Pharmaceutical composition for preventing or treating cancer comprising oxaliplatin and ferroptosis inducer

A pharmaceutical composition of oxaliplatin and ferroptosis inducer, combined with diagnostic tools, addresses cancer resistance by targeting specific gene expressions and metabolic pathways, enhancing treatment efficacy and prognosis prediction.

WO2026127650A1PCT designated stage Publication Date: 2026-06-18SEOUL NAT UNIV HOSPITAL

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SEOUL NAT UNIV HOSPITAL
Filing Date
2025-12-10
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Current cancer treatments face challenges due to resistance to oxaliplatin and ferroptosis inducers, necessitating a need for improved diagnostic methods and compositions that can overcome these resistances and enhance treatment efficacy.

Method used

A pharmaceutical composition comprising oxaliplatin and a ferroptosis inducer, along with diagnostic methods and kits to measure gene expression levels, metabolic levels, and enzyme activities to identify and address resistance, and a method to screen substances that improve resistance, thereby enhancing treatment synergy.

🎯Benefits of technology

The composition and diagnostic methods provide targeted treatment strategies that overcome resistance, improve treatment efficacy, and predict prognosis by identifying and modulating key gene expressions and metabolic pathways, leading to enhanced cancer therapy outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025021321_18062026_PF_FP_ABST
    Figure KR2025021321_18062026_PF_FP_ABST
Patent Text Reader

Abstract

A pharmaceutical composition provided as one aspect of the present invention comprises oxaliplatin and a ferroptosis inducer, and thus can exhibit an excellent prevention or treatment effect on cancer. In particular, the present invention exhibits a remarkably excellent prevention or treatment effect on cancer having resistance to oxaliplatin and / or a ferroptosis inducer, and thus can present a novel method of treating cancers that are expected to be difficult to treat by means of prior art.
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for the prevention or treatment of cancer comprising oxaliplatin and a ferroptosis inducer

[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of cancer comprising oxaliplatin and a ferroptosis inducer.

[0002]

[0003] Ferroptosis is a form of non-apoptotic cell death induced by iron ions, primarily characterized by the abnormal accumulation of peroxidation of unsaturated fatty acids contained in cell membrane phospholipids. Ferroptosis is classified as a form of cell death distinct from previously known apoptosis, necrosis, or autophagy, and is closely associated with intracellular iron metabolism, lipid metabolism, and redox balance. In particular, active iron (Fe 2+ The Fenton reaction triggered by ) increases the generation of lipid radicals, and the process in which these radicals repeatedly react to accumulate phospholipid peroxides is known to be the core mechanism of ferroptosis.

[0004] Ferroptosis is also closely related to the cell's antioxidant system, and GPX4 (glutathione peroxidase 4) acts as a key enzyme that inhibits ferroptosis by reducing phospholipid peroxides. Since the activity of GPX4 depends on glutathione (GSH), System Xc, which transports cystine into the cell - If the function of [it] is impaired or GSH synthesis is limited, GPX4 activity decreases, which can promote ferroptosis. In addition, lipid metabolism-related enzymes such as ACSL4 (acyl-CoA synthetase long-chain family member 4) and LPCAT3 (lysophosphatidylcholine acyltransferase 3) have been reported to regulate lipid peroxidation sensitivity by increasing the proportion of polyunsaturated phospholipids in the cell membrane.

[0005] In addition, recent studies have revealed that FSP1 (ferroptosis suppressor protein 1) suppresses ferroptosis through a GPX4-independent pathway by maintaining coenzyme Q10 (CoQ10) in a reduced form. During ferroptosis, morphological changes such as size reduction, cristae reduction, and membrane potential changes are observed in mitochondria, and these are used as criteria to distinguish it from other forms of apoptosis.

[0006] Ferroptosis has been reported to play a significant role in physiological or pathological conditions, associated with various cellular environmental changes such as abnormal iron metabolism, increased lipid peroxidation, and oxidative stress. Furthermore, oxidative damage induced by external stimuli, changes in trophic status, and fluctuations in metal ion concentrations are also known to influence the initiation of ferroptosis. Based on these research findings, ferroptosis is being established as an independent apoptotic pathway, and its functional importance is being highlighted in various biological phenomena and disease models.

[0007]

[0008] As one aspect of the present invention, the purpose is to provide a pharmaceutical composition for the prevention or treatment of cancer comprising oxaliplatin and a ferroptosis inducer.

[0009] As one aspect of the present invention, the purpose is to provide the use of oxaliplatin and a ferroptosis inducer for the manufacture of a drug for the prevention or treatment of cancer.

[0010] As one embodiment of the present invention, the purpose is to provide a method for preventing or treating cancer comprising the step of co-administering a pharmaceutically effective amount of oxaliplatin and a ferroptosis inducer to an individual in need thereof.

[0011] The technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned technical problems will be clearly understood by those skilled in the art from the description below.

[0012]

[0013] As one aspect of the present invention, from a biological sample obtained from an individual, PAPSS2 (3'-Phosphoadenosine 5'-Phosphosulfate Synthase 2, COL5A2 (Collagen Type V Alpha 2 Chain), FMO5 (Flavin Containing Monooxygenase 5), SEPP1 (Selenoprotein P, Plasma 1), FAM105A (Family with Sequence Similarity 105 Member A), TMEM176B (Transmembrane Protein 176B), IL6R (Interleukin 6 Receptor), OXTR (Oxytocin Receptor), MUC13 (Mucin 13), UST (Uronyl 2-Sulfotransferase), TMEM176A (Transmembrane Protein 176A), RASL11A (RAS Like Family 11 Member A), FGF11 (Fibroblast Growth Factor 11), A method for providing information for diagnosing whether resistance to oxaliplatin exists in the prevention or treatment of cancer is provided, comprising the step of measuring the expression level of at least one gene selected from the group consisting of LBH (Limb Bud And Heart Development), AXIN2 (Axin 2), NKD1 (Naked Cuticle Homolog 1), IFI6 (Interferon Alpha Inducible Protein 6), EPSTI1 (Epithelial Stromal Interaction 1), NPR2 (Natriuretic Peptide Receptor 2), and GATA3 (GATA Binding Protein 3).

[0014] The above method may further include the step of measuring at least one selected from the group consisting of the metabolic level of sulfur, the metabolic level of glutathione, the metabolic level of selenocompound, and the expression level of a ferroptosis inhibitory gene from a biological sample obtained from an individual.

[0015] The above method may further include the step of determining that resistance to oxaliplatin is present when the expression level of at least one gene selected from the group consisting of PAPSS2, COL5A2, FMO5, SEPP1, FAM105A, TMEM176B, IL6R, OXTR, MUC13, UST, TMEM176A, RASL11A, and FGF11 is lower than the expression level in a biological sample obtained from a normal control individual, when the expression level of at least one gene selected from the group consisting of FGF11, LBH, AXIN2, NKD1, IFI6, EPSTI1, NPR2, and GATA3 is higher than the expression level in a biological sample obtained from a normal control individual, and / or when at least one level selected from the group consisting of the metabolic level of sulfur, the metabolic level of glutathione, the metabolic level of selenocompounds, and the expression level of a ferroptosis inhibitory gene is lower than the expression level in a biological sample obtained from a normal control individual.

[0016] In the above method, the term "level of sulfur metabolism" refers to the concentration of sulfur-containing metabolites such as cysteine, cystine, methionine, homocysteine, sulfuric acid, and sulfides in a biological sample, or the ratio thereof, and can be quantified using LC-MS, GC-MS, HPLC, ion chromatography, or commercial enzyme-based analysis kits, but is not limited thereto.

[0017] In the above method, the metabolic level of glutathione refers to the concentration of reduced glutathione (GSH) and oxidized glutathione (GSSG) in a biological sample, the GSH / GSSG ratio, and / or the degree of activity of enzymes (GCL, GSS, GR, etc.) involved in glutathione synthesis and regeneration, and can be measured using LC-MS, HPLC, fluorescence / absorption-based glutathione quantification kits, but is not limited thereto.

[0018] In the above method, the metabolic level of the selenocompound refers to the concentration of selenocysteine, selenomethionine, inorganic selenium ions (selenite, selenate), and one or more selenoproteins (GPX4, TXNRD1, SEPP1, etc.) in a sample or the ratio thereof, and can be measured using LC-MS, ICP-MS, HPLC, or immunoassay methods (ELISA, Western blot, etc.), but is not limited thereto.

[0019] In the method, the ferroptosis suppressor genes include GPX4 (Glutathione Peroxidase 4), SLC7A11 (Solute Carrier Family 7 Member 11), SLC3A2 (Solute Carrier Family 3 Member 2), GCLC (Glutamate-Cysteine ​​Ligase Catalytic Subunit), and GCLM (Glutamate-Cysteine ​​Ligase Modifier). Subunit), GSS (Glutathione Synthetase), GSR (Glutathione Reductase), FSP1 / AIFM2 (Ferroptosis Suppressor Protein 1 / Apoptosis-Inducing Factor Mitochondria Associated 2), GCH1 (GTP Cyclohydrolase 1), DHFR (Dihydrofolate Reductase), FTH1 (Ferritin Heavy Chain 1), FTL (Ferritin Light Chain), SLC40A1 (Solute Carrier Family 40 Member 1, It may be at least one selected from the group consisting of Ferroportin), HMOX1 (Heme Oxygenase 1), ACSL3 (Acyl-CoA Synthetase Long Chain Family Member 3), PRDX1 (Peroxiredoxin 1), PRDX6 (Peroxiredoxin 6), and NFE2L2 (Nuclear Factor, Erythroid 2 Like 2, NRF2), but is not limited thereto.

[0020] In the above method, the individual refers to an animal including humans, and specifically may refer to at least one selected from humans, dogs, cats, mice, etc., but is not particularly limited to any subject that is a potential subject for developing cancer. Specifically, it may be a human individual that is likely to develop cancer or has developed cancer, or has developed cancer. More specifically, it may be a human individual that is likely to develop cancer or has developed cancer, or has developed cancer, and is suspected of having resistance to oxaliplatin.

[0021] In the above method, the cancer may be at least one selected from the group consisting of pancreatic cancer, gastric cancer, lung cancer, hepatocellular carcinoma, colorectal cancer, breast cancer, prostate cancer, thyroid cancer, ovarian cancer, cervical cancer, renal cell carcinoma, bladder cancer, melanoma, leukemia, lymphoma, multiple myeloma, brain tumor, sarcoma, metastatic cancers thereof, and recurrent cancers thereof, but is not limited thereto.

[0022] In the above method, the biological sample refers to any sample capable of detecting the expression level of a gene within an individual, and may be at least one selected from the group consisting of serum, blood, whole blood, plasma, urine, saliva, tissue, cell, organ, bone marrow, fine needle aspiration sample, core needle biopsy sample, and vacuum aspiration biopsy sample, but is not limited thereto, and may be prepared by processing by a method commonly used in the field of the art of the present invention.

[0023] In the above method, as a method for measuring the expression level, a method for measuring the concentration of mRNA, which is a transcription material of a gene, or the concentration of the protein in a sample may be chosen, but is not limited thereto, and may be performed by choosing a method commonly used in the technical field of the present invention.

[0024] In the above method, reverse transcriptase polymerase chain reaction (RT-PCR), competitive reverse transcriptase polymerase chain reaction (Competitive RT-PCR), real-time reverse transcriptase polymerase chain reaction (Real-time RT-PCR), RNase protection assay (RPA), Northern blotting, and DNA chips may be used as methods to measure the concentration of the mRNA in a sample, but are not limited thereto.

