Method for targeting and modulating hepatitis b virus gene
By targeting the hepatitis B virus genome with a combination of epigenetic modification drugs and small nucleic acid drugs, effective regulation of cccDNA and integrated DNA was achieved, solving the problem of HBV virus replication rebound in existing technologies and achieving a higher proportion of functional cure effects.
Patent Information
- Application Number
- PCT/CN2025/000044
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-16
- Filing Date
- 2025-12-15
- Publication Date
- 2026-06-25
AI Technical Summary
Existing technologies are unable to effectively target the hepatitis B virus (HBV) genome, especially cccDNA and integrated DNA, to achieve sustained cure or clearance of HBV virus. Furthermore, conventional treatments cannot completely eliminate cccDNA and integrated DNA, leading to viral replication rebound.
A drug composition containing epigenetic and small nucleic acid drug components is used to target the HBV genome through DNA methylation and histone modification, combined with RNA interference technology to inhibit HBV genome transcription and viral protein expression, thereby clearing HBV-related antigens from host cells.
It achieves a higher rate of functional cure, reduces HBV-related antigen expression, reduces viral production, enhances antiviral immune response, and avoids the uncertainty of DNA repair mechanisms and immunogenic risks.
Smart Images

Figure PCTCN2025000044-FTAPPB-I100001 
Figure PCTCN2025000044-FTAPPB-I100002 
Figure PCTCN2025000044-FTAPPB-I100003
Abstract
Description
Methods for targeting and regulating hepatitis B virus genes Technical Field
[0001] This application relates to the field of biomedicine, specifically to a pharmaceutical composition for regulating the expression of hepatitis B virus (HBV) genes and its uses. Background Technology
[0002] Hepatitis B virus (HBV) is a hepatotropic DNA virus that causes chronic hepatitis B infection, leading to persistent liver inflammation and significantly increasing the risk of cirrhosis and liver cancer. The World Health Organization (WHO) estimates that there are currently over 250 million cases of chronic hepatitis B caused by HBV worldwide, resulting in over 800,000 deaths annually, placing a significant burden on global public health. China, as a populous country, has approximately one-third of the world's hepatitis B carriers. Since the 1980s, with increased hepatitis B vaccination rates, new hepatitis B cases in my country have been effectively controlled; however, the number of hepatitis B carriers in the country remains substantial.
[0003] Current treatments for HBV, such as nucleoside (acid) analogs and IFN, can effectively inhibit viral replication, but achieving a functional cure (reducing HBsAg to undetectable levels) is difficult and requires long-term medication. Once treatment stops, HBV replication rebounds. The main reason for this is that after HBV infects hepatocytes, it forms covalently closed circular DNA (cccDNA), and the HBV genome can integrate into the host hepatocyte genome. cccDNA and integrated DNA can stably serve as templates for viral replication and protein expression for a long time. Current conventional treatments do not eliminate these two components. Therefore, eliminating or silencing cccDNA and integrated DNA may be an effective treatment for HBV infection. Because cccDNA can assemble with histones in the host hepatocyte nucleus to form chromosome-like structures, its transcriptional regulation can also be affected by epigenetic modifications. The HBV genome contains three CpG islands, hereinafter referred to as CG I, CG II, and CG III, which are key regions for epigenetic regulation. Transcription of the HBV genome is regulated by four promoters (Xp, Cp, Sp1, Sp2) and two enhancers (Enh I and Enh II). Xp, Cp, Enh I, and Enh II are located in the CG II region, while Sp1 and Sp2 are located near CG I and CG III. Therefore, epigenetic editing of CpG islands may affect multiple regulatory elements, thereby affecting the transcription of the viral genome.
[0004] Introducing epigenetic modifications into specific regulatory regions or sites of the HBV genome can alter chromatin structure, thereby adjusting the target gene to a transcriptional repression state and achieving target gene silencing. This process does not cleave DNA, avoiding the possibility of genomic double-strand breaks and fundamentally eliminating the risk of activating unpredictable DNA repair mechanisms and potentially generating immunogenic truncated or mutant proteins. However, the development of epigenetic editing technologies that specifically target the HBV genome and can sustainably cure or eliminate the HBV virus still faces many unknowns and limitations. Summary of the Invention
[0005] The epigenetic modification drug component in the pharmaceutical composition provided in this application can target HBV cccDNA and HBV sequences integrated into the human genome, introducing DNA methylation and histone modification at these target sites, inhibiting the transcriptional activity of the HBV genome, thereby reducing the expression of HBV-related antigens (such as HBsAg and HBeAg) and reducing the generation of HBV DNA. The small nucleic acid drug component in the pharmaceutical composition, for example through RNA interference (RNAi) or antisense nucleic acid (ASO), targets HBV mRNA and inhibits viral protein expression and viral particle generation, preventing HBV replication. Furthermore, these small nucleic acid drugs can also reduce the expression of HBsAg and HBeAg, thereby reducing viral immune escape and enhancing the body's antiviral immune response. The combined use of the two drug components has the following advantages: the epigenetic modification drug targets HBV genomic DNA (cccDNA and integrated HBV genome), inhibiting DNA transcription of mRNA; while the small nucleic acid drug can further degrade and clear residual HBV transcripts, further clearing HBV-related antigens in host cells, achieving a higher proportion of functional cure.
[0006] On the one hand, this application provides a pharmaceutical composition for inhibiting the expression of hepatitis B virus (HBV) genes in cells, the pharmaceutical composition comprising: 1) an epigenetic modification pharmaceutical component comprising a fusion peptide or a complex peptide, or a nucleotide encoding the fusion peptide or complex peptide, the fusion peptide or complex peptide comprising at least one DNA-binding domain, at least one epigenetic modification domain and at least one transcriptional regulatory domain, and 2) a small nucleic acid pharmaceutical component capable of targeting HBV and intervening in its expression.
[0007] In some embodiments, the DNA-binding domain is selected from CRISPR enzymes, zinc finger nucleases (ZNF), transcription activator-like effector (TALE) domains, homing endonucleases, dCas9-FokI nucleases, Argonaute nucleases (Ago), or MegaTal nucleases.
[0008] In some embodiments, the CRISPR enzyme is a type 2 Cas protein and / or a mutant thereof.
[0009] In some embodiments, the CRISPR enzyme is one or more of the following Cas proteins: type II-A Cas protein, type II-B Cas protein, type II-C Cas protein, type VA Cas protein, type VB Cas protein, type VC Cas protein, type VU Cas protein, and mutants thereof.
[0010] In some embodiments, the CRISPR enzyme is the Cas9 protein and / or a mutant thereof.
[0011] In some embodiments, the at least one DNA-binding domain is dCas9.
[0012] In some embodiments, the epigenetic drug ingredient further comprises at least one single guide RNA (sgRNA) or a nucleotide encoding the sgRNA.
[0013] In some embodiments, the sgRNA is complementary to a target nucleotide sequence near the HBV gene and / or within the HBV gene regulatory element.
[0014] In some embodiments, the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 8273-9434.
[0015] In some embodiments, the sgRNA comprises a partial sequence of the nucleotide sequence shown in any one of SEQ ID NOs: 8273-9434, the partial sequence being 15-20 base pairs in length.
[0016] In some embodiments, the DNA-binding domain is a TALE domain.
[0017] In some embodiments, the TALE domain is capable of specifically binding to target nucleotide sequences within the HBV gene and / or the HBV gene regulatory element.
[0018] In some embodiments, the target nucleotide sequence is selected from the nucleotide sequences of any one of SEQ ID NO: 65-1701 and 3339-3358.
[0019] In some embodiments, the TALE domain includes an engineered RVD domain that is capable of recognizing and specifically binding to the target nucleotide sequence.
[0020] In some embodiments, the TALE domain comprises the amino acid sequence of any one of SEQ ID NO: 1702-3338 and 3359-8269.
[0021] In some embodiments, the HBV gene is a type B HBV gene, a type C HBV gene, or a type D HBV gene.
[0022] In some embodiments, the HBV gene regulatory element includes a transcription start site, a core promoter, a promoter, an enhancer, a silencer, an insulator element, a boundary element, and / or a locus control region.
[0023] In some embodiments, the at least one epigenetic modification domain provides methylation modification of at least one nucleotide in the vicinity of the HBV gene and / or within the HBV gene regulatory element.
[0024] In some embodiments, the at least one epigenetic modification domain comprises a DNA methyltransferase (DNMT) or a portion thereof.
[0025] In some embodiments, the appearance modification domain is selected from one or more of DNMT3A, DNMT3B, DNMT3C, DNMT1, DNMT2 and DNMT3L.
[0026] In some embodiments, the appearance modification domain includes at least one DNMT3A and at least one DNMT3L, and is connected by a connector sequence.
[0027] In some embodiments, the appearance modification structure domain includes DNMT3A and DNMT3L, and the C-terminal of DNMT3A is connected to the N-terminal of DNMT3L, or the C-terminal of DNMT3L is connected to the N-terminal of DNMT3A.
[0028] In some embodiments, the DNA methyltransferase comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-6.
[0029] In some embodiments, the transcriptional regulatory domain is a transcriptional repressor domain selected from: KRAB, ZIM3KRAB, ZNF680, ZNF554, ZNF264, ZNF582, ZNF324, ZNF669, ZNF354A, ZNF82, ZNF595, ZNF419, ZNF566, ZIM2, EHMT2, SUV39H1, ZFPM1, TRIM28, EZH2, MXD1, SID, LSD1, HP1a, HDAC3, ZNF436, ZNF257, ZNF675, ZNF490, ZNF320, ZNF331, ZNF816, ZNF41, ZNF189, ZNF528, ZNF543, ZNF140, ZNF610, ZNF350, ZNF8, ZNF30, ZNF98, ZNF6 77, ZNF596, ZNF214, ZNF37A, ZNF34, ZNF250, ZNF547, ZNF273, ZFP82, ZNF224, ZNF33A, ZNF4 5. ZNF175, ZNF184, ZFP28-1, ZFP28-2, ZNF18, ZNF213, ZNF394, ZFP1, ZFP14, ZNF416, ZNF557 , ZNF729, ZNF254, ZNF764, ZNF785, ZNF10, CBX5, RYBP, YAF2, MGA, CBX1, SCMH1, MPP8, SUMO3, HERC2, BIN1, PCGF2, TOX, FOXA1, FOXA2, IRF2BP1, IRF2BP2, IRF2BPLIRF-2BP1_2N-terminal domain, HOXA13, HOXB13, HOXC13, HOXA11, HOXC11, HOXC10, HOXA10, HOXB9, HOXA9, ZFP28, ZN334, ZN568, ZN37A, ZN181 , ZN510, ZN862, ZN140, ZN208, ZN248, ZN571, ZN699, ZN726, ZIK1, ZNF2, Z705F, ZNF14, ZN471, ZN624, ZNF84, ZNF7, ZN8 91, ZN337, Z705G, ZN529, ZN729, ZN419, Z705A, ZN302, ZN486, ZN621, ZN688, ZN33A, ZN554, ZN878, ZN772, ZN224, ZN18 4. ZN544, ZNF57, ZN283, ZN549, ZN211, ZN615, ZN253, ZN226, ZN730, Z585A, ZN732, ZN681, ZN667, ZN649, ZN470, ZN484,ZN431,ZN382,ZN254,ZN124,ZN607,ZN317,ZN620,ZN141,ZN584,ZN540,ZN75D,ZN555,ZN658,ZN684,RBAK,ZN829,ZN582,ZN112,ZN716,HKR1,ZN350,ZN480,ZN416,ZNF92,ZN100,ZN736,ZNF74,ZN443,ZN195,ZN530,ZN782,ZN791,ZN331,Z354C,ZN157,ZN727,ZN550,ZN793,ZN235,ZN724,ZN573,ZN577,ZN789,ZN718,ZN300,ZN383,ZN429,ZN677,ZN850,ZN454,ZN257,ZN264,ZN485,ZN737,ZNF44,ZN596,ZN565,ZN543,ZFP69,SUMO1,ZNF12,ZN169,ZN433,ZN175,ZN347,ZNF25,ZN519,Z585B,ZN517,ZN846,ZN230,ZNF66,ZN713,ZN816,ZN426,ZN674,ZN627,ZNF20,Z587B,ZN316,ZN233,ZN611,ZN556,ZN234,ZN560,ZNF77,ZN682,ZN614,ZN785,ZN445,ZFP30,ZN225,ZN551,ZN610,ZN528,ZN284,ZN418,ZN490,ZN805,Z780B,ZN763,ZN285,ZNF85,ZN223,ZNF90,ZN557,ZN425,ZN229,ZN606,ZN155,ZN222,ZN442,ZNF91,ZN135,ZN778,ZN534,ZN586,ZN567,ZN440,ZN583,ZN441,ZNF43,ZN589,ZN563,ZN561,ZN136,ZN630,ZN527,ZN333,Z324B,ZN786,ZN709,ZN792,ZN599,ZN613,ZF69B,ZN799,ZN569,ZN564,ZN546,ZFP92,ZN723,ZN439,ZFP57,ZNF19,ZN404,ZN274,CBX3,ZN250,ZN570,ZN675,ZN695,ZN548,ZN132,ZN738,ZN420,ZN626,ZN559,ZN460,ZN268,ZN304,ZN605,ZN844,SUMO5,ZN101,ZN783,ZN417,ZN182,ZN823,ZN177,ZN197,ZN717,ZN669,ZN256,ZN251,CBX4,CDY2,CDYL2,ZN562,ZN461,Z324A,ZN766,ID2,ZN214,CBX7,ID1,CREM,SCX,ASCL1,ZN764,SCML2,TWST1,CREB1,TERF1,ID3,CBX8,GSX1,NKX22,ATF1,TWST2,ZNF17,TOX3,TOX4,ZMYM3,I2BP1,RHXF1,SSX2,I2BPL,ZN680,TRI68,HXA13,PHC3,TCF24,HXB13,HEY1,PHC2,ZNF81,FIGLA,SAM11,KMT2B,HEY2,JDP2,HXC13,ASCL4,HHEX,GSX2,ETV7,ASCL3,PHC1,OTP,I2BP2,VGLL2,HXA11,PDLI4,ASCL2,CDX4,ZN860,LMBL4,PDIP3,NKX25,CEBPB,ISL1,CDX2,PROP1,SIN3B,SMBT1,HXC11,HXC10,PRS6A,VSX1,NKX23,MTG16,HMX3,HMX1,KIF22,CSTF2,CEBPE,DLX2,PPARG,PRIC1,UNC4,BARX2,ALX3,TCF15,TERA,VSX2,HXD12,CDX1,TCF23,ALX1,HXA10,RX,CXXC5,SCML1,NFIL3,DLX6,MTG8,CEBPD,SEC13,FIP1,ALX4,LHX3,PRIC2,MAGI3,NELL1,PRRX1,MTG8R,RAX2,DLX3,DLX1,NKX26,NAB1,SAMD7,PITX3,WDR5,MEOX2,NAB2,DHX8,CBX6,EMX2,CPSF6,HXC12,KDM4B,LMBL3,PHX2A,EMX1,NC2B,DLX4,SRY,ZN777,ZN398,GATA3,BSH,SF3B4,TEAD1,TEAD3,RGAP1,PHF1,GATA2,FOXO3,ZN212,IRX4,ZBED6,LHX4,SIN3A,RBBP7,NKX61,R51A1,MB3L1,DLX5,NOTC1,TERF2,ZN282,RGS12,ZN840,SPI2B,PAX7,NKX62,ASXL2,FOXO1,GATA1,ZMYM5,LRP1,MIXL1,SGT1,LMCD1,CEBPA, SOX14, WTIP, PRP19, NKX11, RBBP4, DMRT2, SMCA2, and their functionally active fragments.
