichia coli was introduced.

[0335] The mak gene (Sequence No. 19), a fructokinase derived from Escherichia coli, was introduced into the strain prepared in Example 1 above. Information regarding the gene and surrounding nucleotide sequences (Registration No. NC_000913.3) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of Sequence No. 20 and Sequence No. 21 with the chromosomal DNA of the Escherichia coli strain as a template to amplify the mak gene. As a result, a 944 bp DNA fragment containing a 909 bp gene derived from Escherichia coli was obtained.

[0336] Sequence number 20

[0337] - CGAAAGGAAACACTCGTGGCGTATAGGTATCGATTTAGG

[0338] Sequence number 21

[0339] - TGGTGACCGCATTATGGagtTTACTCTTGTGGCCATAACC

[0340]

[0341] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 15 and Sequence No. 22 with Corynebacterium stearis genomic DNA as a template.

[0342]

[0343] Sequence number 22

[0344] - AAATCGATACCTATACGCACGAGTGTTTCCTTTTCGTGGG

[0345]

[0346] After treating the pDC24△BBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the mak gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_02180-BBD29_02200:: Pcj7-mak. Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24△BBD29_02180-BBD29_02200:: Pcj7-mak vector into the CM05-9836 strain constructed in Example 1 by electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-mak gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 17 and SEQ ID NO. 18, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9838.

[0347]

[0348] Examples 2-4. Production of Corynebacterium glutamicum microorganisms into which the scrk gene derived from Klebsiella pneumoniae was introduced.

[0349] The scrk gene (SEQN No. 23), a fructokinase derived from Klebsiella pneumoniae, was introduced into the strain prepared in Example 1 above. Information regarding the gene and surrounding nucleotide sequences (Registration No. NC_016845.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQN No. 24 and SEQN No. 25 with the chromosomal DNA of the Klebsiella pneumoniae strain as a template to amplify the scrk gene. As a result, a 959 bp DNA fragment containing a 924 bp gene derived from Klebsiella pneumoniae was obtained.

[0350] Sequence number 24

[0351] - AACGAAAGGAAACACTCATGAATGGAAAATCTGGGT

[0352] Sequence number 25

[0353] - GTGACCGCATTATGGagtTCACAGCGAGCGCTGAAGA

[0354]

[0355] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 15 and Sequence No. 26 with Corynebacterium stearis genomic DNA as a template.

[0356] Sequence number 26

[0357] - CCAGATTTTTCCATTCATGAGTGTTTCCTTTCGTTGGG

[0358]

[0359] After treating the pDC24△BBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the scrk gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_02180-BBD29_02200:: Pcj7-scrk. Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24△BBD29_02180-BBD29_02200:: Pcj7-scrk vector into the CM05-9836 strain constructed in Example 1 using electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-scrk gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 17 and SEQ ID NO. 18, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9839.

[0360]

[0361] Examples 2-5. Production of Corynebacterium glutamicum microorganisms into which the frk gene derived from Zymomonas mobilis was introduced

[0362] The frk gene (SEQN No. 27), a fructokinase derived from Zymomonas mobilis, was introduced into the strain prepared in Example 1 above. Information regarding the gene and surrounding nucleotide sequences (Registration No. M97296.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQN No. 28 and SEQN No. 29 with the chromosomal DNA of the Zymomonas mobilis strain as a template to amplify the frk gene. As a result, a 936 bp DNA fragment containing a 906 bp Zymomonas mobilis-derived gene was obtained.

[0363] Sequence number 28

[0364] - CGAAAGGAAACACTCATGAAAAACGATAAAAAAAATTTATGG

[0365] Sequence number 29

[0366] - ACCGCATTATGGagtTTATTTATTTTCTGCAGCCAATG

[0367]

[0368] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 15 and Sequence No. 30 with Corynebacterium stearis genomic DNA as a template.

[0369] Sequence number 30

[0370] - TTTATCGTTTTTCATGAGTGTTTCCTTTCGTTGG

[0371]

[0372] After treating the pDC24△BBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the frk gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_02180-BBD29_02200::PCJ7-frk. Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24△BBD29_02180-BBD29_02200::PCJ7-frk vector into the CM05-9836 strain constructed in Example 1 using electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-frk gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 17 and SEQ ID NO. 18, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9840.

[0373]

[0374] Example 3. Evaluation of sugar utilization / L-tryptophan production capacity of Corynebacterium microorganisms into which fructokinases of various microbial origins were introduced

[0375] To confirm the L-tryptophan production capacity and fructose utilization capacity of the strains prepared in the above example, they were evaluated by culturing in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured with shaking at 200 rpm for 20 hours at 30°C. Then, 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured with shaking at 200 rpm for 30 hours at 30°C. After the culture was completed, the production of L-tryptophan was measured by HPLC.

[0376]

[0377] <Seed medium (pH 7.0)>

[0378] Glucose 20g, Peptone 10g, Yeast extract 5g, Urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4 7H2O 0.5g, Biotin 100µg, Thiamine HCl 1000µg, Calcium-Pantothenic Acid 2000µg, Nicotinamide 2000µg (based on 1 liter of distilled water)

[0379]

[0380] Production Medium (pH 7.0)

[0381] Fructose 30g, (NH4)2SO4 15g, MgSO4 7H2O 1.2g, KH2PO4 1g, Yeast extract 5g, Biotin 900µg, Thiamine hydrochloride 4500µg, Calcium pantothenic acid 4500µg, CaCO3 30g (based on 1 liter of distilled water)

[0382] Comparison of Fructose Availability and L-Tryptophan Production Capacity of L-Tryptophan Producing Strains Derived from Corynebacterium glutamicum ATCC 13869 (30hr) Strain No. Fructose Consumed (g / L) L-Tryptophan Production (g / L) CA 04-835 730 2.1 CM 05-9836 1.2 0.05 CM 05-9837 3.2 0.3 CM 05-9838 1.2 0.03 CM 05-9839 1.4 0.04 CM 05-984 08.6 0.8

[0383]

[0384] Including the parent strain CA04-8357, which has the ability to produce L-tryptophan, CM05-9836, CM05-9837, CM05-9838, CM05-9839, and CM05-9840 were cultured under conditions of a single carbon source of fructose. In addition, the concentration of L-tryptophan and sugar consumption in the cultures were measured, and the results are shown in Table 1 above.

[0385] CA04-8357, which has ptsF, consumed all of the added fructose within a given time and produced 2.1 g / L of L-tryptophan. However, CMO5-9836, which has ptsF missing from CA04-8357, was unable to consume much sugar and produced tryptophan at a significantly lower concentration compared to CA04-8357.

[0386] CM05-9838 and CM05-9839, into which mak and scrK were introduced, showed levels of sugar consumption and L-tryptophan production similar to those of CM05-9836, confirming that mak and scrK have almost no effect as fructokinases.

[0387] On the other hand, in the case of CM05-9837, into which csck was introduced, sugar consumption and tryptophan production increased slightly compared to the parent strain CA04-8357, and in the case of CM05-9840, into which frk was introduced, it showed the highest level of sugar consumption ability and produced 0.8 g / L of L-tryptophan.

[0388] From the above results, it was confirmed that frk exhibits the best function as a fructokinase under conditions of a single fructose carbon source.

[0389] However, generally, when culturing microorganisms, it is more common to culture them in the presence of fructose and glucose rather than using fructose as a single carbon source. Therefore, the same strains evaluated in this example were cultured and evaluated in a fructose / glucose mixed medium using the following method. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of mixed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. After the culture was completed, the production of L-tryptophan was measured by HPLC.

