Capture oligonucleotide combination for nucleic acid amplification, kit, and method
By using site-specific cleavage nucleases and universal primer amplification systems, the interaction between multiple targets in PCR amplification and the shortcomings of bisulfite conversion methods were solved, achieving highly sensitive and specific detection of trace amounts of nucleic acid methylation status, simplifying the operation and improving detection efficiency.
Patent Information
- Application Number
- PCT/CN2025/141792
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-18
- Filing Date
- 2025-12-11
- Publication Date
- 2026-06-25
Smart Images

Figure CN2025141792_25062026_PF_FP_ABST
Abstract
Description
Capture oligonucleotide combinations, kits, and methods for nucleic acid amplification Technical Field
[0001] This invention relates to the field of detection technology, and more specifically, to a capture oligonucleotide combination, composition, kit, and method for nucleic acid amplification. Background Technology
[0002] Nucleic acid amplification has not only driven the development of basic biological research but also revolutionized analytical techniques in clinical science. These techniques include molecular cloning, nucleic acid sequencing, genotyping and mutation detection and identification, and quantitative detection of gene expression levels. In clinical research, due to sample scarcity and the increasing scale of projects, single-reaction detection methods are costly and inefficient. Therefore, developing clinically applicable nucleic acid amplification detection reagents is particularly important. However, current PCR amplification, which targets multiple targets, is prone to primer-dimer interactions or the generation of spurious amplicones from two different primers.
[0003] DNA methylation refers to the covalent bonding of a methyl group to the 5th carbon position of a cytosine CpG dinucleotide in the genome, facilitated by DNA methyltransferases. It can affect gene expression levels without altering the DNA sequence and is a crucial area of research in epigenetics. DNA methylation plays a vital role in the development and progression of many human diseases, such as cancer, cardiovascular disease, and diabetes, and is currently a hot topic in both basic and clinical research.
[0004] Early detection of tumors is crucial for increasing the probability of cure, reducing mortality, and improving quality of life. Liquid biopsies, represented by ctDNA, are non-invasive and can be repeated at different stages of tumor development, making them a key method for early tumor diagnosis. ctDNA collected from plasma and urine is increasingly becoming a source for tumor diagnosis, identifying tumor-originating cells by detecting tumor-specific mutations or DNA methylation patterns. However, cfDNA is present in extremely small amounts in bodily fluids; in healthy individuals, plasma cfDNA levels are only about 5-10 ng / ml. Therefore, the greatest technical challenge in cfDNA methylation detection lies in detecting extremely small amounts of abnormally methylated genes using minimal cfDNA samples.
[0005] Currently, bisulfite conversion is the mainstream method for cfDNA methylation detection. However, bisulfite conversion requires stringent chemical conditions, resulting in several drawbacks: 1) incomplete conversion leads to false positives; 2) the conversion process causes DNA degradation and fragmentation, reducing sensitivity; 3) the conversion process alters the base information in the sequence, leading to loss of sequence complexity and amplification bias; 4) cumbersome purification processes such as desulfonation are required for subsequent analysis. Furthermore, ctDNA also suffers from unique problems due to its high fragmentation and low concentration.
[0006] Therefore, developing a simple, rapid, highly sensitive, and highly specific method for detecting trace amounts of nucleic acids and their methylation status is a pressing challenge and pain point that needs to be addressed in this field. Summary of the Invention
[0007] The purpose of this invention is to provide a simple, rapid, highly sensitive, and highly specific method for detecting trace amounts of nucleic acids and their methylation status.
[0008] The inventors have developed a nucleic acid detection system that utilizes site-specific cleavage nucleases and universal primer amplification to detect trace amounts of nucleic acid and their methylation status. This system is simple, fast, highly sensitive, and highly specific.
[0009] In a first aspect of the invention, a capture oligonucleotide for nucleic acid amplification is provided, the capture oligonucleotide comprising a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' end sequence of a target molecule or at least partially identical to the 5' end sequence of the target molecule, and the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.
[0010] Optionally, the capturing oligonucleotide further includes an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the capturing sequence.
[0011] The universal sequence is independent of the target molecule sequence.
[0012] In another preferred embodiment, the capturing oligonucleotide further includes an enzyme cleavage recognition tag located at the 3' end of the universal sequence or at the 5' end of the capturing sequence.
[0013] In another preferred embodiment, the 3' end of the binding capture sequence is modified with a nucleic acid analog.
[0014] In another preferred embodiment, the nucleic acid analog modification is selected from the group consisting of: peptide nucleic acids, locked nucleic acids, transposed bases, spacers, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified bases, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoroRNA, 2'-fluoroRNA, or combinations thereof.
[0015] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the group consisting of: Spacer, amino, C6, methyl, azide, phosphoramide, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or combinations thereof.
[0016] In another preferred embodiment, the binding capture sequence is complementary to the terminal sequence of the target molecule.
[0017] In another preferred embodiment, the binding capture sequence is complementary to the non-5' end sequence of the target molecule.
[0018] In another preferred embodiment, the universal primer contains a sequence that is the same as or partially the same as the 5' end of the capturing oligonucleotide.
[0019] In another preferred embodiment, the enzyme recognition marker contained in the captured oligonucleotide is selected from the group consisting of: / idsP / , RNA base modification.
[0020] In another preferred embodiment, the enzyme that identifies the cleavage recognition marker contained in the captured oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme, and thermostable RNase H.
[0021] In another preferred embodiment, the target molecule is a target molecule with well-defined sequences at both the 3' and 5' ends. Preferably, the target molecule is the enzyme digestion product of a site-specific cleavage nuclease, such as a target molecule with well-defined sequences at both ends due to site-specific cleavage nuclease digestion.
[0022] In another preferred embodiment, the site-specific cleaving nuclease is an exonuclease and / or an endonuclease.
[0023] In another preferred embodiment, the site-specific cleaving nuclease is selected from the group consisting of: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., restriction endonucleases such as Msp I, Xmal, etc.), methylation-dependent restriction endonuclease, methylation-sensitive restriction endonuclease, cleavage enzyme, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or combinations thereof.
[0024] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0025] In another preferred embodiment, the CRISPR-Cas system comprises a guide short RNA that matches the target DNA fragment and an endonuclease that can recognize and cleave a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12, or Cas13.
[0026] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspE I, MspJI, LpnPI, or combinations thereof.
[0027] In a second aspect of the invention, a combination of capture oligonucleotides for nucleic acid amplification is provided, the combination comprising a reverse capture oligonucleotide and a forward capture oligonucleotide:
[0028] (1) The reverse capture oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence (3a) and a first binding capture sequence (2a); wherein,
[0029] The first binding capture sequence (2a) is complementary to the 3' end sequence of the target molecule;
[0030] The reverse capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the first binding capture sequence;
[0031] (2) The positive capture oligonucleotide includes a second universal sequence (4s) and a second binding capture sequence (1s) from the 5' end to the 3' end;
[0032] The second binding capture sequence (1s) is at least partially identical to the 5' end sequence of the target molecule;
[0033] The positive capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the second binding capture sequence (1s);
[0034] Choose any location
[0035] The reverse capture oligonucleotide also includes an enzyme recognition marker located at the 3' end of the first universal sequence or the 5' end of the first binding capture sequence;
[0036] The positive capture oligonucleotide also includes an enzyme cleavage recognition marker located at the 3' end of the second universal sequence or the 5' end of the second binding capture sequence;
[0037] The universal sequence is independent of the target molecule sequence.
[0038] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the group consisting of: Spacer, amino, C6, methyl, azide, phosphoramide, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or combinations thereof.
[0039] In another preferred embodiment, the 3' end of the first binding capture sequence and / or the 3' end of the second binding capture sequence are modified with nucleic acid analogs.
[0040] In another preferred embodiment, the nucleic acid analog modification is selected from the group consisting of: peptide nucleic acids, locked nucleic acids, transposed bases, spacers, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified bases, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoroRNA, 2'-fluoroRNA, or combinations thereof.
[0041] In another preferred embodiment, the universal primer contains a sequence that is the same as or partially the same as the 5' end of the capturing oligonucleotide.
[0042] In another preferred embodiment, the enzyme recognition marker contained in the captured oligonucleotide is selected from the group consisting of: / idsP / , RNA base modification.
[0043] In another preferred embodiment, the enzyme that identifies the cleavage recognition marker contained in the captured oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme, and thermostable RNase H.
[0044] In another preferred embodiment, the target molecule is a target molecule with well-defined sequences at both the 3' and 5' ends. Preferably, the target molecule is the enzyme digestion product of a site-specific cleavage nuclease, such as a target molecule with well-defined sequences at both ends due to site-specific cleavage nuclease digestion.
[0045] In another preferred embodiment, the site-specific cleaving nuclease is an exonuclease and / or an endonuclease.
[0046] In another preferred embodiment, the site-specific cleaving nuclease is selected from the group consisting of: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., restriction endonucleases such as Msp I, Xmal, etc.), methylation-dependent restriction endonuclease, methylation-sensitive restriction endonuclease, cleavage enzyme, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or combinations thereof.
[0047] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0048] In another preferred embodiment, the CRISPR-Cas system comprises a guide short RNA that matches the target DNA fragment and an endonuclease that can recognize and cleave a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12, or Cas13.