[0030] In some embodiments, the transcriptional repressor domain comprises the amino acid sequence shown in any one of SEQ ID NOs: 7-36.
[0031] In some embodiments, the transcriptional repressor domain comprises a zinc finger protein-based transcription factor or a functionally active fragment thereof.
[0032] In some embodiments, the zinc finger protein-based transcription factor is a Krüppel-associated repressor (KRAB) or a KRAB domain derived from ZIM3 (ZIM3 KRAB).
[0033] In some embodiments, the transcriptional regulatory domain comprises two or more zinc finger-based transcription factors or their functionally active fragments, wherein the two or more zinc finger-based transcription factors are of the same or different types and are connected by a linker sequence.
[0034] In some embodiments, the connector sequence is an XTEN connector sequence.
[0035] In some embodiments, the transcriptional repressor domain includes a histone modification domain.
[0036] In some embodiments, the histone modification domain is selected from: EZH2, HDAC3, HDAC1, EHMT2(G9A), PRMT1, PRMT5, SETDB1, hSIRT1, HP1a, LSD1, and their functionally active fragments.
[0037] In some embodiments, the histone modification domain comprises the amino acid sequence shown in any one of SEQ ID NO: 21-36.
[0038] In some embodiments, the epigenetic pharmaceutical ingredient comprises a fusion peptide in which the at least one DNA-binding domain, the at least one epigenetic modification domain, and the at least one transcriptional regulatory domain are directly or indirectly linked.
[0039] In some embodiments, the epigenetic modification domain and the transcriptional regulatory domain are both located at the N-terminus or C-terminus of the DNA-binding domain.
[0040] In some embodiments, the epigenetic modification domain and the transcriptional regulatory domain are located at the N-terminus and C-terminus of the DNA-binding domain, respectively.
[0041] In some embodiments, the fusion peptide is sequentially connected from the N-terminus to the C-terminus to: 1) the epigenetic modification domain, the transcriptional regulatory domain, and the DNA-binding domain; or 2) the transcriptional regulatory domain, the epigenetic modification domain, and the DNA-binding domain; or 3) the DNA-binding domain, the epigenetic modification domain, and the transcriptional regulatory domain; or 4) the DNA-binding domain, the transcriptional regulatory domain, and the epigenetic modification domain; or 5) the epigenetic modification domain, the DNA-binding domain, and the transcriptional regulatory domain; or 6) the transcriptional regulatory domain, the DNA-binding domain, and the epigenetic modification domain.
[0042] In some embodiments, the fusion peptide is sequentially linked from the N-terminus to the C-terminus to: 1) one or a combination of DNMT3A and DNMT3L, one or more zinc finger protein-based transcription factor or histone modification domains, and a dCas9 or TALE domain; or 2) one or more zinc finger protein-based transcription factor or histone modification domains, one or a combination of DNMT3A and DNMT3L, and a dCas9 or TALE domain; or 3) a dCas9 or TALE domain, one or a combination of DNMT3A and DNMT3L, and one or more zinc finger protein-based transcription factor or histone modification domains. The transcription factor or histone modification domain; or 4) the dCas9 or TALE domain, one or more zinc finger protein-based transcription factor or histone modification domains, and one or a combination of DNMT3A and DNMT3L; or 5) one or a combination of DNMT3A and DNMT3L, the dCas9 or TALE domain, and one or more zinc finger protein-based transcription factor or histone modification domains; or 6) one or more zinc finger protein-based transcription factor or histone modification domains, the dCas9 or TALE domain, and one or a combination of DNMT3A and DNMT3L.
[0043] In some embodiments, the fusion peptide comprises the following domains: dCas9 or TALE-DNMT3A-DNMT3L-ZIM3 KRAB; dCas9 or TALE-ZIM3 KRAB-DNMT3L-DNMT3A; dCas9 or TALE-ZIM3 KRAB-DNMT3A-DNMT3L; ZIM3 KRAB-DNMT3A-DNMT3L-dCas9 or TALE; DNMT3A-DNMT3L-ZIM3 KRAB-dCas9 or TALE; DNMT3A-DNMT3L-ZNF324-dCas9 or TALE; DNMT3A-DNMT3L-ZNF419-dCas9 or TALE; DNMT3A-DNMT3L-dCas9 or TALE -EZH2;DNMT3A-DNMT3L-dCas9 or TALE-HDAC3;DNMT3A-DNMT3L-dCas9 or TALE-HP1a;DNMT3A-DNMT3L-dCas9 or TALE-HDAC1;DNMT3A -DNMT3L-dCas9 or TALE-PRMT1; DNMT3A-DNMT3L-dCas9 or TALE-SETDB1; DNMT3A-DNMT3L-dCas9 or TALE-hSIRT1; DNMT3A-DNMT3L-dCas9 or TALE-PRMT5; DNMT3A-DNMT3L-dCas9 or TALE-G9A; DNMT3A-DNMT3L-dCas9 or TALE-KRAB; DNMT3A-DNMT3L-dCas9 or TALE-ZIM3 KRAB, wherein - indicates that the structural domains of the fusion are directly and / or indirectly connected, and the structural domains are arranged in order from the N end to the C end.
[0044] Table 1. Example sequences of fusion peptides
[0045] In some embodiments, the epigenetic pharmaceutical ingredient comprises a complex peptide characterized by: 1) the at least one DNA-binding domain, the at least one epigenetic domain, and at least one recruitment domain A being directly or indirectly linked to form a first fusion, and the at least one transcriptional regulatory domain being directly or indirectly linked to at least one recruitment domain A' to form a second fusion; or 2) the at least one DNA-binding domain, the at least one transcriptional regulatory domain, and at least one recruitment domain A being directly or indirectly linked to form a first fusion, and the at least one epigenetic domain being directly or indirectly linked to at least one recruitment domain A' to form a second fusion; and the recruitment domain A and the recruitment domain A' are capable of interacting such that a fusion of one of the first fusion and the second fusion, or a portion thereof, can be recruited to the vicinity of the other fusion.
[0046] In some embodiments, the first fusion comprises, from the N-terminus to the C-terminus, the following in sequence: 1) an epigenetic modification domain, a DNA-binding domain, and a recruitment domain A; or 2) an epigenetic modification domain, a recruitment domain A, and a DNA-binding domain; or 3) a DNA-binding domain, a recruitment domain A, and an epigenetic modification domain; or 4) a DNA-binding domain, an epigenetic modification domain, and a recruitment domain A; or 5) a recruitment domain A, an epigenetic modification domain, and a DNA-binding domain; or 6) a recruitment domain A, a DNA-binding domain, and an epigenetic modification domain.
[0047] In some embodiments, the second fusion comprises a transcriptional repressor domain and a recruitment domain A' from the N-terminus to the C-terminus, or a recruitment domain A' and a transcriptional repressor domain from the N-terminus to the C-terminus.
[0048] In some embodiments, the first fusion comprises, from the N-terminus to the C-terminus, the following in sequence: 1) a recruitment domain A, a DNA-binding domain, and a transcriptional repressor domain; or 2) a recruitment domain A, a transcriptional repressor domain, and a DNA-binding domain; or 3) a DNA-binding domain, a recruitment domain A, and a transcriptional repressor domain; or 4) a DNA-binding domain, a transcriptional repressor domain, and a recruitment domain A; or 5) a transcriptional repressor domain, a DNA-binding domain, and a recruitment domain A; or 6) a transcriptional repressor domain, a recruitment domain A, and a DNA-binding domain.
[0049] In some embodiments, the second fusion comprises, from the N-end to the C-end, an appearance modification domain and a recruitment domain A', or from the N-end to the C-end, a recruitment domain A' and an appearance modification domain.
[0050] In some embodiments, the complex peptide comprises the following features: 1) the first fusion compound comprises, from N-terminus to C-terminus, an epigenetic modification domain, a DNA-binding domain, and a recruitment domain A, and the second fusion compound comprises, from N-terminus to C-terminus, a transcriptional repressor domain and a recruitment domain A'; or 2) the first fusion compound comprises, from N-terminus to C-terminus, an epigenetic modification domain, a DNA-binding domain, and a recruitment domain A, and the second fusion compound comprises, from N-terminus to C-terminus, a recruitment domain A' and a transcriptional repressor domain; or 3) the first fusion compound comprises, from N-terminus to C-terminus, a recruitment domain A, a DNA-binding domain, and a transcriptional repressor domain, and the second fusion compound comprises, from N-terminus to C-terminus, an epigenetic modification domain and a recruitment domain A'; or 4) the first fusion compound comprises, from N-terminus to C-terminus, a recruitment domain A, a DNA-binding domain, and a transcriptional repressor domain A, and the second fusion compound comprises, from N-terminus to C-terminus, an epigenetic modification domain and a recruitment domain A'; or 5) the first fusion compound comprises, from N-terminus to C-terminus, a recruitment domain A, a DNA-binding domain A, a DNA-binding domain A', a transcriptional repressor domain A', a recruitment domain A', a DNA-binding ... The first fusion comprises a DNA-binding domain and a transcriptional repressor domain, and the second fusion comprises a recruitment domain A' and an epigenetic modification domain from the N-terminus to the C-terminus; or 5) the first fusion comprises an epigenetic modification domain, a recruitment domain A, and a DNA-binding domain from the N-terminus to the C-terminus, and the second fusion comprises a recruitment domain A' and a transcriptional repressor domain from the N-terminus to the C-terminus; or 6) the first fusion comprises a DNA-binding domain, an epigenetic modification domain, and a recruitment domain A from the N-terminus to the C-terminus, and the second fusion comprises a recruitment domain A' and a transcriptional repressor domain from the N-terminus to the C-terminus; or 7) the first fusion comprises a DNA-binding domain, a recruitment domain A, and an epigenetic modification domain from the N-terminus to the C-terminus, and the second fusion comprises a recruitment domain A' and a transcriptional repressor domain from the N-terminus to the C-terminus.
[0051] In some embodiments, the recruitment domain A is selected from one of two groups of domains, and the recruitment domain A' is selected from the other of two groups of domains: 1) universal control non-derepressor protein 4 (GCN4), a GFP11 fragment derived from split green fluorescent protein (GFP), or a GVKESLV polypeptide; and 2) a single-chain antibody (scFv), a GFP1-10 fragment derived from split green fluorescent protein (GFP), or a PDZ protein domain.
[0052] In some embodiments, the complex peptide comprises the following features: 1) one of the recruitment domains A and A' is a GCN4 domain and the other is an scFv domain; or 2) one of the recruitment domains A and A' is a GFP11 fragment and the other is a GFP1-10 domain; or 3) one of the recruitment domains A and A' is a GVKESLV domain and the other is a PDZ protein domain.
[0053] In some embodiments, the complex peptide comprises the following features: 1) one of the first fusion compound and the second fusion compound comprises DNMT(3A-3L)-dCas9 or TALE-n×GCN4, and the other fusion compound comprises a transcriptional repressor domain -scFv; or 2) one of the first fusion compound and the second fusion compound comprises DNMT(3A-3L)-dCas9 or TALE-scFv, and the other fusion compound comprises a transcriptional repressor domain -GCN4; or 3) one of the first fusion compound and the second fusion compound comprises DNMT(3A-3L)-dCas9 or TALE-n×GCN4. P11, and another fusion thereof contains a transcriptional repressor domain -GFP1-10; or 4) a fusion of one of the first fusion and the second fusion comprises DNMT(3A-3L)-dCas9 or TALE-GFP1-10, and another fusion thereof contains a transcriptional repressor domain -GFP11; or 5) a fusion of one of the first fusion and the second fusion comprises DNMT(3A-3L)-dCas9 or TALE-n×GCN4, and another fusion thereof contains a scFv-transcriptional repressor domain; or 6) a fusion of one of the first fusion and the second fusion comprises DNMT(3A-3L)-dCas9 or TALE-n×GCN4, and another fusion thereof contains a scFv-transcriptional repressor domain; The first fusion and the second fusion contain either DNMT(3A-3L)-dCas9 or TALE-scFv, and the other fusion contains a GCN4-transcriptional repressor domain; or 7) the fusion of one of the first and second fusions contains DNMT(3A-3L)-dCas9 or TALE-n×GFP11, and the other fusion contains a GFP1-10-transcriptional repressor domain; or 8) the fusion of one of the first and second fusions contains DNMT(3A-3L)-dCas9 or TALE-n×GFP10, and the other fusion contains a GFP11-transcriptional repressor domain; or 9) the fusion of the first and second fusions contains DNMT(3A-3L)-dCas9 or TALE-n×GFP10, and the other fusion contains a GFP11-transcriptional repressor domain; or 9) the fusion of the first and second fusions contains DNMT(3A-3L)-dCas9 or TALE-n×GFP10, and the other fusion contains a GFP11-transcriptional repressor domain. One of the fusions contains an n×GCN4-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-scFv; or 10) one of the first fusions and the second fusion contains an scFv-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GCN4; or 11) one of the first fusions and the second fusion contains an n×GFP11-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GFP1-10;Or 12) One of the first fusion and the second fusion contains a GFP1-10-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GFP11; or 13) One of the first fusion and the second fusion contains an n×GCN4-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains scFv-DNMT(3A-3L); or 14) One of the first fusion and the second fusion contains scFv -dCas9 or TALE-transcriptional repressor domain, and the other fusion contains GCN4-DNMT(3A-3L); or 15) a fusion of one of the first and second fusions contains an n×GFP11-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains GFP1-10-DNMT(3A-3L); or 16) a fusion of one of the first and second fusions contains an n×GFP11-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains GCN4-DNMT(3A-3L). Containing GFP11-DNMT(3A-3L); or 17) one of the first fusion and the second fusion contains an scFv-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-n×GCN4-dCas9 or TALE; or 18) one of the first fusion and the second fusion contains an scFv-transcriptional repressor domain, and the other fusion contains dCas9 or TALE-DNMT(3A-3L)-n×GCN4; or 19) the first fusion and the second fusion contain GFP11-DNMT(3A-3L)-n×GCN4. One of the fusions contains an scFv-transcriptional repressor domain, and the other fusion contains either dCas9 or TALE-n×GCN4-DNMT(3A-3L); where DNMT(3A-3L) indicates that DNMT3A and DNMT3L are directly or indirectly linked in any order, and the hyphens (-) indicate that the domains at both ends are directly or indirectly linked in order from the N-terminus to the C-terminus; n×GCN4 or n×GFP11 represents n copies of GCN4 linked by adapter sequences or n copies of GFP11 linked by adapter sequences, respectively, where n is an integer selected from 1 to 20.