[0390] <Seed medium (pH 7.0)>

[0391] Glucose 20g, Peptone 10g, Yeast extract 5g, Urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4 7H2O 0.5g, Biotin 100µg, Thiamine HCl 1000µg, Calcium-Pantothenic Acid 2000µg, Nicotinamide 2000µg (based on 1 liter of distilled water)

[0392] Fructose / Glucose Mixed Medium (pH 7.0)

[0393] Fructose 15g, Glucose 15g, (NH4)2SO4 15g, MgSO4 7H2O 1.2g, KH2PO4 1g, Yeast extract 5g, Biotin 900µg, Thiamine hydrochloride 4500µg, Calcium pantothenic acid 4500µg, CaCO3 30g (based on 1 liter of distilled water)

[0394] Comparison of Glucose, Fructose Availability, and L-Tryptophan Production Capacity of L-Tryptophan Producing Strains Derived from Corynebacterium glutamicum ATCC 13869 (20hr) Strain No. Glucose Consumed (g / L) Fructose Consumed (g / L) L-Tryptophan Production (g / L) CA 04-835 7 11.7 151.8 CM 05-9836 13.9 0.2 0.7 CM 05-9837 14.3 2.3 1.1 CM 05-9838 14.10.5 0.8 CM 05-9839 14 0.3 0.8 CM 05-9840 13.8 1.1 0.9

[0395] It was confirmed that all five strains produced under the evaluation conditions consumed glucose at a level similar to that of the parent strain, CA04-8357. On the other hand, the fructose sugar consumption rate showed different results compared to the fructose single carbon source condition. CM05-9840, the frk-introduced strain that exhibited the best sugar consumption rate under the fructose single carbon source condition, showed a lower sugar consumption rate than CM05-9837, the csck-introduced strain, under the mixed medium condition. Therefore, it was determined that csck, which exhibits an appropriate level of activity even under the fructose single carbon source condition without glucose-induced activity inhibition, is the most effective factor as a fructokinase.

[0396]

[0397] Example 4. Preparation of Corynebacterium microorganisms into which Non-PTS glycans derived from various microorganisms were introduced.

[0398]

[0399] Example 4-1. Search and Screening of Non-PTS Fructose Influx Genes

[0400] We aimed to further enhance tryptophan production capacity by increasing the influx of fructose into the strain.

[0401] We searched for foreign genes known to be capable of introducing sugars and selected 14 candidate genes. Among them, considering the biosafety level applicable to production strains and availability, 7 organisms were selected as shown in Table 3 below.

[0402] Sequence Strain Genome Registry Number Biosafety Level Gene Sequence 1Zymomonas mobilisATCC10988CP002850.11352Corynebacterium glutamicumATCC13869CP016335.11423Zygosaccharomyces bailiiAJ515522.11464Kluyveromyces lactisNC_006041.11505Saccharomyces cerevisiaeNC_001136.101546Zygosaccharomyces rouxiiXM_002495633.11587Saccharomyces pastorianusAJ250992.1162

[0403]

[0404] Example 4-2. Construction of plasmids for insertion of Non-PTS glycoflux factors derived from various microorganisms

[0405] To insert an exogenous Non-PTS glycosylation factor into the chromosome of Corynebacterium glutamicum, BBD29_12045-BBD29_12055, known as the gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site. Specifically, to construct a vector for BBD29_12045-BBD29_12055 deletion and target gene insertion, PCR was performed in the same manner as in Example 1 using the ATCC13869 chromosome as a template and primer pairs of SEQ ID NO. 31 and SEQ ID NO. 32, and SEQ ID NO. 33 and SEQ ID NO. 34. Primers of SEQ ID NO. 32 and 33 were designed to include a ScaI cleavage site between the left homologous arm and the right homologous arm.

[0406] Sequence No. 31

[0407] - AATTCGAGCTCGGTACCCGATGGAACTACGAGACT

[0408] Sequence No. 32

[0409] - TGACAATCACCGCATCCagtactGGATATTCGAGACAG

[0410] Sequence number 33

[0411] - CTGTCTCGAATATCCagtactGGATGCGGTGATTGTCAG

[0412] Sequence No. 34

[0413] -GGTCGACTCTAGAGGATCCCCTAACCACGACGAC

[0414] As a result, DNA fragments of 793 bp and 843 bp were obtained, respectively. The obtained DNA products were purified using a PCR purification kit, and the purified amplification products and the chromosomal transformation vector pDC24, which was cleaved with SmaI restriction enzyme, were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24△BBD29_12045-BBD29_12055. Gibson cloning was performed in the same manner as in Example 1.

[0415]

[0416] Example 4-3. Production of a Corynebacterium microorganism into which the Zymomonas mobilis-derived glf gene was introduced

[0417] To enhance the fructose influx ability of the CM05-9837 strain produced in Example 2-2 above, the glf gene (SEQ No. 35), which codes for a Non-PTS sugar influx protein derived from Zymomonas mobilis selected in Example 4-1, was introduced. Information regarding the gene and surrounding nucleotide sequences (Registration No. CP002850.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQ No. 36 and SEQ No. 37 with the chromosomal DNA of the Zymomonas mobilis strain as a template to amplify the glf gene. As a result, a 1452 bp DNA fragment containing the 1422 bp glf gene was obtained.

[0418] Sequence number 36

[0419] - CGAAAGGAAACACTCATGAGTTCTGAAAGTAGTCA

[0420] Sequence number 37

[0421] - ATCACCGCATCCAGTCTACTTCTGGGAGCGCCACA

[0422] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 38 and Sequence No. 39 with Corynebacterium stearis genomic DNA as a template.

[0423] Sequence number 38

[0424] - TCTCGAATATCCAGTAGAAACATCCCAGCGCTACT

[0425] Sequence number 39

[0426] - ACTTTCAGAACTCATGAGTGTTTCCTTTCGTTGGG

[0427]

[0428] After treating the pDC24△BBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the glf gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_12045-BBD29_12055::Pcj7-glf. Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24-Pcj7-glf vector into the CM05-9837 strain constructed in Example 2-2 by electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-glf gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 40 and SEQ ID NO. 41, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9841.

[0429] Sequence number 40

[0430] - AACAACACCACATCTACATC

[0431] Sequence number 41

[0432] - CAGCCTTTTCCAGCACCA

[0433]

[0434] Example 4-4. Production of a Corynebacterium microorganism into which the iolT1 gene derived from Corynebacterium glutamicum was introduced

[0435] To enhance the fructose uptake ability of the CM05-9837 strain produced in Example 2-2 above, the iolT1 gene (Sequence No. 42), which codes for a Non-PTS sugar uptake protein derived from Corynebacterium glutamicum selected in Example 4-1, was introduced. Information regarding the gene and surrounding nucleotide sequences (Registration No. CP016335.1) was obtained from the National Institutes of Health GenBank (NIH GenBank). Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of Sequence No. 43 and Sequence No. 44 with the chromosomal DNA of the Corynebacterium glutamicum strain as a template to amplify the iolT1 gene. As a result, a 1506 bp DNA fragment containing the 1476 bp iolT1 gene was obtained.

[0436] Sequence No. 43

[0437] - CGAAAGGAAACACTCATGGCTAGTACCTTCATTCAGGC

[0438] Sequence No. 44

[0439] - ATCACCGCATCCAGTTTAGTGCACCTTTCCTTTTCG

[0440] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 38 and Sequence No. 45 with Corynebacterium stearis genomic DNA as a template.

[0441] Sequence number 45

[0442] - GAAGGTACTAGCCATGAGTGTTTCCTTTCGTTGGG

[0443]

[0444] After treating the pDC24△BBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the iolT1 gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_12045-BBD29_12055::Pcj7-iolT1. Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24-Pcj7-iolT1 vector into the CM05-9837 strain constructed in Example 2-2 using electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-iolT1 gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 40 and SEQ ID NO. 41, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9842.

[0445]

[0446] Examples 4-5. Production of Corynebacterium microorganisms into which the ffz1 gene derived from Zygosaccharomyces bailii was introduced

[0447] To enhance the fructose influx ability of the CM05-9837 strain produced in Example 2-2 above, the ffz1 gene (SEQ No. 46), which codes for a Non-PTS sugar influx protein derived from Zygosaccharomyces bailii selected in Example 4-1, was introduced. Information on the gene coding for the membrane protein and surrounding nucleotide sequences (Registration No. AJ515522.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQ No. 47 and SEQ No. 48 with the chromosomal DNA of the Zygosaccharomyces bailii strain as a template to amplify the ffz1 gene. As a result, a DNA fragment of 1884 bp containing the 1854 bp ffz1 gene was obtained.

