Embedded loading / bioswitchable mirna-functionalized tetrahedral framework nucleic acid, and preparation method therefor and use thereof

By designing functionalized tetrahedral framework nucleic acids and utilizing RNase H-triggered biological switches to achieve controlled release of miRNAs, the delivery problem of miRNAs in diseases such as uveal melanoma has been solved, providing an efficient, stable, and non-invasive treatment solution.

WO2026130487A1PCT designated stage Publication Date: 2026-06-25SICHUAN UNIV

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SICHUAN UNIV
Filing Date
2025-12-18
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Existing miRNAs lack stability, delivery efficiency, and the ability to cross biological barriers in gene therapy, especially in the eye, resulting in poor efficacy in treating diseases such as uveal melanoma. Furthermore, the traditional tetrahedral framework nucleic acid delivery mode is unstable and uncontrollable.

Method used

A functionalized tetrahedral framework nucleic acid was designed and assembled through base complementary pairing. It contains three DNA single strands and one to three miRNA strands. The controllable release of miRNA is achieved by using a biological switch triggered by RNase H, which enhances delivery stability and targeting.

Benefits of technology

This technology enables efficient and stable delivery of miRNAs, improving the efficacy of treating diseases such as uveal melanoma, avoiding the adverse reactions of invasive treatments, and providing a non-invasive treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025143677_25062026_PF_FP_ABST
    Figure CN2025143677_25062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a bioswitchable, embedded miRNA-loaded tetrahedral framework nucleic acid, and a preparation method therefor and the use thereof. In the present invention, miRNA is embedded into a tetrahedral framework nucleic acid (tFNA), and a ribonucleotide is extended at the end of each miRNA strand as a biological switch. Such enzyme-responsive biological switches can be triggered by intracellular RNase H to realize the disassembly of a three-dimensional structure. Moreover, the miRNA comprises a toehold-mediated strand displacement domain, which facilitates the binding of miRNA to an intracellular target, thereby achieving specific cell recognition. The miRNA delivery platform provided by the present invention can effectively treat tumors such as uveal melanoma, and diseases such as acute liver injuries and acute kidney injuries.
Need to check novelty before this filing date? Find Prior Art

Description

Embedded / Bioswitchable miRNA-functionalized tetrahedral framework nucleic acids, their preparation methods and applications

[0001] Cross-reference to related applications

[0002] This application claims the benefit of Chinese Patent Application No. 202411883464.1, filed on December 19, 2024, and Chinese Patent Application No. 202510011155.3, filed on January 3, 2025, the contents of which are incorporated herein by reference in their entirety.

[0003] Reference to electronic sequence listing

[0004] The contents of the electronic sequence list (F25W1788PCT-SeqList_ST26.xml; size: 37,028 bytes; and creation date: December 16, 2025) are incorporated herein by reference in their entirety. Technical Field

[0005] This invention belongs to the field of biomedical technology, specifically relating to a biologically switchable and / or embedded tetrahedral framework nucleic acid carrying miRNA, its preparation method, and its uses. Background Technology

[0006] Uveal melanoma (UM) is the most common primary intraocular malignancy in adults, originating from melanocytes. 90% of UM cases are located in the choroid, with the remaining 10% in the ciliary body and iris. Although rare, UM is highly aggressive and has a poor prognosis. More than 50% of patients develop systemic metastases after diagnosis, primarily to the liver. Once metastasis occurs, survival is generally less than one year. Currently, treatment strategies for UM are relatively limited, and no adjuvant therapies have been proven effective in preventing UM metastasis. Therefore, early treatment of indeterminate lesions is crucial to prevent fatal UM. Local control of early-stage UM can be achieved through various methods, including radiotherapy, laser therapy, chemotherapy, and surgical intervention. However, these invasive treatments have significant adverse effects, including retinal detachment, vision loss, and tumor recurrence. Therefore, developing a novel, non-invasive, effective, and safe treatment strategy is essential to improve the prognosis of patients with early-stage UM.

[0007] In recent years, microRNA-based gene therapy has become a novel and effective approach for treating human tumors and a hot research topic. As gene expression regulators, miRNAs play a crucial role in tumor development, progression, and metastasis. miRNAs can regulate the expression of target genes by binding to specific messenger RNA (mRNA) sequences, thereby affecting tumor cell proliferation, apoptosis, and metastasis. Studies have shown that various miRNAs are abnormally expressed in UM cells. These miRNAs influence UM growth and metastasis by regulating key signaling pathways such as cell cycle, apoptosis, invasion, and metastasis. Notably, miR-30a-5p has been found to be a tumor suppressor in many malignant tumors, including head and neck squamous cell carcinoma, non-small cell lung cancer, prostate cancer, renal cell carcinoma, breast cancer, and hepatocellular carcinoma. Furthermore, a survival analysis of UM patients showed a positive correlation between miR-30a-5p expression levels and overall survival. Improving these dysregulated miRNAs holds promise for inhibiting UM growth and metastasis. However, the stability, delivery efficiency, and ability of miRNAs to cross biological barriers in gene therapy pose significant obstacles to their clinical application, especially in the eye where there is a blood-retinal barrier.

[0008] Besides tumors, miRNAs can also be used to treat liver and kidney diseases. Multiple factors can lead to liver and kidney failure, causing severe damage, extensive cell necrosis, and disrupting the liver's synthesis, secretion, transformation, and detoxification processes. In severe cases, this can lead to kidney dysfunction or organ decompensation. miRNAs play a crucial role in a range of physiological and pathological processes, standing out among numerous nucleic acid drugs. Furthermore, miRNAs have a wide range of functions. A single miRNA can exhibit different biological functions in different tissues through direct or indirect regulation. For example, in the liver, miRNA-125 can improve ALF by directly regulating the expression of nuclear factor-E2-related factor 2, a known regulator of acute liver failure (ALF). In the kidney, miRNA-125 can directly inhibit the expression of p53 protein, which not only leads to the upregulation of CDK1 and Cyclin B1 to rescue G2 / M phase arrest, but also regulates Bcl-2 and Bax to inhibit apoptosis and thus treat acute kidney injury (AKI).

[0009] The inherent structural limitations of miRNAs make them susceptible to degradation by nucleases present in the blood during in vivo application, hindering the widespread use of miRNA therapy. Although miRNA delivery can be achieved through viral packaging, liposomes, or dendritic macromolecules, potential biosafety and uncertain delivery efficiency have prevented most miRNA therapies from progressing beyond the preclinical stage.