[0054] In some embodiments, the fusion peptide or complex peptide further comprises a nuclear localization signal and / or a marker domain.
[0055] The structure of the appearance-modified pharmaceutical ingredient provided in this application may also be selected from (but is not limited to) the fusion peptides or complex peptides involved in patent application publication numbers WO2024 / 131917A1, TW202440930A1, WO2024 / 131940A1, TW202440931A, WO2023 / 165597A1 and their family applications AU2023228989A1, TW202346588A, WO2019204766A1 and WO2022140577A2 (two patent families of Chroma). (The terms such as "nucleic acid binding domain", "DNA binding domain", "CasN", "dCas9", "DNA binding domain", "nuclease-deficient RNA-guided DNA endonuclease enzyme", etc., contained therein can be replaced with those contained in this application, including SEQ ID.) The disclosure of the above-mentioned patent applications (including the DNA-binding domain of the amino acid sequence described in any one of NO: 1702-3338 and 3359-8269 or other dCas (inactivating Cas enzyme) sequences) is hereby incorporated by reference.
[0056] In some embodiments, the epigenetic pharmaceutical ingredient is capable of providing modification of at least one nucleotide in the vicinity of the HBV gene and / or within the HBV gene regulatory element.
[0057] In some embodiments, the small nucleic acid drug component is selected from one or more of antisense oligonucleotides (ASO), small interfering RNA (siRNA), microRNA (miRNA), small activating RNA (saRNA), messenger RNA (mRNA), and RNA aptamers.
[0058] In some embodiments, the small nucleic acid drug component targets HBV mRNA.
[0059] In some embodiments, the small nucleic acid drug ingredient comprises an ASO. For example, the ASO comprises the nucleotide sequence shown in SEQ ID NO: 9439.
[0060] In some embodiments, the sequence of the ASO includes the following modification: (MOE-G)s(5-Me-MOE-C)s(MOE-A)s(MOE-G)s(MOE-A)sGsGsTsGsAsAsGs(5-Me-C)sGsAs(MOE-A)s(MOE-G)s(MOE-T)s(MOE-G)s(5-Me-MOE-C), where A, C, T, and G represent adenine, cytosine, thymine, and guanine, respectively; 5-Me represents 5-methylcytosine modification; MOE represents 2'-O-2-methoxyethyl modification; and s represents thiophosphorylation modification on the nucleotide backbone. The small nucleic acid pharmaceutical component of the pharmaceutical composition described in this application may also be replaced by all antisense oligonucleotide (ASO) compounds or ASO compositions involved in patent number WO2012145697, the disclosure of which is hereby incorporated by reference.
[0061] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
[0062] On the other hand, this application provides a method for regulating the expression of hepatitis B virus (HBV) gene products in cells, the method comprising introducing the pharmaceutical composition described in this application into cells containing the HBV gene.
[0063] In some embodiments, the method includes contacting the pharmaceutical composition with the HBV gene and / or the HBV gene regulatory element within the cells.
[0064] In some embodiments, the regulatory element includes a core promoter, a proximal promoter, a distal enhancer, a silencer, an insulator element, a boundary element, and / or a locus control region.
[0065] On the other hand, this application provides a method for treating or alleviating a disease or condition associated with hepatitis B virus (HBV) infection, the method comprising administering an effective amount of the pharmaceutical composition described in this application to a subject in need.
[0066] In some embodiments, the epigenetic drug component and the small nucleic acid drug component of the pharmaceutical composition are introduced into the cells or administered to the subject via a common or separate carrier.
[0067] In some embodiments, the epidermal modification drug component and the small nucleic acid drug component of the pharmaceutical composition are each administered to the subject via the same or different routes of administration.
[0068] In some embodiments, the epigenetic drug component and the small nucleic acid drug component of the pharmaceutical composition are sequentially introduced into the cells or administered to the subject at the same time or within a specific time interval. In some embodiments, the epigenetic drug component and the small nucleic acid drug component are administered on day 0, followed by administration of the small nucleic acid drug component every 7 days thereafter.
[0069] In some embodiments, the carrier is a liposome or lipid nanoparticle (LNP).
[0070] In some embodiments, the liposomes or the lipid nanoparticles comprise ionizable lipids (20%-70% molar ratio), polyethylene glycol-modified lipids (0%-30% molar ratio), supporting lipids (30%-50% molar ratio), and cholesterol (10%-50% molar ratio).
[0071] In some embodiments, the ionizable lipid is selected from pH-responsive ionizable lipids, thermoresponsive ionizable lipids, and light-responsive ionizable lipids.
[0072] In some embodiments, the vector is an adeno-associated virus (AAV) vector.
[0073] In some embodiments, the disease or condition associated with hepatitis B virus (HBV) infection includes hepatitis, cirrhosis, liver fibrosis, and hepatocellular carcinoma caused by HBV infection.
[0074] On the other hand, this application provides the use of the composition described herein for the preparation of a medicament for the treatment or relief of a disease or condition associated with hepatitis B virus (HBV) infection. Attached Figure Description
[0075] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:
[0076] Figure 1 shows the knockdown effect of the combination of the epigenetic modification drug EPIREG and antisense nucleic acid (ASO) provided in this application on HBV markers in transgenic HBV mice (the content of HBV markers is logarithmic with base 10). Detailed Implementation
[0077] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.
[0078] Terminology Definition
[0079] In this application, the term "fusion peptide" generally refers to a bipartite molecule consisting of at least two parts, such as in this application, which comprises at least one DNA-binding protein and at least one gene expression regulator described in this application coupled together to form a single entity. For example, the at least one gene expression regulator may be fused to the at least one DNA-binding protein at any amino acid other than the N-terminal, C-terminal, or terminal amino acids, and other molecules or parts may also be fused to parts already included in the fusion molecule. The parts constituting the fusion molecule may be separated by a linker or may be directly coupled. In some embodiments, the fusion molecule is a fusion protein, which may be a chimeric protein produced by directly or indirectly covalently or nonvalently linking two or more genes, which originally encode individual proteins. In some embodiments, translation of the fusion gene produces a single polypeptide having functional properties derived from each original protein. Those skilled in the art fully understand the optimal sequence and / or combination of assays used to determine the parts in the fusion molecule of this application.
[0080] In this application, the terms “polynucleotide,” “nucleotide,” “nucleotide sequence,” “nucleic acid,” and “oligonucleotide” are used interchangeably. They generally refer to a polymeric form of nucleotides of any length, which is a deoxyribonucleotide or ribonucleotide, or an analogue thereof. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, multiple loci (one locus) as defined by ligation analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogues. If present, the nucleotide structure may be modified before or after polymer assembly. The sequence of the nucleotide may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, such as by conjugation with labeled components.
[0081] In this application, the terms "sequence encoding..." or "nucleic acid encoding..." generally refer to a nucleic acid (RNA or DNA molecule) containing a nucleotide sequence encoding a protein. The coding sequence may also include start and stop signals operatively linked to regulatory elements comprising promoters and polyadenylation signals capable of directing expression in the cells of an individual or mammal to which the nucleic acid has been administered. Codon optimization of the coding sequence is possible.
[0082] In this application, the term "epiota modification domain" generally refers to a domain capable of altering gene expression or cell phenotype in a cell population upon administration. It is understood that such alteration refers to one or more function-related modifications to the genome without involving changes to the nucleic acid sequence. Examples of such modifications are DNA methylation and histone modifications, both of which are important for the regulation of gene expression without altering the basic DNA sequence.
[0083] In this application, the term "DNA-binding domain" generally refers to a folded protein domain containing at least one motif that recognizes double-stranded or single-stranded DNA. For example, the DNA-binding domain may recognize a specific DNA sequence (recognition or regulatory sequence) or have general affinity for DNA. In some cases, other domains of the DNA-binding protein typically modulate the activity of the DNA-binding domain; the DNA-binding function may be structural or include transcriptional regulation, and sometimes these two functions overlap. In some embodiments of the methods and compositions provided in this application, the DNA-binding protein may comprise a (DNA) nuclease, such as a nuclease capable of targeting DNA in a sequence-specific manner or capable of being directed or instructed to target DNA in a sequence-specific manner, such as the CRISPR-Cas system, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or a broad range of nucleases. In some embodiments, the DNA-binding protein is a DNA nuclease derived from the CRISPR-Cas system. For example, the CRISPR-Cas-derived DNA nuclease is a Cas protein.
[0084] In this application, the term "Cas protein" is used interchangeably with "CRISPR protein," "CRISPR enzyme," "CRISPR-Cas protein," "CRISPR-Cas enzyme," "Cas," "CRISPR effector," or "Cas effector protein," and is a component of the CRISPR-Cas system. A Cas protein (e.g., an engineered Cas protein) may have substantially the same nuclease activity as its wild-type counterpart (e.g., between 80% and 100%, between 90% and 100%, between 95% and 100%, between 98% and 100%, between 99% and 100%, between 99.9% and 100%, or about 100%). In some cases, an engineered Cas protein has higher nuclease activity than its wild-type counterpart (e.g., at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%). Optionally or additionally, the Cas protein (e.g., an engineered Cas protein) may have a specificity that is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% higher than the wild-type corresponding Cas protein. In specific instances, the Cas protein (e.g., an engineered Cas protein) has a specificity that is at least 30% higher than the wild-type corresponding Cas protein. As used herein, the term “specificity” for Cas may correspond to the number or percentage of on-target polynucleotide cleavage events relative to all polynucleotide cleavage events (including on-target and off-target events). The activity and specificity of the Cas protein are consistent with those described in the following literature: Hsu PD et al., DNA targeting specificity of RNA-guided Cas9 nucleases, Nat Biotechnol. Sep 2013; 31(9): 827-832 and Slaymaker IM et al., Rationally engineered Cas9 nucleases with improved specificity, Science. Jan 1 2016; 351(6268): 84-88. Examples of methods for detecting the activity and specificity of the Cas protein are also described in this paper by reference in their entirety.
[0085] Codon optimization can be performed on nucleic acid molecules encoding Cas. Examples of codon-optimized sequences in this context are sequences optimized for expression in eukaryotes (e.g., humans) or for expression in humans, or sequences optimized for another eukaryote such as the animals or mammals discussed herein; see, for example, the SaCas9 human codon-optimized sequence in WO 2014 / 093622 (PCT / US2013 / 074667). While this is preferred, it should be understood that other examples are possible, and codon optimization for host species other than humans or for specific organs is known. In some embodiments, the enzyme-coding sequence encoding Cas is codon-optimized for expression in specific cells such as eukaryotic cells. Eukaryotic cells can be cells of a specific organism (such as mammals, including but not limited to humans or non-human eukaryotes or the animals or mammals described herein, such as mice, rats, rabbits, dogs, livestock, or non-human mammals or primates) or cells derived from a specific organism. In some implementations, methods for altering human germline genetic traits and / or methods for altering animal genetic traits (which may cause them suffering without any substantial medical benefit to humans or animals), and animals produced by such methods, may be excluded. Generally, codon optimization refers to the process of modifying a nucleic acid sequence to enhance expression in a target host cell by replacing at least one codon of the natural sequence with codons that are more frequently or most frequently used in the genes of that host cell (e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons), while maintaining the natural amino acid sequence. Different species exhibit specific biases toward specific codons of specific amino acids. Codon bias (differences in codon use between organisms) is generally associated with the translation efficiency of messenger RNA (mRNA), which is thought to depend, among other things, on the nature of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The dominance of selected tRNAs in a cell generally reflects the most frequently used codons in peptide synthesis. Therefore, genes can be customized for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available in "codon usage databases" such as www.kazusa.orjp / codon / , and these tables can be modified in various ways. See Nakamura, et al., "Codon usage tabulated from the international DNA sequence databases: status for the year 2000," Nucl. Acids Res. 28: 292 (2000).Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, such as Gene Forge (Appagen; Jacobus, PA). In some implementations, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more, or all codons) in the sequence encoding Cas correspond to the most frequently used codon for a specific amino acid.
[0086] In some embodiments, the Cas protein may have nucleic acid cleavage activity. The Cas protein may have RNA binding and DNA cleavage functions. In some embodiments, Cas may direct the cleavage of one or two nucleic acid strands at or near a target sequence location, such as within the target sequence and / or within the complementary sequence of the target sequence or at a sequence associated with the target sequence, for example, within approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500 or more base pairs from the first or last nucleotide of the target sequence. In some embodiments, the Cas protein can direct more than one cleavage (e.g., one, two, three, four, five, or more cleavages) of one or both strands within the target sequence and / or its complementary sequence or a sequence associated with the target sequence and / or approximately one, two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty, twenty, twenty, five, five, or more base pairs from the first or last nucleotide of the target sequence. In some embodiments, the cleavage can be blunt-ended, i.e., producing blunt ends. In some embodiments, the cleavage can be staggered, i.e., producing sticky ends.
[0087] In some embodiments, the vector encodes a Cas protein targeting a nucleic acid, which may be mutated relative to the corresponding wild-type enzyme such that the mutated Cas protein targeting the nucleic acid lacks the ability to cleave one or both strands of a target polynucleotide containing the target sequence. For example, an alteration or mutation in the HNH domain produces a mutated Cas protein that substantially lacks all DNA cleavage activity. For example, the DNA cleavage activity of the mutated enzyme is approximately 25%, 10%, 5%, 1%, 0.1%, 0.01%, or lower than the cleavage activity of the unmutated form of the enzyme; an example is when the cleavage activity of the mutated form is zero or negligible compared to the unmutated form.
[0088] In some embodiments, the Cas protein may form a component of an inducible system. The inducible nature of this system would allow for spatiotemporal control of gene editing or gene expression using a form of energy. The form of energy may include, but is not limited to, electromagnetic radiation, acoustic energy, chemical energy, and thermal energy. Examples of inducible systems include tetracycline-inducible promoters (Tet-On or Tet-Off), small two-hybrid transcriptional activation systems (FKBP, ABA, etc.), or photoinducible systems (phytochrome, LOV domain, or cryptochrome). In one embodiment, the CRISPR effector protein may be part of a photoinducible transcriptional effector (LITE) that directs changes in transcriptional activity in a sequence-specific manner. The light component may include the CRISPR effector protein, a light-responsive cytochrome heterodimer (e.g., from Arabidopsis thaliana), and a transcriptional activation / repression domain. Other examples of inducible DNA-binding proteins and methods of use thereof are provided in US 61 / 736465 and US 61 / 721,283, and WO 2014018423 A2 (which is hereby incorporated herein by reference in its entirety).
[0089] In some embodiments, the mutated Cas may have one or more mutations that reduce off-target effects, such as improved CRISPR enzymes (e.g., when complexed with guide RNA) for achieving modification of the target locus but reducing or eliminating off-target activity, and improved CRISPR enzymes (e.g., when complexed with guide RNA) for enhancing CRISPR enzyme activity. It should be understood that the mutated enzymes described below can be used in any method described herein as elsewhere in accordance with this application. Any methods, products, compositions, and uses described elsewhere herein are equally applicable to the mutated CRISPR enzymes further detailed below.