[0025] In the above method, the amount of protein can be determined by using an antibody that specifically binds to the protein as a method for measuring the concentration of the protein in a sample. As analytical methods for this purpose, immunoassay, ELISA (enzyme-linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemistry, immunoprecipitation assay, complement fixation assay, FACS (fluorescence-activated cell sorting), and protein chip may be utilized, but are not limited thereto.

[0026]

[0027] As one aspect of the present invention, a composition for diagnosing whether there is resistance to oxaliplatin in the prevention or treatment of cancer is provided, comprising a preparation for measuring the expression level of at least one gene selected from the group consisting of PAPSS2, COL5A2, FMO5, SEPP1, FAM105A, TMEM176B, IL6R, OXTR, MUC13, UST, TMEM176A, RASL11A, FGF11, LBH, AXIN2, NKD1, IFI6, EPSTI1, NPR2, and GATA3.

[0028] The above composition may further include a preparation for measuring at least one level selected from the group consisting of the metabolic level of sulfur, the metabolic level of glutathione, the metabolic level of selenocompounds, and the expression level of a ferroptosis inhibitory gene.

[0029] In the above composition, the agent for measuring the gene expression level may include, but is not limited to, a substance that specifically binds to the nucleotide sequence of the gene, a sequence complementary to the nucleotide sequence, a fragment of the nucleotide, or a protein encoded by the nucleotide sequence.

[0030] In the above composition, the substance that specifically binds to the protein may specifically be an antibody, and the antibody refers to a specific immunoglobulin directed to an antigenic site. The antibody refers to an antibody that specifically binds to the translation protein of the gene. The gene may be cloned into an expression vector to obtain its translation protein, and the antibody may be prepared from the obtained protein according to conventional methods in the art. The form of the antibody includes polyclonal antibodies or monoclonal antibodies, and all immunoglobulin antibodies are included. The antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also a functional fragment of an antibody molecule that does not have the structure of a complete antibody having two light chains and two heavy chains, but possesses an antigen-binding function by having a specific antigen-binding site (binding domain) directed to an antigenic site. In a diagnosis using the above composition, the diagnosis can be made by performing hybridization using the translation protein of the gene and the antibody, and measuring the expression level of the gene through the degree of hybridization. The selection of an appropriate antibody and hybridization conditions can be appropriately selected according to techniques known in the art.

[0031] The nucleotide sequence, the sequence complementary to the nucleotide sequence, and the substance that specifically binds to the fragment of the nucleotide may specifically be a probe or a primer.

[0032] The above probe refers to a nucleotide fragment, such as RNA or DNA, ranging from a few bases to hundreds of bases, capable of specifically binding to nucleotides such as mRNA, and is labeled with a radioactive element, etc., to confirm the presence or absence and content (expression amount) of a specific mRNA. The above probe can be produced in the form of an oligonucleotide probe, a single-strand DNA probe, a double-strand DNA probe, an RNA probe, etc., and diagnosis can be made by performing hybridization using a probe complementary to the mRNA of the gene and measuring the expression amount of mRNA through the degree of hybridization. The selection of an appropriate probe and hybridization conditions can be appropriately selected according to techniques known in the relevant art field.

[0033] The above primer refers to a short nucleotide sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and acting as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of reagents for polymerization (i.e., DNA polymerase / polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer solution and temperature, and can be diagnosed by measuring the expression level of a desired protein by performing PCR amplification using the primers of the mRNA of the gene. The PCR conditions and the length of the primer set can be appropriately selected according to techniques known in the art.

[0034] Since the nucleotide sequence of the gene, the sequence complementary to the nucleotide sequence, or the probe or primer that specifically binds to the fragment of the nucleotide is known, a person skilled in the art can design the primer or probe based on the sequence according to conventional methods in the art.

[0035] The above probe or primer can be chemically synthesized using a phosphoramidite solid support synthesis method or other widely known methods, and may have a length of 10 to 100 nucleotides (hereinafter referred to as 'nt'), 10 to 90 nt, 10 to 80 nt, 10 to 70 nt, 10 to 60 nt, 10 to 50 nt, 10 to 40 nt, 10 to 30 nt, 10 to 25 nt, 20 to 100 nt, 30 to 90 nt, 40 to 80 nt, 50 to 70 nt, 20 to 60 nt, 20 to 50 nt, 30 to 40 nt, 20 to 30 nt, or 20 to 25 nt.

[0036] In the above composition, technical details related throughout the specification, such as samples, cancer, metabolic levels, and ferroptosis-inhibiting genes, may be interpreted by referring to the above.

[0037]

[0038] As one aspect of the present invention, a kit for diagnosing whether there is resistance to oxaliplatin in the prevention or treatment of cancer is provided, comprising the above composition.

[0039] The above kit can diagnose the expression level of the said gene by measuring the expression level of the mRNA of the said gene or the translational protein thereof. The above kit may include a substance that specifically binds to the nucleotide sequence of the said gene, a sequence complementary to the said nucleotide sequence, a fragment of the said nucleotide, or a protein encoded by the said nucleotide sequence, as well as one or more other component compositions, solutions, or devices suitable for an analysis method for measuring the expression level of the said gene's translational protein used by the kit.

[0040] If the above kit is a kit for measuring the expression level of the mRNA of the said gene, it may be a kit containing essential elements necessary for performing RT-PCR. In addition to each primer pair specific to the mRNA of the said gene, the RT-PCR kit may include a test tube or other suitable container, reaction buffer, deoxyribonucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, etc. Additionally, it may include a primer pair specific to the gene used as a quantitative control.

[0041] The above kit may include a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, and a chromogenic substrate for the immunological detection of a substance that specifically binds to the nucleotide sequence of the gene, a sequence complementary to the nucleotide sequence, a fragment of the nucleotide, or a protein encoded by the nucleotide sequence. The substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, and a glass slide glass; the chromogenic enzyme may be peroxidase or alkaline phosphatase; the fluorescent substance may be FITC, RITC, etc.; and the chromogenic substrate may be 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) or o-phenylenediamine (OPD), tetramethylbenzidine (TMB), etc.

[0042] As a specific example, the above kit may be a diagnostic microarray capable of measuring the expression level of the translation protein of the said gene or the mRNA of the gene encoding it. The said microarray can be easily manufactured by a person skilled in the art according to methods known in the art, and according to one embodiment, it may be a microarray in which a cDNA having a sequence corresponding to the mRNA of the said gene or a fragment thereof is attached to a substrate as a probe.

[0043] As a specific example, the above kit may be a diagnostic protein array or protein chip capable of measuring the expression level of the translation protein of the said gene. The said protein array or protein chip can be easily manufactured by a person skilled in the art according to methods known in the art, and according to one embodiment, a diagnosis can be made by extracting a patient's sample and confirming the reaction between the patient's sample and a substance capable of measuring the expression level of the said gene's translation protein, such as an antibody, receptor, nucleic acid, or carbohydrate, which can specifically bind to the said gene's translation protein immobilized in the kit.

[0044] In the above-mentioned kit, technical details related throughout the specification, such as the diagnostic composition, sample, and cancer included in the kit, may be interpreted by referring to the above-mentioned description.

[0045]

[0046] In one aspect of the present invention, a method for screening substances that improve resistance to oxaliplatin in the prevention or treatment of cancer is provided, comprising the step of measuring the expression level of at least one gene selected from the group consisting of PAPSS2, COL5A2, FMO5, SEPP1, FAM105A, TMEM176B, IL6R, OXTR, MUC13, UST, TMEM176A, RASL11A, FGF11, LBH, AXIN2, NKD1, IFI6, EPSTI1, NPR2, and GATA3 from a biological sample obtained from an individual treated with a candidate substance.

[0047] The above method may further include the step of measuring the expression level of at least one selected from the group consisting of the metabolic level of sulfur, the metabolic level of glutathione, the metabolic level of selenocompounds, and the expression level of a ferroptosis inhibitory gene.

[0048] The above method may further include the step of selecting a substance that improves resistance to oxaliplatin in the prevention or treatment of cancer, wherein the expression level of at least one gene selected from the group consisting of PAPSS2, COL5A2, FMO5, SEPP1, FAM105A, TMEM176B, IL6R, OXTR, MUC13, UST, TMEM176A, RASL11A, and FGF11 increases compared to the expression level in a biological sample obtained from an individual prior to treatment, the expression level of at least one gene selected from the group consisting of FGF11, LBH, AXIN2, NKD1, IFI6, EPSTI1, NPR2, and GATA3 decreases compared to the expression level in a biological sample obtained from an individual prior to treatment, and / or at least one level selected from the group consisting of the metabolic level of sulfur, the metabolic level of glutathione, the metabolic level of selenocompounds, and the expression level of a ferroptosis inhibitory gene increases compared to the level in a biological sample obtained from an individual prior to treatment. there is.

[0049] In the above method, the candidate substance may include, without limitation, a newly synthesized or known compound that is expected to improve resistance to oxaliplatin in the prevention or treatment of cancer, and may be, for example, at least one selected from the group consisting of nucleic acids, nucleotides, proteins, peptides, amino acids, sugars, lipids, and compounds, but is not particularly limited thereto.

[0050] In the above method, technical details related throughout the specification, such as individuals, samples, cancer, expression levels, metabolic levels, and ferroptosis inhibitory genes, may be interpreted by referring to the above.

[0051]

[0052] 본 발명의 일 양태로서, 개체로부터 수득한 생물학적 시료로부터 LOC101930275, CCNI2(Cyclin I Family Member 2), RN7SL1(RNA Component of Signal Recognition Particle 7SL1), MMP1(Matrix Metallopeptidase 1), P2RY1(Purinergic Receptor P2Y1), LINC00342(Long Intergenic Non-Protein Coding RNA 342), CXCL17(C-X-C Motif Chemokine Ligand 17), RN75L2(RNA, 7SL-Like 2), KCNMB4(Potassium Calcium-Activated Channel Subfamily M Regulatory Beta Subunit 4), DLG4(Discs Large MAGUK Scaffold Protein 4), SERPINA4(Serpin Family A Member 4), CAP2(Cyclase Associated Actin Cytoskeleton Regulatory Protein 2), SYCP2(Synaptonemal Complex Protein 2), DAB2(Dab Adaptor Protein 2), TRIM16L(Tripartite Motif Containing 16 Like), SLC7A11(Solute Carrier Family 7 Member 11; System Xc -The present invention provides a method for providing information for diagnosing whether there is dual resistance to oxaliplatin and ferroptosis inducers in the prevention or treatment of cancer, comprising the step of measuring the expression level of at least one gene selected from the group consisting of Light Chain, FAM211A-AS1 (FAM211A Antisense RNA 1), STK31 (Serine / Threonine Kinase 31), ENPP1 (Ectonucleotide Pyrophosphatase / Phosphodiesterase 1), and VIM (Vimentin).

[0053] The above method may further include the step of determining that a person has dual resistance to oxaliplatin and ferroptosis inducers if the expression level of at least one gene selected from the group consisting of LOC101930275, CCNI2, RN7SL1, MMP1, P2RY1, LINC00342, CXCL17, and RN75L2 is lower than the expression level in a biological sample obtained from a normal control individual.

[0054] The above method may further include the step of determining that a person has resistance to oxaliplatin and ferroptosis inducers if the expression level of at least one gene selected from the group consisting of KCNMB4, DLG4, SERPINA4, CAP2, SYCP2, DAB2, TRIM16L, SLC7A11, FAM211A-AS1, STK31, ENPP1, and VIM is higher than the expression level in a biological sample obtained from a normal control individual.

[0055] The above ferroptosis inducer is at least one selected from the group consisting of artesunate, sorafenib, sulfasalazine, erastin, imidazole ketone erastin (IKE), piperazine erastin, RSL3, ML210, ML162, FIN56, L-butionine-(S,R)-sulfoximine (BSO), dihydroartemisinin (DHA), artemisinin, ferric ammonium citrate, iron dextran, simvastatin, lovastatin, and atorvastatin. It may be one, but is not limited to this.