[0448] Sequence number 47

[0449] - CGAAAGGAAACACTCATGGTTAAGATAGACGCTTC

[0450] Sequence number 48

[0451] - ACAATCACCGCATCCAGTTTATTCATCATCATGCT

[0452]

[0453] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 38 and Sequence No. 49 with Corynebacterium stearis genomic DNA as a template.

[0454] Sequence number 49

[0455] - GTCTATCTTAACCATGAGTGTTTCCTTTCGTTGGG

[0456]

[0457] After treating the pDC24△BBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the ffz1 gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_12045-BBD29_12055::Pcj7-ffz1. Gibson cloning was performed in the same manner as in Example 1. A strain containing one copy of the Pcj7-ffz1 gene was obtained by transforming the constructed pDC24△BBD29_12045-BBD29_12055::Pcj7-ffz1 vector into the CM05-9837 strain constructed in Example 2-2 via electroporation and undergoing a secondary crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 40 and SEQ ID NO. 41, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9843.

[0458]

[0459] Examples 4-6. Production of Corynebacterium microorganisms into which the frt1 gene derived from Kluyveromyces lactis was introduced

[0460] To enhance the fructose uptake ability of the CM05-9837 strain produced in Example 2-2 above, the frt1 gene (SEQ No. 50), which codes for a Non-PTS sugar uptake protein derived from *Cluiveromyces lactis* selected in Example 4-1, was introduced. Information on the gene coding for the membrane protein and surrounding nucleotide sequences (Registration No. NC_006041.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQ No. 51 and SEQ No. 52 with the chromosomal DNA of the *Cluiveromyces lactis* strain as a template to amplify the frt1 gene. As a result, a DNA fragment of 1731 bp containing the 1701 bp frt1 gene was obtained.

[0461] Sequence number 51

[0462] - CGAAAGGAAACACTCATGTCTAGTAATCTGTCTGA

[0463] Sequence No. 52

[0464] - ATCACCGCATCCAGTTTAAATAGATTTACGGTTAC

[0465]

[0466] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 38 and Sequence No. 53 with Corynebacterium stearis genomic DNA as a template.

[0467] Sequence number 53

[0468] -CAGATTACTAGACATGAGTGTTTCCTTTCGTTGGG

[0469]

[0470] After treating the pDC24△BBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the frt1 gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_12045-BBD29_12055:: Pcj7-frt1. Gibson cloning was performed in the same manner as in Example 1. A strain containing one copy of the Pcj7-frt1 gene was obtained by transforming the constructed pDC24△BBD29_12045-BBD29_12055:: Pcj7-frt1 vector into the CM05-9837 strain constructed in Example 2-2 via electroporation and undergoing a secondary crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 40 and SEQ ID NO. 41, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9844.

[0471]

[0472] Examples 4-7. Production of Corynebacterium microorganisms with introduced hxt6 gene derived from Saccharomyces cerevisiae

[0473] To enhance the fructose influx ability of the CM05-9837 strain produced in Example 2-2 above, the hxt6 gene (SEQ No. 54), which codes for a Non-PTS sugar influx protein derived from Saccharomyces cerevisiae selected in Example 4-1, was introduced. Information on the gene coding for the membrane protein and surrounding nucleotide sequences (Registration No. NC_001136.10) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQ No. 55 and SEQ No. 56 with the chromosomal DNA of the Saccharomyces cerevisiae strain as a template to amplify the hxt6 gene. As a result, a 1743 bp DNA fragment containing the 1713 bp hxt6 gene was obtained.

[0474] Sequence number 55

[0475] - CGAAAGGAAACACTCATGTCACAAGACGCTGCTAT

[0476] Sequence number 56

[0477] - ATCACCGCATCCAGTTTATTTGGTGCTGAACATTC

[0478]

[0479] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 38 and Sequence No. 57 with Corynebacterium stearis genomic DNA as a template.

[0480] Sequence number 57

[0481] -AGCGTCTTGTGACATGAGTGTTTCCTTTCGTTGGG

[0482]

[0483] After treating the pDC24△BBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and hxt6 gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_12045-BBD29_12055:: Pcj7-hxt6. Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24△BBD29_12045-BBD29_12055:: Pcj7-hxt6 vector into the CM05-9837 strain constructed in Example 2-1 using electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-hxt6 gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 40 and SEQ ID NO. 41, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9845.

[0484]

[0485] Examples 4-8. Production of Corynebacterium microorganisms into which the fsy1 gene derived from Zygosaccharomyces rouxii was introduced

[0486] To enhance the fructose uptake ability of the CM05-9837 strain produced in Example 2-2 above, the fsy1(zro) gene (SEQ ID No. 58) coding for a Non-PTS sugar uptake protein derived from Zygosaccharomyces luxi selected in Example 4-1 was introduced. Information on the gene coding for the membrane protein and surrounding nucleotide sequences (Registration ID No. XM_002495633.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQ ID No. 59 and SEQ ID No. 60 with chromosomal DNA of the Saccharomyces cerevisiae strain as a template to amplify the fsy1(zro) gene. As a result, a 1725 bp DNA fragment containing a 1695 bp fsy1(zro) gene was obtained.

[0487] Sequence number 59

[0488] - CGAAAGGAAACACTCATGAAGTTTTCTACTTGGCG

[0489] Sequence number 60

[0490] -ATCACCGCATCCAGTCTAATAGCTTAGTTTACCTC

[0491]

[0492] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 38 and Sequence No. 61 with Corynebacterium stearis genomic DNA as a template.

[0493] Sequence number 61

[0494] -AGTAGAAAACTTCATGAGTGTTTCCTTTCGTTGGG

[0495]

[0496] After treating the pDC24△BBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the fsy1(zro) gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_12045-BBD29_12055:: Pcj7-fsy1(zro). Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24△BBD29_12045-BBD29_12055:: Pcj7-fsy1(zro) vector into the CM05-9837 strain constructed in Example 2-2 by electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-fsy1(zro) gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 40 and SEQ ID NO. 41, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9846.

[0497]

[0498] Examples 4-9. Production of Corynebacterium microorganisms into which the fsy1 gene derived from Saccharomyces pastorianus was introduced

[0499] To enhance the fructose influx ability of the CM05-9837 strain produced in Example 2-2 above, the fsy1(spa) gene (SEQ No. 62) coding for a Non-PTS sugar influx protein derived from Saccharomyces pastorianus selected in Example 4-1 was introduced. Information on the gene coding for the membrane protein and surrounding nucleotide sequences (Registration No. AJ250992.1) was obtained from the National Institutes of Health GenBank. Based on the obtained nucleotide sequences, PCR was performed in the same manner as in Example 1 using primers of SEQ No. 63 and SEQ No. 64 with the chromosomal DNA of the Saccharomyces pastorianus strain as a template to amplify the fsy1(spa) gene. As a result, a 1743bp DNA fragment containing the 1713bp fsy1(spa) gene was obtained.

[0500] Sequence number 63

[0501] - CGAAAGGAAACACTCATGTCACATGTTAACGCGTC

[0502] Sequence number 64

[0503] - ATCACCGCATCCAGTCTAATAGCTCAATTGGCCCT

[0504]

[0505] To use the CJ7 promoter derived from Corynebacterium stearis (Sequence No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 38 and Sequence No. 65 with Corynebacterium stearis genomic DNA as a template.

[0506] Sequence number 65

[0507] - GTTAACATGTGACATGAGTGTTTCCTTTCGTTGGG

[0508]

[0509] After treating the pDC24△BBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the fsy1(spa) gene fragment using the Gibson assembly method, and it was named pDC24△BBD29_12045-BBD29_12055:: Pcj7-fsy1(spa). Gibson cloning was performed in the same manner as in Example 1. After transforming the constructed pDC24△BBD29_12045-BBD29_12055:: Pcj7-fsy1(spa) vector into the CM05-9837 strain constructed in Example 2-2 by electroporation and undergoing a secondary crossover process, a strain containing one copy of the Pcj7-fsy1(spa) gene was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 40 and SEQ ID NO. 41, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions into which the gene was inserted. The strain obtained in this way was named CM05-9847.