[0090] Methods and mutations applicable in various combinations to enhance or reduce the activity and / or specificity of the target nuclease compared to off-target activity, or to enhance or reduce the binding and / or specificity of the target binding compared to off-target binding, can be used to compensate for or enhance mutations or modifications made to promote other effects. Such mutations or modifications to promote other effects include mutations or modifications to Cas and / or mutations or modifications to the guide RNA. The methods and mutations of this application are used to regulate Cas nuclease activity and / or binding to chemically modified guide RNA.
[0091] In some embodiments, the catalytic activity of the Cas protein of this application is altered or modified. It should be understood that if the catalytic activity differs from that of the corresponding wild-type Cas protein (e.g., unmutated Cas protein), the mutated Cas has altered or modified catalytic activity. Catalytic activity can be determined by methods known in the art. For example, and not limited to, catalytic activity can be determined in vitro or in vivo by measuring the percentage of insertions / deletions (e.g., after a given time, or at a given dose). In some embodiments, catalytic activity is enhanced. In some embodiments, the catalytic activity is enhanced by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%. In some embodiments, catalytic activity is reduced. In some embodiments, the catalytic activity is reduced by at least 5%, preferably at least 10%, more preferably at least 20%, such as at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or (substantially) 100%. One or more mutations described herein can deactivate the catalytic activity, which can significantly reduce all catalytic activity, reducing the activity below detectable levels or to unmeasurable catalytic activity.
[0092] One or more characteristics of an engineered Cas protein may differ from those of the corresponding wild-type Cas protein. Examples of such characteristics include catalytic activity, gRNA binding, Cas protein specificity (e.g., editing to determine target specificity), Cas protein stability, off-target binding, target binding, protease activity, nickase activity, and PFS recognition. In some instances, the engineered Cas protein may contain one or more mutations of the corresponding wild-type Cas protein. In some embodiments, the engineered Cas protein exhibits enhanced catalytic activity compared to the corresponding wild-type Cas protein. In some embodiments, the engineered Cas protein exhibits decreased catalytic activity compared to the corresponding wild-type Cas protein. In some embodiments, the engineered Cas protein exhibits increased gRNA binding compared to the corresponding wild-type Cas protein. In some embodiments, the engineered Cas protein exhibits decreased gRNA binding compared to the corresponding wild-type Cas protein. In some embodiments, the Cas protein exhibits enhanced specificity compared to the corresponding wild-type Cas protein. In some embodiments, the Cas protein exhibits decreased specificity compared to the corresponding wild-type Cas protein. In some embodiments, the Cas protein exhibits enhanced stability compared to the corresponding wild-type Cas protein. In some embodiments, the Cas protein exhibits decreased stability compared to the corresponding wild-type Cas protein. In some embodiments, the engineered Cas protein further comprises one or more mutations that inactivate catalytic activity. In some embodiments, off-target binding of the Cas protein is increased compared to the corresponding wild-type Cas protein. In some embodiments, off-target binding of the Cas protein is decreased compared to the corresponding wild-type Cas protein. In some embodiments, target binding of the Cas protein is increased compared to the corresponding wild-type Cas protein. In some embodiments, target binding of the Cas protein is decreased compared to the corresponding wild-type Cas protein. In some embodiments, the engineered Cas protein has higher protease activity or polynucleotide binding capacity compared to the corresponding wild-type Cas protein. In some embodiments, PFS recognition is altered compared to the corresponding wild-type Cas protein.
[0093] Examples of Cas proteins include class I (e.g., types I, III, and IV) and class II (e.g., types II, V, and VI) Cas proteins, such as Cas9, Cas12 (e.g., Cas12a, Cas12b, Cas12c, Cas12d), Cas13 (e.g., Cas13a, Cas13b, Cas13c, Cas13d), CasX, CasY, Cas14, their variants (e.g., mutant forms, truncated forms), their homologs, and their orthologs. The terms "ortholog" and "homolog" are well known in the art. With further guidance, a "homolog" of a protein, as used herein, is a protein of the same species that performs the same or similar function as its homolog. Homologous proteins may be, but are not necessarily, structurally related, or only partially structurally related. An "ortholog" of a protein, as used herein, is a protein of a different species that performs the same or similar function as its ortholog. Orthologous proteins can be, but do not have to be, structurally related, or only partially structurally related.
[0094] In some embodiments, the Cas protein is a class 2 Cas protein, i.e., a Cas protein of a class 2 CRISPR-Cas system. Class 2 CRISPR-Cas systems may have subtypes, such as type II-A, type II-B, type II-C, type VA, type VB, type VC, or type VU. In some embodiments, the Cas protein is Cas9, Cas12a, Cas12b, Cas12c, or Cas12d. In some embodiments, Cas9 may be SpCas9, SaCas9, StCas9, and other Cas9 orthologs. Cas12 may be Cas12a, Cas12b, and Cas12c, including FnCas12a or its homologs or orthologs. The definition and exemplary members of CRISPR-Cas systems include those described in the following literature: Kira S. Makarova and Eugene V. Koonin, Annotation and Classification of CRISPR-Cas systems, Methods Mol Biol. 2015; 1311: 47-75 and Sergey Shmakov et al., Diversity and evolution of class 2 CRISPR-Cas systems, Nat Rev Microbial. 2017 Mar; 15(3): 169-182.
[0095] In some instances, Cas proteins contain at least one RuvC domain and at least one HNH domain. Cas proteins may also contain first and second adapter domains connecting the RuvC domain to the HNH domain. The first adapter (L1) and second adapter (L2) connecting the HNH domain to the RuvC domain in Cas9 are described in Nishimasu, H. et al., “Crystal structure of Cas9 in complex with guide RNA and target RNA”, Cell 156 (February 27, 2014, 2014): 935-949, and Ribeiro, L. et al. (2018), “Protein engineering strategies to expand CRISPR-Cas9 applications”, International Journal of Genomics Volume 2018, Article ID 1652567 (doi.org / 10.1155 / 2018 / 1652567). Figure 1 of Ribeiro's work shows the overall organization, structure, and function of Cas9, which is incorporated herein by reference. Specifically, Figure 1A by Ribeiro shows a schematic diagram of the domain organization of SpCas9, illustrating the genetic structure of the HNH and RuvC domains, including the linker L1 (spanning amino acids 765-780) and L2 (spanning amino acids 906-918) as described herein. Similarly, when referring to the first and second linker domains, the domain organization of Staphylococcus aureus Cas9 (SaCas9) can be utilized. In one embodiment, the linker 1 domain region spans residues 481-519 and connects the RuvC-II domain to the HNH domain in SaCas9. In some embodiments, the linker 2 region spans residues 629-649 and connects the RuvC-III domain of SaCas9 to the HNH domain. Therefore, the first and / or second linker domains can be mutated in Cas9 orthologs, and amino acid residues corresponding to wild-type SaCas9 can be referenced. See Nishimasu, Cell. 27 Aug 2015; 162(5): 1113-1126; doi: 10.1016 / j.cell.2015.08.007, which is incorporated herein by reference. In particular, Figure 1, Nishimasu’s S1-S3, details the domain organization of the Cas9 protein, the teachings of which are incorporated herein by reference.The first and second adapters may contain about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 or more amino acids. The first and second adapters may correspond to the wild-type adapter. In some aspects, the first and second adapters may contain one or more mutations in the first and / or second adapter. In one aspect, the first and / or second adapter contains one or more mutations that enhance Cas9 protein specificity. In some embodiments, the adapters L1 and L2 linking the HNH domain of Cas9 to the RuvC domain contain wild-type amino acid sequences. In some embodiments, the linker connecting the HNH and RuvC domains contains a mutation in one or more amino acids. In one embodiment, the first linker (L1) contains a mutation corresponding to the amino acid T769I of SpCas9, and / or the second linker (L2) contains a mutation corresponding to the amino acid G915M of SpCas9. In one embodiment, one or more linker mutations, such as T769I and G915M, confer enhanced specificity to the Cas9 protein. In one embodiment, as described herein, one or more mutations in the first and second linkers can be combined with one or more mutations in other parts of the Cas9 protein to further enhance specificity and / or maintain substantially equivalent activity to the wild-type Cas9 protein. In one embodiment, mutations in the linkers and / or additional mutations in the Cas protein can be identified using methods detailed herein, which enhance / improve specificity for wild-type Cas9 and substantially preserve its wild-type activity.
[0096] In some embodiments, the Cas protein may be a Cas protein of a type II CRISPR-Cas system (a type II Cas protein). In some embodiments, the Cas protein may be a type II Cas protein, such as Cas9. In some embodiments, a CRISPR / Cas9-based system may include a Cas9 protein or a fragment thereof, a Cas9 fusion protein, a nucleic acid encoding a Cas9 protein or a fragment thereof, or a nucleic acid encoding a Cas9 fusion protein. "Cas9 (CRISPR-associated protein 9)" refers to a polypeptide or fragment thereof having at least about 85% amino acid identity with NCBI accession number NP_269215 and possessing RNA-binding activity, DNA-binding activity, and / or DNA-cutting activity (e.g., endonuclease or nickase activity). The function of Cas9 can be defined by any of a variety of assays, including but not limited to fluorescence polarization-based nucleic acid binding assays, fluorescence polarization-based chain invasion assays, transcription assays, EGFP destruction assays, DNA cleavage assays, and / or Surveyor assays. "Cas9 nucleic acid molecule" refers to a polynucleotide encoding a Cas9 polypeptide or a fragment thereof. An exemplary Cas9 nucleic acid sequence is provided under genome sequence number NC_002737. In some embodiments, inhibitors of Cas9, such as naturally occurring Cas9 or variants thereof in *Streptococcus pyogenes* (SpCas9) or *Staphylococcus aureus* (SaCas9), are disclosed herein. Cas9 recognizes exogenous DNA by base pairing of the protospacer adjacent motif (PAM) sequence and guide RNA (gRNA) with the target DNA. The relative ease with which Cas9 induces target strand breaks at any genomic locus enables efficient genome editing across a wide range of cell types and organisms. Cas9 derivatives can also be used as transcriptional activators / repressors.
[0097] In some cases, CRISPR-Cas proteins are Cas9 or variants thereof. In some instances, Cas9 can be wild-type Cas9, including any naturally occurring bacterial Cas9, or can be codon-optimized or modified forms, including any chimera, mutant, homolog, or ortholog. In another aspect of this application, the Cas9 enzyme may contain one or more mutations and can be used as a universal DNA-binding protein fused with or without a functional domain. The mutation can be artificially introduced or a gain-of-function or loss-of-function mutation. Other aspects of this application relate to mutated Cas9 enzymes fused with domains, including but not limited to nucleases, transcriptional activators, transcriptional repressors, recombinases, transposases, histone remodelers, demethylases, DNA methyltransferases, cryptochromes, photoinducible / controllable domains, or chemically inducible / controllable domains. In some cases, the Cas9 enzyme may be derived from or derived from SpCas9 (Streptococcus pyogenes Cas9), saCas9 (Staphylococcus aureus Cas9), or StCas9 (wild-type Cas9 of Streptococcus thermophilus). As used herein, the term “derived” for enzymes means that a derived enzyme is largely based on the significance of having a high sequence homology with a wild-type enzyme, but has been mutated (modified) in some manner known in the art or described herein. In examples, mutations may include one or more mutations in the first linker domain, the second linker domain, and / or other parts of a protein. High sequence homology relative to the wild-type enzyme may include at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher.
[0098] In specific embodiments, the CRISPR enzyme may be a Cas9 protein derived from or originating from organisms including the following genera: Streptococcus, Campylobacter, Nitrifying Bacteria, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, and Lactobacillus. Genus (Lactobacillus), Genus (Eubacterium), Genus (Corynebactere), Genus (Carnobacterium), Genus (Rhodobacter), Genus (Listeria), Genus (Paludibacter), Genus (Clostridium), Family (Lachnospiraceae), Family (Clostridiaridium), Genus (Leptotrichia), Genus (Francisella), Genus (Legionella), Genus (Alic) yclobacillus), Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacterium *Bacillus*, *Methylobacterium*, or *Acidaminococcus*, *Streptococcus*, *Campylobacter*, *Nitrifying Bacteria*, *Staphylococcus*, *Parvibaculum*, *Rochetes*, *Neisseria*, *Gluconobacterium*, *Azotobacter*, *Squamous*, *Lactobacillus*, *Enterobes*, *Corynebacterium*, *Sutterella*, *Legionella*, *Treponema*, *Filifactor*, *Enterobes*, *Streptococcus*, *Lactobacillus*, *Mycoplasma*, *Bacteroides*Flaviivola, Flavobacterium, Lepidococcus, Azotobacter, Staphylococcus, Neisseria, Rochetomyces, Corynebacterium, Staphylococcus, Nitrifying Bacteria, Mycoplasma, or Campylobacter.
[0099] In some implementations, the CRISPR enzyme may be derived from or derived from Cas9 proteins of organisms including: *Streptococcus mutans*, *Streptococcus agalactiae*, *Streptococcus equisimilis*, *Streptococcus sanguinis*, *Streptococcus pneumoniae*, *Campylobacter jejuni*, *Escherichia coli*; *Bacillus thuringiensis*, *N. tergarcus*; *Staphylococcus auricularis*, *S. carnosus*; *Neisseria meningitidis*, *N. gonorrhoeae*, *Listeria monocytogenes*, *Listeria ivanovii*; *Clostridium botulinum*, *Clostridium difficile*, *Clostridium tetani*, or *Clostridium sordellii*, *Francisella tularensis*. The species include *Francisella tularensis* 1), *Francisella tularensis* subsp. novicida, *Prevotella albensis*, *Lachnospiraceae bacterium MC20171*, *Butyrivibrio proteoclasticus*, *Peregrinibacteria bacterium GW2011 GWA2_33_10*, *Parcubacteria bacterium GW2011 GWC2_44_17*, *Smithella* sp. SCADC, and *Acidaminococcus* sp. BV3L6.The following bacteria are listed: BV3L6, *Lachnospiraceae bacterium MA2020*, *Candidatus Methanoplasma termitum*, *Eubacterium eligens*, *Moraxella bovoculi 237*, *Leptospira inadai*, *Lachnospiraceae bacterium ND2006*, *Porphyromonas crevioricanis 3*, *Prevotella disiens*, and *Porphyromonas macacae*. In some embodiments, the Cas9 protein is derived from or derived from organisms containing *Streptococcus pyogenes*, *Staphylococcus aureus*, or *Streptococcus thermophilus* Cas9.
[0100] In a more preferred embodiment, the Cas9 protein is derived from a bacterial species selected from Streptococcus pyogenes, Staphylococcus aureus, or Streptococcus thermophilus Cas9. In some embodiments, Cas9 is derived from a bacterial species selected from *Streptococcus tularensis* 1, *Prevotella alberella*, *Tricholoma MC20171*, *Vibrio proteolyticus*, *Heterophytes* GW2011 GWA2 33 JO, *Pangolinella* GW2011 GWC2_44_17, *Smithia spp.* SCADC, *Acidococcus* spp. BV3L6BV3L6, *Tricholoma MA2020*, *Mycoplasma methanogens* candidate, *Eubacterium tumefaciens*, *Bacillus bovoi* 237237, *Leptospira oryzae*, *Spirulina* ND2006, *Porphyromonas brasiliensis* 3, *Prevotella glycolytica*, and *Porphyromonas macranthum*. In some embodiments, the Cas9 protein is derived from bacterial species selected from *Acidococcus* species BV3L6 and *Trichophyton* species MA2020. In some embodiments, the effector protein is derived from a subspecies of *Tulafrancsis* 1, including but not limited to *Tulafrancsis novicea*.