[0056] In the above method, the subject refers to an animal including humans, and specifically may refer to at least one selected from humans, dogs, cats, mice, etc., but is not particularly limited to any subject that is a potential subject for developing cancer. Specifically, it may be a human subject that is likely to develop cancer or has developed cancer, or has developed cancer. More specifically, it may be a human subject that is likely to develop cancer or has developed cancer, or has developed cancer, and is suspected of having resistance to oxaliplatin and / or ferroptosis inducers.

[0057] In the above method, technical details related throughout the specification, such as samples, expression levels, and cancer, may be interpreted by referring to the above.

[0058]

[0059] As one aspect of the present invention, a composition for diagnosing whether there is dual resistance to oxaliplatin and a ferroptosis inducer in the prevention or treatment of cancer is provided, comprising a preparation that measures the expression level of at least one gene selected from the group consisting of LOC101930275, CCNI2, RN7SL1, MMP1, P2RY1, LINC00342, CXCL17, RN75L2, KCNMB4, DLG4, SERPINA4, CAP2, SYCP2, DAB2, TRIM16L, SLC7A11, FAM211A-AS1, STK31, ENPP1, and VIM.

[0060] In the above composition, technical details related throughout the specification, such as expression levels, cancer, ferroptosis inducers, and diagnostic compositions, may be interpreted by referring to the above.

[0061]

[0062] As one aspect of the present invention, a kit is provided for diagnosing whether there is dual resistance to oxaliplatin and a ferroptosis inducer in the prevention or treatment of cancer, comprising the above composition.

[0063] In the above-mentioned kit, technical details related throughout the specification, such as expression levels, cancer, ferroptosis inducers, diagnostic compositions, and diagnostic kits, may be interpreted by referring to the above-described provisions.

[0064]

[0065] As one aspect of the present invention, a method for screening substances that improve dual resistance to oxaliplatin and ferroptosis inducers in the prevention or treatment of cancer is provided, comprising the step of measuring the expression level of at least one gene selected from the group consisting of LOC101930275, CCNI2, RN7SL1, MMP1, P2RY1, LINC00342, CXCL17, RN75L2, KCNMB4, DLG4, SERPINA4, CAP2, SYCP2, DAB2, TRIM16L, SLC7A11, FAM211A-AS1, STK31, ENPP1, and VIM from a biological sample obtained from an individual treated with a candidate substance.

[0066] In the above method, the method may further include the step of selecting a substance that improves dual resistance to oxaliplatin and ferroptosis inducers in the prevention or treatment of cancer when the expression level of at least one selected from the group consisting of LOC101930275, CCNI2, RN7SL1, MMP1, P2RY1, LINC00342, CXCL17, and RN75L2 increases compared to the expression level in a biological sample obtained from an individual prior to treatment.

[0067] In the above method, the method may further include the step of selecting a substance that improves dual resistance to oxaliplatin and ferroptosis inducers in the prevention or treatment of cancer when the expression level of at least one selected from the group consisting of KCNMB4, DLG4, SERPINA4, CAP2, SYCP2, DAB2, TRIM16L, SLC7A11, FAM211A-AS1, STK31, ENPP1, and VIM is lower than the expression level in a biological sample obtained from an individual prior to treatment.

[0068] In the above method, technical content related throughout the specification, such as candidate substances, individuals, samples, expression levels, cancer, ferroptosis inducers, etc., may be interpreted by referring to the above.

[0069]

[0070] As one aspect of the present invention, a pharmaceutical composition for the prevention or treatment of cancer is provided, comprising oxaliplatin and a ferroptosis inducer.

[0071] In the above composition, the ferroptosis inducer may be a preparation that induces ferroptosis by a GPX4 (Glutathione Peroxidase 4) independent pathway, wherein the independent pathway may include a lipid peroxidation induction pathway based on the influx of iron ions or the regulation of iron homeostasis (iron axis), and accordingly, when oxaliplatin and the ferroptosis inducer are administered together, the induction of ferroptosis is enhanced, thereby achieving a technical effect of improved synergy.

[0072] In the above composition, for the technical purpose of overcoming dual resistance to oxaliplatin and ferroptosis inducers, it may further include an agent that inhibits the expression of at least one gene selected from the group consisting of KCNMB4, DLG4, SERPINA4, CAP2, SYCP2, DAB2, TRIM16L, SLC7A11, FAM211A-AS1, STK31, ENPP1, and VIM, and preferably may further include an agent that inhibits the expression of the SLC7A11 gene.

[0073] In the above composition, as agents for inhibiting the expression of the SLC7A11 gene, erastin, imidazole ketone erastin (IKE), piperazine erastin, sulfasalazine, sorafenib tosylate, Nutlin-3a, AMG-232, RG-7388 (Idasanutlin), Brusatol, Luteolin, Trigonelline, Tricostatin A (TSA), Valproic acid, 5-Azacytidine, Decitabine, miR-27a, miR-375, miR-5096, miR-125b, SLC7A11 It may further include at least one selected from the group consisting of specific siRNA and SLC7A11 specific shRNA, but is not limited thereto.

[0074] In the above composition, the cancer may have resistance to at least one selected from the group consisting of oxaliplatin and ferroptosis inducers.

[0075] The above composition may further include a preparation that promotes the expression of at least one of the genes TFRC (Transferrin Receptor) and DMT1 (Divalent Metal Transporter 1).

[0076] The above composition may further include a preparation that promotes the expression of at least one gene selected from the group consisting of LOC101930275, CCNI2, RN7SL1, MMP1, P2RY1, LINC00342, CXCL17, and RN75L2.

[0077] The above composition may further include an agent that promotes the expression of at least one gene selected from the group consisting of PAPSS2, COL5A2, FMO5, SEPP1, FAM105A, TMEM176B, IL6R, OXTR, MUC13, UST, TMEM176A, RASL11A, and FGF11.

[0078] The above composition may further include an agent that inhibits the expression of at least one gene selected from the group consisting of FGF11, LBH, AXIN2, NKD1, IFI6, EPSTI1, NPR2, and GATA3.

[0079] In the above composition, the term "agent that promotes gene expression" refers to a substance that directly or indirectly increases the transcription, translation, or protein stability of a specific gene to significantly increase the mRNA expression level or protein expression level of the said gene, and the said agent may include a transcription factor activator, a signal transduction pathway activator, an epigenetic regulator (histone acetylation inducer, DNA methylation inhibitor, etc.), a microRNA inhibitor, a proteolytic inhibitor, or a combination thereof, and the increase in expression may be confirmed through qRT-PCR, RNA-seq, Western blot, immunohistochemical staining (IHC), or ELISA analysis.

[0080] In the above composition, the term "agent that inhibits gene expression" refers to a substance that directly or indirectly inhibits the transcription, translation, or protein stability of a specific gene to significantly reduce the mRNA expression level or protein expression level of the said gene, and the agent may include a transcription inhibitor, a signaling pathway inhibitor, an epigenetic regulator (histone deacetylation inducer, DNA methylation inducer, etc.), microRNA, siRNA, shRNA, antisense oligonucleotide, a CRISPR-based gene inhibition means, or a combination thereof, and the reduction in expression may be confirmed through qRT-PCR, RNA-seq, Western blot, immunohistochemical staining (IHC), or ELISA analysis.

[0081] The above composition may further include a pharmaceutically acceptable carrier and may be formulated together with the carrier. In the present invention, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not irritate living organisms and does not impair the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions are those that are sterile and biocompatible, and may include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and mixtures of one or more of these components; additionally, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. Furthermore, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into injectable formulations such as aqueous solutions, suspensions, and emulsions, as well as pills, capsules, granules, or tablets.

[0082] The above composition may be applied to any formulation containing the above composition as an active ingredient, and may be prepared as an oral or parenteral formulation. The pharmaceutical formulations of the present invention include forms suitable for oral, rectal, nasal, topical (including the cheek and under the tongue), subcutaneous, vaginal, or parenteral (including intramuscular, subcutaneous, and intravenous) administration, or forms suitable for administration by inhalation or insufflation.

[0083] In the above composition, the composition is administered in a pharmaceutically effective amount. The effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by taking all of the above factors into consideration, and this can be easily determined by a person skilled in the art.

[0084] In the above composition, the dosage of the composition varies widely depending on the patient's body weight, age, gender, health status, diet, time of administration, method of administration, excretion rate, and severity of the disease, and the appropriate dosage may vary, for example, depending on the amount of drug accumulated in the patient's body and / or the specific efficacy of the composition used. Generally, it can be calculated based on the EC50 measured as effective in in vivo animal models and in vitro, for example, 0.01 μg to 1 g per kg of body weight, and may be administered in divided doses of one to several times per unit period on a daily, weekly, monthly, or yearly basis, or may be administered continuously over a long period using an infusion pump. The number of repeated administrations is determined by considering the time the drug remains in the body and the drug concentration in the body. Depending on the course of disease treatment, the composition may be administered for recurrence even after treatment has been achieved.

[0085] In the above composition, the composition may additionally contain one or more active ingredients that exhibit the same or similar functions in relation to the prevention or treatment of cancer, or a compound that maintains / increases the solubility and / or absorption of the active ingredients. Additionally, optionally, it may additionally include chemotherapy agents, anti-inflammatory agents, antiviral agents and / or immunomodulators, etc.

[0086] In the above composition, the composition may be formulated using methods known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to a mammal. The formulation may be in the form of powder, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, or sterile powders.

[0087] In the above composition, technical details related throughout the specification, such as cancer and ferroptosis inducers, may be interpreted by referring to the above.

[0088]

[0089] As one aspect of the present invention, a method for providing information for predicting the prognosis of cancer is provided, comprising the step of measuring the expression level of the SLC7A11 gene from a biological sample obtained from an individual.

[0090] In the above method, the term prognosis refers to the result of comprehensively predicting the future course, progression pattern, likelihood of recurrence, likelihood of metastasis, responsiveness to treatment, survival possibility, or survival period of the disease, particularly cancer, based on the time of diagnosis, and can be quantified by clinical indicators such as relapse-free survival, progression-free survival, overall survival, disease recurrence rate, treatment response rate, or risk of death.

[0091] In the above method, the method may further include a step of determining that the prognosis of cancer is poor if the expression level of the SLC7A11 gene is higher than the expression level in a biological sample obtained from a normal control individual.

[0092] In the above method, the subject refers to an animal including humans, and specifically may refer to at least one selected from humans, dogs, cats, mice, etc., but is not particularly limited to any subject that is a potential subject for developing cancer. Specifically, it may be a human subject that is likely to develop cancer or has developed cancer, or has developed cancer. More specifically, it may be a human subject that is likely to develop cancer or has developed cancer, or has developed cancer, and is suspected of having resistance to oxaliplatin and / or ferroptosis inducers.

[0093] The above cancer may be resistant to at least one of oxaliplatin and a ferroptosis inducer.

[0094] In the above method, technical details related throughout the specification, such as samples, expression levels, cancer, ferroptosis inducers, etc., may be interpreted by referring to the above.

[0095]

[0096] As one aspect of the present invention, a diagnostic composition for predicting the prognosis of cancer is provided, comprising a preparation for measuring the expression level of the SLC7A11 gene.

[0097] In the above composition, the cancer may have resistance to at least one of oxaliplatin and a ferroptosis inducer.

[0098] In the above composition, technical details related throughout the specification, such as expression levels, formulations, diagnostic compositions, cancer, prognosis, and ferroptosis inducers, may be interpreted by referring to the above.