[0010] Tetrahedral framework nucleic acids (tFNAs) are a novel type of nucleic acid nanomaterial. They consist of four pre-fabricated single-stranded DNA molecules self-assembling into a tetrahedral structure, exhibiting excellent in vivo properties, including low immunogenicity, good biocompatibility, and outstanding stability. Furthermore, tFNAs are easy to prepare and can be produced in high quantities, all of which support their potential as a key solution for in vivo miRNA delivery. tFNAs can passively target and accumulate in the liver and kidneys in vivo, suggesting that they may improve the efficacy of miRNA therapy by delivering miRNAs that ameliorate liver and kidney damage, thereby reducing off-target effects. In addition, tFNAs possess anti-inflammatory and antioxidant properties and can activate pro-survival pathways. However, previous methods of transporting miRNA, siRNA, or aptamers using tFNA often involved loading the cargo onto the tFNA apex or suspending it from the tFNA side arms. This approach not only increases the size of the nanostructure, affecting its permeability, but also exposes the transported nucleic acid drug to a large number of nucleases in the bloodstream. Exposed miRNAs may become unstable and easily degraded by enzymes, introducing more uncertainty into the transported cargo. Furthermore, this static delivery mode makes miRNA release uncontrollable.

[0011] Therefore, in order to improve the delivery efficiency of miRNAs and ensure that they can be delivered stably and intact to target organs, it is urgent to develop a miRNA delivery platform with excellent carrying efficiency, high stability and good biocompatibility, so as to open up new avenues for innovative treatment of tumors, liver and kidney-related diseases. Summary of the Invention

[0012] To address the problems of existing technologies, this invention provides a biologically switchable and / or embedded tetrahedral framework nucleic acid carrying miRNA, its preparation method, and its uses.

[0013] Nanodelivery systems based on tetrahedral framework nucleic acids (tFNA) / tetrahedral DNA nanostructures (TDN) show considerable application potential due to their unique structure and properties. Controlled release of miRNAs into cells via cellular environments, such as pH or intracellular enzymes, is one method to address the instability and susceptibility to enzymatic degradation of exposed miRNAs. RNase H, widely distributed in cells, can catalyze the degradation of the RNA portion in DNA-RNA hybrids. Applying it to tFNA-based miRNA delivery systems could provide a feasible method for stable and efficient miRNA delivery.

[0014] This invention provides a nucleic acid composition characterized by its ability to form a functionalized tetrahedral framework nucleic acid. In some embodiments, the nucleic acid composition comprises three different DNA single strands and one to three miRNA strands, which can be assembled through base complementarity pairing to form a functionalized tetrahedral framework nucleic acid. In some embodiments, the miRNA strand comprises miRNA and 2 to 6 ribonucleotides at its ends. In some embodiments, 4 to 8 bp of ribonucleic acid on the miRNA does not participate in the complementary pairing for forming the tetrahedral framework nucleic acid. In some embodiments, the 2 to 6 deoxyribonucleotides at the ends of the DNA single strands are complementary to the 2 to 6 ribonucleotides at the ends of the miRNA strands, and the portion of the DNA single strand complementary to the miRNA is a ribonucleotide. In some embodiments, the tetrahedral framework nucleic acid is assembled from three different DNA single strands and three miRNA strands through base complementarity pairing.

[0015] This invention provides a functionalized tetrahedral framework nucleic acid, characterized in that: it is a tetrahedral framework nucleic acid embedded with miRNA; the tetrahedral framework nucleic acid is assembled from 3 DNA single strands and 1-3 miRNA strands through base complementarity pairing; the miRNA strand includes miRNA and 2-6 ribonucleotides at the ends; 4-8 bp of ribonucleic acid on the miRNA does not participate in the complementary pairing to form the tetrahedral framework nucleic acid; the 2-6 deoxyribonucleotides at the ends of the DNA single strands are complementary to the 2-6 ribonucleotides at the ends of the miRNA strands, and the portion of the DNA single strand complementary to the miRNA is a ribonucleotide. In some embodiments, the tetrahedral framework nucleic acid is assembled from 3 DNA single strands and 3 miRNA strands through base complementarity pairing.

[0016] In some embodiments, the miRNA strand has 2-6 terminal ribonucleotides. In some embodiments, there are 2 terminal ribonucleotides. In some embodiments, there are 3 terminal ribonucleotides. In some embodiments, there are 4 terminal ribonucleotides. In some embodiments, there are 5 terminal ribonucleotides. In some embodiments, there are 6 terminal ribonucleotides.

[0017] In some embodiments, the terminal ribonucleotide of the miRNA strand is located at the 3' end of the miRNA. In some embodiments, the terminal ribonucleotide of the miRNA strand is located at the 5' end of the miRNA. In some embodiments, there are no other nucleotides between the miRNA and the terminal ribonucleotide of the miRNA strand.

[0018] In some embodiments, the ribonucleotide at the end of the miRNA chain is cuua.

[0019] In some embodiments, the miRNA chain has a length of 18-25 bp. In some embodiments, the miRNA chain has a length of 22-24 bp. In some embodiments, the miRNA has a length of 18 bp. In some embodiments, the miRNA has a length of 19 bp. In some embodiments, the miRNA has a length of 20 bp. In some embodiments, the miRNA has a length of 21 bp. In some embodiments, the miRNA has a length of 22 bp. In some embodiments, the miRNA has a length of 23 bp. In some embodiments, the miRNA has a length of 24 bp. In some embodiments, the miRNA has a length of 25 bp.

[0020] In some embodiments, the three miRNA strands in a functionalized tetrahedral framework nucleic acid have the same nucleotide sequence. In some embodiments, the three miRNA strands in a functionalized tetrahedral framework nucleic acid have different nucleotide sequences.

[0021] In some embodiments, a 4-8 bp ribonucleic acid segment in the miRNA chain, starting from the 8th-11th ribonucleotide, does not participate in the complementary pairing to form a tetrahedral framework nucleic acid, and the remaining ribonucleotides of the miRNA are complementary to the ribonucleotides on the DNA single strand to form a tetrahedral framework nucleic acid. In some embodiments, a 6 bp ribonucleic acid segment in the miRNA chain, starting from the 9th ribonucleotide, does not participate in the complementary pairing to form a tetrahedral framework nucleic acid.

[0022] In some embodiments, the 1st to 8th ribonucleotides and the 15th to 22nd ribonucleotides of the miRNA are complementary to the ribonucleotides on the DNA single strand to form a tetrahedral framework nucleic acid. In some embodiments, the 1st to 8th ribonucleotides of the miRNA, and the 15th ribonucleotide to the 3' end of the miRNA, are complementary to the ribonucleotides on the DNA single strand to form a tetrahedral framework nucleic acid.