[0049] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspE I, MspJI, LpnPI, or combinations thereof.
[0050] In a third aspect, the present invention provides a composition or kit for nucleic acid amplification, said composition or kit comprising the capturing oligonucleotides described in the first aspect of the present invention or the combination of capturing oligonucleotides described in the second aspect of the present invention.
[0051] In another preferred embodiment, the capturing oligonucleotide is the capturing oligonucleotide described in the first aspect of the present invention or the capturing oligonucleotide combination described in the second aspect of the present invention.
[0052] In another preferred embodiment, the capturing oligonucleotide is a reverse capturing oligonucleotide and / or a forward capturing oligonucleotide in the combination of capturing oligonucleotides described in the second aspect of the present invention.
[0053] In another preferred embodiment, the composition or kit is a composition or kit for nucleic acid detection.
[0054] In another preferred embodiment, the composition or kit includes a capture oligonucleotide combination 1 and a capture oligonucleotide combination 2, wherein the capture oligonucleotide combination 1 includes a forward capture oligonucleotide and a reverse capture oligonucleotide targeting target molecule 1; and the capture oligonucleotide combination 2 includes a forward capture oligonucleotide and a reverse capture oligonucleotide targeting target molecule 2.
[0055] In another preferred embodiment, the composition or kit includes a capturing oligonucleotide and a universal primer, the capturing oligonucleotide comprising a universal sequence and a binding capturing sequence from 5' to 3', wherein the binding capturing sequence is complementary to the 3' end sequence of the target molecule or at least partially identical to the 5' end sequence of the target molecule, and the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capturing sequence.
[0056] In another preferred embodiment, the capturing oligonucleotide further includes an enzyme cleavage recognition marker located at the 3' end of the universal sequence or at the 5' end of the capturing sequence.
[0057] In another preferred embodiment, the composition or kit further includes a target molecule pre-sequence pretreatment reagent.
[0058] In another preferred embodiment, the target molecule pre-sequence pretreatment reagent includes a site-specific cleavage nuclease.
[0059] In another preferred embodiment, the composition or kit further includes a site-specific cleavage nuclease.
[0060] In another preferred embodiment, the site-specific cleaving nuclease is selected from the group consisting of exonucleases, endonucleases, or combinations thereof.
[0061] In another preferred embodiment, the site-specific cleaving nuclease is selected from the group consisting of: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., restriction endonucleases such as Msp I, Xmal, etc.), methylation-dependent restriction endonuclease, methylation-sensitive restriction endonuclease, cleavage enzyme, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or combinations thereof.
[0062] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0063] In another preferred embodiment, the CRISPR-Cas system comprises a guide short RNA that matches the target DNA fragment and an endonuclease that can recognize and cleave a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12, or Cas13.
[0064] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspE I, MspJI, LpnPI, or combinations thereof.
[0065] In another preferred embodiment, the composition or kit further includes DNA polymerase, dNTPs, and Mg. 2+ , or combinations thereof.
[0066] In another preferred embodiment, the composition or kit further includes an enzyme digestion buffer and / or a PCR buffer.
[0067] In another preferred embodiment, the composition or kit further includes universal primers.
[0068] (1) The universal primers are independent of the target molecule sequence; and
[0069] (2) The universal primer contains the same or partially the same sequence as the capturing oligonucleotide (5' end);
[0070] Preferably, the first universal primer is identical or partially identical to the 5' end sequence of the reverse capture oligonucleotide, or the second universal primer is identical or partially identical to the 5' end sequence of the forward capture oligonucleotide.
[0071] In another preferred embodiment, the first universal primer is the same as or partially the same as the first universal sequence.
[0072] In another preferred embodiment, the 3' terminal sequence of the first universal primer has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 identical bases to the first universal sequence.
[0073] In another preferred embodiment, the 3' terminal sequence of the first universal primer is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the first universal sequence.
[0074] In another preferred embodiment, the second universal primer is the same as or partially the same as the second universal sequence.
[0075] In another preferred embodiment, the 3' end sequence of the second universal primer has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 identical bases to the second universal sequence.
[0076] In another preferred embodiment, the 3' end sequence of the second universal primer is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the second universal sequence.
[0077] In another preferred embodiment, the composition or kit further includes universal primers and / or detection probes.
[0078] In another preferred embodiment, the composition or kit further includes a detection probe.
[0079] In another preferred embodiment, the detection probe is labeled with a fluorescent group and / or a quenching group.
[0080] In another preferred embodiment, the fluorescent group is labeled on the 5' end of the detection probe; the quenching group is labeled on the 3' end of the detection probe.
[0081] In another preferred embodiment, the fluorescent group is selected from the group consisting of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LC RED460, or combinations thereof; the quenching group is selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or combinations thereof.
[0082] A fourth aspect of the present invention provides a method for nucleic acid amplification or detection, the method comprising the step of employing a capture oligonucleotide to bind a target molecule, the capture oligonucleotide being as described in the first aspect of the present invention.
[0083] In another preferred embodiment, the capturing oligonucleotide is the capturing oligonucleotide described in the first aspect of the present invention or the capturing oligonucleotide combination described in the second aspect of the present invention.
[0084] In another preferred embodiment, the capturing oligonucleotide is a reverse capturing oligonucleotide and / or a forward capturing oligonucleotide in the combination of capturing oligonucleotides described in the second aspect of the present invention.
[0085] In another preferred embodiment, the method includes the steps of processing the linear extension product of the target molecule and then amplifying it using universal primers and / or capturing oligonucleotides to obtain the amplified product.
[0086] In another preferred embodiment, the present invention provides a method for nucleic acid amplification or detection, the method comprising the steps of:
[0087] (a) Using capture oligonucleotides to bind to target molecules (i.e., using capture oligonucleotides to bind to target molecules);
[0088] (b) Linear elongation of the target molecule;
[0089] (d) Exponential amplification using universal primers,
[0090] The capturing oligonucleotide is the capturing oligonucleotide described in the first aspect of this invention or the reverse capturing oligonucleotide and / or forward capturing oligonucleotide combination described in the second aspect of this invention. The universal primer is independent of the target molecule sequence.
[0091] Typically, the capturing oligonucleotide from 5' to 3' includes a universal sequence and a binding capture sequence, wherein the binding capture sequence is complementary to the 3' end sequence of the target molecule or at least partially identical to the 5' end sequence of the target molecule, and the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is independent of the target molecule sequence.
[0092] In another preferred embodiment, the method (direct method) includes:
[0093] (1) Reverse capture oligonucleotides bind to target molecules with clearly defined 3' end sequences by binding to the capture sequence;
[0094] (2) The target molecule extends using the reverse capture oligonucleotide as a template. A sequence (3s) complementary to the first universal sequence (3a) is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0095] (3) The 3' end of the linear extension product of the target molecule binds complementary to the first universal primer (3a);
[0096] (4) The first universal primer is used as a template for the linear extension product of the target molecule to carry out the extension reaction. A sequence complementary to the linear extension product of the target molecule is added to the 3' end of the first universal primer to obtain the linear extension product of the first universal primer (3a) (3'1a-2a-3a 5').
[0097] (5) The forward-capture oligonucleotide binds complementary to the linear extension product of the first universal primer.
[0098] (6) The linear extension product of the first universal primer is extended using the forward-capture oligonucleotide as a template. A sequence (4a) complementary to the second universal sequence (4s) is added to the 3' end of the linear extension product of the first universal primer to obtain the linear extension product of the second universal primer (3'4a-1a-2a-3a 5'). The linear extension product of the second universal primer is a single-stranded product containing the first universal primer sequence (3a) and the complementary sequence of the second universal primer (4a) at the 5' and 3' ends, respectively, and containing the complementary sequence of the target molecule in the middle.
[0099] (7) The first universal primer and the second universal primer are used as templates for exponential amplification to obtain the amplified product.
[0100] In another preferred embodiment, the method further includes the step of: (8) using a probe and detecting the probe signal, or using capillary electrophoresis for detection.
[0101] In another preferred embodiment, the capturing oligonucleotide further includes an enzyme cleavage recognition tag located at the 3' end of the universal sequence or at the 5' end of the capturing sequence.
[0102] In another preferred embodiment, the method includes the steps of:
[0103] (a) Using capture oligonucleotides to bind to target molecules (i.e., using capture oligonucleotides to bind to target molecules);
[0104] (b) Linear elongation of the target molecule;
[0105] (c) Enzyme-specific recognition and cleavage;
[0106] (d) Exponential amplification using universal primers;
[0107] The capturing oligonucleotide is the capturing oligonucleotide described in the first aspect of this invention or the reverse capturing oligonucleotide and / or forward capturing oligonucleotide combination described in the second aspect of this invention. The universal primer is independent of the target molecule sequence.
[0108] Typically, the capturing oligonucleotide from 5' to 3' includes a universal sequence and a binding capture sequence, wherein the binding capture sequence is complementary to the 3' end sequence of the target molecule or at least partially identical to the 5' end sequence of the target molecule, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the capturing oligonucleotide further includes an enzyme cleavage recognition tag located at the 3' end of the universal sequence or the 5' end of the binding capture sequence, wherein the universal primer is independent of the target molecule sequence.