[0099]

[0100] As one aspect of the present invention, a diagnostic kit for predicting the prognosis of cancer is provided, comprising the above composition.

[0101] Regarding the above kit, technical content related throughout the specification, such as expression levels, formulations, kits, cancer, prognosis, and ferroptosis inducers, may be interpreted by referring to the above.

[0102]

[0103] As one aspect of the present invention, a method for screening substances that improve the prognosis in the prevention or treatment of cancer is provided, comprising the step of measuring the SLC7A11 gene expression level from a biological sample obtained from an individual treated with a candidate substance.

[0104] In the above method, the step of selecting a substance that improves the prognosis in the prevention or treatment of cancer may be further included if the expression level of the SLC7A11 gene is lower than the expression level in a biological sample obtained from an individual prior to treatment.

[0105] The above cancer may be resistant to at least one of oxaliplatin and a ferroptosis inducer.

[0106] In the above method, overlapping matters regarding candidate substances, individuals, samples, expression levels, cancer, prognosis, ferroptosis inducers, etc., may be interpreted by referring to the above.

[0107]

[0108] A pharmaceutical composition provided as one embodiment of the present invention comprises oxaliplatin and a ferroptosis inducer, and can exhibit excellent preventive or therapeutic effects against cancer. In particular, by demonstrating significantly superior preventive or therapeutic effects against cancers resistant to oxaliplatin and / or ferroptosis inducers, it may be possible to present a new treatment method for cancers that are expected to be difficult to treat with the prior art.

[0109] However, it should be understood that the effects are not limited to those mentioned above and include all effects that can be inferred from the composition of the invention described in the detailed description or claims.

[0110]

[0111] Figures 1a through 1h: Representing the results of molecular profiling of patient-derived pancreatic cancer organoids (PDPCOs) to elucidate ferroptosis-related mechanisms associated with oxaliplatin responsiveness. (a) Schematic diagram of the experimental workflow for establishing PDPCOs (42 in total), performing integrated molecular profiling, and characterizing oxaliplatin resistance. (b) Concentration-response curves measuring the heterogeneous responses to oxaliplatin (0–500 μM, 5-day treatment) for 42 PDPCOs using the 3D CellTiter-Glo assay. (c) Oncoplot showing recurrent genomic variations in PDPCOs compared to TCGA pancreatic cancer data. Clinical information, including oxaliplatin responsiveness, histological features, and patient metadata, is displayed at the bottom. (d) Volcano plot showing differentially expressed genes between oxaliplatin-sensitive and resistant PDPCOs. (e) Red and blue dots represent genes that are significantly upregulated and downregulated, respectively (log2-fold change > 1 or < -1, p < 0.05), and (e) a clear distinction between oxaliplatin-resistant PDPCO (red) and oxaliplatin-sensitive PDPCO (blue) is observed by Principal Component Analysis (PCA). (f) Pathway enrichment analysis results for biological pathways showing differences between the oxaliplatin-sensitive and resistant groups (dot size indicates the number of genes, and color intensity indicates statistical significance). (g) Gene Set Enrichment Analysis (GSEA) results for sulfur metabolism, selenocompound metabolism, and lipid oxidation (GO:0034440). (h) GSEA results for ferroptosis-promoting and repressive gene sets derived from FerrDb V2, indicating that ferroptosis-repressive genes are significantly enriched in the negative direction in oxaliplatin-resistant PDPCO.

[0112] Figures 2a to 2i: Showing the synergistic effects of in vitro and in vivo inhibition of pancreatic cancer growth by the combination of oxaliplatin and artesunate. (a) Cell viability matrix showing the concentration-dependent effects of oxaliplatin (OXA, 0-100 μM) and artesunate (ART, 0-50 μM) co-treatment for 48 hours on AsPC-1, Panc-1, and MIA PaCa-2 cells (color scale indicates inhibition rate (%)). (b) Synergistic effect maps of OXA / ART combinations generated using ZIP, Bliss, Loewe, and HSA models, and the corresponding synergistic effect scores and statistical significance scores. (c) Representative image and quantitative analysis results of cancer cell metastasis in a 3D Matrigel model treated with Vehicle, OXA (100 μM), ART (10 μM), or combinations thereof for 48 hours (Nucleus: blue, F-actin: red). (d) Apoptotic profiles confirmed by Annexin V / PI flow cytometry after 48 hours of treatment with Vehicle, OXA (100 μM), ART (10 μM), or combinations thereof. Representative flow cytometry plots and quantitative results for viable cells, early apoptotic cells, and late apoptotic / necrotic cell populations. (e) Representative phase-contrast image and quantitative results of spheroid formation ability in 3D culture after 5 days of treatment with Vehicle, OXA (50 μM), ART (5 μM), or combinations. (f) Representative phase-contrast microscopy image of PDPCO treated with Vehicle, ART (10 μM), OXA (200 μM), or combinations for 5 days. (g) Synergy map analyzing the synergistic effect of OXA (0-500 μM) and ART (0-50 μM) combinations in multiple PDPCOs using SynergyFinder .0.Drug interactions were quantified by applying four different synergistic models of ZIP, Bliss, Loewe, and HSA, with the color scale representing synergistic (red) to antagonistic (green). (h) Tumor growth curves of SNU-4425-TO xenograft models treated with Vehicle, ART (20 mg / kg, intraperitoneal injection, daily), OXA (5 mg / kg, intraperitoneal injection, twice weekly), or combination therapy (n = 5 animals per group). (i) Final weight of excised tumors and representative images of the tumors from each treatment group.

[0113] Figures 3a to 3n: Demonstrating that TFRC and DMT1 play essential mediating roles in ART / OXA-induced ferroptosis. (a) Flow cytometry results for lipid peroxidation analyzed using C11-BODIPY (2 μM, 30 min) in AsPC-1, Panc-1, and MIA PaCa-2 cells treated with Vehicle, ART (20 μM), OXA (200 μM), or ART / OXA combination for 24 hours. Representative histogram on the left, and quantitative results on the right. (b) Labile iron pool levels measured by Calcein-AM Red (1 μM, 15 min) analysis in pancreatic cancer cells treated with the indicated compounds for 24 hours (higher fluorescence intensity indicates higher iron levels). (c) Levels of lipid peroxidation quantified as a percentage relative to the control group via C11-BODIPY staining and flow cytometry in pancreatic cancer cells treated with Vehicle, DFO (100 μM), ART (20 μM), OXA (200 μM), or combinations thereof for 24 hours. (d) Cell viability evaluated using CellTiter-Glo analysis after 48 hours of treatment with the indicated compounds. (e) Levels of mitochondrial reactive oxygen species (ROS) measured by MitoSOX (5 μM, 15 min) staining in pancreatic cancer cells treated with Vehicle, ART (20 μM), OXA (200 μM), or combinations of ART / OXA for 24 hours. Representative histograms are shown on the left, and immunofluorescence images on the right. (f) Intracellular ROS levels measured by DCF-DA (5 μM, 20 min) staining in pancreatic cancer cells treated with the indicated compounds for 24 hours. Representative histogram on the left, quantitative results on the right. (g) Oxygen consumption rate (OCR) measured in real-time using a Seahorse XF analyzer in pancreatic cancer cells treated with Vehicle, ART (20 μM), OXA (200 μM), or ART / OXA combination for 24 hours. Oligomycin (1 μM), FCCP (1 μM), rotenone / antimicin A (0.0 μM each).(5 μM) Time points for addition are indicated. (h) Basal, ATP-linked, maximal, and non-mitochondrial OCR values ​​derived from (G). (i) Schematic diagram of iron metabolism and ferroptosis pathways including transferrin receptor, System Xc-, DMT1, ferritin storage, Fenton reaction, lipid peroxidation, and ROS generation. (j) mRNA expression levels of TFRC, DMT1, and GPX4 measured by qRT-PCR and normalized to GAPDH in Panc-1 and MIA PaCa-2 cells treated with Vehicle, ART (20 μM), OXA (200 μM), or ART / OXA for 24 hours. (k) Western blot analysis results for GPX4, TFRC, DMT1, and β-actin in Panc-1 and MIA PaCa-2 cells after 48 hours of treatment. (l) Relative mRNA expression levels of DMT1 and TFRC normalized relative to siControl after introduction of siRNA (20 nM, 48 hours) into Panc-1 and MIA PaCa-2 cells. (m) Cell viability measured after 24 hours of treatment with Vehicle, ART (20 μM) / OXA (200 μM) and / or DFO (100 μM) following introduction of siControl, siTFRC, or siDMT1 into Panc-1 and MIA PaCa-2 cells. (n) Lipid peroxidation levels assessed by C11-BODIPY staining and flow cytometry after 24 hours of treatment with Vehicle or ART / OXA in pancreatic cancer cells introduced with siControl, siTFRC, or siDMT1.

[0114] Figures 4a to 4i: Prognostic effects of SLC7A11 expression in the entire cohort and the oxaliplatin-treated cohort. (a) Volcano plot showing differentially expressed genes between dual-resistant PDPCO and sensitive PDPCO. Red and blue dots represent genes that were significantly upregulated or downregulated, respectively (log₂ fold change > 1 or < -1, p < 0.05). (b) Gene ontology analysis results for differentially expressed genes associated with dual resistance, highlighting enrichment of processes related to membrane function and ion binding. (c) Venn diagram showing the intersection between genes related to ART responsiveness and ferroptosis, identifying SLC7A11 as a key duplicate gene. (d) Comparison of SLC7A11 expression between tumor tissue (T) and non-tumor tissue in three independent datasets (GSE28735, GSE62452, and GSE71729) (p-values ​​indicated). (e) Kaplan-Meier survival curves showing progression-free survival (left panel, p = 0.0086) and overall survival (right panel, p = 0.03) in pancreatic cancer patients classified into high-expression (red) and low-expression (blue) groups for SLC7A11. (f) Comparison of SLC7A11 expression between oxaliplatin-resistant and sensitive PDPCO in the SNUH cohort (TPM criteria, p = 0.01). (g) Comparison of 6-month and 12-month survival rates according to SLC7A11 expression levels (cutoff: 40) in the entire cohort and oxaliplatin-treated subgroups. (h) Violin plot comparing SLC7A11 expression levels between the surviving and non-surviving groups at 6 and 12 months in the entire cohort (n = 42). (i) Violin plot comparing SLC7A11 expression levels between the surviving and non-surviving groups at 6 and 12 months in the oxaliplatin treatment subgroup (n = 27).

[0115] FIGS. 5a to 5g: Indicating that SLC7A11 mediates resistance to oxaliplatin and artesunate through the inhibition of ferroptosis. (a) Cell viability measured after introducing siControl or siSLC7A11 (20 nM, 48 hours) into Panc-1 and MIA PaCa-2 cells, followed by treatment with Vehicle, ART (20 μM) / OXA (100 μM) and / or DFO (100 μM) for 72 hours. (b) Flow cytometry results for mitochondrial reactive oxygen species (ROS) analyzed using MitoSOX (5 μM, 10 min) after treating cells introduced with siControl or siSLC7A11 with Vehicle or ART (20 μM) / OXA (100 μM) for 24 hours. Representative histograms and mean fluorescence intensity (MFI) values ​​are shown. (c) Labile iron levels measured by Calcein-AM Red (1 μM, 15 min) analysis after treating siControl or siSLC7A11 cells with Vehicle or ART (20 μM) / OXA (200 μM) for 24 hours (higher fluorescence intensity indicates higher iron levels). (d) Lipid peroxidation levels analyzed by C11-BODIPY (2 μM, 30 min) staining after treating siControl or siSLC7A11 cells with Vehicle or ART (20 μM) / OXA (200 μM) for 24 hours. (e) Synergy map analyzing the synergistic effects of the combination of erastin (0-50 μM), OXA (200 and 500 μM), and ART (0-50 μM) in PDPCO using SynergyFinder 2.0 for ZIP, Bliss, Loewe, and HSA models (color scale indicates synergistic effect (red) to antagonistic effect (green)). (f) Representative phase-contrast microscopy images of PDPCO treated for 4 days with Vehicle, ART (20 μM), OXA (200 μM), erastin (10 μM), or the ART / OXA / erastin combination. (g) Synergistic scores and corresponding p-values ​​for each model.