[0510]

[0511] Example 5. Evaluation of sugar utilization / L-tryptophan production capacity of Corynebacterium microorganisms introduced with Non-PTS sugar influx factors derived from various microorganisms

[0512] To confirm the L-tryptophan production capacity and fructose utilization capacity of the strain prepared in Example 4 above, they were evaluated by culturing in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured with shaking at 200 rpm for 20 hours at 30°C. Then, 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of mixed medium and cultured with shaking at 200 rpm for 20 hours at 30°C. After the culture was completed, the production of L-tryptophan was measured by HPLC.

[0513]

[0514] < Seed medium (pH 7.0) >

[0515] Glucose 20g, Peptone 10g, Yeast extract 5g, Urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4 7H2O 0.5g, Biotin 100µg, Thiamine HCl 1000µg, Calcium-Pantothenic Acid 2000µg, Nicotinamide 2000µg (based on 1 liter of distilled water)

[0516]

[0517] Fructose / Glucose Mixed Medium (pH 7.0)

[0518] Fructose 15g, glucose 15g, (NH4)2SO4 15g, MgSO4 7H2O 1.2g, KH2PO4 1g, yeast extract 5g, biotin 900µg, thiamine hydrochloride 4500µg, calcium-pantothenic acid 4500µg, CaCO3 30g (based on 1 liter of distilled water).

[0519]

[0520] Comparison of Glucose, Fructose Availability, and L-Tryptophan Production Capacity of L-Tryptophan-Producing Strains Derived from Corynebacterium glutamicum ATCC 13869 with Introduced Fructose Availability Factor (20H) Strain No. Glucose Consumed (g / L) Fructose Consumed (g / L) Total Sugars Consumed (g / L) L-Tryptophan Production volume (g / L)CM05-983714.12.216.31CM05-984112.310.322.52.2CM05-984213.53.416.91.1CM05-984313.54.217.71.3CM05-984413.2316.21.2CM05-98457.36.914.20.6CM05-98469.47.416.81CM05-98477.56.914.40.9

[0521] Based on the strains prepared in Example 4, culture was carried out in a mixed medium of glucose and fructose. As a result, as shown in Table 4 above, it was confirmed that the parent strain CM05-9837 consumed most of the glucose but had low fructose consumption capacity. However, the CM05-9841 strain, into which a Non-PTS sugar influx protein derived from Zymomonas mobilis was introduced, showed a fructose consumption capacity approximately 4.7 times higher than that of the parent strain and exhibited the highest tryptophan productivity. Through these results, it was confirmed that among a total of seven types of foreign Non-PTS fructose influx factors, glf derived from Zymomonas mobilis was the most effective and, when combined with csck, increased tryptophan production along with the greatest improvement in sugar influx capacity.

[0522]

[0523] Example 6. Evaluation of sugar utilization / L-histidine production capacity of Corynebacterium microorganisms introduced with the csck gene derived from Escherichia and the glf gene derived from Zymomonas

[0524]

[0525] Example 6-1. Preparation of a Histidine-Producing Strain

[0526] To evaluate L-histidine production capacity, the Corynebacterium glutamicum strain CJH1 was constructed.

[0527] Specifically, to resolve the feedback inhibition of the HisG protein, the first enzyme of the L-histidine biosynthesis pathway, the 233rd and 235th amino acids from the N-terminus of HisG were simultaneously replaced from glycine to histidine and from threonine to glutamine, respectively (Sequence No. 66) (ACS Synth. Biol., 2014, 3 (1), pp 21-29). In addition, to enhance the activity of the hisE gene, which is located within the same operon as hisG, the start codon was replaced from GTG to ATG. Furthermore, to enhance the L-histidine biosynthesis pathway, the promoters of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB were replaced with strong promoters, and the hisE(g1a)G(G233H / T235Q) gene and the hisD gene were enhanced by introducing additional copies.

[0528]

[0529] Example 6-1-1. Production of a histidine-producing strain with resolved feedback limitation

[0530] To construct a histidine-producing strain with resolved feedback limitation, the left homologous carcinoma fragment of 'hisE(g1a)G(G233H / T235Q)' was obtained by performing PCR using primers of SEQ ID NO. 67 and SEQ ID NO. 68 and primers of SEQ ID NO. 69 and SEQ ID NO. 70, in the same manner as in Example 1. The 'hisE(g1a)G(G233H / T235Q)' gene fragment was obtained by performing PCR using the two amplified DNA fragments as templates and primers of SEQ ID NO. 67 and SEQ ID NO. 70, in the same manner as in Example 1. In addition, PCR was performed using primers of sequence numbers 71 and 72 with ATCC13032 chromosomal DNA as a template, and the upstream region of the hisE gene was obtained.

[0531] Sequence number 67

[0532] - gaggagatcaaaacaATGAAGACATTTGAC

[0533] Sequence number 68

[0534] - AGTGGGGATACCTGTGGGTGGGATAAGCCT

[0535] Sequence number 69

[0536] -GGCTTATCCCACCCACAGGTATCCCCACTG

[0537] Sequence number 70

[0538] - ACTCTAGAGGATCCCCCTAGATCGCGGGC

[0539] Sequence number 71

[0540] -TCGAGCTCGGGTACCCACCGAACTCCTGACAGAGT

[0541] Sequence number 72

[0542] -acatgaagcgccTCGGTACATTCTTCCACA

[0543]

[0544] In order to replace with a strong promoter, PCR was performed in the same manner as in Example 1 using primers of SEQ ID NO. 74 and SEQ ID NO. 75 with the synthetic promoter Pspl13 promoter (SEQ ID NO. 73, US 10584338 B2) as a template.

[0545] Sequence number 74

[0546] -AAGAATGTACCGAggcgcttcatgtcaaca

[0547] Sequence number 75

[0548] - CAAATGTCTTCATtgttttgatctcctcca

[0549] After treating the pDC24 vector with the restriction enzyme Sma1, a recombinant plasmid was obtained by cloning the upstream DNA fragment of the amplified hisE gene, the Pspl13 promoter region, and the hisEG (G233H / T235Q) gene fragment using the Gibson assembly method, and it was named pDC24△Pn_hisEG::Pspl13_hisEG(G233H / T235Q). Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24△Pn_hisEG::Pspl13_hisEG(G233H / T235Q) vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a secondary crossover process was performed to introduce a mutation into the existing hisG gene, thereby resolving the feedback restriction, and to substitute the start codon of the hisE gene, a strain with enhanced hisE activity was obtained. The genetic manipulation was confirmed through PCR using primers of SEQ ID NO. 76 and SEQ ID NO. 77 and genome sequencing. The strain obtained in this way was named CJ-HIS1.

[0550] Sequence number 76

[0551] - AGCTTTTCGACGAATCCC

[0552] Sequence number 77

[0553] - CTGCCTCTCACAAGTTGAAG

[0554]

[0555] Example 6-1-2. Production of a histidine-producing strain with an enhanced biosynthetic pathway through promoter replacement

[0556] Next, to enhance the activity of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB, plasmids were constructed as follows to replace the wild-type promoters of each gene with strong promoters.

[0557] Specifically, PCR was performed in the same manner as in Example 1 using primers of SEQ ID NOs 78 and 79, SEQ ID NOs 80 and 81, SEQ ID NOs 82 and 83, SEQ ID NOs 84 and 85, and SEQ ID NOs 86 and 87 with Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template, and upstream fragments of the hisN, hisH, hisD, hisA, and hisB genes were obtained.