[0109] In another preferred embodiment, the method (cutting method) includes:
[0110] (1) Reverse capture oligonucleotides bind to target molecules with well-defined 3' end sequences by binding to the capture sequence.
[0111] (2) The target molecule extends using the reverse capture oligonucleotide as a template. A sequence (3s) complementary to the first universal primer (3a) is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0112] (3) The enzyme specifically recognizes the cleavage site in the target molecule's linear elongation product and reverse capture oligonucleotide binding dimer and cleaves it, yielding a reverse capture oligonucleotide cleavage product containing a free 3' end.
[0113] (4) The reverse capture oligonucleotide cleavage product containing a free 3' end is used as a template for the extension reaction. The complementary sequence of the target molecule is added to the 3' end of the reverse capture oligonucleotide cleavage product containing a free 3' end to obtain the linear extension product of the first universal primer.
[0114] (5) The forward-capture oligonucleotide binds complementary to the linear extension product of the first universal primer.
[0115] (6) The linear extension product of the first universal primer is extended using the forward-capture oligonucleotide as a template. The complementary sequence (4a) of the second universal primer is added to the 3' end of the linear extension product of the first universal primer to obtain the linear extension product of the second universal primer (3'4a-1a-2a-3a 5'). The linear extension product of the second universal primer is a single-stranded product containing the first universal primer sequence (3a) and the complementary sequence of the second universal primer (4a) at the 5' and 3' ends, respectively, and containing the complementary sequence of the target molecule in the middle.
[0116] (7) The linear extension product of the second universal primer can be exponentially amplified based on reverse capture oligonucleotides and forward capture oligonucleotides under the enzyme-specific recognition, or directly based on the first universal primer and the second universal primer to obtain the amplified product.
[0117] In another preferred embodiment, the method further includes the step of: (8) using a probe and detecting the probe signal, or using capillary electrophoresis for detection.
[0118] In another preferred embodiment, the universal primer contains a sequence that is the same as or partially the same as the 5' end of the capturing oligonucleotide.
[0119] In another preferred embodiment, the first universal primer is the same as or partially the same as the first universal sequence.
[0120] In another preferred embodiment, the 3' terminal sequence of the first universal primer has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 identical bases to the first universal sequence.
[0121] In another preferred embodiment, the 3' terminal sequence of the first universal primer is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the first universal sequence.
[0122] In another preferred embodiment, the second universal primer is the same as or partially the same as the second universal sequence.
[0123] In another preferred embodiment, the 3' end sequence of the second universal primer has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 identical bases to the second universal sequence.
[0124] In another preferred embodiment, the 3' end sequence of the second universal primer is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the second universal sequence.
[0125] In another preferred embodiment, the target molecule is a target molecule with well-defined 3' and 5' end sequences.
[0126] In another preferred embodiment, the target molecule is the cleavage product of a site-specific cleaving nuclease.
[0127] In another preferred embodiment, the target molecule with well-defined 3' and 5' end sequences is a DNA digestion product of a site-specific cleavage nuclease, preferably a target molecule with well-defined sequences at both ends due to site-specific cleavage nuclease digestion.
[0128] In another preferred embodiment, the DNA comprises cfDNA.
[0129] In another preferred embodiment, the binding capture sequence of the reverse capture oligonucleotide and the forward capture oligonucleotide has a nucleic acid analog modification at its 3' end and a nucleic acid extension blocking modification at its 3' end.
[0130] In another preferred embodiment, the method further includes the use of / idsP / and RNA base modification.
[0131] In another preferred embodiment, the 3' end of the universal sequence contained in the captured oligonucleotide or the 5' end of the enzyme digestion recognition marker that binds to the captured sequence is selected from one or more of the following: / idsP / and RNA base modification.
[0132] In another preferred embodiment, the enzyme that identifies the cleavage recognition marker contained in the captured oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme, and thermostable RNase H.
[0133] In another preferred embodiment, the site-specific cleaving nuclease is an exonuclease and / or an endonuclease.
[0134] In another preferred embodiment, the endonuclease is a restriction endonuclease.
[0135] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0136] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspEI, MspJI, LpnPI, or combinations thereof.
[0137] A fifth aspect of the present invention also provides a nucleic acid detection system, the system comprising the capture oligonucleotides of the first aspect of the present invention, or the capture oligonucleotide combination of the second aspect of the present invention, or the composition or kit of the third aspect of the present invention, Taq polymerase, dNTPs, MgCl2, and PCR buffer.
[0138] In another preferred embodiment, the system comprises 1–100 nM of the capture oligonucleotides described in the first aspect of the invention or the capture oligonucleotide combination described in the second aspect of the invention, 1–5 U (preferably 1–2 U) of Taq polymerase, 50–500 μM (preferably 100–300 μM) of dNTPs, 1–5 mM (preferably 1–3 mM) of MgCl2, and PCR buffer.
[0139] In another preferred embodiment, the system further includes primers (universal primers) and probes (specific probes, universal probes).
[0140] In another preferred embodiment, the system further includes 100–800 nM (preferably 100–400 nM) universal primers.
[0141] In another preferred embodiment, the system further includes a 100–600 nM (preferably 100–300 nM) probe.
[0142] In another preferred embodiment, the system further includes at least 20 U (preferably 1–10 U) of 3'Tth endonuclease, a thermostable mismatch repair enzyme, and / or a thermostable RNase H enzyme.
[0143] In one or more embodiments, the universal primers and probes are as described in the third aspect of the present invention.
[0144] In one or more embodiments, the system further includes 1-20 U (preferably 5-15 U) of site-specific cleaving nucleases; preferably exonucleases and / or endonucleases.
[0145] In another preferred embodiment, the endonuclease is a restriction endonuclease.
[0146] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0147] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspEI, MspJI, and LpnPI, or combinations thereof.
[0148] In another preferred embodiment, the method includes the steps of:
[0149] (a) Using a capture oligonucleotide targeting target molecule 1 to bind target molecule 1, and using a capture oligonucleotide targeting target molecule 2 to bind target molecule 2.
[0150] (b) Target molecule 1 and target molecule 2 are linearly extended respectively;
[0151] (c) Optionally, enzyme-specific recognition and cleavage;
[0152] (d) Exponential amplification using universal primers;
[0153] The capturing oligonucleotide is the capturing oligonucleotide described in the first aspect of the present invention or the reverse capturing oligonucleotide and / or forward capturing oligonucleotide in the combination of capturing oligonucleotides described in the second aspect of the present invention, and the universal primer is independent of the target molecule sequence.
[0154] In a sixth aspect of the invention, the application of the capturing oligonucleotides described in the first aspect of the invention, the capturing oligonucleotide combinations described in the second aspect of the invention, the compositions or kits described in the third aspect of the invention, and / or the nucleic acid detection system described in the fifth aspect of the invention in the preparation of nucleic acid detection products is provided.
[0155] In another preferred embodiment, the nucleic acid detection product is a DNA methylation detection product.
[0156] In another preferred embodiment, the product is selected from reagent kits, devices, and computer-readable media.
[0157] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and are not intended to limit this disclosure. Attached Figure Description
[0158] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention. It is obvious that the drawings described below are merely some embodiments of the invention, and those skilled in the art can obtain other drawings based on these drawings without any inventive effort.
[0159] Figure 1 shows (A) the amplification principle of captured oligonucleotides without enzyme digestion recognition markers; and (B) the amplification results of captured oligonucleotides without enzyme digestion recognition markers.
[0160] Figure 2 shows (A) the amplification principle of captured oligonucleotides containing enzyme digestion recognition markers; and (B) the amplification results of captured oligonucleotides containing enzyme digestion recognition markers.
[0161] Figure 3 shows the design of capture oligonucleotides with different amplification principles that do not contain enzyme digestion recognition markers; 1 / 3 / 5 are capture oligonucleotides with universal primer sequences containing hairpin structures; 2 / 4 / 6 are capture oligonucleotides with universal primer sequences not containing hairpin structures. 1 / 2 represents 2000 copies / reaction; 3 / 4 represents 200 copies / reaction; 5 / 6 represents negative controls.
[0162] Figure 4 shows the addition of a universal probe sequence to the captured oligonucleotide; 1 / 3 / 5 are target molecule-specific probe detections; 2 / 4 / 6 are universal probe detections. 1 / 2 represents 2000 copies / reaction; 3 / 4 represents 200 copies / reaction; 5 / 6 are negative controls.
[0163] Figure 5 shows the sensitivity test results. The target molecule concentrations for 1, 2, and 3 were 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, while 4 was the negative control.
[0164] Figure 6 shows the methylation detection results of oligonucleotides captured by locked nucleic acid modification. The target molecule concentrations in 1, 2, and 3 were 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, while 4 was the negative control.
[0165] Figure 7 shows the results of LINE-1 gene demethylation based on methylation-sensitive restriction endonuclease treatment.
[0166] Figure 8 shows the detection of Mycobacterium tuberculosis based on methylation-sensitive restriction endonuclease treatment. The target molecule concentrations for 1 / 2 / 3 / 4 are 2000 copies / reaction, 1000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, with 5 serving as the negative control.