[0116] Figures 6a and 6b: Shown the results of Gene Ontology and GSEA analyses on differentially expressed genes between oxaliplatin-sensitive PDPCO and resistant PDPCO. (a) Results of Gene Ontology analysis on differentially expressed genes between oxaliplatin-sensitive PDPCO and resistant PDPCO, categorized into three groups: biological process (top panel), cellular component (middle panel), and molecular function (bottom panel). The size of the dots represents the number of genes associated with each term, and the color intensity indicates statistical significance (rich factor). (b) GSEA plots for glutathione metabolism and selenocompound metabolic pathways, illustrating differential enrichment between oxaliplatin-sensitive PDPCO and resistant PDPCO, along with Normalized Enrichment Score (NES) and FDR values.

[0117] Figures 7a and 7b: Evaluation of ferroptosis inducers in pancreatic cancer cells. (a) Analysis of cell viability measured in AsPC-1, Panc-1, and MIA PaCa-2 cells treated with different concentrations of ART (0-50 μM), SOR (0-50 μM), or SSZ (0-10 mM) for 72 hours in the presence or absence of ferroptosis inhibitors Fer-1 (1 μM), DFO (100 μM), and Trolox (100 μM). (b) Comparison of the effects of ferroptosis inhibitors and the apoptosis inhibitor zVAD.fmk (10 μM) on ART-induced apoptosis after treating pancreatic cancer cells with ART (0-12.5 μM) for 72 hours, confirming that ferroptosis is the primary mechanism of the corresponding apoptosis.

[0118] Figure 8: Shown the effects of OXA / ART combination on cell migration and invasion. Migration and invasion were analyzed in AsPC-1, Panc-1, and MIA PaCa-2 cells after treatment with Vehicle, ART (20 μM), OXA (100 μM), or ART / OXA combination for 24–48 hours. Representative images of cells stained with crystal violet are shown on the left, while the quantitative results of the number of migrated and invaded cells and their statistical significance are shown on the right.

[0119] Figure 9: Showing heterogeneous sensitivity to ART in patient-derived pancreatic cancer organoids; concentration-response curves evaluating variable sensitivity to ART (0-100 μM, 5 days of treatment) for 43 PDPCOs using the 3D CellTiter-Glo assay.

[0120] FIGS. 10a to 10d: Reduction in aggressiveness of pancreatic cancer cells due to inhibition of SLC7A11 expression. (a) Results of cell proliferation measured by CellTiter-Glo assay for 3 days after introducing siControl or siSLC7A11 (20 nM) into AsPC-1 and Panc-1 cells. (b) Migration and invasion ability of Panc-1 cells after 48 hours following introduction of siControl or siSLC7A11. Representative images are shown on the left and quantitative results on the right, indicating that cell migration and invasion are significantly reduced by inhibition of SLC7A11 expression. (c) Representative phase-contrast images of AsPC-1 and Panc-1 cells introduced with siControl or siSLC7A11 after culturing under 3D culture conditions for 5 days are shown on the left and quantitative results of spheroid diameter on the right. (d) Quantification of the number of spheroids after 5 days of 3D culture under the same conditions, indicating that the ability to form spheroids is significantly reduced with the inhibition of SLC7A11 expression.

[0121]

[0122] Hereinafter, to explain more specifically, examples and experimental examples will be described in detail. However, the following examples and experimental examples are illustrative and the scope of the invention is not limited thereto.

[0123]

[0124] Experimental method

[0125]

[0126] 1. Culture of patient-derived pancreatic cancer organoids (PDPCO)

[0127]

[0128] The culture of patient-derived pancreatic cancer organoids (PDPCOs) was performed in accordance with guidelines approved by the Institutional Review Board of Seoul National University Hospital. Patient-derived pancreatic cancer organoids were established from core biopsy tissues obtained via endoscopic ultrasound-guided fine needle biopsy. All organoids were cultured in Advanced DMEM / F12 (Life Technologies) medium based on Wnt3a / R-spondin1 / Noggin conditioning medium (50% vol / vol) and containing 1X B27 supplement (Life Technologies, Carlsbad, CA, USA), 0.5 mM N-acetyl-L-cysteine ​​(Sigma-Aldrich), 10 mM nicotinamide (Sigma-Aldrich), 50 ng / mL human epithelial growth factor (EGF; PeproTech Inc., Cranbury, NJ, USA), 500 nM A83-01, 100 ng / mL human fibroblast growth factor 10 (FGF10; PeproTech), and 10 nM gastrin (R&D Systems, Inc., Minneapolis, MN, USA).

[0129] For subculture, organoids were washed after collection and separated by mechanical shearing or digestion with TrypLE Express (Life Technologies), and the separated organoid fragments were re-coated in fresh Matrigel (Corning, NY, USA). All established PDPCOs were included in the analysis, and no exclusions were performed.

[0130]

[0131] 2. Processing of Whole-exome, Whole-genome, and RNA sequencing data

[0132]

[0133] Whole-exome and whole-genome sequencing data were processed using the nf-core / sarek workflow (v3.4.2) in accordance with GATK Best Practices. Sequencing reads were aligned to the GRCh38 reference genome. Somatic variant detection was performed using GATK Mutect2. Annotation was performed using SnpEff and ANNOVAR based on the GRCh38 reference.

[0134] RNA sequencing data were processed using the nf-core / rnaseq pipeline (version 3.14.0) in accordance with RNA-seq best practices. Raw sequencing reads were trimmed using fastp to remove adapter sequences and low-quality nucleotides. The trimmed reads were aligned to the GRCh38 reference genome using STAR aligner. Transcriptome quantification was performed using Salmon in alignment-based mode to generate gene expression data.

[0135] To identify gene expression signatures associated with drug responsiveness, PDPCO stratified samples into sensitive and resistant groups based on AUC values ​​derived from the drug response analysis. The gene expression matrix was normalized and batch-corrected using pyComBat to minimize technical variability between samples. Differential expression analysis was performed using the DESeq2 package. Genes with a p-value < 0.05 and an absolute log2fold change ≥ 1 were considered significant differential expression genes. To explore the biological associations of differential expression genes, functional enrichment analysis was performed using the GSEApy Python package.

[0136]

[0137] 3. Analysis of cell viability and drug combination synergy

[0138]

[0139] Cell lines were cultured at 37°C under 5% CO2 conditions. For cytotoxicity analysis, cells (3,000 cells / well) were treated with ART (0-100 μM) or OXA (0-100 μM) for 48 hours. For inhibitor analysis, cells were preincubated with Fer-1 (1 μM, 6 hours), Trolox (40 μM, 6 hours), DFO (AsPC-1 and Panc-1: 1 μM, 6 hours; MiaPaCa-2: 6 μM, 6 hours), and z-VAD.fmk (10 μM, 2 hours) prior to ART treatment. In the drug combination experiment, cells were treated with OXA (AsPC-1 and Panc-1: 100 μM; MiaPaCa-2: 25 μM) and ART (AsPC-1: 10 μM; Panc-1 and MiaPaCa-2: 20 μM) for 24 hours. Cell viability was evaluated using the Cell Titer-Glo luminescent cell viability assay kit (Promega, Madison, USA).

[0140] For PDPCO, 600 viable cells were seeded into 50 μL of 50% Matrigel: 50% human complete organoid media per well. After 72 hours of treatment, 3D cell viability was evaluated using the Cell Titer-Glo 3D luminescent cell viability assay kit (Promega). Luminescence signals were measured using a Luminometer (Glomax® Explore Multimode Microplate Reader, Promega, USA). Data were normalized relative to the vehicle control group, and IC50 50 The values ​​were calculated using the Hill equation of GraphPad Prism software 10 (GraphPad Inc., San Diego, CA, USA).

[0141] The drug combination effect was analyzed using SynergyFinder (version 2.0), which implements four criterion synergy models (highest single agent, Bliss, Loewe, zero interaction potency). According to the synergy score, the interaction between the two drugs is classified as antagonistic (less than -10), additive (between -10 and 10), and synergistic (greater than 10).

[0142]

[0143] 4. Verification of the ferroptosis mechanism

[0144]

[0145] Lipid peroxidation was evaluated by flow cytometry using C11-BODIPY staining (Thermo Fisher Scientific, 5 μM, 30 min). Intracellular iron concentration was measured using a Calcein-AM assay kit (Thermo Fisher, 1 μM, 15 min). Mitochondria and intracellular ROS were detected using MitoSOX Red (Invitrogen, 5 μM, 15 min) and H2DCFDA (Invitrogen, 5 μM, 20 min), respectively. For the verification of ferroptosis, cells were pretreated with ferrostatin-1 (Fer-1, 1 μM, 2 hours), deferoxamine (DFO, 1-6 μM, 6 hours), or Trolox (40 μM, 6 hours) prior to treatment.

[0146] Western blotting was performed using antibodies against SLC7A11, SLC3A2, SLC11A2 (DMT1), NCOA4, FTH (Cell Signaling Technology, Danvers, MA, USA), Transferrin Receptor (Thermo Fisher), and β-actin (BD Biosciences) as a loading control. For qPCR analysis, total RNA was isolated and cDNA was synthesized, and the data were normalized to GAPDH expression levels as described in Supplementary Methods.

[0147]

[0148] 5. SLC7A11 Functional Study

[0149]

[0150] siRNA-mediated knockdown of SLC7A11, TFRC, and DMT1 was performed for 48 hours using 20 nM siRNA. In the SLC7A11 inhibition study, erastin (0-50 μM) was used for triple combination treatment with OXA and ART in dual-resistant PDPCO.

[0151]

[0152] 6. Cell Culture and Chemicals

[0153]

[0154] Panc-1, MiaPaCa-2, and AsPC-1 cell lines were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and the Korea Cell Line Bank (KCLB, Korea). AsPC-1 cells were cultured in RPMI (Gibco, CA, USA) medium containing 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA) and 1% penicillin / streptomycin (PS; Gibco). Panc-1, MiaPaCa-2, and BxPC-3 cells were cultured in DMEM (Gibco) medium containing 10% FBS and 1% PS. Cells were maintained at 37°C in a humidified environment containing 95% air and 5% CO2, and were periodically checked for Mycoplasma contamination. Artesunate (ART) was purchased from Tokyo Chemical Company (TCI; Shanghai, China). Oxaliplatin (OXA) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Ferrostatin-1 (Fer-1), Trolox, deferoxamine (DFO), and erastin were purchased from Selleckchem (Houston, TX, USA). Carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]-fluoromethyl ketone (zVAD.fmk) was purchased from R&D Systems, Inc. (Minneapolis, MN, USA).

[0155]

[0156] 7. Sequence Analysis and Data Processing

[0157]

[0158] The preprocessing steps included adapter trimming, duplicate marking, base quality score recalibration, and alignment quality control. A multi-stage filtering strategy was applied to identify high-reliability somatic mutations. In the initial stage, only variants with a PASS filter status were retained. Subsequently, variants were further filtered based on sequencing depth and allele frequency, and only those satisfying a minimum depth of 25 or greater and a variant allele frequency of 0.05 or greater were retained. Only bi-allelic single nucleotide variants (SNVs) with clear reference and alternate alleles were included. Variants located in non-coding regions or synonymous regions, such as introns, untranslated regions (UTRs), or intergenic regions, were excluded. The remaining variant set consisted of protein-altering variants, including missense variants, frameshifts, splice site variants, and other functional categories, as defined by SnpEff.