[0558] Sequence number 78

[0559] - TCGAGCTCGGGTACCCATTGGTGCTCGGCGC

[0560] Sequence number 79

[0561] - tgggatgtttctGTGTTGTTAGTCTAGTG

[0562] Sequence number 80

[0563] - TCGAGCTCGGTACCCAACCAAGTTTAGATGCGCC

[0564] Sequence number 81

[0565] - gctgggatgtttctGCCGATAGTTTATGTCA

[0566] Sequence number 82

[0567] - TCGAGCTCGGTACCCGGTGACAGCTCGCGCCGCAT

[0568] Sequence number 83

[0569] - gcgctgggatgtttctGGCGAAAAGTTCTCCC

[0570] Sequence number 84

[0571] - TCGAGCTCGGGTACCCTTGATGCCTGCATGAAGG

[0572] Sequence number 85

[0573] - tgacatgaagcgccGAATATTGATCCTATCT

[0574] Sequence number 86

[0575] - TTCGAGCTCGGTACCCACCTTCAGCAACCACTC

[0576] Sequence number 87

[0577] - tgacatgaagcgccGAAAAATTCTTCTCT

[0578] In addition, using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template, downstream regions of the hisN, hisH, hisD, hisA, and hisB genes were obtained using primers of SEQ ID NO. 88 and SEQ ID NO. 89, SEQ ID NO. 90 and SEQ ID NO. 91, SEQ ID NO. 92 and SEQ ID NO. 93, SEQ ID NO. 94 and SEQ ID NO. 95, and SEQ ID NO. 96 and SEQ ID NO. 97, respectively.

[0579] Sequence number 88

[0580] -aaaggaacactcATGAGCAAATATGCAGACG

[0581] Sequence number 89

[0582] - CTAGAGGATCCCCCAGCCGGAGAGGGAGGAG

[0583] Sequence number 90

[0584] -aaaggaacactcATGACCAAAACTGTCGC

[0585] Sequence number 91

[0586] - CTAGAGGATCCCCACCTCTGGAGGGCGTGGTC

[0587] Sequence number 92

[0588] -cgaaaggaaacactcATGTTGAATGTCACTGACC

[0589] Sequence number 93

[0590] - CTAGAGGATCCCCCCGTGCTCAGCCTGAGGAG

[0591] Sequence number 94

[0592] - ggagatcaaaacaATGACCTTCACTATTCTTCC

[0593] Sequence number 95

[0594] - CTAGAGGATCCCACGAAACGTGCACAACCTT

[0595] Sequence number 96

[0596] - gagatcaaaacaATGACTGTCGCACCA

[0597] Sequence number 97

[0598] - CTAGAGGATCCCCGGGTCGCGGCCGTAGTGGC

[0599]

[0600] In order to replace the endogenous promoters of the hisN, hisH, and hisD genes with the strong promoter Pcj7 promoter (SEQ No. 14, US 7662943 B2), PCR was performed in the same manner as in Example 1 using primers of SEQ No. 98 and 99, SEQ No. 100 and 101, and SEQ No. 102 and 103, using the genomic DNA of Corynebacterium stearis as a template.

[0601] Sequence number 98

[0602] - ACTAGACTAACAAACACagaaacatcccagcgc

[0603] Sequence number 99

[0604] - TCTGCATATTTGCTCATgagtgtttccttt

[0605] Sequence number 100

[0606] - ACATAAACTATCGGCagaaacatcccagcgcta

[0607] Sequence number 101

[0608] -GACAGTTTTGGTCATgagtgtttcctttcg

[0609] Sequence No. 102

[0610] -GAGAACTTTTCGCCagaaacatcccagcgct

[0611] Sequence No. 103

[0612] -AGTGACATTCAACATgagtgtttcctttcg

[0613]

[0614] In addition, to replace the intrinsic promoters of the hisA and hisB genes with the strong promoter Pspl13 promoter (Sequence No. 73, US 10584338 B2), PCR was performed in the same manner as in Example 1 using primers of Sequence No. 104, Sequence No. 105, Sequence No. 106, and Sequence No. 107 with the Pspl13 promoter as a template.

[0615] Sequence No. 104

[0616] - AGGATCAATTTCggcgcttcatgtcaac

[0617] Sequence No. 105

[0618] - GAATAGTGAAGGTCATtgttttgatctcct

[0619] Sequence number 106

[0620] -GAGAAGAATTTTTCggcgcttcatgtcaa

[0621] Sequence number 107

[0622] - TGGTGCGACAGTCATtgttttgatctcct

[0623]

[0624] After treating the pDC24 vector with restriction enzyme Sma1, recombinant plasmids were obtained by cloning the upstream DNA fragments of the amplified hisN, hisH, and hisD genes, the Pcj7 promoter fragment, and the downstream DNA fragments of the hisN, hisH, and hisD genes, respectively, using the Gibson assembly method, and were named pDC24△Pn::Pcj7_hisN, pDC24△Pn::Pcj7_hisH, and pDC24△Pn::Pcj7_hisD. In addition, recombinant plasmids were obtained by treating the pDC24 vector with restriction enzyme Sma1, the upstream DNA fragments of the amplified hisA and hisB genes, the Pspl13 promoter fragment, and the downstream DNA fragments of the hisA and hisB genes, respectively, using the Gibson assembly method, and were named pDC24△Pn::Pspl13_hisA and pDC24△Pn::Pspl13_hisB. Gibson cloning was performed in the same manner as in Example 1.

[0625] A strain was obtained in which the gene was strengthened by replacing the promoter of the existing hisN gene through a secondary crossover process after transforming the CJ-HIS1 produced in Example 6-1-1 with the constructed pDC24△Pn:: Pcj7_hisN vector by electroporation. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 108 and SEQ ID NO. 109 and genome sequencing. The strain obtained in this way was named CJ-HIS2.

[0626] Sequence number 108

[0627] - GAGCATGCATCAAAG

[0628] Sequence number 109

[0629] - AGAAATTTGATCCTTATAA

[0630] Sequentially, the constructed pDC24△Pn:: Pcj7_hisH vector was transformed into the above-mentioned CJ-HIS2 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisH gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 110 and SEQ ID NO. 111 and genome sequencing. The strain obtained in this way was named CJ-HIS3.

[0631] Sequence number 110

[0632] - TTGAGAGATGCTTATCG

[0633] Sequence number 111

[0634] - CACTTCAGTGCGGATTCCAA

[0635] Sequentially, the constructed pDC24△Pn:: Pcj7_hisD vector was transformed into the above-mentioned CJ-HIS3 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisD gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 112 and SEQ ID NO. 113 and genome sequencing. The strain obtained in this way was named CJ-HIS4.

[0636] Sequence No. 112

[0637] - AGCGGGTTTAATTCAGG

[0638] Sequence No. 113

[0639] - GTGGGTAAGGGTTTTCGT

[0640] Sequentially, the constructed pDC24△Pn:: Pspl13_hisA vector was transformed into the above-mentioned CJ-HIS4 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisA gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 114 and SEQ ID NO. 115 and genome sequencing. The strain obtained in this way was named CJ-HIS5.

[0641] Sequence No. 114

[0642] - CACGAAAATGATCGTTTTG

[0643] Sequence number 115

[0644] - TATGGGATTCGATGGCCA

[0645] Sequentially, the constructed pDC24△Pn:: Pspl13_hisB vector was transformed into the above-mentioned CJ-HIS5 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisB gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 116 and SEQ ID NO. 117 and genome sequencing. The strain obtained in this way was named CJ-HIS6.

[0646] Sequence number 116

[0647] - TGTGGGAATCGCTGGGCAC

[0648] Sequence number 117

[0649] - CGGTCGCCCGCATCTG

[0650]

[0651] Example 6-1-3. Production of a histidine-producing strain with an enhanced biosynthetic pathway through gene insertion

[0652] Subsequently, NCgl1021, known as a gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site to additionally insert the 'hisE(g1a)G(G233H / T235Q)' gene and the hisD gene. Specifically, to construct the NCgl1021 deletion and target gene insertion vector, PCR was performed in the same manner as in Example 1 using primer pairs of SEQ ID NO. 118 and SEQ ID NO. 119 and SEQ ID NO. 120 and SEQ ID NO. 121 with the chromosome of ATCC13032 as a template, and the left homologous cancer region and the right homologous cancer region of NCgl1021 were amplified.

[0653] Sequence number 118

[0654] - TTCGAGCTCGGTACCCATGAAGTCTACCGGC

[0655] Sequence number 119

[0656] -gacatgaagcgccGACATCTAATAACCGGG

[0657] Sequence number 120

[0658] -CCGACGAGGCCTAAGAACTCATTCCTTCTGCT

[0659] Sequence number 121

[0660] - CTCTAGAGGATCCCCTTAGAGTGCATTGATC

[0661] PCR was performed in the same manner as in Example 1 using the vector pDC24△Pn:: Pspl13_hisEG(G233H / T235Q) constructed in Example 6-1-1 as a template and primers of SEQ ID NO. 122 and SEQ ID NO. 123, and the gene fragment 'Pspl13_ hisE(g1a)G(G233H / T235Q)' was obtained.