[0101] Cas9 proteins include, but are not limited to, Streptococcus pyogenes M1 serotype (UniProt ID: Q99ZW2), Staphylococcus aureus Cas9 (UniProt ID: J7RUA5), Eubacterium ventriosum Cas9 (UniProt ID: A5Z395), Azotobacter spp. (strain B510) Cas9 (UniProt ID: D3NT09), Staphylococcus diazotrophus (strain ATCC 49037) Cas9 (UniProt ID: A9HKP2), Neisseria griseus Cas9 (UniProt ID: D0W2Z9), Rosbyrates caspaenatum Cas9 (UniProt ID: C7G697), Corynebacterium glutamicum (strain DS-1) Cas9 (UniProt ID: A7HP89), and Brine nitrate lysate bacteria (strain DSM 16511) Cas9 (UniProt ID: Q99ZW2). (ID: E6WZS9), Campylobacter cas9 (UniProt ID: G1UFN3).
[0102] Enzymatic action of Cas9 derived from Streptococcus pyogenes or any closely related Cas9 produces a double-strand break at a target site sequence that hybridizes to 20 nucleotides of a guide sequence and is followed by a preintermediate sequence adjacent motif (PAM) sequence (examples include NGG / NRG, which can be determined as described herein). CRISPR activity for site-specific DNA recognition and cleavage via Cas9 is defined by the guide sequence, the tracr sequence that partially hybridizes to the guide sequence, and the PAM sequence. Further details of the CRISPR system are described in Karginov and Hannon, The CRISPR system: small RNA-guided defense in bacteria and archaea, Mole Cell, January 15, 2010; 37(1):7. A type II CRISPR locus from *Streptococcus pyogenes* SF370 comprises a cluster of four genes: Cas9, Cas1, Cas2, and Csn1, along with two non-coding RNA elements (tracrRNA) and a characteristic array of repetitive sequences (positive repeat sequences) separated by short segments (spacer regions, each approximately 30 bp) of non-repetitive sequences. In this system, targeted DNA double-strand breaks (DSBs) are generated in four consecutive steps. First, two non-coding RNAs (the precrRNA array and tracrRNA) are transcribed from the CRISPR locus. Second, the tracrRNA hybridizes with the positive repeat sequences of the precrRNA and is then processed into mature crRNA containing a single spacer region sequence. Third, the mature crRNA:tracrRNA complex forms a heteroduplex between the spacer region of the crRNA and the prespacer sequence DNA, directing Cas9 to a DNA target composed of the prespacer sequence and the corresponding PAM. Finally, Cas9 mediates the cleavage of the target DNA upstream of the PAM to generate a DSB within the original spacer region. In some implementations, Cas9 may be constitutively present, inducible, conditionally present, administered, or delivered. Cas9 optimization can be used to enhance function or develop new functions. Chimeric Cas9 proteins can be generated, and Cas9 can be used as a universal DNA-binding protein. The structural information provided for Cas9 can be used for further engineering and optimization of the CRISPR-Cas system, and this can also infer structure-function relationships in other CRISPR enzyme systems, particularly in other type II CRISPR enzymes or Cas9 orthologs. Furthermore, the Cas9 protein contains an easily identifiable C-terminal region homologous to the transposon ORF-B and includes an active RuvC-like nuclease (an arginine-rich region).
[0103] In this application, the term "TALE" refers to a polypeptide containing one or more TALE repeating domains / units. Naturally occurring TALEs, or "wild-type TALEs," are nucleic acid-binding proteins secreted by numerous species of Proteobacteria. TALE polypeptides contain a nucleic acid-binding domain consisting of tandem repeats of highly conserved monomeric polypeptides, which are primarily 33, 34, or 35 amino acids in length and differ primarily from each other at amino acid positions 12 and 13. In a preferred embodiment, the nucleic acid is DNA. As used herein, a polypeptide monomer of TALE is used to refer to a highly conserved repeating polypeptide sequence within the TALE nucleic acid-binding domain, and the terms "repeated variable diresidue" or "RVD" are used to refer to a highly variable amino acid at positions 12 and 13 of the polypeptide monomer. A general representation of a TALE monomer contained within a DNA-binding domain is X. 1-11 -(X 12 X 13 )-X 14-33或34或35 The subscript indicates the position of the amino acid, and X represents any amino acid. 12 X 13 Indicating RVD. In some TALE polypeptide monomers, the variable amino acid at position 13 is missing or absent, and in such monomers, RVD consists of a single amino acid. In such cases, RVD can alternatively be represented as X*, where X represents X. 12 And (*) indicates X 13 No. The DNA-binding domain contains several repeats of the TALE monomer, and this can be represented as (X 1-11 -(X 12 X 13 )-X 14-33或34或35 ) z In a preferred embodiment, z is at least 5-40. In a further preferred embodiment, z is at least 10-26.
[0104] TALE monomers possess nucleotide binding affinity determined by the amino acid types within their RVDs. For example, polypeptide monomers with RVDs containing NI preferentially bind to adenine (A), polypeptide monomers with RVDs containing NG preferentially bind to thymine (T), polypeptide monomers with RVDs containing HD preferentially bind to cytosine (C), and monomers with RVDs containing NN preferentially bind to both adenine (A) and guanine (G). In other embodiments, monomers with RVDs containing IG preferentially bind to T. Therefore, the number and order of repeats of polypeptide monomers within the nucleotide-binding domain of a TALE determine its nucleic acid target specificity. In a further embodiment of this application, monomers with RVDs containing NS recognize all four base pairs and can bind to A, T, G, or C. The structure and function of TALE are further described, for example, in Moscou et al., Science 326:1501 (2009); Boch et al., Science 326:1509-1512 (2009); and Zhang et al., Nature Biotechnology 29:149-153 (2011), each of which is incorporated herein by reference in its entirety. The repeating domains of TALE are involved in the binding of TALE to its homologous target DNA sequences. These repeating units (or “repetitive sequences”) exhibit at least some sequence homology with other TALE repeating sequences within naturally occurring TALE proteins. See, for example, U.S. Patent Publication No. 20110301073. The TALE binding domains involved in this application can be “engineered” to bind to predetermined nucleotide sequences, for example via engineering (changing one or more amino acids) of the recognition helical region of naturally occurring TALE proteins. Thus, engineered DNA-binding proteins (TALEs) are non-naturally occurring proteins. Non-limiting examples of methods for engineering DNA-binding proteins include design and selection. The designed DNA-binding protein is a non-naturally occurring protein, and its design and / or composition are primarily derived from rational design criteria. Rational design criteria include the application of substitution rules and computational algorithms used to process information in an information database storing existing TALE designs and binding data. See, for example, U.S. Patents 6,140,081; 6,453,242; and 6,534,261; also see WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO02 / 016536 and WO 03 / 016496 and U.S. Publication No. 20110301073.
[0105] In this application, the term "DNA methyltransferase" generally refers to an enzyme that catalyzes the transfer of methyl groups to DNA. Non-limiting examples of DNA methyltransferases include DNMT1, DNMT3A, DNMT3B, and DNMT3L. For example, through DNA methylation, DNA methyltransferases can modify the activity of DNA fragments (e.g., regulate gene expression) without altering the DNA sequence. As described herein, epigenetic editing agents may include one or more (e.g., two) DNA methyltransferases. When a DNA methyltransferase is included as part of an epigenetic editing agent (fusion peptide or complex peptide), the DNA methyltransferase may be referred to as a "DNA methyltransferase domain". In all respects, the DNA methyltransferase domain comprises a variant or homolog of DNMT3A having an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identical. In all respects, the DNA methyltransferase domain comprises a variant or homolog of DNMT3L having an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identical.
[0106] In this application, the term "functionally active fragment" generally refers to a fragment that has a partial region of a full-length protein or nucleic acid but retains or partially retains the biological activity or function of the full-length protein or nucleic acid. For example, a functionally active fragment may retain or partially retain the ability of a full-length protein to bind to another molecule. For example, a functionally active fragment of a DNA methyltransferase may retain or partially retain the biological activity of a full-length DNA methyltransferase in catalyzing the transfer of methyl groups to DNA.
[0107] In this application, the terms "inhibition," "repression," "silencing," etc., generally refer to a reduction in gene expression and / or activity. For example, the application of the substance of this application may have a negative impact (e.g., reduction) on the activity of a nucleic acid sequence relative to the activity in the absence of a substance (e.g., fusion protein, complex, nucleic acid, vector) (control). For example, inhibition may refer to a reduction in disease or disease symptoms. For example, inhibition includes at least partially, partially, or completely blocking the activation (e.g., transcription) of a nucleic acid sequence, or reducing, preventing, or delaying the activation of a nucleic acid sequence. For example, the inhibitory activity may be 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or lower than that in the control.
[0108] In this application, the term "transcriptional repressor" generally refers to a substance and / or agent, such as a protein (e.g., a transcription factor or fragment thereof), that binds to a target nucleic acid sequence and causes a decrease in the expression level of a gene product associated with the target nucleic acid sequence. For example, the gene product may be RNA (e.g., mRNA) transcribed from a gene or a polypeptide translated from mRNA transcribed from a gene. Typically, an increase or decrease in mRNA levels leads to an increase or decrease in the level of the polypeptide translated from it. Expression levels can be determined using standard techniques for measuring mRNA or protein. Examples of non-restrictive transcriptional repressors include: mSin3-interacting domain (SID) proteins, methyl-CpG-binding domain 2 (MBD2), MBD3, DNA methyltransferase (DNMT) 1 (DNMT1), DNMT2A, DNMT3A, DNMT3B, DNMT3L, retinoblastoma protein (Rb), methyl-CpG-binding protein 2 (Mecp2), GATA-1 and its cofactor Fog1, MAT2 regulator (ROM2), Arabidopsis HD2A protein (AtHD2A), lysine-specific demethylase 1 (LSD1), and / or Krüppel-related box (KRAB).
[0109] In this application, the term "KRAB" is also referred to as "Krüüppel-associated box domain" or "Krüüppel-associated box domain," which generally refers to about 45 to about 75 amino acid residues of the transcriptional repressor domain present in transcription factors of human zinc finger proteins. In various aspects, the KRAB domain may include variants or homologs having an amino acid sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identical to the ZIM3 KRAB domain or the KOX1 KRAB domain.
[0110] In this application, the term "split green fluorescent protein" generally refers to a polypeptide that is capable of splitting and immediately forming an active green fluorescent protein upon recombination.
[0111] In this application, the term "GCN4" refers to a transcription factor in Saccharomyces cerevisiae, which is a "master regulator" in the yeast genome that regulates nearly one-tenth of the yeast genome. It is a highly conserved protein, and its mammalian homologue is Activating Transcription Factor-4 (ATF4).
[0112] In this application, the term "PDZ protein" generally refers to a naturally occurring protein containing a PDZ domain. Exemplary PDZ proteins include CASK, MPP1, DLG1, DLG2, PSD95, NeDLG, TIP-33, SYN1a, TIP-43, LDP, LIM, LIMK1, LIMK2, MPP2, NOS1, AF6, PTN_4, prIL16, 41.8kD, KIAA0559, RGS12, KIAA0316, DVL1, TIP-40, TIAM1, MINT1, MAGI-I, MAGI-2, MAGI-3, KIAA0303, CBP, MINT3, TIP-2, KIAA0561, and / or TIP-I.
[0113] In this application, the term "single-chain antibody" or "scFv (Single Chain Antibody)" generally refers to a single-chain polypeptide containing one or more antigen-binding sites. Additionally, although the H and L chains of the Fv fragment are encoded by different genes, they can be linked together directly or via peptides. For example, through recombinant methods, the H and L chains can be linked into a single protein chain (called a single-chain antibody, sAb; Bird et al. 1988 Science 242: 423-426; and Huston et al. 1988 PNAS 85: 5879-5883) using synthetic linkers. This single-chain antibody is also included in the term "antibody," which can be used as a binding determinant in the design and manufacture of multispecific binding molecules, and can be prepared by recombinant techniques or by enzymatic or chemical cleavage of the intact antibody.
[0114] In this application, the term "directly or indirectly linked" generally refers to the opposite of "directly linked" or "indirectly linked." "Directly linked" generally refers to a direct connection. For example, a direct connection can be a situation where linked substances (e.g., amino acid sequence segments) are directly linked without a spacer component (e.g., amino acid residues or derivatives thereof); for example, amino acid sequence segment X is directly linked to another amino acid sequence segment Y via an amide bond formed by the C-terminal amino acid of amino acid sequence segment X and the N-terminal amino acid of amino acid sequence segment Y. "Indirectly linked" generally refers to a situation where linked substances (e.g., amino acid sequence segments) are indirectly linked with a spacer component (e.g., amino acid residues or derivatives thereof). For example, as used herein, the spacer component is a "linker" or "linker sequence," which generally refers to a linker comprising two or more parts. In various embodiments, the linker is connected at the N-terminus and C-terminus to the amino acid sequence of the remaining portion of the compound (e.g., the first or second fusion of the fusion peptide or complex peptide provided herein). For example, as used herein, the terms "XTEN," "XTEN linker," or "XTEN peptide" refer to a recombinant peptide lacking hydrophobic amino acid residues (e.g., an unstructured recombinant peptide). In some embodiments, the XTEN adapter sequence comprises one or more fragment sequences truncated from the amino acid sequence shown in SEQ ID NO: 64 (the full-length XTEN polypeptide), said one or more fragment sequences comprising not less than 16 consecutive amino acids. The development and use of XTEN can be found, for example, in Schellenberger et al., *Nature Biotechnology* 27, 1186-1190 (2009), which is incorporated herein by reference in its entirety. For example, in some embodiments of this application, the adapter sequence comprises a GS linker peptide, said GS linker peptide comprising the sequence: (GS) a (GGS) b (GGGS) c (GGGGS) d In this context, G represents a glycine residue (Gly), S represents a serine residue (Ser), and a, b, c, and d represent integers greater than or equal to 0. For example, the spacer component (linker sequence) used in this application is selected from the amino acid sequences shown in any one of SEQ ID NO: 46-63 (SEQ ID NO: 47 is GSG).
[0115] In this application, the term "recruitment" generally refers to recruitment between protein molecules, specifically the recruitment of other molecules by a protein to perform a particular biological function. This recruitment relies primarily on the affinity of intermolecular interactions, which is often considered complex and related to the spatial structure of the protein molecule. Interaction mechanisms may include, but are not limited to, non-covalent interactions such as hydrogen bonds, ionic interactions, hydrophobic interactions, and van der Waals forces. For example, some proteins can recruit enzymes to catalyze chemical reactions or recruit other proteins to form complexes. These recruitment processes are crucial for many cellular processes, such as signal transduction, DNA replication, and gene expression.