[0023] In some embodiments, the structure of the DNA single strand is ribonucleic acid 1-deoxyribonucleic acid 2-ribonucleic acid 3-deoxyribonucleic acid 4, wherein ribonucleic acid 1 and ribonucleic acid 3 are complementary to the miRNA, and deoxyribonucleic acid 4 is complementary to the ribonucleotide at the end of the miRNA strand. In some embodiments, ribonucleic acid 1 is completely complementary to the corresponding nucleotide segment of the miRNA starting from the 3' end. In some embodiments, ribonucleic acid 3 is completely complementary to the corresponding segment of the miRNA (or miRNA strand) starting from the 5' end. In some embodiments, the first nucleotide at the 3' end of ribonucleic acid 3 is not complementary to the first nucleotide at the 5' end of the miRNA (or miRNA strand) (i.e., mismatch). In some embodiments, except for this one nucleotide mismatch, the remaining nucleotides of ribonucleic acid 3 are completely complementary to the corresponding segment of the miRNA (or miRNA strand) starting from the second nucleotide at the 5' end. In some embodiments, the nucleotide at the 3' end of ribonucleic acid 3 is U. In some embodiments, the mismatch is a UU mismatch (i.e., the nucleotide at the 3' end of the ribonucleic acid 3 is U, and the first nucleotide at the 5' end of the miRNA (or miRNA chain) is also U). In some embodiments, the mismatch can help the specific screening of the functional strand of the miRNA delivery system. Without being limited to any particular theory, it can be assumed that the screening of the miRNA functional strand follows the rule of "5' end thermodynamic instability," and that base mismatches (e.g., UU mismatches) can reduce the thermodynamic stability of the 5' end of the functional strand. By breaking the stable double-stranded structure formed by complementary base pairing, the 5' end of the functional strand becomes thermodynamically disadvantaged, and is thus preferentially screened as the main strand that functions, while promoting the degradation of non-functional strands, ultimately ensuring that the miRNA can efficiently exert its targeted regulatory activity. Therefore, in some embodiments, the base mismatch (e.g., UU mismatch) can promote the functional strand screening of the miRNA and enhance its intracellular efficacy.

[0024] In some embodiments, in the DNA single strand, except for the portion complementary to the miRNA which is a ribonucleotide, the remaining nucleotides are all deoxyribonucleotides.

[0025] In some embodiments, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are each 7-10 bp. In some embodiments, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are each 7 bp. In some embodiments, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are each 8 bp. In some embodiments, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are each 9 bp. In some embodiments, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are each 10 bp.

[0026] In some embodiments, the length of deoxyribonucleic acid 4 (DNA 4) is 2-6 bp. In some embodiments, the length of DNA 4 is 2 bp. In some embodiments, the length of DNA 4 is 3 bp. In some embodiments, the length of DNA 4 is 4 bp. In some embodiments, the length of DNA 4 is 5 bp. In some embodiments, the length of DNA 4 is 6 bp. In some embodiments, DNA 4 is TAAG.

[0027] In some embodiments, the total length of the DNA single strand is 39–111 bp. In some embodiments, the total length of the DNA single strand is 39–60 bp. In some embodiments, the total length of the DNA single strand is 50–70 bp. In some embodiments, the total length of the DNA single strand is 60–80 bp. In some embodiments, the total length of the DNA single strand is 70–90 bp. In some embodiments, the total length of the DNA single strand is 80–100 bp. In some embodiments, the total length of the DNA single strand is 90–111 bp.

[0028] In some embodiments, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are 8 bp each, the length of deoxyribonucleic acid 4 is 4 bp, and the total length of the single strand of DNA is 63 bp.

[0029] In some embodiments, ribonucleic acid 1 is complementary to the 3' end of the miRNA (i.e., the portion near the 3' end of the miRNA) of the ribonucleic acid that does not participate in complementary pairing, and ribonucleic acid 3 is complementary to the 5' end of the miRNA (i.e., the portion near the 5' end of the miRNA) of the ribonucleic acid that does not participate in complementary pairing.

[0030] In some embodiments, the deoxyribonucleic acid (DNA) 2 portions of the three DNA single strands are complementary to form three edges of the tetrahedral framework, the three edges sharing a single tetrahedral vertex. In some embodiments, the length of the DNA 2 portion is 30-56 bp. In some embodiments, the length of the DNA 2 portion is 35-51 bp. In some embodiments, the length of the DNA 2 portion is 40-46 bp. In some embodiments, the length of the DNA 2 portion is 43 bp. In some embodiments, the DNA 2 portions of the three DNA single strands contain sequences corresponding to nucleotides 9-51 of SEQ ID NO. 1-3, respectively.

[0031] In some embodiments, the ribonucleic acid 1, ribonucleic acid 3, deoxyribonucleic acid 4, and miRNA strand of the DNA single strand form three edges of a triangular face of a tetrahedral framework, and the deoxyribonucleic acid 2 of the three DNA single strands complement each other to form the remaining three edges of the tetrahedral framework.

[0032] In some embodiments, the tetrahedral framework nucleic acid is a BiRDS structure.

[0033] In some embodiments, the miRNA in the miRNA chain is selected from miRNA125. In some embodiments, the sequence of miRNA125 comprises nucleotides 1-22 of SEQ ID NO.4, or has up to one, two, three, or four nucleotide variations (mutations, deletions, and / or additions) compared to nucleotides 1-22 of SEQ ID NO.4.

[0034] In some embodiments, the nucleotide sequence of the miRNA chain includes SEQ ID NO.4.

[0035] In some embodiments, the nucleotide sequence of the first DNA single strand is shown in SEQ ID NO.1. In some embodiments, the nucleotide sequence of the second DNA single strand is shown in SEQ ID NO.2. In some embodiments, the nucleotide sequence of the third DNA single strand is shown in SEQ ID NO.3.

[0036] In some embodiments, the miRNA in the miRNA chain is selected from miR-30a-5p. In some embodiments, the sequence of miR-30a-5p comprises nucleotides 1-22 of SEQ ID NO.14, or has up to one, two, three, or four nucleotide variations (mutations, deletions, and / or additions) compared to nucleotides 1-22 of SEQ ID NO.14.

[0037] In some embodiments, the nucleotide sequence of the miRNA chain includes SEQ ID NO.14.

[0038] In some embodiments, the nucleotide sequence of the first DNA single strand is SEQ ID NO.11 or SEQ ID NO.17. In some embodiments, the nucleotide sequence of the second DNA single strand is SEQ ID NO.12 or SEQ ID NO.18. In some embodiments, the nucleotide sequence of the third DNA single strand is SEQ ID NO.13 or SEQ ID NO.19.

[0039] In some embodiments, the nucleotide sequence of the first DNA single strand is SEQ ID NO. 11. In some embodiments, the nucleotide sequence of the second DNA single strand is SEQ ID NO. 12. In some embodiments, the nucleotide sequence of the third DNA single strand is SEQ ID NO. 13.

[0040] In some embodiments, the nucleotide sequence of the first DNA single strand is SEQ ID NO.17. In some embodiments, the nucleotide sequence of the second DNA single strand is SEQ ID NO.18. In some embodiments, the nucleotide sequence of the third DNA single strand is SEQ ID NO.19.

[0041] This invention provides the use of the nucleic acid composition or functionalized tetrahedral framework nucleic acid described herein in the preparation of a medicament for treating a disease. This invention provides a method of treating a disease comprising administering the nucleic acid composition or functionalized tetrahedral framework nucleic acid described herein to a subject. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the use or method comprises using an effective amount of the nucleic acid composition or functionalized tetrahedral framework nucleic acid. As used herein, the term "effective amount" is intended to mean an amount sufficient to achieve the desired effect. In the context of therapeutic or preventative applications, the effective amount will depend on the type and severity of the condition in question and the characteristics of the individual subject, such as general health status, age, sex, weight, and tolerance to the pharmaceutical composition.