[0159] Allele frequency data from the Genome Aggregation Database (gnomAD v4.1) were used to remove presumed germline mutations and common polymorphisms. Variants with a frequency exceeding 1% in the East Asian population were excluded. Finally, to limit the filtered variants to cancer-related genes with established biological or clinical relevance, the variants were restricted to those occurring in genes listed in the OncoKB cancer gene database.

[0160] For RNA-seq analysis, functional abundance analysis including KEGG pathways and Gene Ontology items was performed using the GSEApy Python package to identify molecular pathways associated with drug sensitivity and resistance in PDPCO. In each cohort of OXA and ART, a low AUC value was defined as the sensitivity group, and a high AUC value was defined as the resistance group.

[0161]

[0162] 8. qPCR and Western blotting

[0163]

[0164] For qPCR analysis, total RNA was isolated from cells using the AccuPrep® Universal RNA Extraction Kit (Bioneer, Daejeon, Korea) according to the manufacturer's protocol. Genomic DNA was removed by DNase treatment using the RNase-Free-DNase Set (Qiagen, Hilden, Germany). cDNA was synthesized using AccuPower® RocketScript Cycle RT PreMix (Bioneer). Data were normalized to the expression levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin. The primer sequences (5'-3') used are as follows: GPX4, (forward) GCCAGGGAGTAACGAAGAGAT, (reverse) TTGATGGCATTTCCCAGGATG; SLC7A11, (forward) ACAGGGATTGGCTTCGTCAT, (reverse) GGGCAGATTGCCAAGATCTCA; Transferrin, (forward) TGTTCCGGTCGGAAACCAAG, (reverse) TTTGGTTGCCACTTCCCCAT; Transferrin Receptor 1(TFRC), (forward) GGACGCGCTAGTCTTCT, (reverse) CATCTACTTGCCGAGCCAGG. Data analysis was performed based on the relative quantification method, and the relative change in expression was calculated using △CT values.

[0165] For Western blotting, cells were collected and homogenized on ice using RIPA lysis buffer (Thermo Fisher). Subsequently, the cell lysates were centrifuged at 4°C for protein separation. The separated proteins were quantified using a Bicinchoninic Acid Protein Assay kit (Thermo Fisher).

[0166]

[0167] 9. Evaluation of drug cytotoxicity in 3D spheroid culture

[0168]

[0169] The evaluation of drug cytotoxicity in 3D spheroid assembly cultures was performed according to previously reported methods. Briefly, cells (1,000 cells / well) were seeded into U-bottom 96-well plates (Corning), grown into spheroids for 2 days, and then treated with the drug at the above concentration.

[0170]

[0171] 10. Analysis of drug combination therapy

[0172]

[0173] Drug combination profiling data was analyzed using SynergyFinder (version 2.0), and in the analysis, four standard synergy models and their extension models were applied to calculate synergy scores for higher-order combination data.

[0174]

[0175] 11. Analysis of cell migration and invasion

[0176]

[0177] Transwell migration analysis was performed in a chamber system, and 2-5 x 10⁻⁶ suspended in 100 μL of serum-free DMEM 5Cells were added to the upper chamber of a 24-well Transwell (Corning) with a pore size of 6.5 mm (pore size 8 μm). DMEM containing 10% FBS was placed in the lower wells. Invasiveness analysis was performed using the same chamber system, but with a Matrigel (Corning) coating. Subsequently, the upper chamber was washed with PBS, fixed with 4% paraformaldehyde for 10 minutes, and stained with crystal violet. Images were acquired using an inverted microscope (Leica DMi8, Leica Microsystems, Wetzlar, Germany), and the number of stained cells was counted.

[0178]

[0179] 12. Spherical Formation Analysis

[0180]

[0181] After collection, cells were washed to remove serum and subsequently suspended in serum-free DMEM / F12 medium containing 20 ng / mL human EGF (PeproTech), 20 ng / mL human recombinant basic fibroblast growth factor (bFGF, PeproTech), and 1X B27 supplement (Life Technologies). Cells were cultured in ultra-low attachment 96-well plates (Corning) at a density of 2,000 cells / well. Sphere formation efficiency was calculated by counting the number of spheres with a diameter of 100 μm or more.

[0182]

[0183] 13. ROS Detection

[0184]

[0185] Intracellular reactive oxygen species (ROS) and mitochondrial superoxide were measured by flow cytometry using H2DCFDA (Invitrogen) and MitoSOX Red (Invitrogen). Cells were cultured at 37°C for 15 minutes with a 10 μM DCFH-DA probe and for 30 minutes with 2.5 μM MitoSOX Red, respectively. Subsequently, the cell suspensions were immediately analyzed using a BD FACSCaliber (BD Biosciences, Franklin Lakes, NJ, USA). All data were processed using FlowJO® 10 software.

[0186]

[0187] 14. Analysis of Mitochondrial ROS Using Fluorescence Microscopy

[0188]

[0189] For fluorescence microscopic analysis of ROS generated in mitochondria, cells were seeded onto glass coverslips in 24-well plates and treated with vehicle, ART (20 μM), OXA (200 μM), or a combination of ART and OXA for 24 hours. After treatment, the cells were washed with PBS and incubated with 5 μM MitoSOX Red (Invitrogen) at 37°C under dark conditions for 15 minutes. Subsequently, the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 minutes, and mounted using a mounting solution containing DAPI (Vector Laboratories, Burlingame, CA, USA).

[0190] Fluorescence images were acquired using a confocal laser scanning microscope (LSM 800, Carl Zeiss, Germany), with excitation / emission wavelengths of 510 / 580 nm for MitoSOX Red and 358 / 461 nm for Hoechst33342. The acquired images were analyzed using Leica Application Suite X (LAS X) software.

[0191]

[0192] 15. Measurement of lipid peroxidation

[0193]

[0194] Lipid peroxidation analysis was performed to evaluate the excessive phospholipid peroxidation levels that distinguish peroptosis from other apoptotic mechanisms. The relative concentration of malondialdehyde (MDA) in cell lysates was measured using the Lipid Peroxidation Assay Kit (Abcam, Cambridge, MA, USA) according to the manufacturer's instructions. Briefly, MDA in the samples reacted with thiobarbituric acid (TBA) to form MDA-TBA adducts, and the formed MDA-TBA adducts were quantified by colorimetric (OD = 532 nm) or fluorescence (Ex / Em = 532 / 553 nm).

[0195] Intracellular relative lipid ROS levels were evaluated using the C11-BODIPY dye (Thermo Fisher Scientific). Cells were treated with 5 μM C11-BODIPY for 30 minutes, harvested, and washed twice with PBS. When the polyunsaturated butadienyl moiety of the dye is oxidized, the fluorescence emission peak shifts from approximately 590 nm to approximately 510 nm, which was detected by a flow cytometer (BD Bioscience). Relative lipid peroxidation levels were calculated using mean fluorescence intensity (MFI).

[0196]

[0197] 16. LIP (Labile Iron Pool) Analysis

[0198]

[0199] Total cellular iron content was measured using a Calcein-AM assay kit (Thermo Fisher). Briefly, cells were washed with PBS and stained in a PBS solution containing Calcein-AM (1 μM) at 37°C for 15 minutes. After the Calcein-AM solution was removed, the cell suspension was immediately analyzed using a BD FACSCaliber (BD Biosciences, Franklin Lakes, NJ, USA). All data were analyzed using FlowJo TM 10 was processed using software.

[0200]

[0201] 17. Measurement of Mitochondrial Oxygen Consumption (OCR)

[0202]

[0203] Mitochondrial respiration was measured using the Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies, Santa Clara, CA, USA) on a Seahorse XFe96 Analyzer according to the manufacturer's instructions. Briefly, cells were seeded in Seahorse XF96 cell culture microplates at a density of 10,000 cells per well and treated for 24 hours with vehicle, ART (20 μM), OXA (200 μM), or a combination thereof. On the day of analysis, cells were cultured for 1 hour in Seahorse XF DMEM medium supplemented with 10 mM glucose, 1 mM sodium pyruvate, and 2 mM L-glutamine. Oxygen consumption rate (OCR) was measured at baseline and subsequently after sequential injection of oligomycin (1 μM), FCCP (1 μM), and rotenone / antimycin A (0.5 μM each).

[0204]

[0205] 18. Patient-derived organoid xenograft model

[0206]

[0207] All animal experiments were conducted with the approval of the Institutional Animal Care and Use Committee of Seoul National University Hospital (IACUC No. 21-0249-S1A0). 5-week-old female BALB / c nude mice were purchased from Orient Bio Inc. (Seongnam, Korea). Mice were acclimatized for one week prior to the experiment. PDPCO SNU-4425-TO (5 x 10^6 cells) were suspended in 100 μL of PBS (1:1) and subcutaneously injected into the right flank of the mice. When the tumor size reached approximately 100 mm^3, mice were randomly divided into four groups (n = 5 per group), each consisting of a vehicle control group, ART (20 mg / kg, ip, daily), OXA (5 mg / kg, ip, twice weekly), and a combination group. Tumor volume was measured twice a week using digital calipers and calculated according to the formula (length Х width^2) / 2. After 21 days of treatment, mice were sacrificed, and tumors were excised, quantified, and processed for subsequent analysis. All xenograft mice were included in the analysis. Treatment was performed non-blindly, but tumor measurement and analysis were conducted blindly.

[0208]

[0209] 19. Statistical Analysis

[0210]

[0211] Data were expressed as mean ± standard error (mean ± SEM) and analyzed using Student's t-test. The primary outcomes regarding the efficacy of the anticancer agent treatment were defined as tumor growth inhibition in mice and cell viability in PDPCO. qPCR data were expressed as mean ± standard deviation and analyzed using two-sided Student's t-test. In the Differential Gene Expression (DEG) analysis, genes with a fold change of 0.1 or greater and a P-value of less than 0.05 were considered significantly differentially expressed. For survival analysis, patients were stratified into high-expression and low-expression groups based on the median expression levels of biomarker candidate genes. Survival rates at 6 and 12 months were compared between the high-expression and low-expression groups in the entire cohort and the oxaliplatin-treated cohort. Additionally, biomarker candidate gene expression levels were compared between survivors and non-survivors at 6 and 12 months. Kaplan-Meier survival curves were generated using the survival and survminer packages of R software (version 4.4.0), and comparisons were performed using the log-rank test and Student's t-test. Statistical analysis and data processing were performed using Prism software 8 (GraphPad Inc.). A P value < 0.05 was considered statistically significant. Sample size calculations were not performed, and the sample size was determined based on experimental feasibility. It was assumed that the data followed a normal distribution, and no formal tests for normality were applied.

[0212]

[0213] 20. Ethics Approval

[0214]

[0215] This study was approved by the Institutional Review Board of Seoul National University Hospital (IRB No. 2201-138-1294; IRB No. 1102-098-357; IRB No. 1712-056-905; IRB No. 2003-189-1112). Animal experiments were approved by the Institutional Animal Care and Use Committee of Seoul National University Hospital (IACUC No. 21-0249-S1A0). Written informed consent was obtained from all patients regarding tissue collection, organoid generation, and molecular analysis. All procedures involving humans and animal experiments were conducted in accordance with relevant ethical guidelines and regulations.

[0216]

[0217] 21. Patient and Public Participation

[0218]

[0219] This study is a preclinical laboratory-based study, and therefore, the participation of patients or the general public in the design, conduct, reporting, or dissemination of results was not included.