[0167] Figure 9 shows that both hypermethylation and hypomethylation can be detected simultaneously. The first and fourth peaks are identified as 20 bp and 1000 bp markers, respectively, with MigrationTime representing the migration time. The second peak represents hypomethylation, and the third peak represents hypermethylation. Detailed Implementation
[0168] Exemplary embodiments will now be described more fully with reference to the accompanying drawings. However, these exemplary embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, they are provided so that the invention will be thorough and complete, and the concept of the exemplary embodiments will be fully conveyed to those skilled in the art.
[0169] Unless otherwise defined, all terms and phrases used herein include their meanings as they have in the art, unless explicitly stated otherwise or clearly indicated from the context of their use. While any methods and materials similar to or equivalent to those described herein may be used in carrying out or testing the invention, specific methods and materials are now described.
[0170] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as embodiments) can be combined with each other to form preferred technical solutions.
[0171] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time the method of capturing target molecules using capture oligonucleotides, followed by extension of the target molecules using the capture oligonucleotides as templates, and then linear amplification using universal primers. This yields an intermediate sequence containing different universal primer sequences at both ends, which can be exponentially amplified by universal primers, with the target molecule sequence in the middle. Subsequently, exponential amplification guided by universal primers and / or capture oligonucleotides is performed on the intermediate sequence obtained from linear amplification. Based on this, the present invention was completed.
[0172] Capture oligonucleotides
[0173] This invention provides a capture oligonucleotide for nucleic acid amplification, wherein the capture oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' end sequence of the target molecule or at least partially identical to the 5' end sequence of the target molecule, and the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.
[0174] Optionally, the capturing oligonucleotide further includes an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end that binds to the capturing sequence.
[0175] The universal sequence is independent of the target molecule sequence.
[0176] Typically, the capture oligonucleotides described in this invention also include nucleic acid analog modifications.
[0177] The complementarity described herein includes complete complementarity and partial complementarity. Generally, for a nucleic acid strand requiring extension, its 3' end sequence must be at least 90% complementary to the corresponding complementary strand, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or completely complementary, as long as it does not affect the extension of the nucleic acid strand. For example, in the complementarity of the binding capture sequence of a target molecule and a capturing oligonucleotide, the target molecule is the nucleic acid strand requiring extension, and its 3' end sequence is at least 90% complementary or completely complementary to the binding capture sequence (i.e., the 3' end nucleic acid of the target molecule has a paired base on the capturing oligonucleotide). As another example, in the complementarity of a universal primer and the linear extension product of a target molecule, the universal primer is the nucleic acid strand requiring extension, and its 3' end sequence is at least 90% complementary or completely complementary to the linear extension product sequence of the target molecule.
[0178] The target molecule, with clearly defined 3' and 5' sequence information, binds complementary to the binding capture sequence of the capturing oligonucleotide. Subsequently, using the capturing oligonucleotide as a template, extension occurs by adding the complementary strand of the first universal primer sequence to the 3' end of the target molecule (as shown in Figures 1A and 1B). To prevent the capturing oligonucleotide itself from extending, it may optionally include a nucleic acid extension blocking modification. This nucleic acid extension blocking modification is typically located at the 3' end of the binding capture sequence. The nucleic acid extension blocking modification contains substances that can block DNA polymerase extension, preventing the capturing oligonucleotide from extending to the 3' end and thus forming a complementary strand of the target molecule that affects the subsequent binding and extension of the capturing oligonucleotide. Modifications that can block DNA polymerase extension include: spacers, thio groups, thiol groups, amino or uracil bases.
[0179] In this embodiment of the invention, the capture oligonucleotide having the aforementioned nucleic acid extension modification is modified with a spacer to bind the capture sequence. To further enhance the effect of nucleic acid extension blocking, a nucleic acid analog modification may also be included at the 3' end of the binding capture sequence of the capture oligonucleotide. The nucleic acid analog comprises one or more selected from the following: peptide nucleic acid, locked nucleic acid, 2'-O,4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, or 2'-fluoroRNA.
[0180] In this invention, in embodiments requiring enzyme recognition and cleavage for amplification, an enzyme recognition marker can be added to the 3' end of the universal sequence of the captured oligonucleotide or the 5' end of the sequence binding to the captured oligonucleotide. This generates free ends through enzyme recognition and cleavage, thereby enabling extension and amplification. The enzyme recognition marker modification includes / idsP / and RNA base modification. The recognition enzyme includes a 3' Tth endonuclease, a thermostable mismatch repair enzyme, and a thermostable RNase H.
[0181] Typically, during use, capturing oligonucleotides can appear in pairs to form a capturing oligonucleotide combination (a pair of capturing oligonucleotides), including a reverse capturing oligonucleotide and a forward capturing oligonucleotide. The reverse capturing oligonucleotide includes a first universal sequence (3a) and a first binding capturing sequence (2a) from the 5' end to the 3' end, and the forward capturing oligonucleotide includes a second universal sequence (4s) and a second binding capturing sequence (1s) from the 5' end to the 3' end.
[0182] In this invention, the universal sequence can be a synthetically produced sequence. Therefore, when detecting different target molecules, only the binding capture sequence of the capturing oligonucleotide needs to be designed according to the target molecule, while the universal sequence remains unchanged. In some embodiments, to reduce non-specific amplification, binding capture sequences of the capturing oligonucleotide are designed according to different target molecules, while the universal sequence remains unchanged, thereby achieving multiplex amplification detection. The length or base ratio of the universal sequence (universal primer) can be routinely adjusted according to the composition, length, and required specificity of the sequence to be amplified.
[0183] Typically, in this invention, when using a combination of capture oligonucleotides, the first universal sequence and the second universal sequence can be synthetically produced sequences. Therefore, when detecting different target molecules, only the binding capture sequence of the capture oligonucleotide needs to be designed according to the target molecule, while the first and second universal sequences remain unchanged. In some embodiments, to reduce non-specific amplification, the binding capture sequence of the capture oligonucleotide is designed according to different target molecules, while the first and second universal sequences remain unchanged, thereby achieving multiplex amplification detection. The length or base ratio of the universal sequence (universal primer) can be routinely adjusted according to the composition, length, and required specificity of the sequence to be amplified.
[0184] Capture oligonucleotide combinatorial
[0185] This invention provides a combination of capture oligonucleotides for nucleic acid amplification, the combination comprising reverse capture oligonucleotides and forward capture oligonucleotides:
[0186] (1) The reverse capture oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence (3a) and a first binding capture sequence (2a); wherein,
[0187] The first binding capture sequence (2a) is complementary to the 3' end sequence of the target molecule;
[0188] The reverse capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the first binding capture sequence;
[0189] (2) The positive capture oligonucleotide includes a second universal sequence (4s) and a second binding capture sequence (1s) from the 5' end to the 3' end;
[0190] The second binding capture sequence (1s) is at least partially identical to the 5' end sequence of the target molecule;
[0191] The positive capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the second binding capture sequence (1s);
[0192] Choose any location
[0193] The reverse capture oligonucleotide also includes an enzyme recognition marker located at the 3' end of the first universal sequence or the 5' end of the first binding capture sequence;
[0194] The positive capture oligonucleotide also includes an enzyme recognition marker located at the 3' end of the second universal sequence or the 5' end of the second binding capture sequence.
[0195] In a preferred embodiment of the present invention, the capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3'. The binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide further include a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is independent of the target molecule sequence.
[0196] In another preferred embodiment of the present invention, the capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3'. The binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide further include a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence and an enzyme digestion recognition marker located at the 3' end of the universal sequence or the 5' end of the binding capture sequence, wherein the universal primer is independent of the target molecule sequence.
[0197] target molecules
[0198] In this invention, the target molecule can be a target molecule with clearly defined 3' and 5' sequence information (i.e., a well-defined sequence), or a target molecule with clearly defined 3' and 5' sequence information generated through biological treatment. The types of nucleic acid sequences with clearly defined 3' and 5' sequence information include normal nucleic acid sequences, modified nucleic acid sequences, single nucleotide mutations, sequence transpositions, sequence deletions, and sequence recombinations, among others.
[0199] Target molecules with clearly defined 3' and 5' end sequences, such as mature microRNAs, microRNA precursors, and cfDNA.
[0200] Intermediate products of target molecules with clearly defined 3' and 5' sequence information can be obtained through biological methods of cutting or blocking. These include products cleaved by site-specific nucleases, such as AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), restriction endonucleases, methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, giant nucleases, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), CRISPR-Cas systems, and mismatch repair enzymes. Methylation-dependent restriction endonucleases include GlaI, FspEI, MspJI, and LpnPI; methylation-sensitive restriction endonucleases include Hpa II and Sma I; restriction endonucleases include Msp I and Xmal; CRISPR-Cas systems contain a guide short RNA that matches the target DNA fragment and an endonuclease that recognizes and cuts a specific sequence, such as CRISPR-Cas systems based on Cas9, Cas12, or Cas13.
[0201] In this invention, the target molecule can be a single component including one of the above-mentioned target molecules, or it can be a multi-component mixture including multiple (two or more) of the above-mentioned target molecules.