[0042] In some embodiments, the disease is acute liver injury and / or acute kidney injury (wherein, the miRNA used is preferably miRNA125). In some embodiments, the disease is post-stroke depression, cardiovascular disease, cancer, peripheral nerve injury, or knee osteoarthritis (wherein, the miRNA used is preferably miR-30a-5p). In some embodiments, the cancer is selected from head and neck squamous cell carcinoma, non-small cell lung cancer, prostate cancer, renal cell carcinoma, breast cancer, hepatocellular carcinoma, and uveal melanoma. In some embodiments, the cancer is uveal melanoma.

[0043] In some embodiments, the disease is an eye disease. In some embodiments, the eye disease is a fundus disease. In some embodiments, fundus diseases include lesions occurring in the retina, fundus blood vessels, optic nerve, macula, choroid, etc. In some embodiments, the administration method is by means of eye drops.

[0044] The present invention provides a pharmaceutical composition characterized in that it comprises the nucleic acid composition or functionalized tetrahedral framework nucleic acid described herein, and pharmaceutically acceptable excipients.

[0045] In some embodiments, the pharmaceutical composition (e.g., a functionalized tetrahedral framework nucleic acid containing miRNA125) is a pharmaceutical composition for treating acute liver injury and / or acute kidney injury. In some embodiments, the pharmaceutical composition (e.g., a functionalized tetrahedral framework nucleic acid containing miR-30a-5p) is a pharmaceutical composition for treating eye diseases. In some embodiments, the pharmaceutical composition (e.g., a functionalized tetrahedral framework nucleic acid containing miR-30a-5p) is a pharmaceutical composition for treating post-stroke depression, cardiovascular disease, cancer, peripheral nerve injury, or knee osteoarthritis. In some embodiments, the cancer is selected from head and neck squamous cell carcinoma, non-small cell lung cancer, prostate cancer, renal cell carcinoma, breast cancer, hepatocellular carcinoma, and uveal melanoma. In some embodiments, the pharmaceutical composition is a pharmaceutical composition for treating uveal melanoma.

[0046] This invention provides a method for preparing functionalized tetrahedral framework nucleic acids, characterized by the following steps: mixing three single-stranded DNA strands and three miRNA strands. In some embodiments, the mixture is incubated using a thermal cycler. In some embodiments, the molar ratio of the three single-stranded DNA strands is 1:1:1. In some embodiments, the molar ratio of any one single-stranded DNA strand to any one miRNA strand is 1:1. In some embodiments, the molar ratio of the three single-stranded DNA strands to the miRNA strand is 1:1:1:1-3. In some embodiments, the molar ratio of the three single-stranded DNA strands to the miRNA strand is 1:1:1:3.

[0047] This article provides a functionalized tetrahedral framework nucleic acid, which is a tetrahedral framework nucleic acid embedded with miRNA. The tetrahedral framework nucleic acid is assembled from 3 DNA single strands and 3 miRNA strands through base complementarity pairing. The miRNA strand includes miRNA and 2-6 ribonucleotides at the ends. 4-8 bp of ribonucleic acid on the miRNA does not participate in the formation of the tetrahedral framework nucleic acid. The 2-6 deoxyribonucleotides at the ends of the DNA single strands are complementary to the 2-6 ribonucleotides at the ends of the miRNA strands, and the portion of the DNA single strand that is complementary to the miRNA is a ribonucleotide.

[0048] Preferably, in the miRNA chain, the miRNA is 22-24 bp in length and has 2-6 ribonucleotides at the ends;

[0049] Preferably, the miRNA chain has a length of 22 bp and four ribonucleotides at its ends.

[0050] Preferably, in the miRNA chain, the miRNA is selected from miRNA125; and / or, the terminal ribonucleic acid is cuua.

[0051] Preferably, the miRNA chain is as shown in SEQ ID NO.4.

[0052] Preferably, in the miRNA chain, the 4-8 bp ribonucleic acid starting from the 8th-11th ribonucleotide of the miRNA does not participate in the formation of tetrahedral framework nucleic acid, and the remaining ribonucleotides complement the ribonucleotides on the DNA single strand to form tetrahedral framework nucleic acid;

[0053] Preferably, in the miRNA chain, the 6bp ribonucleic acid starting from the 9th ribonucleotide of the miRNA does not participate in the formation of the tetrahedral framework nucleic acid, and the 1st to 8th ribonucleotides and the 15th to 22nd ribonucleotides of the miRNA complement the ribonucleotides on the DNA single strand to form the tetrahedral framework nucleic acid.

[0054] Preferably, the structure of the DNA single strand is ribonucleic acid 1-deoxyribonucleic acid 2-ribonucleic acid 3-deoxyribonucleic acid 4, wherein ribonucleic acid 1 and ribonucleic acid 3 are complementary to miRNA, and deoxyribonucleic acid 4 is complementary to the ribonucleotide at the end of miRNA; the lengths of ribonucleic acid 1 and ribonucleic acid 3 are (7-10) bp, the length of deoxyribonucleic acid 4 is (2-6) bp, and the total length of the DNA single strand is 39-111 bp;

[0055] Preferably, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are 8 bp, the length of deoxyribonucleic acid 4 is 4 bp, and the total length of the single strand of DNA is 63 bp.

[0056] Preferably, the nucleotide sequences of the three DNA single strands are as shown in SEQ ID NO.1-SEQ ID NO.3.

[0057] The present invention also provides a method for preparing the above-mentioned functionalized tetrahedral framework nucleic acid, comprising the following steps: mixing three single-stranded DNA strands and three miRNA strands, and incubating them in a thermal cycler to obtain the product; wherein the molar ratio of the three single-stranded DNA strands is 1:1:1, and the molar ratio of any one single-stranded DNA strand to any one miRNA strand is 1:1.

[0058] The present invention also provides the use of the above-described functionalized tetrahedral framework nucleic acid in the preparation of medicaments for treating acute liver injury and / or acute kidney injury.

[0059] The present invention also provides a medicament for treating acute liver injury and / or acute kidney injury, which is made by adding pharmaceutically acceptable excipients to the above-mentioned functionalized tetrahedral framework nucleic acid as the active ingredient.

[0060] The structure of the tetrahedral framework nucleic acid of the present invention is shown in Figure 1. It is formed by the assembly of 3 DNA single strands and 3 miRNA strands through complementary base pairing. The 3 miRNA strands form one face of the tetrahedral structure.

[0061] RNase H is a ribonuclease that specifically breaks down the RNA strand in RNA-DNA hybrids. The tetrahedral framework nucleic acid of this invention is equipped with an RNase H-dependent biological switch. Specifically, four ribonucleotides are attached to the ends of the miRNA strand, and four complementary deoxyribonucleotides are attached to the corresponding complementary DNA single-strand ends. These complementary pairings form an RNA-DNA hybrid. After the tetrahedral framework nucleic acid of this invention enters the cell, RNase H can recognize the RNA-DNA hybrid, enabling the opening of its three-dimensional structure.