[0662] In addition, PCR was performed in the same manner as in Example 1 using primers of SEQ ID NO. 124 and SEQ ID NO. 125 with the vector pDC24△Pn::Pcj7_hisD constructed in Example 6-1-2 as a template, and the 'Pcj7_hisD' gene fragment was obtained.

[0663] Sequence No. 122

[0664] -CCGGTTATTAGATGTCggcgcttcatgtca

[0665] Sequence No. 123

[0666] - ggatgtttctCTAGATGCGGGCGAT

[0667] Sequence No. 124

[0668] - GCCCGCATCTAGagaaacatcccagcgct

[0669] Sequence number 125

[0670] - AGAAGGAATGAGTTCTTAGGCCTCGTCGG

[0671] After treating the pDC24 vector with the restriction enzyme Sma1, a recombinant plasmid was obtained by cloning the amplified left homologous cancer region of NCgl1021, the right homologous cancer region of NCgl1021, the 'Pspl13_hisEG(G233H / T235Q)', and the 'Pcj7_hisD' gene fragments using the Gibson assembly method, and was named 'pDC24△NCgl1021:: Pspl13_hisEG(G233H / T235Q)- Pcj7_hisD'. Gibson cloning was performed in the same manner as in Example 1. After transforming the CJ-HIS6 produced in Example 6-1-2 with the constructed 'pDC24△NCgl1021:: Pspl13_hisEG(G233H / T235Q)- Pcj7_hisD' vector by electroporation and undergoing a secondary crossover process, a strain with an enhanced histidine biosynthetic pathway through the additional insertion of a gene was obtained. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 126 and SEQ ID NO. 127 and genome sequencing. The strain thus obtained was named CJH1.

[0672] Sequence number 126

[0673] - CTTTCAGCTTTCCCTCCCG

[0674] Sequence No. 127

[0675] - GCTGTACTTTTAGTACA

[0676]

[0677] Example 6-2. Preparation of a transformed strain into which the csck (E.co) gene and the glf (Z.mo) gene were introduced into a histidine-producing strain.

[0678] In order to determine whether there is an effect of increasing histidine production capacity through the introduction of a combination of the csck (E.co) gene and the glf (Z.mo) gene in a Corynebacterium glutamicum strain capable of producing L-histidine, a strain was prepared in which the ptsF gene, which introduces fructose, was deleted from the histidine-producing strain CJH1 prepared in Example 6-1 above, and the csck gene derived from Escherichia coli and the glf gene derived from Zymomonas mobilis were introduced.

[0679] Specifically, PCR was performed in the same manner as in Example 1 using primer pairs of SEQ ID NOs. 128 and 129 and SEQ ID NOs. 130 and 131, using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template. As a result, DNA fragments of 807 bp and 837 bp, respectively, for ptsF gene deletion were obtained.

[0680] Sequence number 128

[0681] - ATTCGAGCTCGGTACCCCCTGGGCGGGCTCGCTGCC

[0682] Sequence number 129

[0683] - agcgctgggatgtttctTGACCAGGAACGCCGGTGCCGGACT

[0684] Sequence number 130

[0685] - TGGCGCTCCCAGAAGTAGTCTTCGTGGTCTGGGC

[0686] Sequence No. 131

[0687] - ACTCTAGAGGATCCCCCATTTCTAGGCCCGCA

[0688] PCR was performed in the same manner as in Example 1 using the primers of SEQ ID NO. 132 and SEQ ID NO. 133 with the vector 'pDC24△BBD29_02180-BBD29_02200:: Pcj7-csck' prepared in Example 2-2 as a template.

[0689] As a result, a 1270 bp DNA fragment containing a 1233 bp 'Pcj7-csck' gene fragment was obtained.

[0690] Sequence No. 132

[0691] -CCGGCACCGGCGTTCCTGGTCAagaaacatcccagcgcta

[0692] Sequence No. 133

[0693] - CGCTGGGATGTTTTCTCTATTCCAGTTCTTGTCGACATGGC

[0694]

[0695] PCR was performed in the same manner as in Example 1 using the primers of SEQ ID NO. 134 and SEQ ID NO. 135 with the vector 'pDC24△BBD29_12045-BBD29_12055:: Pcj7-glf' prepared in Example 4-3 as a template.

[0696] As a result, a 1767bp DNA fragment containing a 1740bp 'Pcj7-glf' gene fragment was obtained.

[0697] Sequence No. 134

[0698] - CAAGAACTGGAATAGAGAAACATCCCAGCGCT

[0699] Sequence number 135

[0700] - AGACCACGAAGACTACTTCTGGGAGCGCC

[0701] Each obtained DNA product was purified using a PCR purification kit, and the purified amplification product and the chromosomal transformation vector pDC24, which was cleaved with SmaI restriction enzyme, were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named 'pDC24△ptsF:: Pcj7-csck-Pcj7-glf'. Gibson cloning was performed in the same manner as in Example 1.

[0702] After transforming the constructed pDC24△ptsF:: Pcj7-csck-Pcj7-glf vector into the histidine-producing strain CJH1 by electroporation and undergoing a secondary crossover process, a strain with one copy of the Pcj7-csck-Pcj7-glf gene inserted was obtained. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 136 and SEQ ID NO. 137 and genome sequencing. The strain obtained in this way was named 'CJH1△ptsF:: Pcj7-csck-Pcj7-glf'.

[0703] Sequence number 136

[0704] - CAACAAGAACGTCCGCACC

[0705] Sequence number 137

[0706] - TCGAGATCCGTGGGCACTC

[0707]

[0708] Example 6-3. Evaluation of Histidine Production Capacity of Transformed Strains

[0709] To confirm the L-histidine production ability and fructose utilization ability of the strains prepared in the above example, they were evaluated by culturing in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the following seed medium and cultured with shaking at 200 rpm for 20 hours at 30°C. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured with shaking at 200 rpm for 48 hours at 30°C.

[0710]

[0711] <Seed medium (pH 7.0)>

[0712] Glucose 5%, Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4% (based on 1 liter of distilled water)

[0713]

[0714] Production Medium (pH 7.0)

[0715] Glucose 3%, Fructose 3%, Ammonium sulfate 2%, Potassium dihydrogen phosphate 0.1%, Magnesium sulfate heptahydrate 0.05%, CSL (Corn steep extract) 2.0%, Biotin 200 µg / L, Calcium carbonate 30 g / L (per 1 liter of distilled water)

[0716] Comparison of Glucose, Fructose Availability, and L-Histidine Production Capacity of L-Histidine Producing Strains Derived from Corynebacterium glutamicum ATCC 13032 with Introduced Fructose Availability Factor (48H) Strain No. Glucose Consumed (g / L) Fructose Consumed (g / L) L-Histidine Production (g / L) CJH1 16.8 8.7 4.6 CJH1 △pts F:: Pcj7-csck-Pcj7-glf 14.1 18.7 5.0

[0717] As shown in the table above, it was confirmed that the production of histidine increased when the csck gene derived from Escherichia coli and the glf gene derived from Zymomonas mobilis were introduced. Through this, it was found that the combination of csck and glf genes is effective in increasing L-histidine production.

[0718]

[0719] Example 7. Evaluation of sugar utilization / L-lysine production capacity of Corynebacterium microorganisms into which the csck gene derived from Escherichia genus and the glf gene derived from Zymomonas genus were introduced

[0720]

[0721] Example 7-1. Preparation of a transformed strain into which the csck (E.co) gene and the glf (Z.mo) gene were introduced into a lysine-producing strain.

[0722] To determine whether the introduction of a combination of the csck (E.co) gene and the glf (Z.mo) gene in a Corynebacterium glutamicum strain capable of producing L-lysine has an effect of increasing lysine production capacity, a strain was constructed in which the ptsF gene, which introduces fructose, was deleted from the lysine-producing strain KCCM11016P (US 9938546 B2) and the csck gene derived from Escherichia coli and the glf gene derived from Zymomonas mobilis were introduced.