[0116] In this application, the terms "nuclear localization sequence" or "nuclear localization signal" or "NLS" generally refer to a peptide that directs a protein to the cell nucleus. For example, an NLS comprises five basic, positively charged amino acids. For example, an NLS can be located at any position on the peptide chain.
[0117] In this application, the term "marker" refers to a peptide that can be introduced into an expression vector, which can be used to allow the deletion and / or purification of the expression product of one or more vector insert fragments. Such markers are well-known in the art and comprise radiolabeled amino acids or polypeptides linked to a biotinylated moiety detectable by a labeled avidin (e.g., streptomycin containing a fluorescent label or enzymatic activity detectable by optical or colorimetric methods). Affinity markers such as FLAG, glutathione S-transferase, maltose-binding protein, cellulose-binding domain, thioredoxin, NusA, mistin, chitin-binding domain, keratinase, AGT, GFP, and other widely used markers, such as those used in protein expression and purification systems, are also included. Further non-limiting examples of peptides include, but are not limited to, the following: histidine labels, radioisotopes or radionuclides (e.g., 3H, 14C, 35S, 90Y, 99Tc, 111In, 125I, 177Lu, 166Ho, or 153Sm); fluorescent labels (e.g., FITC, rhodamine, lanthanides); enzyme labels (e.g., horseradish peroxidase, luciferase, alkaline phosphatase); chemiluminescent labels; biotin groups; pendant peptide antigenic determinants recognized by a second reporter (e.g., leucine zipper pairs, binding sites for secondary antibodies, metal-binding domains, antigenic determinant markers); and magnetic agents, such as gadolinium chelates.
[0118] In this application, the specific protein (e.g., KRAB, TALE, Dnmt3A, Dnmt3L) may include any native form of the protein or a variant or homolog that maintains the activity of the protein (e.g., having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the activity compared to the native protein). In each aspect, the variant or homolog has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., 50, 100, 150, or 200 consecutive amino acid segments) compared to the native form.
[0119] In this application, the term "nucleotide modification" may refer to the synthesis or modification of the nucleic acid described in this invention by methods well-established in the art, such as those described in "Current protocols in nucleic acid chemistry" Beaucage, SL et al., (Edrs.), John Wiley & Sons, Inc., New York, NY, USA (which are incorporated herein by reference). Such modifications may include, but are not limited to: terminal modifications, such as 5'-terminal modifications (e.g., phosphorylation, conjugation, inverted linkage) or 3'-terminal modifications (e.g., conjugation, DNA nucleotides, inverted linkage, etc.); base modifications, such as substitution with a stable base, a destabilized base, or a base paired with an expanded library of bases, base removal (base-free nucleotide), or conjugated bases; sugar modifications (e.g., sugar modification at the 2' or 4' position) or sugar substitution; or backbone modifications, including modification or substitution of phosphodiester bonds.
[0120] In this application, the term "liposome" generally refers to a vesicle with an internal space that is isolated from an external medium by one or more bilayer membranes. In some embodiments, the bilayer membrane can be formed from amphiphilic molecules, such as synthetic or naturally derived lipids comprising spatially isolated hydrophilic and hydrophobic domains; in other embodiments, the bilayer membrane can be formed from amphiphilic polymers and surfactants. In some embodiments, the liposome is a spherical vesicle structure consisting of a single or multiple lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. In some embodiments, the liposome is biocompatible, non-toxic, capable of delivering hydrophilic and lipophilic drug molecules, protecting their carriers from degradation by plasma enzymes, and transporting their load across biological membranes and the blood-brain barrier (BBB). Liposomes can be made from several different types of lipids, such as phospholipids. Liposomes may contain natural phospholipids and lipids such as 1,2-distearate-sn-glycerol-3-phosphatidylcholine (DSPC), sphingomyelin, lecithin, monosialotetrahexosylganglioside, or any combination thereof. Several other additives may be added to liposomes to modify their structure and properties. For example, liposomes may also contain cholesterol, sphingomyelin, and / or 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), for example, to increase stability and / or prevent leakage of the internal carriers of the liposomes.
[0121] The term "lipid nanoparticle (LNP)" generally refers to a particle containing multiple (i.e., more than one) lipid molecules physically bound together by intermolecular forces (e.g., covalent or non-covalent). LNPs can be, for example, microspheres (including monolayer and multilayer vesicles, such as liposomes), dispersed phases in emulsions, micelles, or internal phases in suspensions. LNPs can encapsulate nucleic acids within cationic lipid particles (e.g., liposomes) and can be delivered to cells relatively easily. In some instances, lipid nanoparticles are free of any viral components, which helps minimize safety and immunogenicity issues. The lipid particles can be used for in vitro, ex vivo, and in vivo delivery. The lipid particles can also be used for cell populations of various sizes. The LNPs of this application can be readily prepared by various methods known in the art, such as by mixing an organic phase with an aqueous phase. Mixing of the two phases can be achieved using microfluidic devices and impinging flow reactors. The more thoroughly the organic and aqueous phases are mixed, the better the encapsulation efficiency and particle size distribution of the obtained LNPs. Preferably, the particle size of the LNPs can be adjusted by varying the mixing rate of the organic and aqueous phases. The faster the mixing rate, the smaller the particle size of the prepared LNPs. Encapsulation efficiency can be optimized by adjusting the N / P (ionizable lipid / nucleic acid) ratio of the LNP system. In some instances, LNPs can be used to deliver DNA molecules and / or RNA molecules (such as mRNA). In certain cases, LNPs can be used to deliver RNP complexes.
[0122] In this application, the term "adenovirus-associated virus (AAV) vector" generally refers to a vector having a functional or partially functional ITR sequence and a transgene. As used herein, the term "ITR" refers to an inverted terminal repeat sequence. ITR sequences may be derived from adenovirus serotypes, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-66, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13, as well as any AAV variants or mixtures. However, the ITR need not be a wild-type nucleotide sequence and may be altered (e.g., by insertion, deletion, or substitution of nucleotides) as long as the sequence retains the function of providing functional rescue, replication, and packaging. AAV vectors may have one or more wholly or partially deleted AAV wild-type genes, preferably the rep and / or cap genes, but retain functional flanking ITR sequences. The functional ITR sequence serves, for example, to rescue, replicate, and package AAV viral particles or granules. Therefore, "AAV vector" is defined in this application as including at least those sequences required for inserting the transgene into the subject's cells. Optionally, it may include those cis sequences necessary for viral replication and packaging (e.g., functional ITR).
[0123] In this application, the term "pharmaceutically acceptable carrier" generally refers to a carrier for administering therapeutic agents, such as antibodies or peptides, genes, and other therapeutic agents. This term refers to any pharmaceutical carrier that does not itself induce antibody production harmful to the individual receiving the composition and can be administered without causing excessive toxicity. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polyamino acids, amino acid copolymers, lipid aggregates, and inactivated viral particles. These carriers are well known to those skilled in the art. Pharmaceutically acceptable carriers in therapeutic compositions may include liquids such as water, saline, glycerol, and ethanol. These carriers may also contain excipients such as wetting agents or emulsifiers, pH buffers, etc.
[0124] In this application, the term "regulatory element" refers to a genetic element capable of controlling the expression of a nucleic acid sequence. Examples include splicing signals, promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, etc., which together enable the replication, transcription, and translation of coding sequences in recipient cells. Not all of these control sequences are required. Transcriptional control signals in eukaryotes typically comprise "promoter" and "enhancer" elements. Promoters and enhancers consist of short arrays of DNA sequences; promoters are regulatory elements that promote the initiation of transcription of operatively linked coding regions, while enhancers are regulatory elements that increase the rate of genetic transcription by increasing the activity of the nearest promoter on the same DNA molecule. These sequences specifically interact with cellular proteins involved in transcription (Maniatis et al., Science 236:1237 (1987), incorporated herein by reference in its entirety). Promoter and enhancer elements have been isolated from a wide range of eukaryotic sources, including genes in yeast, insect and mammalian cells, and viruses (similar control sequences, i.e., promoters, have also been found in prokaryotes). The choice of specific promoters and enhancers depends on the recipient cell type. Some eukaryotic promoters and enhancers have a broad host range, while others function within a limited subgroup of cell types (for reviews, see, e.g., Voss et al., Trends Biochem. Sci., 11:287 (1986); and Maniatis et al. (ibid.), incorporated herein by reference in their entirety). For example, the SV40 early gene enhancer is highly active in a wide range of cell types from many mammalian species and has been used to express proteins in a variety of mammalian cells (Dijkema et al., EMBO J. 4:761 (1985), incorporated herein by reference in its entirety). Promoter and enhancer elements derived from the human elongation factor 1-α gene (Uetsuki et al., J. Biol. Chem., 264: 5791 (1989); Kim et al., Gene 91: 217 (1990); and Mizushima and Nagata, Nucl. Acids. Res., 18: 5322 (1990)), long terminal repeat sequences of Rous sarcoma virus (Gorman et al., Proc. Natl. Acad. Sci. USA79: 6777 (1982)), and human cytomegalovirus (Boshart et al., Cell41: 521 (1985)) can also be used to express proteins in different mammalian cell types, and the aforementioned references are incorporated herein by reference in their entirety. Promoters and enhancers can exist naturally, alone or together. For example, long terminal repeat sequences of retroviruses contain promoter and enhancer elements.Generally, the function of promoters and enhancers is independent of the gene being transcribed or translated. Therefore, the enhancers and promoters used can be “endogenous,” “exogenous,” or “heterogeneous” relative to the gene to which they are operatively linked. An “endogenous” enhancer / promoter is one that is naturally linked to a given gene in the genome. An “exogenous” or “heterogeneous” enhancer or promoter is one that is juxtaposed with a gene through genetic manipulation (i.e., molecular biology techniques), such that transcription of that gene is directed by the linked enhancer / promoter. The presence of a “splicing signal” on the expression vector typically leads to high levels of expression of the recombinant transcript. In some embodiments, the “splicing signal” mediates the removal of introns from the primary RNA transcript, consisting of a splicing donor and recipient site (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1989), pp. 16.7–16.8, incorporated herein by reference in its entirety). The commonly used splicing donor and acceptor sites are splice sites of 16S RNA derived from SV40. In some implementations, the "transcription termination signal" is typically located downstream of the polyadenylation signal and is several hundred nucleotides in length. For example, the term "poly A signal" or "poly A sequence" refers to the DNA sequence that directs the termination and polyadenylation of nascent RNA transcripts. Efficient polyadenylation of recombinant transcripts is often necessary because transcripts lacking a poly A signal are unstable and rapidly degraded. The poly A signal used in expression vectors can be "heterologous" or "endogenous." An endogenous poly A signal is a signal naturally present at the 3' end of the coding region of a given gene in the genome. A heterologous poly A signal is a signal isolated from one gene and operatively linked to the 3' end of another gene. A commonly used heterologous poly A signal is the SV40 poly A signal. The SV40 poly A signal is contained on a 237 bp BamHI / BclI-restricting fragment and directs termination and polyadenylation (Sambrook et al., ibid., 16.6–16.7, incorporated herein by reference in its entirety).
[0125] In this application, the term "subject" generally refers to an animal, typically a mammal such as a human, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cattle, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents, and adult subjects. Subjects include animal disease models, such as mice and other animal models of blood clotting disorders (such as HemA), and other animal models known to those skilled in the art.
[0126] In this application, the term "effective amount" in the context of modulating activity or treating or preventing symptoms refers to the amount of a drug agent administered to a subject requiring such modulation, treatment, or prevention in the form of a single dose or a portion of a series of doses that effectively modulates the effect, or treats, prevents, or improves the symptoms. Effective amounts can vary between individuals, depending on the health and physical condition of the individual being treated, the taxonomic group of the individual being treated, the formulation of the composition, the evaluation of the individual's medical condition, and other relevant factors.
[0127] In this application, the term "comprising" generally means including the explicitly specified features, but does not exclude other elements.
[0128] In this application, the term “selected from” generally refers to the selection of objects and all combinations thereof. For example, “selected from (:) A, B and C” means all combinations of A, B and C, such as A, B, C, A+B, A+C, B+C or A+B+C.
[0129] In this application, the term "about" generally refers to a variation within a range of 0.5% to 10% above or below a specified value, such as a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.
[0130] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the pharmaceutical compositions, preparation methods and uses of this application, and are not intended to limit the scope of the invention.
[0131] Example
[0132] Example 1
[0133] The combination of EPIREG and antisense nucleic acid (ASO) inhibits HBV-A gene expression in transgenic HBV mice.
[0134] This embodiment uses epigenetic modification drugs and small nucleic acid drugs (including ASO, siRNA, etc.) in combination to treat a transgenic HBV research model, thereby verifying the inhibitory effect of the combined drugs on HBV gene expression in the in vivo model. The transgenic HBV mice used (purchased from Beijing Vitonda Biotechnology Co., Ltd., C57BL / 6-HBV, subsequent feeding and testing were completed by Beijing Vitonda) had a 1.28-fold length of HBV genome (type A, GenBank: AF305422.1) inserted into their genomes. The experimental methods are as follows:
[0135] 1) Delivery of two epigenetic modification drugs for EPIEG: A combination of mRNA encoding EPI-003 (SEQ ID NO: 9436) and sgRNA D99 (SEQ ID NO: 8451, AGGAGUUCCGCAGUAUGGAU) was delivered to transgenic HBV mice via tail vein injection using lipid nanoparticles (LNPs); the mass ratio of mRNA to sgRNA was 1:1, or mRNA encoding SS527 (SS527 is also known as EPI-003T, SEQ ID NO: 9438) was delivered. The method for preparing LNPs can be found in the literature: Musunuru, K., Chadwick, AC, Mizoguchi, T. et al. In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature 593, 429-434 (2021). All EPIEG deliveries were single-dose administrations at a dose of 3 mg / kg, with the day of administration considered day 0.
[0136] 2) Delivery of antisense oligonucleotides / ASO drugs: Bepirovirsen (GSK3228836, patent number: WO2012145697) is delivered via subcutaneous injection. This drug targets all HBV RNAs; the day of administration is considered day 0. The first injection is given on day 0, followed by weekly injections (dose of 50 mg / kg).
[0137] 3) PBS (200 μL) was injected on day 0 as a negative control group. Blood samples were collected periodically after each group was administered the drug to detect the levels of HBV surface antigen (HBsAg) and core antigen (HBcAg / HBeAg) in serum. HBV DNA levels were detected using qPCR. (Hepatitis B e antigen quantitative kit: Maccura Biotechnology, catalog number IM4403003; Hepatitis B surface antigen quantitative kit: Maccura Biotechnology, catalog number IM4403001; Hepatitis B virus nucleic acid quantitative kit: Sansure Biotech, 2015340008; Detection methods were performed according to the kit instructions).