[0062] In this invention, six ribonucleotides of the miRNA chain do not participate in the formation of the tetrahedral framework nucleic acid. These ribonucleotides are used as a foothold-mediated strand substitution reaction domain. This foothold-mediated strand substitution reaction domain can complementarily pair with the nucleic acid sequence inside the cell, thereby releasing the miRNA chain and achieving specific recognition of the cell.

[0063] This invention, using miRNA125 as an example, embeds the miRNA within a tetrahedral framework nucleic acid (tFNA), thereby providing ample protection for the miRNA. The invention extends ribonucleotides at the ends of the miRNA, acting as biological switches. These enzyme-responsive biological switches are triggered by RNase-H upon delivery of the nanostructure to its destination, opening the three-dimensional structure. Simultaneously, the miRNA possesses a foothold-mediated strand displacement reaction domain, facilitating the binding of the miRNA to intracellular targets and achieving specific cell recognition. The delivery platform (NP) of this invention exhibits high delivery efficiency, high stability, and good biocompatibility. It can alleviate inflammation, maintain ROS homeostasis, and block hepatocyte apoptosis, effectively treating liver injury. Furthermore, NP can significantly reverse apoptosis, effectively treating kidney injury, opening new avenues for innovative treatment of liver and kidney-related diseases.

[0064] This invention also provides a miRNA-functionalized tetrahedral framework nucleic acid, its preparation method, and its uses. In some embodiments, its purpose is to stably, efficiently, and safely inhibit uveal melanoma. Studies have shown that tFNA can serve as a programmable carrier for transdermal administration of malignant melanoma. Furthermore, tFNA-based miRNA delivery has potential applications in ocular diseases, including corneal epithelial wound healing, pathological neovascularization of the retina and choroid, and retinal ischemia / reperfusion injury.

[0065] This invention provides a functionalized tetrahedral framework nucleic acid, wherein the tetrahedral framework nucleic acid has a BiRDS structure; the BiRDS structure contains 1-3 RNA1s, and the nucleotide sequence of the RNA1s includes SEQ ID NO.14.

[0066] A “BiRDS structure” (Bioswitchable microRNA (miRNA) Delivery System) refers to a tetrahedral framework structure composed of nucleic acids, which dissociates under the action of RNase H. In some embodiments, in this tetrahedral framework structure, one vertex contains 3 free deoxyribonucleotides, and at least one of the other three vertices contains 6 free ribonucleotides and 2 free deoxyribonucleotides; at least three edges each contain 20 base pairs of double-stranded nucleic acid; and at least one edge contains a 4-base-pair DNA-RNA complementary region.

[0067] Preferably, the functionalized tetrahedral framework nucleic acid is composed of three single-stranded nucleic acids S1, S2, S3 and RNA1 through base complementary pairing;

[0068] The molar ratio of S1 to S2, S3, and RNA1 is 1:1:1:1-3.

[0069] Preferably, the nucleotide sequence of S1 is SEQ ID NO.11. Preferably, the nucleotide sequence of S2 is SEQ ID NO.12. Preferably, the nucleotide sequence of S3 is SEQ ID NO.13.

[0070] Preferably, the nucleotide sequence of S1 is SEQ ID NO.17. Preferably, the nucleotide sequence of S2 is SEQ ID NO.18. Preferably, the nucleotide sequence of S3 is SEQ ID NO.19.

[0071] This invention provides a method for preparing the functionalized tetrahedral framework nucleic acid described in any one of the above claims, comprising the following steps:

[0072] The single-stranded nucleic acids S1, S2, S3 and RNA1 are mixed to obtain the final product.

[0073] This invention provides the use of the functionalized tetrahedral framework nucleic acid described in any of the above claims in the preparation of medicaments for treating post-stroke depression, cardiovascular disease, cancer, peripheral nerve injury, and knee osteoarthritis.

[0074] Preferably, the cancer is selected from head and neck squamous cell carcinoma, non-small cell lung cancer, prostate cancer, renal cell carcinoma, breast cancer, hepatocellular carcinoma, and uveal melanoma.

[0075] Preferably, the cancer is uveal melanoma.

[0076] This invention provides a drug for treating uveal melanoma, which is made by adding pharmaceutically acceptable excipients to functionalized tetrahedral framework nucleic acids as the active ingredient as described above.

[0077] This invention provides a bio-switchable miRNA delivery system (BiRDS) based on tFNA. This system encapsulates miRNA within tFNA nanomaterials for protection and achieves efficient delivery and controlled release of miRNA in response to RNase H. BiRDS consists of a nucleic acid tetrahedron composed of three single-stranded nucleic acids S1-S3 and miR-30a-5p. The central portion of the tetrahedron's edges is the DNA-RNA hybridization region. In the presence of RNase H, the RNA portion of the DNA-RNA hybridization region is hydrolyzed, leading to the dissociation of the tetrahedron structure and the intracellular release of miR-30a-5p. Experiments have shown that BiRDS exhibits high stability and good biocompatibility, can cross the blood-retinal barrier, and can be used as eye drops for the treatment of ocular diseases. When used to treat microscopic myopia (UM), it provides a non-invasive and simple treatment method suitable for long-term, frequent administration. This addresses the adverse reactions caused by invasive treatments in ophthalmic diseases, including pain, bleeding, inflammation, infection, and even choroidal / retinal detachment and visual impairment, thus improving patient compliance and quality of life. In summary, this invention is the first to apply BiRDS carrying miR-30a-5p to UM in the form of nano-eye drops, filling the research gap in non-invasive UM inhibition based on miRNA and showing great application potential.

[0078] Regarding the definition of terms used in this invention: Unless otherwise stated, the initial definitions provided for groups or terms herein apply to the groups or terms used throughout this specification; for terms not specifically defined herein, the meanings that a person skilled in the art would give them should be given based on the disclosure and context.

[0079] As used herein, unless otherwise indicated, the term "or" can be a conjunction or a disjunctive conjunction. As used herein, unless otherwise indicated, any embodiment may be combined with any other embodiment.

[0080] As used herein, unless otherwise indicated, certain application embodiments herein envision a range of values. Where a range exists, the range includes the range endpoints. Furthermore, each subrange and value within that range exists as if explicitly written.

[0081] As used herein, the singular form (e.g., “a”, “an”) includes plural indicators unless the context clearly indicates otherwise.

[0082] As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized in,” and is inclusive or open-ended, and does not exclude additional unstated components, elements, or method steps, etc. As used herein, “consisting of” excludes any component, element, or method step not specified in the elements of the claim. As used herein, “consisting substantially of” does not exclude components, elements, or method steps that do not substantially affect the essential and novel features of the claim. Any statement of the term “comprising” herein, such as when describing compositional components or method steps, should be understood to include (i) those compositions and methods consisting of the stated components, elements, or method steps; and (ii) those compositions and methods substantially consisting of the stated components, elements, or method steps.