[0723] Specifically, the pDC24△ptsF::Pcj7-csck-Pcj7-glf vector produced in Example 6-2 above was transformed into the lysine-producing strain KCCM11016P by electroporation, and a strain with one copy of the Pcj7-csck-Pcj7-glf gene inserted was obtained through a secondary crossover process. The genetic modification was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 136 and SEQ ID NO. 137, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions, respectively, in which the gene was inserted. The strain obtained in this way was named 'KCCM11016P△ptsF::Pcj7-csck-Pcj7-glf'.

[0724]

[0725] Example 7-2. Evaluation of Lysine Production Capacity of Transformed Strains

[0726] To confirm the L-lysine production ability and fructose utilization ability of the strains prepared in the above example, they were evaluated by culturing in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the following seed medium and cultured with shaking at 200 rpm for 20 hours at 37°C. 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured with shaking at 200 rpm for 42 hours at 37°C.

[0727] <Seed medium (pH 7.0)>

[0728] Raw sugar 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 0.1 mg, thiamine HCl 1 mg, calcium-pantothenic acid 22 mg, nicotinamide 2 mg (based on 1 liter of distilled water)

[0729] Production Medium (pH 7.0)

[0730] Glucose 22.5 g, Fructose 22.5 g, (NH4)2SO4 30 g, Soy protein 10 g, 50% sugar molasses 10 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, Biotin 0.9 mg, Thiamine hydrochloride 4.5 mg, Calcium pantothenic acid 4.5 mg, Nicotinamide 30 mg, MnSO4 9 mg, FeSO4 9 mg, ZnSO4 0.45 mg, CuSO4 0.45 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0731] Comparison of Glucose, Fructose Availability, and L-Lysine Production Capacity of L-Lysine Producing Strains Derived from Corynebacterium glutamicum ATCC13032 Introduced with Fructose Availability Factor (42H) Strain No. Glucose Consumed (g / L) Fructose Consumed (g / L) L-Lysine Production (g / L) KCCM11016P 22.5 22.5 11.9 KCCM11016P △pts F:: Pcj7-csck-Pcj7-glf 22.5 22.5 13.0

[0732]

[0733] As shown in the table above, it was confirmed that the production of lysine increased when the csck gene derived from Escherichia coli and the glf gene derived from Zymomonas mobilis were introduced. Through this, it was found that the combination of csck and glf genes is effective in increasing L-lysine production.

[0734]

[0735] Example 8. Evaluation of sugar utilization / L-threonine production capacity of Corynebacterium microorganisms into which the csck gene derived from Escherichia genus and the glf gene derived from Zymomonas genus were introduced

[0736] Example 8-1. Preparation of a transformed strain into which the csck (E.co) gene and the glf (Z.mo) gene were introduced into a threonine-producing strain.

[0737] To determine whether there is an effect of increasing threonine production capacity through the introduction of a combination of the csck (E.co) gene and the glf (Z.mo) gene in a Corynebacterium glutamicum strain capable of producing L-threonine, strains were constructed in which the ptsF gene, which introduces fructose, was deleted from the threonine-producing strain KCCM12120P (US 11236374 B2) and the csck gene derived from Escherichia coli and the glf gene derived from Zymomonas mobilis were introduced.

[0738] Specifically, the pDC24△ptsF::Pcj7-csck-Pcj7-glf vector produced in Example 6-2 above was transformed into the threonine-producing strain KCCM12120P by electroporation, and a strain with one copy of the Pcj7-csck-Pcj7-glf gene inserted was obtained through a secondary crossover process. The genetic modification was confirmed through PCR and genome sequencing using primers of SEQ ID NO. 136 and SEQ ID NO. 137, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions, respectively, in which the gene was inserted. The strain thus obtained was named 'KCCM12120P△ptsF::Pcj7-csck-Pcj7-glf'.

[0739]

[0740] Example 8-2. Evaluation of Threonine Production Capacity of Transformed Strains

[0741] To confirm the L-threonine production ability and fructose utilization ability of the strain prepared in the above example, it was evaluated by culturing in the following manner. After inoculating the strain into a 250 ml corner-baffle flask containing 25 ml of seed medium, it was cultured at 30°C for 20 hours with shaking at 200 rpm. 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium, and it was cultured at 30°C for 48 hours with shaking at 200 rpm.

[0742] <Seed medium (pH 7.0)>

[0743] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, Biotin 100 µg, Thiamine HCl 1000 µg, Calcium-Pantothenic Acid 2000 µg, Nicotinamide 2000 µg (based on 1 liter of distilled water)

[0744] Production Medium (pH 7.0)

[0745] Glucose 15g, Fructose 15g, KH2PO4 2g, Urea 3g, (NH4)2SO4 40g, Peptone 2.5g, CSL(Sigma) 5g (10 ml), MgSO4.7H2O 0.5g, Leucine 400mg, CaCO3 20g (based on 1 liter of distilled water)

[0746] Comparison of Glucose, Fructose Availability, and L-Threonine Production Capacity of L-Threonine Producing Strains Derived from Corynebacterium Glutamicum ATCC13032 with Introduced Fructose Availability Factor (48H) Strain No. Glucose Consumed (g / L) Fructose Consumed (g / L) L-Threonine Production (g / L) KCCM 12120P 15151.01 KCCM 12120P △ pts F:: Pcj7-csck-Pcj7-glf 15151.3

[0747] As shown in the table above, it was confirmed that the production of threonine increased when the csck gene derived from Escherichia coli and the glf gene derived from Zymomonas mobilis were introduced. Through this, it was found that the combination of csck and glf genes is effective in increasing L-threonine production.

[0748]

[0749] Example 9. Evaluation of L-amino acid production capacity of Corynebacterium microorganisms into which the csck variant gene derived from Escherichia genus and the glf gene derived from Zymomonas genus were introduced.

[0750]

[0751] Example 9-1. Vector Creation

[0752] To determine whether the introduction of a combination of the csck variant gene (csck_W79C or csck_W79C / A181V) and the glf(Z.mo) gene into a Corynebacterium glutamicum strain capable of producing L-amino acids has an effect of increasing amino acid production, a vector was constructed to introduce csck gene variants derived from Escherichia coli.

[0753] Specifically, PCR was performed in the same manner as in Example 1 using the primer pair of SEQ ID NO. 141 and SEQ ID NO. 142 and the primer pair of SEQ ID NO. 143 and SEQ ID NO. 144, using the vector 'pDC24△BBD29_02180-BBD29_02200:: Pcj7-csck' constructed in Example 2-2 as a template. Overlapping PCR was performed again using the primer pair of SEQ ID NO. 141 and SEQ ID NO. 144 as a template of the mixture of the two fragments obtained, and as a result, a DNA fragment for introducing the csck (W79C, E.co) variant (SEQ ID NO. 147) was obtained.

[0754] In addition, PCR was performed in the same manner as in Example 1 using the primer pairs SEQ ID NO. 141 and SEQ ID NO. 142, SEQ ID NO. 143 and SEQ ID NO. 145, and SEQ ID NO. 146 and SEQ ID NO. 144, using the vector 'pDC24△BBD29_02180-BBD29_02200:: Pcj7-csck' constructed in Example 2-2 as a template. Overlapping PCR was performed again using the primer pairs SEQ ID NO. 141 and SEQ ID NO. 144 as a template of the mixture of the three fragments obtained, and as a result, a DNA fragment for introducing the csck (W79C / A181V, E.co) variant (SEQ ID NO. 148) was obtained.