[0202] In a specific embodiment of the present invention, the target molecule is a multi-component mixture formed by the enzymatic digestion product of human Septine 9 gene hypermethylation and the enzymatic digestion product of LINE-1 gene hypomethylation.
[0203] Compositions, reagent kits
[0204] The present invention provides a composition or kit for nucleic acid amplification, the composition or kit comprising the capture oligonucleotides or combinations of capture oligonucleotides described above.
[0205] Depending on the target molecule being detected, the kit of the present invention may include two or more capture oligonucleotide combinations, such as capture oligonucleotide combination 1, capture oligonucleotide combination 2, ... capture oligonucleotide combination N-1, capture oligonucleotide combination N, where N is a positive integer ≥3. Capture oligonucleotide combination 1 to capture oligonucleotide combination N may be capture oligonucleotide combinations targeting different structures of the same target molecule, or capture oligonucleotide combinations targeting different target molecules with different sequences.
[0206] In a typical example of the present invention, the capturing oligonucleotide combination 1 includes a straight-chain forward capturing oligonucleotide and a straight-chain reverse capturing oligonucleotide; the capturing oligonucleotide combination 2 includes a folded forward capturing oligonucleotide and a folded reverse capturing oligonucleotide.
[0207] In another typical example of the present invention, the capturing oligonucleotide combination 1 includes a forward capturing oligonucleotide and a reverse capturing oligonucleotide targeting target molecule 1; the capturing oligonucleotide combination 2 includes a forward capturing oligonucleotide and a reverse capturing oligonucleotide targeting target molecule 2.
[0208] Typically, the present invention provides compositions or kits comprising the capture oligonucleotides described in any of the embodiments for amplifying or detecting nucleic acids. Exemplary capture oligonucleotides are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:26. Exemplary modified capture oligonucleotides are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:26. Exemplary sequences of capture oligonucleotides with self-folding regions are shown in SEQ ID NO:9 and SEQ ID NO:10. The kit also includes reagents for generating target molecules with well-defined 3' and 5' end sequences (e.g., target molecule pre-sequence pretreatment reagents), such as the aforementioned site-specific cleavage nucleases. The kit also includes DNA polymerase, dNTPs, and Mg... 2+ Any one or more of the following: enzyme digestion buffer, PCR buffer.
[0209] In addition, the kit also includes universal primers. Specifically, the kit further includes universal primers as described above in this invention. Exemplary universal primers are shown in SEQ ID NO:3 or 4.
[0210] When detecting different target molecules, it is only necessary to design the binding capture sequence of specific capture oligonucleotides according to the target molecules, while the universal primers can remain unchanged.
[0211] To detect nucleic acids, the kit may also include probes (i.e., detection probes). In some embodiments, the probes are labeled with a fluorescent group and / or a quencher group. Typically, the fluorescent group is labeled at the 5' end of the detection probe, and the quencher group is labeled at the 3' end. The fluorescent group includes any one or more of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quencher group includes any one or more of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra. Exemplary probes are shown in SEQ ID NO: 5, 12, 17, or 21.
[0212] The kit may also include reagents required for sequencing, which are well known to those skilled in the art, such as polymerases, sequencing primers, etc.
[0213] Nucleic acid amplification or detection methods
[0214] The present invention provides a method for nucleic acid amplification or detection, the method comprising the step of using a capture oligonucleotide to bind a target molecule, wherein the capture oligonucleotide is as described in the first aspect of the present invention.
[0215] Typically, the nucleic acid amplification or detection method is a non-diagnostic nucleic acid amplification or detection method.
[0216] Generally, the method includes the following steps: (A) providing a capture oligonucleotide and a target molecule (or a pre-sequence of the target molecule); (B) performing an extension and amplification reaction between the capture oligonucleotide and the target molecule in a reaction system; and (C) detecting a signal; wherein the capture oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' end sequence of the target molecule or at least partially identical to the 5' end sequence of the target molecule, and the capture oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.
[0217] Optionally, the capturing oligonucleotide further includes an enzyme cleavage recognition tag located at the 3' end of the universal sequence or at the 5' end bound to the capturing sequence.
[0218] The universal primers are independent of the target molecule sequence.
[0219] Typically, the present invention provides a method for nucleic acid amplification or detection, the method comprising the steps of:
[0220] (a) Using capture oligonucleotides to bind to target molecules (i.e., using capture oligonucleotides to bind to target molecules);
[0221] (b) Linear elongation of the target molecule;
[0222] (d) Exponential amplification using universal primers,
[0223] The capturing oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' end sequence of the target molecule or at least partially identical to the 5' end sequence of the target molecule, and the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.
[0224] Optionally, the capturing oligonucleotide further includes an enzyme cleavage recognition tag located at the 3' end of the universal sequence or at the 5' end bound to the capturing sequence.
[0225] The universal primers are independent of the target molecule sequence.
[0226] In a preferred embodiment of the present invention, the nucleic acid amplification or detection method is a non-diagnostic nucleic acid amplification or detection method.
[0227] The nucleic acid amplification or detection methods can be further divided into cutting methods, which include step (c) enzyme-specific recognition and cutting, and direct methods, which do not include step (c).
[0228] In a preferred embodiment of the present invention, the direct method includes the steps of capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, and exponential amplification using universal primers. Specifically, the method includes:
[0229] (1) Reverse capture oligonucleotides bind to target molecules with well-defined 3' end sequences by binding to the capture sequence.
[0230] (2) The target molecule extends using the reverse capture oligonucleotide as a template. A sequence (3s) complementary to the first universal primer (3a) is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0231] (3) The 3' end of the linear extension product of the target molecule binds complementary to the first universal primer (3a).
[0232] (4) The first universal primer is used as a template for the linear extension product of the target molecule to perform the extension reaction. A sequence complementary to the linear extension product of the target molecule is added to the 3' end of the first universal primer to obtain the linear extension product of the first universal primer (3'1a-2a-3a 5').
[0233] (5) The forward-capture oligonucleotide binds complementary to the linear extension product of the first universal primer.
[0234] (6) The linear extension product of the first universal primer is extended using the forward-capture oligonucleotide as a template. The complementary sequence (4a) of the second universal primer (4s) is added to the 3' end of the linear extension product of the first universal primer to obtain the linear extension product of the second universal primer (3'4a-1a-2a-3a 5'). The linear extension product of the second universal primer is a single-stranded product containing the first universal primer sequence (3a) and the complementary sequence of the second universal primer (4a) at the 5' and 3' ends, respectively, and containing the complementary sequence of the target molecule in the middle.
[0235] (7) The first universal primer and the second universal primer are used as templates for exponential amplification to obtain the amplified product.
[0236] The amplification may also optionally include the use of probes.
[0237] In another preferred embodiment of the present invention, the cleavage method includes the steps of capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, enzyme-specific recognition and cleavage, and / or exponential amplification using universal primers. Specifically, the method includes:
[0238] (1) Reverse capture oligonucleotides bind to target molecules with well-defined 3' end sequences by binding to the capture sequence.
[0239] (2) The target molecule extends using the reverse capture oligonucleotide as a template. A sequence (3s) complementary to the first universal primer (3a) is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0240] (3) The enzyme specifically recognizes the cleavage site in the target molecule's linear elongation product and reverse capture oligonucleotide binding dimer and cleaves it, yielding a reverse capture oligonucleotide cleavage product containing a free 3' end.
[0241] (4) The reverse capture oligonucleotide cleavage product containing a free 3' end is used as a template for the extension reaction. The complementary sequence of the target molecule is added to the 3' end of the reverse capture oligonucleotide cleavage product containing a free 3' end to obtain the linear extension product of the first universal primer.
[0242] (5) The forward-capture oligonucleotide binds complementary to the linear extension product of the first universal primer.
[0243] (6) The linear extension product of the first universal primer is extended using the forward-capture oligonucleotide as a template. The complementary sequence (4a) of the second universal primer is added to the 3' end of the linear extension product of the first universal primer to obtain the linear extension product of the second universal primer (3'4a-1a-2a-3a 5'). The linear extension product of the second universal primer is a single-stranded product containing the first universal primer sequence (3a) and the complementary sequence of the second universal primer (4a) at the 5' and 3' ends, respectively, and containing the complementary sequence of the target molecule in the middle.
[0244] (7) The linear extension product of the second universal primer can be exponentially amplified based on reverse capture oligonucleotides and forward capture oligonucleotides under the enzyme-specific recognition, or directly based on the first universal primer and the second universal primer to obtain the amplified product.
[0245] The amplification may also optionally include the use of probes.
[0246] In another preferred embodiment of the invention, the method includes the steps of:
[0247] (a) Using a capture oligonucleotide targeting target molecule 1 to bind target molecule 1, and using a capture oligonucleotide targeting target molecule 2 to bind target molecule 2.
[0248] (b) Target molecule 1 and target molecule 2 are linearly extended respectively;
[0249] (c) Optionally, enzyme-specific recognition and cleavage;
[0250] (d) Exponential amplification using universal primers;
[0251] The capturing oligonucleotide is the capturing oligonucleotide described in the first aspect of the present invention or the reverse capturing oligonucleotide and / or forward capturing oligonucleotide in the combination of capturing oligonucleotides described in the second aspect of the present invention, and the universal primer is independent of the target molecule sequence.