[0083] Technical solution

[0084] In one aspect, the present invention addresses the problems existing in the prior art through the following technical solutions:

[0085] Item A1: A functionalized tetrahedral framework nucleic acid, characterized in that: the tetrahedral framework nucleic acid is a BiRDS structure; the BiRDS structure contains 1-3 RNA1s, the nucleotide sequence of which includes SEQ ID NO.14.

[0086] Item A2: The functionalized tetrahedral framework nucleic acid according to Item A1, characterized in that: the functionalized tetrahedral framework nucleic acid is composed of three single-stranded nucleic acids S1, S2, S3 and RNA1 through base complementary pairing;

[0087] The molar ratio of S1 to S2, S3, and RNA1 is 1:1:1:1-3.

[0088] Item A3: The functionalized tetrahedral framework nucleic acid according to Item A2, characterized in that: the nucleotide sequence of S1 is SEQ ID NO.11.

[0089] Item A4: The functionalized tetrahedral framework nucleic acid according to Item A2, characterized in that: the nucleotide sequence of S2 is SEQ ID NO.12.

[0090] Item A5: The functionalized tetrahedral framework nucleic acid according to Item A2, characterized in that: the nucleotide sequence of S3 is SEQ ID NO.13.

[0091] Item A6: A method for preparing the functionalized tetrahedral framework nucleic acid described in any one of items A1-A5, characterized in that it includes the following steps:

[0092] The single-stranded nucleic acids S1, S2, S3 and RNA1 are mixed to obtain the final product.

[0093] Item A7: Use of the functionalized tetrahedral framework nucleic acid described in any one of items A1-A5 in the preparation of drugs for treating post-stroke depression, cardiovascular disease, cancer, peripheral nerve injury, and knee osteoarthritis.

[0094] Item A8: The use according to Item A7 is characterized in that: the cancer is selected from head and neck squamous cell carcinoma, non-small cell lung cancer, prostate cancer, renal cell carcinoma, breast cancer, hepatocellular carcinoma, and uveal melanoma.

[0095] Item A9: The use according to item A8, characterized in that: the cancer is uveal melanoma.

[0096] Item A10: A drug for treating uveal melanoma, characterized in that it is made by adding pharmaceutically acceptable excipients to functionalized tetrahedral framework nucleic acids as described in any one of items A1-A5 as active ingredients.

[0097] In one aspect, the present invention addresses the problems existing in the prior art through the following technical solutions:

[0098] Item B1. A functionalized tetrahedral framework nucleic acid, characterized in that: it is a tetrahedral framework nucleic acid embedded with miRNA; the tetrahedral framework nucleic acid is assembled from 3 DNA single strands and 3 miRNA strands through base complementary pairing; the miRNA strand includes miRNA and 2-6 ribonucleotides at the ends; 4-8 bp of ribonucleic acid on the miRNA does not participate in the formation of the tetrahedral framework nucleic acid; the 2-6 deoxyribonucleotides at the ends of the DNA single strands are complementary to the 2-6 ribonucleotides at the ends of the miRNA strands, and the portion of the DNA single strand that is complementary to the miRNA is a ribonucleotide.

[0099] Item B2, the functionalized tetrahedral framework nucleic acid according to Item B1, characterized in that: in the miRNA chain, the length of the miRNA is 22-24 bp, and the number of terminal ribonucleotides is 2-6;

[0100] Preferably, the miRNA chain has a length of 22 bp and four ribonucleotides at its ends.

[0101] Item B3, the functionalized tetrahedral framework nucleic acid according to Item B2, characterized in that: in the miRNA chain, the miRNA is selected from miRNA125; and / or, the terminal ribonucleic acid is cuua.

[0102] Item B4, the functionalized tetrahedral framework nucleic acid according to any one of items B1-B3, characterized in that: the nucleotide sequence of the miRNA chain is as shown in SEQ ID NO.4.

[0103] Item B5. The functionalized tetrahedral framework nucleic acid according to Item B1, characterized in that: in the miRNA chain, the 4-8 bp ribonucleic acid starting from the 8th-11th ribonucleotide of the miRNA does not participate in the formation of the tetrahedral framework nucleic acid, and the remaining ribonucleotides complement the ribonucleotides on the DNA single strand to form the tetrahedral framework nucleic acid;

[0104] Preferably, in the miRNA chain, the 6bp ribonucleic acid starting from the 9th ribonucleotide of the miRNA does not participate in the formation of the tetrahedral framework nucleic acid, and the 1st to 8th ribonucleotides and the 15th to 22nd ribonucleotides of the miRNA complement the ribonucleotides on the DNA single strand to form the tetrahedral framework nucleic acid.

[0105] Item B6. The functionalized tetrahedral framework nucleic acid according to Item B1, characterized in that: the structure of the DNA single strand is ribonucleic acid 1-deoxyribonucleic acid 2-ribonucleic acid 3-deoxyribonucleic acid 4, wherein ribonucleic acid 1 and ribonucleic acid 3 are complementary to miRNA, and deoxyribonucleic acid 4 is complementary to the ribonucleotides at the end of miRNA; the lengths of ribonucleic acid 1 and ribonucleic acid 3 are (7-10) bp, the length of deoxyribonucleic acid 4 is (2-6) bp, and the total length of the DNA single strand is 39-111 bp;

[0106] Preferably, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are 8 bp, the length of deoxyribonucleic acid 4 is 4 bp, and the total length of the single strand of DNA is 63 bp.

[0107] Item B7, the functionalized tetrahedral framework nucleic acid according to Item B1, characterized in that: the nucleotide sequences of the three DNA single strands are as shown in SEQ ID NO.1-SEQ ID NO.3.

[0108] Item B8. A method for preparing functionalized tetrahedral framework nucleic acids according to any one of items B1-B7, characterized in that it includes the following steps: mixing three single-stranded DNA strands and three miRNA strands, and incubating them using a thermal cycler to obtain the product; wherein the molar ratio of the three single-stranded DNA strands is 1:1:1, and the molar ratio of any one single-stranded DNA strand to any one miRNA strand is 1:1.

[0109] Use of the functionalized tetrahedral framework nucleic acid described in any one of items B9 or B1-B7 in the preparation of medicaments for the treatment of acute liver injury and / or acute kidney injury.

[0110] Item B10, a medicament for treating acute liver injury and / or acute kidney injury, characterized in that: it is prepared by adding pharmaceutically acceptable excipients to functionalized tetrahedral framework nucleic acids as the active ingredient as described in any one of items B1-B7.

[0111] In one aspect, the present invention addresses the problems existing in the prior art through the following technical solutions:

[0112] Item C1. A functionalized tetrahedral framework nucleic acid, characterized in that: it is a tetrahedral framework nucleic acid embedded with miRNA; the tetrahedral framework nucleic acid is assembled from 3 DNA single strands and 3 miRNA strands through base complementary pairing; the miRNA strand includes miRNA and 2-6 ribonucleotides at the ends; 4-8 bp of ribonucleic acid on the miRNA does not participate in the complementary pairing to form the tetrahedral framework nucleic acid; the 2-6 deoxyribonucleotides at the ends of the DNA single strands are complementary to the 2-6 ribonucleotides at the ends of the miRNA strands, and the portion of the DNA single strand that is complementary to the miRNA is a ribonucleotide.