[0220]

[0221] Experimental results

[0222]

[0223] 1. Underlying Molecular Characteristics and Oxaliplatin Reactivity of PDPCO

[0224]

[0225] In this study, a total of 42 PDPCO panels were established, and comprehensive data including clinical information, whole-exome sequencing, transcriptomics, and drug response profiles were collected for these 42 panels (Fig. 1A). Patient clinical characteristics (histotype subtype, age, sex (female (F), male (M)), disease status, responsiveness to oxaliplatin and artesunate (susceptibility (S), resistance (R)), etc.) are summarized in Table 1 below. These PDPCO panels encompass a spectrum of diverse patient populations and disease stages and provide a clinically significant platform for evaluating treatment response in pancreatic cancer.

[0226] Cell viability analysis revealed significant heterogeneity in OXA responsiveness across 42 PDPCOs (Fig. 1B). Based on drug response profiles and the area under the curve (AUC), 31 organoids (73.81% of the total) were classified as OXA resistant, and 11 organoids (26.19%) were classified as OXA sensitive.

[0227] Genetic profiling results revealed mutation patterns consistent with established genomic characteristics of pancreatic cancer (Fig. 1C). The most frequent mutations were observed in KRAS (79%), followed by TP53 (67%), SMAD4 (21%), and CDKN2A (12%). These mutation frequencies are consistent with previously reported representative genomic characteristics of pancreatic cancer and are also consistent with data from the Cancer Genome Atlas (TCGA).

[0228] PDPCO Subtype Age Gender Pathological Status Oxaliplatin Reactive Artesunate Reactive SNU-3947-TO Adenocarcinoma 64F Distant Metastasis RRSNU-3969-TO Adenocarcinoma 77M Locally Advanced RSSNU-4208-TO Adenocarcinoma 45M Distant Metastasis RRSNU-4305-TO Adenocarcinoma 59F Locally Advanced RSSNU-4340-TO Adenocarcinoma 66M Distant Metastasis RSSNU-4354-TO Adenocarcinoma 64F Locally Advanced RRSNU-4365-TO Adenocarcinoma 55F Distant Metastasis RSSNU-4378-TO Adenocarcinoma 69F Distant Metastasis RSSNU-4425-TO Adenocarcinoma 60F Locally Advanced RRSNU-4457-TO Adenocarcinoma 58M Distant Metastasis RRSNU-4607-TO Adenocarcinoma 57F Distant Metastatic RRSNU-4837-TO Adenocarcinoma 67M Locally advanced RRSNU-4894-TO Adenocarcinoma 61M Distant metastasis RRSNU-5790-TO Adenocarcinoma 45F Distant metastasis RRSNU-5791-TO Adenocarcinoma 66F Distant metastasis RSSNU-5813-TO Adenocarcinoma 64F Distant metastasis RRSNU-5955-TO Adenocarcinoma originating from intraductal papillary mucinous tumor 75M Resectable RSSNU-6134-TO Adenocarcinoma 78F Distant metastasis SSSNU-6390-TO Adenocarcinoma 70M Marginal resectable RRSNU-6476-TO Adenocarcinoma 58F Distant metastasis RSSNU-6831-TO Adenocarcinoma 77F Distant metastasis RRSNU-6948-TO Adenocarcinoma 70F Distant Metastatic SSSNU-6949-TO Adenocarcinoma 65F Distant metastasis SSSNU-6992-TO Adenocarcinoma 78M Distant metastasis SSSNU-7093-TO Adenocarcinoma 77M Distant metastasis SSSNU-7333-TO Adenocarcinoma 77F Distant metastasis RSSNU-7388-TO Adenocarcinoma 52F Distant metastasis SSSNU-7459-TO Adenocarcinoma 72F Borderline resectable RRSNU-7502-TO Adenocarcinoma 76F Distant metastasis RRSNU-7518-TO Adenocarcinoma 73M Distant metastasis RSSNU-7529-TO Adenocarcinoma 76F Distant metastasis RRSNU-7610-TO Adenocarcinoma 63M Borderline resectable SSSNU-7611-TO Adenocarcinoma 61F Distant metastasis RRSNU-7634-TO Adenocarcinoma 62M Distant Metastatic RRSNU-8206-TO Adenocarcinoma 60F Distant metastasis SSSNU-8340-TO Adenocarcinoma 56M Distant metastasis SSSNU-8341-TO Adenocarcinoma 60F Distant metastasis RSSNU-8581-TO Adenocarcinoma 71M Distant metastasis RRSNU-9142-TO Adenocarcinoma 69F ResectionPossible RRSNU-9286-TO Adenocarcinoma 76F Marginal resectable SRSNU-9381-TO Adenocarcinoma originating from intraductal papillary mucinous tumor 57F Distant metastasis SRSNU-205A-TO Adenocarcinoma 68M Distant metastasis RR

[0229]

[0230] 2. Analysis of Oxaliplatin Resistance of PDPCO by Ferroptosis-Related Transcriptome Signatures

[0231]

[0232] To confirm the molecular correlations associated with oxaliplatin (OXA) resistance, transcriptomic differences between OXA-resistant and OXA-sensitive PDPCOs were analyzed. Differential gene expression analysis revealed distinct transcriptomic profiles between OXA-sensitive and OXA-resistant PDPCOs (Fig. 1D). Principal Component Analysis (PCA) also showed a separation of the two groups along the PC1 and PC2 axes, suggesting the existence of transcriptomic differences between the two populations (Fig. 1E). Pathway abundance analysis identified several biological pathways that were differentially abundant between the two groups (Fig. 1F), notably including pathways related to sulfur and selenocompound metabolism. Previous studies have suggested that these pathways are associated with redox balance and the regulation of apoptosis. Additionally, various signaling pathways such as Hippo, Wnt, and cGMP-PKG were also found to be abundant, demonstrating the potential for multiple molecular processes to influence OXA responsiveness.

[0233] In the gene set abundance analysis (GSEA), the sulfur metabolic pathway showed distinctly negative abundance in OXA-resistant PDPCO (NES = -1.51; FDR q-value = 0.109; Fig. 1G). In the analysis of ferroptosis-related gene signatures using the FerrDb v2 database, ferroptosis-inhibiting genes showed significantly negative abundance in OXA-resistant PDPCO (NES = -1.44; FDR q-value = 0.024), whereas ferroptosis-inducing genes did not show distinct abundance (NES = 1.01; FDR q-value = 0.427; Fig. 1H). These results suggest that reduced expression of ferroptosis-inhibiting genes may be associated with OXA resistance. Further gene ontology analysis results regarding selenocompound metabolism and glutathione metabolic pathways are presented in Figs. 6A and 6B, respectively.

[0234] In summary, the results of this analysis indicate a potential association between ferroptosis modulation and OXA resistance, supporting the validity of a strategy combining ferroptosis inducers with conventional chemotherapy in the treatment of pancreatic cancer. The negative abundance of ferroptosis inhibitory genes in OXA-resistant PDPCO suggests the potential for therapeutic application through ferroptosis modulation. Based on this hypothesis, the combined effect of OXA and ferroptosis inducers was evaluated in a pancreatic cancer model.

[0235]

[0236] 3. Synergistic induction of ferroptotic apoptosis by combination therapy of oxaliplatin and artesunate

[0237]

[0238] To determine whether oxaliplatin (OXA) resistance could be overcome, the synergistic effects of ferroptosis inducers were evaluated in OXA-resistant PDPCOs. Among the tested drugs, ART, sorafenib, and sulfasalazine, ART exhibited the most potent ferroptosis-inducing activity. The cytotoxic effect of ART was reversed by ferroptosis inhibitors (ferrostatin-1, DFO, and Trolox), but not by the apoptosis inhibitor zVAD.fmk (Figs. 7A and 7B). Therefore, considering its specificity and safety profile, ART was used in combination studies with OXA.

[0239] OXA / ART combination therapy significantly reduced cell viability in three types of pancreatic cancer cell lines (Fig. 2A). Analysis of synergistic effects revealed strong synergistic interactions in AsPC-1 (ZIP = 28.2; p < 0.0001), Panc-1 (ZIP = 16.4; p = 0.002), and MIA PaCa-2 (ZIP = 18.8; p < 0.0001) (Fig. 2B). Additional synergistic indicators also supported these results. The combination therapy inhibited cancer cell metastasis in a 3D Matrigel model (Fig. 2C) and induced reduced invasion (Fig. 8), increased apoptosis (Fig. 2D), and inhibition of spheroid formation (Fig. 2E), suggesting a reduction in metastasis and cancer cell stem cell development.

[0240] The clinical relevance of this combination therapy was further validated using a PDPCO panel previously profiled for OXA and ART sensitivity (Figs. 1B, 9, Table 1 above). Among seven representative PDPCOs exhibiting diverse sensitivity characteristics (Fig. 2F), combination treatment demonstrated consistent growth inhibitory and synergistic effects (Fig. 2G), with particularly high synergistic scores observed in SNU-9286-TO (ZIP = 56.0; p < 0.0001) and SNU-4457-TO (ZIP = 44.9; p < 0.0001). All tested PDPCOs showed significant synergistic effects across various indicators (Table 2 below).

[0241] In a graft model using dual-resistant PDPCO SNU-4425-TO, the OXA / ART combination demonstrated a greater tumor suppression effect than monotherapy alone, as assessed by tumor volume (Fig. 2H) and final tumor weight (Fig. 2I; p < 0.01). This suggests that the OXA / ART combination can overcome the limited efficacy of each drug alone.

[0242] Synergy Scores Across ModelsPDPCOZIPp-valueBlissp-valueHSAp-valueLoewep-valueSNU-7333-TO33.40.00335.20.00125.40.00623.10.004SNU- 4457-TO44.9<0.000144.70.00121.40.00520.20.006SNU-9286-TO56.0<0.000156.8<0.000133.3<0.000144.6<0.0001SNU-430 5-TO16.7<0.000118.0<0.000121.5<0.000119.3<0.0001SNU-3947-TO25.8<0.000125.6<0.000122.0<0.000121.9<0.0001SNU -3969-TO44.1<0.000151.3<0.000131.9<0.000129.3<0.0001SNU-7610-TO27.5<0.000127.5<0.000134.4<0.000127.2<0.0001

[0243]

[0244] 4. Role of Iron Transporters TFRC and DMT1 in the Induction of Ferroptotic Synergy by Oxaliplatin and Artesunate

[0245]

[0246] To identify the regulatory axis of ferroptosis mediating the synergistic effects of oxaliplatin (OXA) and artesunate (ART), key factors involved in the ferroptosis pathway were analyzed. Combination treatment with ART / OXA significantly increased lipid peroxidation levels via C11-BODIPY staining in all three pancreatic cancer cell lines (Fig. 3A, p < 0.001), and indicated potent activation of the ferroptosis pathway by increasing more than twofold (p < 0.01) compared to single-drug treatment. Measurement of intracellular iron concentration using Calcein-AM staining revealed an increase in iron concentration in all cell lines (Fig. 3B, p < 0.01), and lipid peroxidation (Fig. 3C) and apoptosis (Fig. 3D) were reversed by the iron chelator DFO (p < 0.001), confirming that ferroptosis is the primary mechanism.

[0247] Additionally, MitoSOX and DCF-DA staining results confirmed an increase in mitochondrial and intracellular reactive oxygen species (ROS) (Figs. 3E, 3F). Oxygen consumption rate (OCR) analysis showed a significant decrease in both basal and maximal respiratory capacity (Figs. 3G, 3H), indicating distinct mitochondrial dysfunction. These results demonstrate that OXA / ART combination therapy induces intracellular iron accumulation through increased expression of the iron transport proteins TFRC and DMT1, and leads to ferroptotic apoptosis by causing lipid peroxidation and mitochondrial impairment (Fig. 3I).