[0252] Typically, for target molecule 1 and target molecule 2, depending on the different capture oligonucleotides used (containing or not containing enzyme recognition markers): (1) the same method can be used, for example, both using the direct method (capture oligonucleotides do not contain enzyme recognition markers), or both using the cleavage method (capture oligonucleotides contain enzyme recognition markers); (2) different methods can also be used, for example, for target molecule 1, the cleavage method is used (capture oligonucleotides contain enzyme recognition markers), and for target molecule 2, the direct method is used (capture oligonucleotides do not contain enzyme recognition markers).
[0253] Testing system
[0254] The present invention provides a nucleic acid detection system, the system comprising the capture oligonucleotides described in the first aspect of the present invention, or the capture oligonucleotide combination described in the second aspect of the present invention, or the composition or kit described in the third aspect of the present invention, Taq polymerase, dNTPs, MgCl2, and PCR buffer.
[0255] Typically, the detection system also includes primers (universal primers) and probes (specific probes, universal probes).
[0256] Methylation detection system
[0257] In a specific embodiment, the present invention relates to a methylation detection system, mainly comprising two parts: methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonuclease treatment, and fluorescent PCR technology based on capture oligonucleotides and / or universal primers for amplification. This methylation detection system involves enzymatic digestion of target gene sequences using methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonucleases; and involves fluorescent PCR amplification of the digestion products of methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonucleases. Preferably, the methylation detection system includes capture oligonucleotides, probes, and universal primers, as described elsewhere herein.
[0258] The methylation detection system involves two choices of capture oligonucleotides.
[0259] First option: The capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3'. The binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide also include a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is independent of the target molecule sequence.
[0260] The second option: The capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3'. The binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide also include a nucleic acid extension blocking modification at the 3' end of the binding capture sequence and an enzyme cleavage recognition marker at the 3' end of the universal sequence or the 5' end of the binding capture sequence, wherein the universal primer is independent of the target molecule sequence.
[0261] In a preferred embodiment of the invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog.
[0262] Typically, the capture oligonucleotides involved in the methylation detection system are modified with nucleic acid analogs; preferably, the nucleic acid analogs include any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, spacers, 2'-O,4'-C-methylated bridging RNA, 2'-methoxy modified bases, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoroRNA, or 2'-fluoroRNA. The preferred nucleic acid analogs modified above are located on the 3' end of the capture oligonucleotide binding to the capture sequence.
[0263] In an embodiment of the present invention, the probes (including specific probes and universal probes) involved in the methylation detection system are labeled with a fluorescent detection group and a quenching group at both ends.
[0264] Preferred fluorescent detection groups are selected from the following group: FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LC RED460, or combinations thereof.
[0265] The preferred quenching groups are selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or combinations thereof.
[0266] This invention provides two methods for the above-mentioned fluorescence PCR amplification detection:
[0267] The first method includes the steps of capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, and exponential amplification using universal primers.
[0268] Specifically, the method includes: (1) a reverse capture oligonucleotide binds to a target molecule with a defined 3' end sequence by binding a capture sequence; (2) the target molecule extends using the reverse capture oligonucleotide as a template, and a sequence complementary to the first universal primer is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule; (3) the 3' end of the linear extension product of the target molecule binds to the first universal primer; (4) the first universal primer extends using the linear extension product of the target molecule as a template, and a sequence complementary to the linear extension product of the target molecule is added to the 3' end of the first universal primer to obtain a linear extension product of the first universal primer; (5) a forward capture oligonucleotide binds to the linear extension product of the first universal primer; (6) the linear extension product of the first universal primer extends using the forward capture oligonucleotide as a template, and a sequence (4a) complementary to the second universal primer (4s) is added to the 3' end of the linear extension product of the first universal primer to obtain a linear extension product of the second universal primer (3'4a-1a-2a-3a). 5'), the linear extension product of the second universal primer is a single-stranded product with the first universal primer sequence and the complementary sequence of the second universal primer at the 5' and 3' ends, respectively, and the complementary sequence of the target molecule in the middle. (7) The first universal primer and the second universal primer are used as templates for exponential amplification to obtain the amplified product. The amplification may also include the use of a probe.
[0269] The second method includes steps such as capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, enzyme-specific recognition and cleavage, and / or exponential amplification using universal primers.
[0270] Specifically, the method includes: (1) a reverse capture oligonucleotide binds to a target molecule with a defined 3' end sequence by binding a capture sequence; (2) the target molecule extends using the reverse capture oligonucleotide as a template, and a sequence complementary to the first universal primer is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule; (3) an enzyme specifically recognizes the restriction site in the target molecule linear extension product and the reverse capture oligonucleotide binding dimer and performs cleavage to obtain a reverse capture oligonucleotide cleavage product containing a free 3' end; and (4) the reverse capture oligonucleotide containing a free 3' end is cleaved. The product is extended using the target molecule linear extension product as a template. The target molecule complementary sequence is added to the 3' end of the reverse capture oligonucleotide cleavage product containing the free 3' end to obtain the first universal primer linear extension product. (5) The forward capture oligonucleotide binds complementary to the first universal primer linear extension product. (6) The first universal primer linear extension product is extended using the forward capture oligonucleotide as a template. The second universal primer complementary sequence (4a) is added to the 3' end of the first universal primer linear extension product to obtain the second universal primer linear extension product (3'4a-1a-2a-3a 5'). The second universal primer linear extension product is a single-stranded product containing the first universal primer sequence (3a) and the second universal primer complementary sequence (4a) at the 5' and 3' ends, respectively, and containing the target molecule complementary sequence in the middle.
[0271] (7) The linear extension product of the second universal primer can be exponentially amplified based on reverse capture oligonucleotides and forward capture oligonucleotides under the enzyme-specific recognition, or directly based on the first universal primer and the second universal primer to obtain the amplified product.
[0272] The amplification may also optionally include the use of probes.
[0273] In a specific embodiment of the present invention, methylation sites in the Septine 9 gene, as described in SEQ ID NO:6, are detected by the following method:
[0274] The capturing oligonucleotides shown in SEQ ID NO:1 and 2 are contacted with GlaI-digested cfDNA. SEQ ID NO:2 binds complementary to target molecule 1 shown in SEQ ID NO:23. Target molecule 1 is extended using SEQ ID NO:2 as a template by adding a sequence complementary to SEQ ID NO:2 to the 3' end, resulting in an extended target molecule (i.e., the linear extension product of the target molecule). The extended target molecule binds complementary to the universal primer SEQ ID NO:3. The universal primer SEQ ID NO:3 uses the extended target molecule as a template for an extension reaction to obtain a sequence complementary to the extended target molecule. This sequence can bind complementary to and extend the capturing oligonucleotide SEQ ID NO:1, forming a single-stranded product with the first universal primer sequence and the second universal primer complementary sequence at the 5' and 3' ends, respectively, and containing the target molecule complementary sequence in the middle. Finally, amplification is performed using the universal primers shown in SEQ ID NO:3 and SEQ ID NO:4 and the probe shown in SEQ ID NO:5, and the probe signal is detected.
[0275] The main advantages of this invention include:
[0276] Compared with existing methylation detection technologies based on the conversion of bisulfite, the present invention has the following advantages:
[0277] (1) The cfDNA methylation detection technology of the present invention does not require cumbersome chemical treatment and purification processes. The present invention can only trigger amplification when both the 3' end and 5' end are mediated by methylation sites. It can effectively suppress false positives caused by random fragmentation of cfDNA, improve the specificity of amplification, and is more suitable for the detection of methylation of cfDNA with a high degree of fragmentation.
[0278] (2) The capture oligonucleotides and universal primers in this invention are specially designed so that when target molecules are present in the environment, they can trigger an extension reaction mediated by the capture oligonucleotides and amplify the signal through subsequent exponential amplification to meet the sensitivity requirements for cfDNA methylation detection.
[0279] Compared with existing methylation-dependent restriction endonuclease-based technologies (ZL 202111389443.0 and Nucleic Acids Res. 2013; 41(1):e15.), the present invention has the following advantages:
[0280] (1) The amplification method described in this invention only requires a pair of simply designed capture oligonucleotides with nucleic acid extension blocking modifications at their 3' ends and a pair of universal primers to detect methylation. This unique design structure, compared to the comparative file (ZL 202111389443.0), not only eliminates the two-step amplification required by the comparative file, but also forms a hairpin structure and is treated with USER enzyme during the amplification process, making the principle simpler and clearer, and the operation simpler. Compared to the comparative file (Nucleic Acids Res.2013;41(1):e15.), this invention not only avoids the effect of requiring multiple cycles for one round of amplification in the comparative file, but also directly utilizes 3'Tth restriction enzyme, thermostable mismatch repair enzyme, and thermostable RNase H-mediated exponential amplification based on capture oligonucleotides modified with enzyme recognition sites and universal primers, improving the amplification efficiency and detection sensitivity.