[0113] Item C2, the functionalized tetrahedral framework nucleic acid according to Item C1, characterized in that: the miRNA chain has 2-6 ribonucleotides at its terminal; preferably, the terminal ribonucleotides are 4.

[0114] Item C3, the functionalized tetrahedral framework nucleic acid according to item C1 or C2, characterized in that: the ribonucleotide at the end of the miRNA chain is located at the 3' end of the miRNA; preferably, there are no other nucleotides between the miRNA and the ribonucleotide at the end of the miRNA chain.

[0115] Item C4, the functionalized tetrahedral framework nucleic acid according to any one of items C1-C3, characterized in that: the ribonucleotide at the end of the miRNA chain is cuua.

[0116] Item C5, the functionalized tetrahedral framework nucleic acid according to any one of items C1-C4, characterized in that: in the miRNA chain, the length of the miRNA is 18-25 bp; preferably, the length of the miRNA is 22-24 bp; preferably, the length of the miRNA is 22 bp.

[0117] Item C6, the functionalized tetrahedral framework nucleic acid according to any one of items C1-C4, characterized in that: the three miRNA chains have the same nucleotide sequence.

[0118] Item C7. The functionalized tetrahedral framework nucleic acid according to any one of items C1-C5, characterized in that: in the miRNA chain, the 4-8 bp ribonucleic acid starting from the 8th-11th ribonucleotide of the miRNA does not participate in the complementary pairing to form the tetrahedral framework nucleic acid, and the remaining ribonucleotides of the miRNA are complementary with the ribonucleotides on the DNA single strand to form the tetrahedral framework nucleic acid;

[0119] Preferably, in the miRNA chain, the 6bp ribonucleic acid starting from the 9th ribonucleotide of the miRNA does not participate in the complementary pairing to form a tetrahedral framework nucleic acid; preferably, the 1st to 8th ribonucleotides and the 15th to 22nd ribonucleotides of the miRNA complement the ribonucleotides on the DNA single strand to form a tetrahedral framework nucleic acid.

[0120] Item C8. The functionalized tetrahedral framework nucleic acid according to any one of items C1-C7, characterized in that: the structure of the DNA single strand is ribonucleic acid 1-deoxyribonucleic acid 2-ribonucleic acid 3-deoxyribonucleic acid 4, wherein ribonucleic acid 1 and ribonucleic acid 3 are complementary to the miRNA, and deoxyribonucleic acid 4 is complementary to the ribonucleotide at the end of the miRNA strand;

[0121] Preferably, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are 7-10 bp, the length of deoxyribonucleic acid 4 is 2-6 bp, and the total length of the single strand of DNA is 39-111 bp;

[0122] Preferably, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are 8 bp, the length of deoxyribonucleic acid 4 is 4 bp, and the total length of the DNA single strand is 63 bp.

[0123] Item C9. The functionalized tetrahedral framework nucleic acid according to Item C8, characterized in that: the ribonucleic acid 1 is complementary to the ribonucleic acid at the 3' end of the miRNA that does not participate in complementary pairing, and the ribonucleic acid 3 is complementary to the ribonucleic acid at the 5' end of the miRNA that does not participate in complementary pairing.

[0124] Item C9.1, the functionalized tetrahedral framework nucleic acid according to item C8 or C9, characterized in that:

[0125] The ribonucleic acid 1 is completely complementary to the corresponding nucleotide segment of the miRNA starting from the 3' end;

[0126] The first nucleotide at the 3' end of the ribonucleic acid 3 is mismatched with the first nucleotide at the 5' end of the miRNA (or the miRNA chain), and the remaining nucleotides of the ribonucleic acid 3 are completely complementary to the corresponding nucleotide segments of the miRNA (or the miRNA chain) starting from the second nucleotide at the 5' end; preferably, the mismatch is a UU mismatch.

[0127] Item C9.2, the functionalized tetrahedral framework nucleic acid according to item C8 or C9, characterized in that:

[0128] The ribonucleic acid 1 is completely complementary to the corresponding nucleotide segment of the miRNA starting from the 3' end;

[0129] The ribonucleic acid 3 is completely complementary to the corresponding nucleotide segment of the miRNA (or the miRNA chain) starting from the 5' end.

[0130] Item C10, the functionalized tetrahedral framework nucleic acid according to any one of items C8-C9.2, characterized in that: the ribonucleic acid 1, the ribonucleic acid 3, the deoxyribonucleic acid 4 and the miRNA strand of the DNA single strand form three edges of a triangular face of the tetrahedral framework, and the deoxyribonucleic acid 2 of the three DNA single strands complementarily form the remaining three edges of the tetrahedral framework.

[0131] Item C11, the functionalized tetrahedral framework nucleic acid according to any one of items C1-C10, characterized in that: the tetrahedral framework nucleic acid is a BiRDS structure.

[0132] Item C12, the functionalized tetrahedral framework nucleic acid according to any one of items C1-C11, characterized in that: the miRNA in the miRNA chain is selected from miRNA125; preferably, the sequence of miRNA125 contains nucleotides 1-22 of SEQ ID NO.4, or has at most 1, at most 2, at most 3, or at most 4 nucleotide variations (mutations, deletions, and / or additions) compared to nucleotides 1-22 of SEQ ID NO.4.

[0133] Item C13, the functionalized tetrahedral framework nucleic acid according to item C12, characterized in that: the nucleotide sequence of the miRNA chain includes SEQ ID NO.4.

[0134] Item C14, the functionalized tetrahedral framework nucleic acid according to any one of items C1-C13, characterized in that: the nucleotide sequences of the three DNA single strands are as shown in SEQ ID NO.1-SEQ ID NO.3.

[0135] Item C15. A method for preparing functionalized tetrahedral framework nucleic acid according to any one of items C1-C14, characterized in that it includes the following steps: mixing the three single-stranded DNA strands and the three miRNA strands;

[0136] Preferably, the mixture is incubated using a thermal cycler.

[0137] Preferably, the molar ratio of the three single-stranded DNA strands is 1:1:1;

[0138] Preferably, the molar ratio of the three single-stranded DNA strands to the miRNA strand is 1:1:1:1-3; more preferably, the molar ratio is 1:1:1:3.

[0139] The use of the functionalized tetrahedral framework nucleic acid described in any one of items C16 or C1-C14 in the preparation of drugs for treating diseases.

[0140] Item C17, the use according to item C16, characterized in that: the disease is acute liver injury and / or acute kidney injury.

[0141] Item C18, a pharmaceutical composition, characterized in that it comprises the functionalized tetrahedral framework nucleic acid described in any one of items C1-C14, and pharmaceutically acceptable excipients.