[0755] Sequence No. 141

[0756] -TCGAGCTCGGGTACCCccaccacctaaaaat

[0757] Sequence No. 142

[0758] - CGTGGATGTCCGGTGACATTCATCTTGCTT

[0759] Sequence No. 143

[0760] - CTGAAGCAAGATGAATGTCACCGGACATCC

[0761] Sequence No. 144

[0762] - CTCTAGAGGATCCCCGATAATTCGTCGCATTTC

[0763] Sequence No. 145

[0764] - AGAGCTTGACGACATCCACCAGTTGTAGCGC

[0765] Sequence number 146

[0766] - GCGCTACAACTGGTGGATGTCGTCAAGCTCT

[0767]

[0768] The obtained DNA product was purified using a PCR purification kit, and the purified amplification product and the chromosomal transformation vector pDC24, which was cleaved with SmaI restriction enzyme, were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named 'pDC24△csck(E.co)::csck(W79C, E.co)' and 'pDC24△csck(E.co)::csck(W79C / A181V, E.co)', respectively. Gibson cloning was performed in the same manner as in Example 1.

[0769]

[0770] Example 9-2. Strain Preparation

[0771] After transforming the recombinant vectors 'pDC24△csck(E.co)::csck(W79C,E.co)' and 'pDC24△csck(E.co)::csck(W79C / A181V, E.co)' produced in Example 9-1 above into the production strains CM05-9841, 'CJH1△ptsF::Pcj7-csck-Pcj7-glf', 'KCCM11016P△ptsF::Pcj7-csck-Pcj7-glf', and 'KCCM12120P△ptsF::Pcj7-csck-Pcj7-glf' produced in Examples 4-3, 6-2, 7-1, and 8-1, respectively, using the electro-pulse method, a secondary crossing-in process was performed to convert the wild-type csck(E.co) gene on the chromosome into a mutant type Strains replaced with the cscK(W79C, E.co) gene were obtained, and these were respectively CM05-9841△csck(E.co):: csck(W79C,E.co)', 'CJH1△ptsF:: Pcj7-csck(W79C)-Pcj7-glf', 'KCCM11016P△ptsF:: Pcj7-csck(W79C)-Pcj7-glf', 'KCCM12120P△ptsF:: Pcj7-csck(W79C)-Pcj7-glf', CM05-9841△csck(E.co):: csck(W79C / A181V,E.co)', 'CJH1△ptsF:: It was named Pcj7-csck(W79C / A181V)-Pcj7-glf', 'KCCM11016P△ptsF:: Pcj7-csck(W79C / A181V)-Pcj7-glf' and 'KCCM12120P△ptsF:: Pcj7-csck(W79C / A181V)-Pcj7-glf'.

[0772]

[0773] Example 9-3. Production Capacity Evaluation

[0774] To confirm the L-amino acid production ability of the strains produced in the above examples, they were evaluated by culturing them in the same manner as in Examples 5, 6-3, 7-2, and 8-2.

[0775] Comparison of L-Tryptophan Production Capacity of L-Tryptophan Producing Strains (20H) Strain No. L-Tryptophan Production Amount (g / L) CM05-9841 2.2 CM05-9841 △csck(E.co)::csck(W79C,E.co) 2.8 CM05-9841 △csck(E.co)::csck(W79C / A181V,E.co) 2.9

[0776] Comparison of L-histidine Production Capacity of L-histidine Producing Strains (48H) Strain No. L-histidine Production Amount (g / L) CJH1 △ptsF::Pcj7-csck-Pcj7-glf5.0 CJH1 △ptsF::Pcj7-csck(W79C)-Pcj7-glf5.5 CJH1 △ptsF::Pcj7-csck(W79C / A181V)-Pcj7-glf5.6

[0777] Comparison of L-Lysine Production Capacity of L-Lysine Producing Strains (42H) Strain No. L-Lysine Production Amount (g / L) KCCM 11016P △ptsF::Pcj7-csck-Pcj7-glf 13.0 KCCM 11016P △ptsF::Pcj7-csck(W79C)-Pcj7-glf 14.0 KCCM 11016P △ptsF::Pcj7-csck(W79C / A181V)-Pcj7-glf 13.8

[0778] Comparison of L-Threonine Production Capacity of L-Threonine Producing Strains (48H) Strain No. L-Threonine Production Amount (g / L) KCCM 12120P △ptsF::Pcj7-csck-Pcj7-glf1.3 KCCM 12120P △ptsF::Pcj7-csck(W79C)-Pcj7-glf1.8 KCCM 12120P △ptsF::Pcj7-csck(W79C / A181V)-Pcj7-glf1.6

[0779] As shown in the table above, it was confirmed that the production of amino acids increased when a csck gene variant derived from Escherichia coli was introduced. Through this, it was found that the combination of the csck variant and the glf gene is effective in increasing L-amino acid production.

[0780]

[0781] From the foregoing description, those skilled in the art to which this disclosure pertains will understand that this disclosure may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this disclosure should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

1. Fructokinase derived from microorganisms of the genus Escherichia, a polynucleotide encoding the same, a polypeptide of said fructokinase variant, or one or more selected from a polynucleotide encoding the same; and A Corynebacterium genus microorganism producing L-amino acids, comprising one or more selected from a non-PTS sugar influx factor derived from the genus Zymomonas, or a polynucleotide encoding the same.

2. In paragraph 1, the microorganism is a microorganism of the genus Corynebacterium that has increased L-amino acid production capacity compared to a non-modified microorganism.

3. A microorganism of the genus Corynebacterium, wherein the fructokinase in paragraph 1 is encoded by the cscK gene.

4. In claim 1, the fructokinase is a microorganism of the genus Corynebacterium that is encoded by the cscK gene derived from Escherichiacoli.

5. A microorganism of the genus Corynebacterium according to claim 1, wherein the fructokinase comprises the amino acid sequence of SEQ ID NO. 139 or an amino acid sequence having at least 80% sequence identity therewith.

6. A microorganism of the genus Corynebacterium, wherein the variant polypeptide is one in which the amino acid corresponding to the 79th or 181st position of SEQ ID NO. 139 is substituted with another amino acid.

7. A microorganism of the genus Corynebacterium, wherein the variant polypeptide is one in which the amino acid corresponding to the 79th position of SEQ ID NO. 139 is substituted with cysteine, or the amino acid corresponding to the 181st position of SEQ ID NO. 139 is substituted with valine, or a combination thereof.

8. A microorganism of the genus Corynebacterium according to claim 6, wherein the variant polypeptide comprises SEQ ID NO. 147 or an amino acid sequence having at least 80% sequence identity therewith; or SEQ ID NO. 148 or an amino acid sequence having at least 80% sequence identity therewith.

9. A microorganism of the genus Corynebacterium, wherein the non-PTS sugar influx factor is capable of influxing glucose and fructose.

10. A microorganism of the genus Corynebacterium, wherein the non-PTS sugar influx factor is encoded by the glf gene in claim 1.

11. A microorganism of the genus Corynebacterium, wherein the non-PTS sugar influx factor is encoded by the glf gene derived from Zymomonas mobilis.

12. A microorganism of the genus Corynebacterium according to claim 1, wherein the non-PTS sugar influent factor comprises the amino acid sequence of SEQ ID NO. 140 or an amino acid sequence having at least 80% sequence identity therewith.

13. In paragraph 1, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

14. In paragraph 1, the Corynebacterium microorganism is a Corynebacterium microorganism having a deleted ptsF gene.

15. A microorganism of the genus Corynebacterium, wherein the L-amino acid is one or more selected from L-tryptophan, L-lysine, L-histidine, and L-threonine.

16. A composition for producing L-amino acid comprising the microorganism of claim 1, a culture of the microorganism, a fermented product of the microorganism, or a combination of two or more of these.

17. A method for producing L-amino acids comprising the step of culturing a microorganism of the genus Corynebacterium in a medium, the mixture comprising: a fructokinase derived from the genus Escherichia, a polynucleotide encoding the same, a fructokinase variant polypeptide, or a polynucleotide encoding the same; and a non-PTS sugar influx factor derived from the genus Zymomonas or a polynucleotide encoding the same.

18. A method for producing L-amino acids according to claim 17, further comprising the step of recovering L-amino acids from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium.

19. One or more selected from fructokinase derived from the genus Escherichia, a polynucleotide encoding the same, said fructokinase variant polypeptide, or a polynucleotide encoding the same; and one or more selected from a non-PTS sugar influx factor derived from the genus Zymomonas or a polynucleotide encoding the same; for the production of L-amino acids by a microorganism of the genus Corynebacterium.