[0281] (2) When the present invention performs methylation detection on different target molecules, it is only necessary to design the binding capture sequence of the capture oligonucleotide according to the target molecule, while keeping the universal primer unchanged. This reduces the interference between multiple primers that are easy to occur during the amplification of multiple target molecules, improves the sensitivity of the reaction, and thus enables the detection of methylation of multiple target molecules.
[0282] Compared with existing multiplex nucleic acid amplification detection technologies (WO 2018 / 165593 A1 and US 2012 / 0171725 A1), the present invention has the following advantages:
[0283] (1) The capture oligonucleotide described in this invention not only contains nucleic acid extension blocking modification at its 3' end, but also contains nucleic acid analog modification in its binding capture sequence. This unique design structure, compared with the comparative documents (WO 2018 / 165593 A1 and US 2012 / 0171725 A1), can not only effectively reduce non-specific amplification caused by partial mismatch between primers, but also avoid the nested opening scheme required for other documents, thus improving the detection sensitivity.
[0284] (2) The amplification reaction described in this invention depends on the presence of target molecules with well-defined 5' and 3' end sequences to initiate the corresponding amplification reaction. This unique amplification design based on the simultaneous presence of captured oligonucleotides and target molecules with well-defined 5' and 3' end sequences can not only further improve the specificity of detection compared to the prior art (WO 2018 / 165593 A1 and US 2012 / 0171725 A1), but also achieve some detections that cannot be achieved by the prior art (WO 2018 / 165593 A1 and US 2012 / 0171725 A1), such as DNA methylation detection.
[0285] The following detailed description of the detection method, detection system, and reagent kit provided by the invention is provided in conjunction with specific embodiments.
[0286] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Guide* by Sambrook J. et al. (translated by Huang Peitang et al., Beijing: Science Press, 2002), or according to the manufacturer's recommendations (e.g., product instructions). Unless otherwise stated, percentages and parts are by weight. Unless otherwise specified, the experimental materials and reagents used in the following embodiments are commercially available or can be prepared according to literature methods.
[0287] Example 1: Detection of methylation of human Septine 9 gene fragment DNA by ultrasound based on the amplification principle of capturing oligonucleotides without enzyme recognition markers.
[0288] (1) Obtain methylated Jurka genomic DNA and sequence it to identify the methylation status of the Septine9 gene.
[0289] (2) Methylated Jurka genomic DNA was treated with ultrasound to obtain fragment DNA with a size of about 150 bp.
[0290] (3) The DNA treated with the above-mentioned sonicated fragments was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10U GlaI, sonicated fragment DNA, total volume 10μL; the reaction conditions were 37℃ for 1 hour; after the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0291] (4) Add the capture oligonucleotide of the Septine 9 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0292] The combination of capture oligonucleotides, universal primers, and specific probes used includes:
[0293] Forward capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0294] Reverse capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0295] First universal primer
[0296] Second universal primer
[0297] Target molecule specific probe
[0298] The partial sequence of the human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.
[0299] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGG GTCGC / / GCGGAGGGC(SEQ ID NO:6, where positions 18 to 62 are the sequence of target molecule 1, and the sequence number of target molecule 1 is SEQ ID NO:23)
[0300] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. Figure 1 illustrates the good sensitivity and specificity of this invention for detecting methylation of the Septine 9 gene in sonicated fragment DNA.
[0301] Example 2: Detection of methylation of human Septine 9 gene fragment DNA by ultrasound based on the amplification principle of capturing oligonucleotides containing enzyme recognition markers.
[0302] (1) Obtain methylated Jurka genomic DNA and sequence it to identify the methylation status of the Septine9 gene.
[0303] (2) Methylated Jurka genomic DNA was treated with ultrasound to obtain fragment DNA with a size of about 150 bp.
[0304] (3) The DNA treated with the above-mentioned sonicated fragments was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10U GlaI, sonicated fragment DNA, total volume 10μL; the reaction conditions were 37℃ for 1 hour; after the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0305] (4) Add the capture oligonucleotide of the Septine 9 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 10 U Tth Endonuclease IV, 25 mM ZnCl2, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0306] The combinations of universal primers and specific probes used are the same as those in Example 1, including:
[0307] Forward capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0308] Reverse capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0309] The partial sequence of the human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.
[0310] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGG GTCGC / / GCGGAGGGC(SEQ ID NO:6, where positions 18 to 62 are the sequence of target molecule 1, and the sequence number of target molecule 1 is SEQ ID NO:23)
[0311] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. Figure 2 illustrates the good sensitivity and specificity of this invention for detecting methylation of the Septine 9 gene in ultrasonically fragmented DNA.
[0312] Example 3: Experiments on capturing oligonucleotides with different structures
[0313] To improve the ability of captured oligonucleotides to bind to target molecules, this example selected captured oligonucleotides with different structures for detection. The universal primers and specific probes used were the same as in Example 1, and the enzyme digestion and amplification conditions were also the same as in Example 1.
[0314] The captured oligonucleotides used include:
[0315] Straight-chain forward-capturing oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0316] Straight-chain reverse-capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0317] Self-folding forward-capturing oligonucleotides (underlined regions indicate self-folding, italicized bases indicate 2'-methoxy modified bases)
[0318] Self-folding reverse-capture oligonucleotides (underlined regions indicate self-folding, italicized bases indicate 2'-methoxy modified bases)
[0319] The partial sequence of the human Septine 9 gene is shown in Example 1.
[0320] As shown in Figure 3, different designed capture oligonucleotides exhibited amplification curves in the detection of 2000 copies and 200 copies of methylated positive genomic DNA, indicating positive results. This demonstrates that both straight-chain and folded capture oligonucleotides can achieve highly sensitive methylation detection. However, in this embodiment, there was no significant difference between the two.
[0321] Example 4: Experiments with different probe selections
[0322] To improve the flexibility of capture oligonucleotide detection, this embodiment adds a universal probe sequence between a universal primer sequence for capturing oligonucleotides and the binding capture sequence. The other capturing oligonucleotides and universal primers used are the same as in Example 1, as are the enzyme digestion and amplification conditions.
[0323] The captured oligonucleotides used include:
[0324] Capture oligonucleotides without universal probe sequences (italicized 2' methoxy modified bases)
[0325] Capture oligonucleotides containing universal probe sequences (underlined regions are self-folded regions, italicized bases are 2' methoxy modified bases)
[0326] Universal probe sequence
[0327] The partial sequence of the human Septine 9 gene is shown in Example 1.
[0328] As shown in Figure 4, both capture oligonucleotides without and containing universal probe sequences showed amplification curves in the detection of 2000 copies and 200 copies of methylation-positive genomic DNA, indicating positive results. This demonstrates that both universal probe sequences and target-molecule-specific probe sequences can achieve highly sensitive methylation detection. However, in this embodiment, there was no significant difference between the two.
[0329] Example 5: Sensitivity Test
[0330] To test the sensitivity of this invention in detecting ctDNA methylation, this embodiment selected different target concentrations after treatment for detection. The capturing oligonucleotides, universal primers, and specific probes used were the same as in Example 1, as were the enzyme digestion and amplification conditions. As shown in Figure 5, positive results were observed when methylated positive genomic DNA was present at 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, while the negative control NC showed no amplification.
[0331] Example 6: Detection of Methylation of Captured Oligonucleotides by Locked Nucleic Acid Modification
[0332] (1) Genomic DNA was extracted from the Jurkat and Hela cell lines respectively, and the methylation status of the Septine9 gene was identified by sequencing.
[0333] (2) By sonicating the two types of genomic DNA, fragment DNA with a fragment size of about 150 bp was obtained.
[0334] (3) The DNA treated with the above-mentioned sonicated fragments was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10U GlaI, sonicated fragment DNA, total volume 10μL; the reaction conditions were 37℃ for 1 hour; after the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0335] (4) Add the capture oligonucleotide of the Septine 9 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0336] The combination of universal primers, target-specific probes, and target molecule sequences used is the same as in Example 1, and the captured oligonucleotides include:
[0337] Positive capture oligonucleotides (the base preceding the + indicates locked nucleic acid modification).
[0338] Reverse capture oligonucleotides (the base preceding the + indicates locked nucleic acid modification).
[0339] The capturing oligonucleotides have a spacer C3 at the 3' end of the folded sequence to block elongation. As shown in Figure 6, 200 copies and 100 copies of the positive template showed amplification curves, indicating positive results, while the negative control NC showed no amplification curve, indicating a negative result. This demonstrates that the capturing oligonucleotides modified with locked nucleic acids can be used in this invention for DNA methylation detection.
[0340] Example 7: Detection of methylation of human LINE-1 gene fragment DNA by ultrasound based on the amplification principle of capturing oligonucleotides without enzyme recognition markers.
[0341] (1) Obtain HELA genomic DNA and sequence it to identify the methylation status.
[0342] (2) DNA was digested using the methylation-sensitive restriction endonuclease HinP1I. The reaction system consisted of 1× digestion buffer, 10U HinP1I, and genomic DNA, with a total volume of 10μL. The reaction conditions were incubation at 37℃ for 1 hour.