[0138] The experimental results after drug administration are shown in Figure 1. In transgenic HBV mice, after a single injection of EPI-003 or SS527, the expression levels of HBsAg, HBeAg, and HBV DNA in serum rapidly decreased within two weeks. After two weeks, the levels of HBsAg and HBV DNA slightly recovered and eventually stabilized. In transgenic HBV mice, after weekly ASO injections, the expression levels of HBsAg, HBeAg, and HBV DNA in serum gradually and slowly decreased over six weeks. In transgenic HBV mice, after a single injection of EPI-003 or SS527 combined with weekly ASO injections, the expression levels of HBsAg, HBeAg, and HBV DNA in serum rapidly decreased within two weeks, with a greater reduction than in the EPI-003 or SS527 monotherapy groups. Subsequently, HBsAg and HBV DNA levels remained stable. Mice in the EPI-003 + ASO combination group achieved 60% HBsAg clearance (n=5), while mice in the SS527 + ASO combination group achieved 100% HBsAg clearance (n=5). These results indicate that in the transgenic HBV mouse model, the combination of EPI-003 epigenetic modifiers and ASO can significantly inhibit integrated HBV gene expression and rapidly achieve HBsAg clearance.
Claims
1. A pharmaceutical composition for inhibiting the expression of hepatitis B virus (HBV) genes in cells, said pharmaceutical composition comprising: 1) An epigenetically modified pharmaceutical ingredient comprising a fusion peptide or a complex peptide, or a nucleotide encoding said fusion peptide or complex peptide, said fusion peptide or complex peptide comprising at least one DNA-binding domain, at least one epigenetic modification domain, and at least one transcriptional regulatory domain, and 2) Small nucleic acid drug components that can target HBV and interfere with its expression.
2. The pharmaceutical composition according to claim 1, wherein the DNA-binding domain is selected from CRISPR enzymes, zinc finger nucleases (ZNF), transcription activator-like effector (TALE) domains, homing endonucleases, dCas9-FokI nucleases, Argonaute nucleases (Ago), or MegaTal nucleases.
3. The pharmaceutical composition according to claim 1 or 2, wherein the CRISPR enzyme is a type 2 Cas protein and / or a mutant thereof.
4. The pharmaceutical composition according to any one of claims 1-3, wherein the CRISPR enzyme is one or more of the following Cas proteins: type II-A Cas protein, type II-B Cas protein, type II-C Cas protein, type VA Cas protein, type VB Cas protein, type VC Cas protein, type VU Cas protein, and mutants thereof.
5. The pharmaceutical composition according to any one of claims 1-4, wherein the CRISPR enzyme is Cas9 protein and / or a mutant thereof.
6. The pharmaceutical composition according to any one of claims 1-5, wherein the at least one DNA-binding domain is dCas9.
7. The pharmaceutical composition according to any one of claims 1-6, wherein the epigenetic modification pharmaceutical ingredient further comprises at least one single guide RNA (sgRNA) or a nucleotide encoding said sgRNA.
8. The pharmaceutical composition according to claim 7, wherein the sgRNA is complementary to a target nucleotide sequence near the HBV gene and / or within the regulatory element of the HBV gene.
9. The pharmaceutical composition according to claim 7 or 8, wherein the sgRNA comprises the nucleotide sequence shown in any one of SEQ ID NOs: 8273-9434.
10. The pharmaceutical composition according to any one of claims 7-9, wherein the sgRNA comprises a partial sequence of the nucleotide sequence shown in any one of SEQ ID NOs: 8273-9434, said partial sequence having a length of 15-20 base pairs.
11. The pharmaceutical composition according to claim 1 or 2, wherein the DNA binding domain is a TALE domain.
12. The pharmaceutical composition of claim 11, wherein the TALE domain is capable of specifically binding to the HBV gene and / or target nucleotide sequences within the HBV gene regulatory element.
13. The pharmaceutical composition according to claim 12, wherein the target nucleotide sequence is selected from the nucleotide sequence of any one of SEQ ID NO: 65-1701 and 3339-3358.
14. The pharmaceutical composition according to any one of claims 11-13, wherein the TALE domain comprises an engineered RVD domain capable of recognizing and specifically binding to the target nucleotide sequence.
15. The pharmaceutical composition according to any one of claims 11-14, wherein the TALE domain comprises the amino acid sequence of any one of SEQ ID NO: 1702-3338 and 3359-8269.
16. The pharmaceutical composition according to any one of claims 1-15, wherein the HBV gene is a type B HBV gene, a type C HBV gene, or a type D HBV gene.
17. The pharmaceutical composition according to any one of claims 8, 12 and 16, wherein the HBV gene regulatory element comprises a transcription start site, a core promoter, a promoter, an enhancer, a silencer, an insulator element, a boundary element and / or a locus control region.
18. The pharmaceutical composition according to any one of claims 1-17, wherein the at least one epigenetic modification domain provides methylation modification of at least one nucleotide in the vicinity of the HBV gene and / or within the HBV gene regulatory element.
19. The pharmaceutical composition according to any one of claims 1-18, wherein the at least one epigenetic modification domain comprises a DNA methyltransferase (DNMT) or a portion thereof.
20. The pharmaceutical composition according to any one of claims 1-19, wherein the apparent modification domain is selected from one or more of DNMT3A, DNMT3B, DNMT3C, DNMT1, DNMT2 and DNMT3L.
21. The pharmaceutical composition according to any one of claims 1-20, wherein the apparent modification domain comprises at least one DNMT3A and at least one DNMT3L, and is connected by a linker sequence.
22. The pharmaceutical composition according to any one of claims 1-21, wherein the apparent modification domain comprises DNMT3A and DNMT3L, and the C-terminus of DNMT3A is connected to the N-terminus of DNMT3L, or the C-terminus of DNMT3L is connected to the N-terminus of DNMT3A.
23. The pharmaceutical composition according to any one of claims 19-22, wherein the DNA methyltransferase comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-6.
24. The pharmaceutical composition according to any one of claims 1-23, wherein the transcriptional regulatory domain is a transcriptional repressor domain selected from: KRAB, ZIM3 KRAB, ZNF680, ZNF554, ZNF264, ZNF582, ZNF324, ZNF669, ZNF354A, ZNF82, ZNF595, ZNF419, ZNF566, ZIM2, EHMT2, SUV39H1, ZFPM1, TRIM28, EZH2, MXD1, SID, LSD1, HP1 a, HDAC3, ZNF436, ZNF257, ZNF675, ZNF490, ZNF320, ZNF331, ZNF816, ZNF41, ZNF189, ZNF528, ZNF543, ZNF140, ZNF610, ZNF350, ZNF8, ZNF30, ZNF98, ZNF677, ZNF596, ZNF214, ZNF37A, ZNF34, ZNF250, ZNF547, ZNF273, ZFP82, ZNF224, ZNF33A, ZNF45, ZNF175, ZNF184, ZFP28-1, ZFP28-2, ZNF18, ZNF213, ZNF394, ZFP1, ZFP14, ZNF416, Z NF557, ZNF729, ZNF254, ZNF764, ZNF785, ZNF10, CBX5, RYBP, YAF2, MGA, CBX1, SCMH1, MPP8, SUMO3, HERC2, BIN1, PCGF2, TOX, FOXA1, FOXA2, IRF2BP1, IRF2BP2, IRF2BPL IRF-2BP1_2N-terminal domain, HOXA13, HOXB13, HOXC13, HOXA11, HOXC11, HOXC10, HOXA10, HOXB9, HOXA9, ZFP28, ZN334, ZN568, ZN37A, ZN181, ZN510, ZN862, ZN140, ZN208, ZN248, ZN571, ZN699, ZN726, ZIK1, ZNF2, Z705F, ZNF14, ZN471, ZN624, ZNF84 , ZNF7, ZN891, ZN337, Z705G, ZN529, ZN729, ZN419, Z705A, ZN302, ZN486, ZN621, ZN688, ZN33A, ZN554, ZN878, ZN7 72, ZN224, ZN184, ZN544, ZNF57, ZN283, ZN549, ZN211, ZN615, ZN253, ZN226, ZN730, Z585A, ZN732, ZN681, ZN667,ZN649,ZN470,ZN484,ZN431,ZN382,ZN254,ZN124,ZN607,ZN317,ZN620,ZN141,ZN584,ZN540,ZN75D,ZN555,ZN658,ZN684,RBAK,ZN829,ZN582,ZN112,ZN716,HKR1,ZN350,ZN480,ZN416,ZNF92,ZN100,ZN736,ZNF74,ZN443,ZN195,ZN530,ZN782,ZN791,ZN331,Z354C,ZN157,ZN727,ZN550,ZN793,ZN235,ZN724,ZN573,ZN577,ZN789,ZN718,ZN300,ZN383,ZN429,ZN677,ZN850,ZN454,ZN257,ZN264,ZN485,ZN737,ZNF44,ZN596,ZN565,ZN543,ZFP69,SUMO1,ZNF12,ZN169,ZN433,ZN175,ZN347,ZNF25,ZN519,Z585B,ZN517,ZN846,ZN230,ZNF66,ZN713,ZN816,ZN426,ZN674,ZN627,ZNF20,Z587B,ZN316,ZN233,ZN611,ZN556,ZN234,ZN560,ZNF77,ZN682,ZN614,ZN785,ZN445,ZFP30,ZN225,ZN551,ZN610,ZN528,ZN284,ZN418,ZN490,ZN805,Z780B,ZN763,ZN285,ZNF85,ZN223,ZNF90,ZN557,ZN425,ZN229,ZN606,ZN155,ZN222,ZN442,ZNF91,ZN135,ZN778,ZN534,ZN586,ZN567,ZN440,ZN583,ZN441,ZNF43,ZN589,ZN563,ZN561,ZN136,ZN630,ZN527,ZN333,Z324B,ZN786,ZN709,ZN792,ZN599,ZN613,ZF69B,ZN799,ZN569,ZN564,ZN546,ZFP92,ZN723,ZN439,ZFP57,ZNF19,ZN404,ZN274,CBX3,ZN250,ZN570,ZN675,ZN695,ZN548,ZN132,ZN738,ZN420,ZN626,ZN559,ZN460,ZN268,ZN304,ZN605,ZN844,SUM05,ZN101,ZN783,ZN417,ZN182,ZN823,ZN177,ZN197,ZN717,ZN669,ZN256,ZN 251,CBX4,CDY2,CDYL2,ZN562,ZN461,Z324A,ZN766,ID2,ZN214,CBX7,ID1 ,CREM,SCX,ASCL1,ZN764,SCML2,TWST1,CREB1,TERF1,ID3,CBX8,GSX1,NK X22,ATF1,TWST2,ZNF17,TOX3,TOX4,ZMYM3,I2BP1,RHXF1,SSX2,I2BPL,ZN6 80,TRI68,HXA13,PHC3,TCF24,HXB13,HEY1,PHC2,ZNF81,FIGLA,SAM11,KM T2B,HEY2,JDP2,HXC13,ASCL4,HHEX,GSX2,ETV7,ASCL3,PHC1,OTP,I2BP2, VGLL2,HXA11,PDLI4,ASCL2,CDX4,ZN860,LMBL4,PDIP3,NKX25,CEBPB,ISL 1,CDX2,PROP1,SIN3B,SMBT1,HXC11,HXC10,PRS6A,VSX1,NKX23,MTG16,HMX 3,HMX1,KIF22,CSTF2,CEBPE,DLX2,PPARG,PRIC1,UNC4,BARX2,ALX3,TCF1 5,TERA,VSX2,HXD12,CDX1,TCF23,ALX1,HXA10,RX,CXXC5,SCML1,NFIL3,D LX6,MTG8,CEBPD,SEC13,FIP1,ALX4,LHX3,PRIC2,MAGI3,NELL1,PRRX1,MT G8R,RAX2,DLX3,DLX1,NKX26,NAB1,SAMD7,PITX3,WDR5,MEOX2,NAB2,DHX8, CBX6,EMX2,CPSF6,HXC12,KDM4B,LMBL3,PHX2A,EMX1,NC2B,DLX4,SRY,ZN7 77,ZN398,GATA3,BSH,SF384,TEAD1,TEAD3,RGAP1,PHF1,GATA2,FOXO3,ZN2 12,IRX4,ZBED6,LHX4,SIN3A,RBBP7,NKX61,R51A1,MB3L1,DLX5,NOTC1,TE RF2,ZN282,RGS12,ZN840,SPI2B,PAX7,NKX62,ASXL2,FOXO1,GATA1,ZMYM5,LRP1, MIXL1, SGT1, LMCD1, CEBPA, SOX14, WTIP, PRP19, NKX11, RBBP4, DMRT2, SMCA2, and their functionally active fragments.
25. The pharmaceutical composition according to claim 24, wherein the transcriptional repressor domain comprises the amino acid sequence shown in any one of SEQ ID NOs: 7-36.
26. The pharmaceutical composition according to claim 24 or 25, wherein the transcriptional repressor domain comprises a zinc finger protein-based transcription factor or a functionally active fragment thereof.
27. The pharmaceutical composition according to claim 26, wherein the zinc finger protein-based transcription factor is a Krüppel-associated repressor (KRAB) or a KRAB domain derived from ZIM3 (ZIM3 KRAB).
28. The pharmaceutical composition according to any one of claims 1-27, wherein the transcriptional regulatory domain comprises two or more of the zinc finger-based transcription factors or functionally active fragments thereof, wherein the two or more zinc finger-based transcription factors are of the same or different types and are connected by a linker sequence.
29. The pharmaceutical composition according to claim 21 or 28, wherein the connector sequence is an XTEN connector sequence.
30. The pharmaceutical composition of claim 24, wherein the transcriptional repressor domain comprises a histone modification domain.
31. The pharmaceutical composition according to claim 30, wherein the histone modification domain is selected from: EZH2, HDAC3, HDAC1, EHMT2(G9A), PRMT1, PRMT5, SETDB1, hSIRT1, HP1a, LSD1, and their functionally active fragments.
32. The pharmaceutical composition according to claim 31, wherein the histone modification domain comprises the amino acid sequence shown in any one of SEQ ID NO: 21-36.
33. The pharmaceutical composition according to any one of claims 1-32, wherein the epigenetic modification pharmaceutical ingredient comprises a fusion peptide, wherein the at least one DNA-binding domain, the at least one epigenetic modification domain, and the at least one transcriptional regulatory domain therein are directly or indirectly linked.
34. The pharmaceutical composition according to claim 33, wherein the epigenetic modification domain and the transcriptional regulatory domain are both located at the N-terminus or C-terminus of the DNA-binding domain.
35. The pharmaceutical composition according to claim 33, wherein the epigenetic modification domain and the transcriptional regulatory domain are located at the N-terminus and C-terminus of the DNA binding domain, respectively.
36. The pharmaceutical composition according to any one of claims 1-35, wherein the fusion peptide is sequentially linked from the N-terminus to the C-terminus with: 1) The epigenetic modification domain, the transcriptional regulatory domain, and the DNA-binding domain; or 2) The transcriptional regulatory domain, the epigenetic modification domain, and the DNA-binding domain; or 3) The DNA-binding domain, the epigenetic modification domain, and the transcriptional regulatory domain; or 4) The DNA-binding domain, the transcriptional regulatory domain, and the epigenetic modification domain; or 5) The epigenetic modification domain, the DNA-binding domain, and the transcriptional regulatory domain; or 6) The transcriptional regulatory domain, the DNA binding domain, and the epigenetic modification domain.