[0248] As a result of expression analysis, the combination treatment significantly increased the mRNA and protein expression of transferrin receptor (TFRC) and divalent metal transporter 1 (DMT1) in Panc-1 and MIA PaCa-2 cells (Fig. 3J, p < 0.001; Fig. 3K), while Western blot analysis showed no relatively large change in the expression of glutathione peroxidase 4 (GPX4).

[0249] To verify the function, expression inhibition of TFRC and DMT1 using siRNA was performed. As a result, cytotoxicity (Fig. 3M) and lipid peroxidation (Fig. 3N) caused by the combination of ART and OXA were significantly reduced, confirming that these proteins are essential for mediating ferroptotic apoptosis through iron transport and accumulation. These results confirm that OXA / ART combination therapy induces intracellular iron accumulation through increased expression of TFRC and DMT1, and causes ferroptosis leading to lipid peroxidation and mitochondrial dysfunction.

[0250]

[0251] 5. Mediation of dual resistance to oxaliplatin and artesunate by SLC7A11 overexpression

[0252]

[0253] To elucidate the mechanism of dual tolerance acquisition, a transcriptome comparative analysis was performed between dual-tolerance (OXA / ART) PDPCO and OXA-only tolerance PDPCO. Transcriptome analysis revealed distinct gene expression profiles between the two groups (Fig. 4A), and several genes were upregulated in the dual-tolerance samples. Gene ontology analysis observed significant enrichment in calcium ion binding, channel activity, and membrane-related processes (Fig. 4B). SLC7A11 was identified as playing a key role in regulating dual tolerance and ferroptosis inhibition (Fig. 4C).

[0254] Validation using the public dataset revealed that SLC7A11 expression was high in pancreatic cancer tumors across several cohorts (Fig. 4D; GSE28735: p = 0.0002; GSE62452: p < 0.0001; GSE71729: p < 0.0001), with tumor tissue (T) consistently showing higher expression compared to non-tumor tissue (NT). Overexpression of SLC7A11 was associated with reduced progression-free survival (Fig. 4E, left; p = 0.0086) and reduced overall survival (Fig. 4E, right; p = 0.03) in the TCGA cohort. Additionally, SLC7A11 expression was significantly higher in resistant pancreatic cancer cells compared to sensitized cells (Fig. 4F).

[0255] Clinical validation results in the cohort of this study showed that SLC7A11 demonstrated significant prognostic value. In the entire cohort (n = 42), the high-expression group (≥ 40) of SLC7A11 had numerically lower 6-month survival rates (66.7% vs. 77.8%) and 12-month survival rates (40.0% vs. 48.1%) compared to the low-expression group (< 40), but these differences did not reach statistical significance (p 0.089 and p = 0.156). However, in the oxaliplatin treatment subgroup (n = 27), high expression of SLC7A11 was associated with significantly poorer survival outcomes; the 12-month survival rate was significantly lower (30.0% vs. 52.9%, p = 0.043), and the difference in 6-month survival rates was also close to significance (60.0% vs. 70.6%) (Fig. 4G).

[0256] In the analysis based on survival status, SLC7A11 expression was significantly lower in both the 6-month and 12-month survival groups compared to the non-surviving group in the entire cohort (Fig. 4H; 6 months: p = 0.006; 12 months: p = 0.02), and this trend was more pronounced in the oxaliplatin treatment subgroup (Fig. 4I; 6 months: p = 0.001; 12 months: p < 0.001).

[0257] These results establish that SLC7A11 functions as a predictive biomarker for oxaliplatin responsiveness and as a prognostic marker for pancreatic cancer survival.

[0258]

[0259] 6. Restoration of ferroptosis susceptibility and overcoming dual resistance by SLC7A11 inhibition

[0260]

[0261] To verify the functional role of SLC7A11, siRNA-mediated silencing or pharmacological inhibition of SLC7A11 was performed in a resistance model. siRNA-mediated silencing of SLC7A11 significantly reduced cell proliferation (Fig. 10A), reduced cell migration and invasion (Fig. 10B), and inhibited spheroid formation (Fig. 10C, Fig. 10D). Silencing of SLC7A11 using siRNA significantly increased ART / OXA-induced cytotoxicity in Panc-1 and MIA PaCa-2 cells (Fig. 5A, p < 0.001), and these effects were reversed by the administration of deferoxamine, confirming that ferroptosis is a resistance mechanism. In addition, SLC7A11 silencing increased mitochondrial ROS production (Fig. 5B), intracellular iron concentration (Fig. 5C), and lipid peroxidation (Fig. 5D), further confirming that SLC7A11 is involved in inhibiting ferroptosis.

[0262]

[0263] 7. Increased sensitivity to OXA / ART combination therapy in resistant PDPCO due to SLC7A11 inhibition

[0264]

[0265] Erastin, a selective SLC7A11 inhibitor, was tested in a triple combination therapy with OXA and ART in nine dual-resistant PDPCOs. A strong synergistic effect was observed (Fig. 5E), with very high synergistic scores confirmed particularly in SNU-7459-TO and SNU-3947-TO (ZIP: 61.4 and 73.8, respectively; Bliss: 66.0 and 89.8, respectively; Fig. 5G). SNU-4894-TO, SNU-7529-TO, and SNU-9142-TO showed moderate synergistic scores (ZIP: 44.6, 31.5, and 38.2, respectively), but consistent positive synergistic effects were observed across all indices in all models. Representative images confirmed that while single-agent treatment showed only a limited effect on PDPCO growth, triple combination treatment significantly reduced organoid survival (Fig. 5F). These effects were particularly pronounced in models with high baseline resistance, indicating that SLC7A11 inhibition is an effective strategy for overcoming treatment resistance and enhancing ferroptosis-based therapeutic effects.

[0266]

[0267] Abbreviations

[0268]

[0269] PC: pancreatic cancer; PDPCO(s): patient-derived pancreatic cancer organoid(s); OXA: oxaliplatin; ART: artesunate; TFRC: transferrin receptor; DMT1 (SLC11A2): divalent metal transporter 1; SLC7A11: solute carrier family 7 member 11; SLC3A2: solute carrier family 3 member 2; GPX4: glutathione peroxidase 4; NCOA4: nuclear receptor coactivator 4; FTH: ferritin heavy chain; ROS: reactive oxygen species; OCR: oxygen consumption rate; DFO: deferoxamine; Fer-1: ferrostatin-1; z-VAD.fmk: benzyloxycarbonyl-Val-Ala-Asp(OMe)-fluoromethylketone; qPCR: quantitative polymerase chain reaction; DEG(s): differentially expressed gene(s); GSEA: gene set enrichment analysis; PCA: principal component analysis; NES: normalized enrichment score; FDR: false discovery rate; ZIP: zero interaction potency; HSA: highest single agent; WES: whole-exome sequencing; WGS: whole-genome sequencing; RNA-seq: RNA sequencing; GEO: Gene Expression Omnibus; SRA: Sequence Read Archive; TCGA: The Cancer Genome Atlas; EGF: epidermal growth factor; FGF10: fibroblast growth factor 10; DMEM / F12: Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12; PBS: phosphate-buffered saline; i.p.: intraperitoneal; siRNA: small interfering RNA; TPM: transcripts per million; MFI: mean fluorescence intensity; H2DCFDA: 2′,7′-dichlorodihydrofluorescein diacetate; C11-BODIPY: lipid peroxidation reporter dye (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-C11); MitoSOX: mitochondrial superoxide indicator; ACSL4: acyl-CoA synthetase long-chain family member 4; AUC: area under the curve; IC50: half maximal inhibitory concentration.

[0270]

[0271] The scope of the present invention is defined by the claims set forth below, and all modifications or variations derived from the meaning and scope of the claims and equivalent concepts thereof should be interpreted as being included within the scope of the present invention.

Claims

1. A pharmaceutical composition for the prevention or treatment of cancer, comprising oxaliplatin and a ferroptosis inducer.

2. In claim 1, the ferroptosis inducer is artesunate, sorafenib, sulfasalazine, erastin, imidazole ketone erastin (IKE), piperazine erastin, RSL3, ML210, ML162, FIN56, L-butionine-(S,R)-sulfoximine (BSO), dihydroartemisinin (DHA), artemisinin, ferric ammonium citrate, iron dextran, simvastatin, lovastatin, and A pharmaceutical composition for the prevention or treatment of cancer, wherein at least one selected from the group consisting of atorvastatin.

3. A pharmaceutical composition for the prevention or treatment of cancer, wherein the ferroptosis inducer of claim 1 is a preparation that induces ferroptosis by a GPX4 (Glutathione Peroxidase 4) independent pathway.

4. A pharmaceutical composition for the prevention or treatment of cancer according to claim 1, wherein the cancer is at least one selected from the group consisting of pancreatic cancer, gastric cancer, lung cancer, hepatocellular carcinoma, colorectal cancer, breast cancer, prostate cancer, thyroid cancer, ovarian cancer, cervical cancer, renal cell carcinoma, bladder cancer, melanoma, leukemia, lymphoma, multiple myeloma, brain tumor, sarcoma, metastatic cancer thereof, and recurrent cancer thereof.

5. A pharmaceutical composition for the prevention or treatment of cancer according to claim 1, wherein the cancer has resistance to oxaliplatin or a ferroptosis inducer.

6. A pharmaceutical composition for the prevention or treatment of cancer according to claim 1, wherein the composition further comprises an agent that inhibits the expression of at least one gene selected from the group consisting of KCNMB4, DLG4, SERPINA4, CAP2, SYCP2, DAB2, TRIM16L, SLC7A11, FAM211A-AS1, STK31, ENPP1, and VIM.

7. A pharmaceutical composition for the prevention or treatment of cancer, wherein the composition of claim 1 further comprises a preparation that inhibits the expression of the SLC7A11 gene.

8. A pharmaceutical composition for the prevention or treatment of cancer according to claim 6, wherein the cancer has resistance to oxaliplatin and a ferroptosis inducer.

9. In claim 1, the composition is a preparation for inhibiting the expression of the SLC7A11 gene, comprising erastin, imidazole ketone erastin (IKE), piperazine erastin, sulfasalazine, sorafenib tosylate, Nutlin-3a, AMG-232, RG-7388 (Idasanutlin), Brusatol, Luteolin, Trigonelline, Tricostatin A (TSA), Valproic acid, 5-Azacytidine, Decitabine, miR-27a, miR-375, miR-5096, A pharmaceutical composition for the prevention or treatment of cancer, further comprising at least one selected from the group consisting of miR-125b, SLC7A11-specific siRNA and SLC7A11-specific shRNA.

10. A pharmaceutical composition for the prevention or treatment of cancer, wherein the composition of claim 1 further comprises a preparation that promotes the expression of at least one of the genes TFRC and DMT1.

11. A pharmaceutical composition for the prevention or treatment of cancer, wherein the composition further comprises a preparation that promotes the expression of at least one gene selected from the group consisting of LOC101930275, CCNI2, RN7SL1, MMP1, P2RY1, LINC00342, CXCL17 and RN75L2.

12. A pharmaceutical composition for the prevention or treatment of cancer according to claim 1, wherein the composition further comprises a preparation that promotes the expression of at least one gene selected from the group consisting of PAPSS2, COL5A2, FMO5, SEPP1, FAM105A, TMEM176B, IL6R, OXTR, MUC13, UST, TMEM176A, RASL11A, and FGF11.

13. A pharmaceutical composition for the prevention or treatment of cancer, wherein the pharmaceutical composition of claim 1 further comprises an agent that inhibits the expression of at least one gene selected from the group consisting of FGF11, LBH, AXIN2, NKD1, IFI6, EPSTI1, NPR2, and GATA3.