[0343] (3) Add the captured oligonucleotides and universal primers of the treated gene to the above enzyme digestion system for amplification. The reaction system is as follows: digested genomic DNA, 5 nM captured oligonucleotides, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0344] The combination of capture oligonucleotides, universal primers, and specific probes used includes:
[0345] Forward capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0346] Reverse capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0347] Second universal primer
[0348] First universal primer
[0349] Specific probes
[0350] The partial sequence of the human LINE-1 gene is as follows: / / indicates the restriction enzyme cleavage site, and CG before and after it indicates the methylation site.
[0351] CGAATATTGC / / GCTTTTCAGACCGGCTTAAGAAACGGC / / GCACCACGAGA (SEQ ID NO:18, where positions 11 to 37 are the sequence of target molecule 2, and the sequence number of target molecule 2 is SEQ ID NO:24)
[0352] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. Figure 7 illustrates that methylation-sensitive restriction endonuclease treatment can detect results for the unmethylated state.
[0353] Example 8: Detection of the IS6110 fragment of Mycobacterium tuberculosis based on the present invention
[0354] (1) Obtain Mycobacterium tuberculosis genomic DNA.
[0355] (2) DNA was digested using the restriction endonuclease FokI. The reaction system consisted of 1× digestion buffer, 10U FokI, and Mycobacterium tuberculosis genomic DNA, with a total volume of 10μL. The reaction conditions were incubation at 37℃ for 1 hour.
[0356] (3) The captured oligonucleotides and universal primers of the treated gene were added to the above enzyme digestion system for amplification. The reaction system was: Mycobacterium tuberculosis genome after enzyme digestion, 5 nM captured oligonucleotides, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program was: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values were collected.
[0357] The combination of capture oligonucleotides, universal primers, and specific probes used includes:
[0358] Forward capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0359] Reverse capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0360] Second universal primer
[0361] First universal primer
[0362] Specific probes
[0363] The partial sequence of the IS6110 gene of Mycobacterium tuberculosis is as follows: / / indicates the restriction enzyme site, and the CG before and after it indicates the methylation site.
[0364] Gactccagttcttggaaaggatggggtcatgt / / caggtggttcatcgaggaggtaccc gccggagctgcgtgagcgggcggtgcggatggtcgcagag / / atc(SEQ ID NO:22, where positions 33 to 97 are the sequence of target molecule 3, and the sequence number of target molecule 3 is SEQ ID NO:25)
[0365] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. Figure 8 illustrates that methylation-sensitive restriction endonuclease treatment can detect results for the unmethylated state.
[0366] Example 9: Simultaneous detection of hypermethylation of human Septine 9 gene and hypomethylation of LINE-1 gene
[0367] (1) Obtain methylated Jurka genomic DNA and sequence it to identify the methylation status of the Septine9 and LINE-1 genes.
[0368] (2) Methylated Jurka genomic DNA was treated with ultrasound to obtain fragment DNA with a size of about 150 bp.
[0369] (3) The DNA treated with sonication fragments was digested by the methylation-dependent restriction endonuclease GlaI / HinP1I. The reaction system was: 1× digestion buffer, 10U GlaI, sonicated fragment DNA, total volume 10μL. The reaction conditions were: incubation at 37℃ for 1 hour. After the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0370] (4) Add the capture oligonucleotide of the Septine 9 / LINE-1 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Finally, the results are detected by capillary electrophoresis.
[0371] The universal primers used for human Septine 9 detection are the same as those used in Example 2, including:
[0372] Straight-chain forward-capturing oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0373] Straight-chain reverse-capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0374] The partial sequence of the human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.
[0375] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGG GTCGC / / GCGGAGGGC(SEQ ID NO:6, where positions 18 to 62 are the sequence of target molecule 1, and the sequence number of target molecule 1 is SEQ ID NO:23)
[0376] The universal primers used for human LINE-1 detection are the same combinations as those used in Example 7, including:
[0377] Forward capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0378] Reverse capture oligonucleotides (italicized bases are 2'-methoxy modified bases)
[0379] The partial sequence of the human LINE-1 gene is as follows: / / indicates the restriction enzyme cleavage site, and CG before and after it indicates the methylation site.
[0380] CGAATATTGC / / GCTTTTCAGACCGGCTTAAGAAACGGC / / GCACCACGAGA (SEQ ID NO:18, where positions 11 to 37 are the sequence of target molecule 2, and the sequence number of target molecule 2 is SEQ ID NO:24)
[0381] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. Figure 9 illustrates that this invention can simultaneously detect hypermethylation and hypomethylation with good sensitivity and specificity.
[0382] Other embodiments of the invention will readily occur to those skilled in the art upon consideration of the specification and practice of the invention disclosed herein. This application is intended to cover any variations, uses, or adaptations of the invention that follow the general principles of the invention and include common knowledge or customary techniques in the art not disclosed herein. The specification and examples are to be considered exemplary only, and the true scope and spirit of the invention are indicated by the appended claims.
Claims
1. A capture oligonucleotide for nucleic acid amplification, characterized in that, The capturing oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' end sequence of the target molecule or at least partially identical to the 5' end sequence of the target molecule, and the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence. Optionally, the capturing oligonucleotide further includes an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the capturing sequence.
2. The capture oligonucleotide of claim 1, wherein, The binding capture sequence has a nucleic acid analog modification at its 3' end.
3. The capture oligonucleotide of claim 1, wherein, The nucleic acid extension blocking modification is selected from the group consisting of: Spacer, amino, C6, methyl, azide, phosphoramide, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or combinations thereof.
4. The capture oligonucleotide of claim 2, wherein, The nucleic acid analog modification is selected from the group consisting of: peptide nucleic acid, locked nucleic acid, transposed base, spacer, 2'-O,4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, 2-fluoroRNA, 2'-fluoroRNA, or combinations thereof.
5. A set of capture oligonucleotides for nucleic acid amplification, characterized in that, The combination includes reverse-capture oligonucleotides and forward-capture oligonucleotides: (1) The reverse capture oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence and a first binding capture sequence; wherein, The first binding capture sequence is complementary to the 3' end sequence of the target molecule; The reverse capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the first binding capture sequence; (2) The positive capture oligonucleotide includes a second universal sequence and a second binding capture sequence from the 5' end to the 3' end; Wherein, the second binding capture sequence is at least partially identical to the 5' end sequence of the target molecule; The positive capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the second binding capture sequence (1s); Choose any location The reverse capture oligonucleotide also includes an enzyme recognition marker located at the 3' end of the first universal sequence or the 5' end of the first binding capture sequence; The positive capture oligonucleotide also includes an enzyme recognition marker located at the 3' end of the second universal sequence or the 5' end of the second binding capture sequence.
6. A composition or kit for nucleic acid amplification, characterized by, The composition or kit comprises any of the capturing oligonucleotides of claims 1-4 or the combination of capturing oligonucleotides of claim 5.
7. The composition or kit of claim 6, wherein, The composition or kit includes a capture oligonucleotide combination 1 and a capture oligonucleotide combination 2, wherein the capture oligonucleotide combination 1 includes a forward capture oligonucleotide and a reverse capture oligonucleotide targeting target molecule 1; and the capture oligonucleotide combination 2 includes a forward capture oligonucleotide and a reverse capture oligonucleotide targeting target molecule 2.
8. The composition or kit of claim 6, wherein The composition or kit further includes a target molecule pre-sequence pretreatment reagent to obtain target molecules with well-defined 3' and 5' end sequences; Preferably, the pretreatment reagent comprises methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
9. A method for nucleic acid amplification or detection for non-diagnostic purposes, characterized in that, The method includes the step of using a capture oligonucleotide to bind a target molecule, said capture oligonucleotide as described in claim 1.
10. The nucleic acid amplification or detection method according to claim 9, wherein, The method includes the following steps: (a) Using the capture oligonucleotide to bind target molecules; (b) Linear elongation of the target molecule; (d) Exponential amplification using universal primers, The capturing oligonucleotide is the capturing oligonucleotide of claim 1 or the reverse capturing oligonucleotide and / or forward capturing oligonucleotide in the combination of capturing oligonucleotides of claim 2, and the universal primer is independent of the target molecule sequence.
11. The nucleic acid amplification or detection method according to claim 9, wherein, The method includes the following steps: (a) Using the capture oligonucleotide to bind target molecules; (b) Linear elongation of the target molecule; (c) Enzyme-specific recognition and cleavage; (d) Exponential amplification using universal primers; The capturing oligonucleotide is the capturing oligonucleotide of claim 1 or the reverse capturing oligonucleotide and / or forward capturing oligonucleotide in the combination of capturing oligonucleotides of claim 2, and the universal primer is independent of the target molecule sequence.
12. The nucleic acid amplification or detection method according to claim 9, wherein, The method includes the following steps: (a) Using a capture oligonucleotide targeting target molecule 1 to bind target molecule 1, and using a capture oligonucleotide targeting target molecule 2 to bind target molecule 2. (b) Target molecule 1 and target molecule 2 are linearly extended respectively; (c) Optionally, enzyme-specific recognition and cleavage; (d) Exponential amplification using universal primers; The capturing oligonucleotide is the capturing oligonucleotide of claim 1 or the reverse capturing oligonucleotide and / or forward capturing oligonucleotide in the combination of capturing oligonucleotides of claim 2, and the universal primer is independent of the target molecule sequence.