37. The pharmaceutical composition according to any one of claims 33-36, wherein the fusion peptide is sequentially linked from the N-terminus to the C-terminus to: 1) One or a combination of DNMT3A and DNMT3L, one or more zinc finger-based transcription factors or histone modification domains, and dCas9 or TALE domains; or 2) One or more zinc finger-based transcription factors or histone modification domains, one or a combination of DNMT3A and DNMT3L, and a dCas9 or TALE domain; or 3) dCas9 or TALE domain, one or a combination of DNMT3A and DNMT3L, and one or more zinc finger-based transcription factor or histone modification domains; or 4) dCas9 or TALE domain, one or more zinc finger-based transcription factor or histone modification domains, and one or a combination of DNMT3A and DNMT3L; or 5) One or a combination of DNMT3A and DNMT3L, the dCas9 or TALE domain, and one or more zinc finger-based transcription factor or histone modification domains; or 6) One or more zinc finger protein-based transcription factors or histone modification domains, dCas9 or TALE domains, and one or a combination of DNMT3A and DNMT3L.
38. The pharmaceutical composition according to any one of claims 33-37, wherein the fusion peptide comprises the following domains: dCas9 or TALE-DNMT3A-DNMT3L-ZIM3 KRAB; dCas9 or TALE-ZIM3 KRAB-DNMT3L-DNMT3A; dCas9 or TALE-ZIM3 KRAB-DNMT3A-DNMT3L; ZIM3 KRAB-DNMT3A-DNMT3L-dCas9 or TALE; DNMT3A-DNMT3L-ZIM3 KRAB-dCas9 or TALE; DNMT3A-DNMT3L-ZNF324-dCas9 or TALE; DNMT3A-DNMT3L-ZNF419-dCas9 or TALE; DNMT3A-DNMT3L-dCas9 or TALE -EZH2;DNMT3A-DNMT3L-dCas9 or TALE-HDAC3;DNMT3A-DNMT3L-dCas9 or TALE-HP1a;DNMT3A-DNMT3L-dCas9 or TALE-HDAC1;DNMT3A -DNMT3L-dCas9 or TALE-PRMT1; DNMT3A-DNMT3L-dCas9 or TALE-SETDB1; DNMT3A-DNMT3L-dCas9 or TALE-hSIRT1; DNMT3A-DNMT3L-dCas9 or TALE-PRMT5; DNMT3A-DNMT3L-dCas9 or TALE-G9A; DNMT3A-DNMT3L-dCas9 or TALE-KRAB; DNMT3A-DNMT3L-dCas9 or TALE-ZIM3 KRAB, where... - indicates that the structural domains of the fusion are directly and / or indirectly connected, and that the structural domains are arranged in order from the N end to the C end.
39. The pharmaceutical composition according to any one of claims 1-32, wherein the apparent modification pharmaceutical ingredient comprises a complex peptide, characterized by: 1) The at least one DNA-binding domain, the at least one epigenetic modification domain, and at least one recruitment domain A are directly or indirectly linked to form a first fusion, and the at least one transcriptional regulatory domain is directly or indirectly linked to at least one recruitment domain A' to form a second fusion; or 2) The at least one DNA-binding domain, the at least one transcriptional regulatory domain, and the at least one recruitment domain A are directly or indirectly connected to form a first fusion, and the at least one epigenetic modification domain is directly or indirectly connected to the at least one recruitment domain A' to form a second fusion; Furthermore, the recruitment domain A and recruitment domain A' can interact to enable a fusion of one of the first fusion and the second fusion, or a portion thereof, to be recruited to the vicinity of the other fusion.
40. The pharmaceutical composition of claim 39, wherein the first fusion comprises, from the N-terminus to the C-terminus, the following: 1) Epigenetic modification domain, DNA binding domain, and recruitment domain A, or 2) Epigenetic modification domains, recruitment domain A, and DNA-binding domains, or 3) DNA binding domain, recruitment domain A, and epigenetic modification domain, or 4) DNA binding domain, epigenetic modification domain, and recruitment domain A, or 5) Recruitment domain A, epigenetic modification domain, and DNA-binding domain, or 6) Recruitment domain A, DNA binding domain and epigenetic modification domain.
41. The pharmaceutical composition according to claim 39 or 40, wherein the second fusion comprises, from the N-terminus to the C-terminus, a transcriptional repressor domain and a recruitment domain A', or from the N-terminus to the C-terminus, a recruitment domain A' and a transcriptional repressor domain.
42. The pharmaceutical composition of claim 39, wherein the first fusion comprises, from the N-terminus to the C-terminus, the following: 1) Recruitment domain A, DNA-binding domain, and transcriptional repressor domain, or 2) Recruitment domain A, transcriptional repressor domain, and DNA-binding domain, or 3) DNA-binding domain, recruitment domain A, and transcriptional repressor domain, or 4) DNA-binding domain, transcriptional repressor domain, and recruitment domain A, or 5) Transcription repressor domain, DNA-binding domain, and recruitment domain A, or 6) Transcription repressor domain, recruitment domain A, and DNA binding domain.
43. The pharmaceutical composition according to claim 39 or 42, wherein the second fusion comprises, from the N-terminus to the C-terminus, an epigenetic modification domain and a recruitment domain A', or from the N-terminus to the C-terminus, a recruitment domain A' and an epigenetic modification domain.
44. The pharmaceutical composition according to any one of claims 39-43, wherein the complex peptide comprises the following characteristics: 1) The first fusion compound comprises, from N-terminus to C-terminus, an epigenetic modification domain, a DNA-binding domain, and a recruitment domain A, and the second fusion compound comprises, from N-terminus to C-terminus, a transcriptional repressor domain and a recruitment domain A'; or 2) The first fusion compound comprises, from N-terminus to C-terminus, an epigenetic modification domain, a DNA-binding domain, and a recruitment domain A; the second fusion compound comprises, from N-terminus to C-terminus, a recruitment domain A' and a transcriptional repressor domain; or 3) The first fusion compound contains, from N-terminus to C-terminus, a recruitment domain A, a DNA-binding domain, and a transcriptional repressor domain, respectively; the second fusion compound contains, from N-terminus to C-terminus, an epigenetic modification domain and a recruitment domain A', respectively; or 4) The first fusion compound contains, from N-terminus to C-terminus, a recruitment domain A, a DNA-binding domain, and a transcriptional repressor domain; the second fusion compound contains, from N-terminus to C-terminus, a recruitment domain A and an epigenetic modification domain; or 5) The first fusion compound contains, from N-terminus to C-terminus, an epigenetic modification domain, a recruitment domain A, and a DNA-binding domain; the second fusion compound contains, from N-terminus to C-terminus, a recruitment domain A' and a transcriptional repressor domain; or 6) The first fusion compound contains, from N-terminus to C-terminus, a DNA-binding domain, an epigenetic modification domain, and a recruitment domain A; the second fusion compound contains, from N-terminus to C-terminus, a recruitment domain A' and a transcriptional repressor domain; or 7) The first fusion contains a DNA-binding domain, a recruitment domain A, and an epigenetic modification domain from the N-terminus to the C-terminus, and the second fusion contains a recruitment domain A' and a transcriptional repressor domain from the N-terminus to the C-terminus.
45. The pharmaceutical composition according to any one of claims 39-44, wherein the recruiting domain A is selected from one of two groups of domains, and the recruiting domain A' is selected from the other group of domains: 1) Universally controlled non-derepressor protein 4 (GCN4), a GFP11 fragment derived from splitting green fluorescent protein (GFP), or a GVKESLV polypeptide; and 2) Single-chain antibody (scFv), GFP1-10 fragments derived from split green fluorescent protein (GFP), or PDZ protein domain.
46. The pharmaceutical composition according to any one of claims 3945, wherein: 1) One of the recruitment domains A and A' is a domain GCN4, and the other is a domain scFv; or 2) One of the recruitment domains A and A' is a GFP11 fragment, and the other domain is GFP1-10; or 3) One of the recruitment domains A and A' is GVKESLV, and the other of the domains is the PDZ protein domain.
47. The pharmaceutical composition according to any one of claims 39-46, wherein the complex peptide comprises the following characteristics: 1) One of the first fusion and the second fusion contains DNMT(3A-3L)-dCas9 or TALE-n×GCN4, and the other fusion contains a transcriptional repressor domain -scFv; or 2) One of the first fusion compound and the second fusion compound contains DNMT(3A-3L)-dCas9 or TALE-scFv, and the other fusion compound contains a transcriptional repressor domain -GCN4; or 3) One of the first fusion and the second fusion contains DNMT(3A-3L)-dCas9 or TALE-n×GFP11, and the other fusion contains a transcriptional repressor domain -GFP1-10; or 4) One of the first fusion and the second fusion contains DNMT(3A-3L)-dCas9 or TALE-GFP1-10, and the other fusion contains a transcriptional repressor domain-GFP11; or 5) One of the first fusion and the second fusion contains DNMT(3A-3L)-dCas9 or TALE-n×GCN4, and the other fusion contains an scFv-transcriptional repressor domain; or 6) One of the first fusion and the second fusion contains DNMT(3A-3L)-dCas9 or TALE-scFv, and the other fusion contains a GCN4-transcriptional repressor domain; or 7) One of the first fusion and the second fusion contains DNMT(3A-3L)-dCas9 or TALE-n×GFP11, and the other fusion contains a GFP1-10-transcriptional repressor domain; or 8) One of the first fusion and the second fusion comprises DNMT(3A-3L)-dCas9 or TALE-GFP1-10, and the other fusion comprises a GFP11-transcriptional repressor domain; or 9) One of the first fusion and the second fusion contains an n×GCN4-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-scFv; or 10) One of the first fusion and the second fusion contains an scFv-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GCN4; or 11) One of the first fusion and the second fusion contains an n×GFP11-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GFP1-10; or 12) One of the first fusion and the second fusion contains a GFP1-10-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GFP11; or 13) One of the first fusion and the second fusion contains an n×GCN4-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains scFv-DNMT(3A-3L); or 14) One of the first fusion and the second fusion contains an scFv-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains a GCN4-DNMT(3A-3L); or 15) One of the first fusion and the second fusion contains an n×GFP11-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains GFP1-10-DNMT(3A-3L); or 16) One of the first fusion and the second fusion contains a GFP1-10-dCas9 or TALE-transcriptional repressor domain, and the other fusion contains a GFP11-DNMT(3A-3L); or 17) One of the first fusion and the second fusion contains an scFv-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-n×GCN4-dCas9 or TALE; or 18) One of the first fusion and the second fusion contains an scFv-transcriptional repressor domain, and the other fusion contains dCas9 or TALE-DNMT(3A-3L)-n×GCN4; or 19) One of the first fusion and the second fusion contains an scFv-transcriptional repressor domain, and the other fusion contains dCas9 or TALE-n×GCN4-DNMT(3A-3L); in, DNMT(3A-3L) indicates that DNMT3A and DNMT3L are directly or indirectly connected in any order, and - indicates that the domains at both ends are directly or indirectly connected in order from the N end to the C end; n×GCN4 or n×GFP11 represent n copies of GCN4 connected by the adapter sequence or n copies of GFP11 connected by the adapter sequence, respectively, where n is selected from any integer from 1 to 20.
48. The pharmaceutical composition according to any one of claims 1-47, wherein the fusion peptide or complex peptide further comprises a nuclear localization signal and / or marker domain.
49. The pharmaceutical composition according to any one of claims 1-48, wherein the epigenetic modifying pharmaceutical ingredient is capable of providing modification of at least one nucleotide in the vicinity of the HBV gene and / or within the HBV gene regulatory element.
50. The pharmaceutical composition according to any one of claims 1-49, wherein the small nucleic acid pharmaceutical component is selected from one or more of antisense oligonucleotides (ASO), small interfering RNA (siRNA), microRNA (miRNA), small activating RNA (saRNA), messenger RNA (mRNA), and RNA aptamers.
51. The pharmaceutical composition according to any one of claims 1-50, wherein the small nucleic acid pharmaceutical component targets HBV mRNA.
52. The pharmaceutical composition according to any one of claims 1-51, wherein the small nucleic acid pharmaceutical component comprises ASO.
53. The pharmaceutical composition according to claim 52, wherein the ASO comprises the nucleotide sequence shown in SEQ ID NO: 9439.
54. The pharmaceutical composition according to claim 53, wherein the sequence of the ASO comprises the following modification: (MOE-G)s(5-Me-MOE-C)s(MOE-A)s(MOE-G)s(MOE-A)sGsGsTsGsAsAsGs(5-Me-C)sGsAs(MOE-A)s(MOE-G)s(MOE-T)s(MOE-G)s(5-Me-MOE-C), wherein, A, C, T, and G represent adenine, cytosine, thymine, and guanine, respectively. 5-Me indicates 5-methylcytosine modification, MOE indicates 2'-O-2-methoxyethyl modification, and s indicates thiophosphorylation modification on the nucleotide backbone.
55. The pharmaceutical composition according to any one of claims 1-54, further comprising a pharmaceutically acceptable carrier.
56. A method for regulating the expression of hepatitis B virus (HBV) gene products in cells, the method comprising introducing the pharmaceutical composition of any one of claims 1-55 into cells containing the HBV gene.
57. The method of claim 56, wherein the method comprises contacting the pharmaceutical composition with the HBV gene and / or the HBV gene regulatory element within the cell.
58. The method of claim 57, wherein the regulatory element comprises a core promoter, a proximal promoter, a distal enhancer, a silencer, an insulator element, a boundary element, and / or a locus control region.
59. A method for treating or alleviating a disease or condition associated with hepatitis B virus (HBV) infection, the method comprising administering to a subject in need an effective amount of the pharmaceutical composition of any one of claims 1-55.
60. The method according to any one of claims 56-59, wherein the epigenetic drug component and the small nucleic acid drug component of the pharmaceutical composition are introduced into the cells or administered to the subject via a common or separate carrier.
61. The method according to claim 59 or 60, wherein the apparent modifying pharmaceutical component and the small nucleic acid pharmaceutical component of the pharmaceutical composition are each administered to the subject via the same or different routes of administration.
62. The method according to any one of claims 56-61, wherein the epigenetic drug component and the small nucleic acid drug component of the pharmaceutical composition are successively introduced into the cells or administered to the subject at the same time or within a specific time interval.
63. The method according to claim 60, wherein the carrier is a liposome or lipid nanoparticle (LNP).
64. The method according to claim 63, wherein the liposome or the lipid nanoparticle comprises ionizable lipids (20%-70%, molar ratio), polyethylene glycol-modified lipids (0%-30%, molar ratio), supporting lipids (30%-50%, molar ratio) and cholesterol (10%-50%, molar ratio).
65. The method of claim 64, wherein the ionizable lipid is selected from pH-responsive ionizable lipids, thermoresponsive ionizable lipids, and photoresponsive ionizable lipids.
66. The method according to claim 60, wherein the vector is an adeno-associated virus (AAV) vector.
67. The method according to any one of claims 59-66, wherein the disease or condition associated with hepatitis B virus (HBV) infection includes hepatitis, cirrhosis, liver fibrosis, and hepatocellular carcinoma caused by HBV infection.
68. Use of the composition of any one of claims 1-55 for the preparation of a medicament for the treatment or relief of a disease or condition associated with hepatitis B virus (HBV) infection.