[0142] Item C19, the pharmaceutical composition according to item C18, characterized in that: the pharmaceutical composition is a pharmaceutical composition for treating acute liver injury and / or acute kidney injury.

[0143] Item C20, the functionalized tetrahedral framework nucleic acid according to any one of items C1-C11, characterized in that: the miRNA of the miRNA chain is selected from miR-30a-5p; preferably, the sequence of miR-30a-5p contains nucleotides 1-22 of SEQ ID NO.14, or has at most 1, at most 2, at most 3, or at most 4 nucleotide variations (mutations, deletions, and / or additions) compared to nucleotides 1-22 of SEQ ID NO.14.

[0144] Item C21, the functionalized tetrahedral framework nucleic acid according to item C20, characterized in that: the nucleotide sequence of the miRNA chain includes SEQ ID NO.14.

[0145] Item C22, the functionalized tetrahedral framework nucleic acid according to item C20 or C21, characterized in that:

[0146] (a) The nucleotide sequence of the DNA single strand described in the first paragraph is SEQ ID NO.11 or SEQ ID NO.17;

[0147] (b) The nucleotide sequence of the DNA single strand described in Clause 2 is SEQ ID NO. 12 or SEQ ID NO. 18; and / or

[0148] (c) The nucleotide sequence of the DNA single strand described in Article 3 is SEQ ID NO.13 or SEQ ID NO.19.

[0149] Item C23, the functionalized tetrahedral framework nucleic acid according to any one of items C20-C22, characterized in that: the nucleotide sequence of the first DNA single strand is SEQ ID NO.11, the nucleotide sequence of the second DNA single strand is SEQ ID NO.12, and the nucleotide sequence of the third DNA single strand is SEQ ID NO.13.

[0150] Item C24, the functionalized tetrahedral framework nucleic acid according to any one of items C20-C22, characterized in that: the nucleotide sequence of the first DNA single strand is SEQ ID NO.17, the nucleotide sequence of the second DNA single strand is SEQ ID NO.18, and the nucleotide sequence of the third DNA single strand is SEQ ID NO.19.

[0151] The method for preparing the functionalized tetrahedral framework nucleic acid according to any one of items C25, C1-C11 and C20-C24 is characterized by comprising the following steps: mixing the three single-stranded DNA strands and the three miRNA strands;

[0152] Preferably, the mixture is incubated using a thermal cycler.

[0153] Preferably, the molar ratio of the three single-stranded DNA strands is 1:1:1;

[0154] Preferably, the molar ratio of the three single-stranded DNA strands to the miRNA strand is 1:1:1:1-3; more preferably, the molar ratio is 1:1:1:3.

[0155] Use of the functionalized tetrahedral framework nucleic acid described in any one of items C26, C1-C11, and C20-C24 in the preparation of medicaments for treating diseases.

[0156] Item C27, the use according to item C26, characterized in that: the disease is an eye disease; optionally, the eye disease is a fundus disease.

[0157] Item C28, the use according to item C26, characterized in that: the disease is post-stroke depression, cardiovascular disease, cancer, peripheral nerve injury, or knee osteoarthritis.

[0158] Item C29, the use according to item C28, characterized in that: the cancer is selected from head and neck squamous cell carcinoma, non-small cell lung cancer, prostate cancer, renal cell carcinoma, breast cancer, hepatocellular carcinoma, and uveal melanoma.

[0159] Item C30, the use according to item C29, characterized in that: the cancer is uveal melanoma.

[0160] Item C31, a pharmaceutical composition, characterized in that it comprises the functionalized tetrahedral framework nucleic acid described in any one of items C1-C11 and C20-C24, and pharmaceutically acceptable excipients.

[0161] Item C32, the pharmaceutical composition according to item C31, characterized in that: the pharmaceutical composition is a pharmaceutical composition for treating eye diseases.

[0162] Item C33, the pharmaceutical composition according to item C31, characterized in that: the pharmaceutical composition is a pharmaceutical composition for treating uveal melanoma.

[0163] All references throughout this application, such as patent documents containing published or granted patents or their equivalents, patent application publications, and non-patent literature or other sources, are incorporated herein by reference in their entirety, as if individually incorporated by reference. All patents and publications referenced in the specification indicate the level of skill of a person skilled in the art to which this invention relates. References cited herein are incorporated in their entirety by reference to indicate the state of the art in the art (in some cases) at their filing date, and this information may be used in the invention, excluding (e.g., abandoning) specific embodiments in the prior art if necessary. For example, when claiming a compound, it is understood that compounds known in the art that include a particular compound disclosed in the references disclosed herein (particularly in the referenced patent documents) are not included in the claims.

[0164] Some reference documents:

[0165] Tian et al.,Nat Protoc.2023Apr;18(4):1028-1055.doi:10.1038 / s41596-022-00791-7

[0166] Zhang et al.,Nat Protoc.2020Aug;15(8):2728-2757.doi:10.1038 / s41596-020-0355-z

[0167] Li et al.,Nat Protoc.2025Feb;20(2):336-362.doi:10.1038 / s41596-024-01050-7

[0168] Jiang et al.,ACS Nano.2025Apr 22;19(15):14756-14769.doi:10.1021 / acsnano.4c16427

[0169] Li et al.,Adv Sci(Weinh).2025Mar;12(10):e2411210.doi:10.1002 / advs.202411210

[0170] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0171] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0172] Figure 1 is a schematic diagram of NP fabrication.

[0173] Figure 2 shows the stepwise synthesis of NP and tFNA as displayed by AGE. miRNA-125 was successfully loaded onto NP, and the stepwise preparation of NP and tFNA was shown by enhanced Cy5 fluorescence (lane 1: tFNA-S1; lane 2: tFNA-S1+tFNA-S2; lane 3: tFNA-S1+tFNA-S2+tFNA-S3; lane 4: tFNA-S1+tFNA-S2+tFNA-S3+tFNA-S4; lane 5: S1; lane 6: S1+S2; lane 7: S1+S2+S3; lane 8: S1+S2+S3+Cy5-miRNA-125; lane 9: S1+S2+S3+2×Cy5-miRNA-125; lane 10: S1+S2+S3+3×Cy5-miRNA-125).

[0174] Figure 3 shows a schematic diagram of NPs in both matched and mismatched configurations. In AGE, matched NPs exhibit minimal Cy5 fluorescence, indicating successful structural integration.

[0175] Figure 4 shows the small size of the NP in the AFM image and the uniform distribution of the small-sized NP in the TEM image.

[0176] Figure 5 shows that the hydrodynamic dimensional analysis reveals that the NP and tFNA have similar dimensions.

[0177] Figure 6 shows the NP potential with a negative charge.

[0178] Figure 7(a) Schematic diagram of NP opening in response to stimulus. (b) AGE shows conformational change of NP in response to stimulus.

[0179] Figure 8 shows that CGE analysis confirmed the structural changes observed in AGE. Data were analyzed using one-sided Student's t-tests or one-way ANOVA and post-hoc analyses (Sidak tests) for multiple comparisons. Data are expressed as mean ± standard deviation (SD) (n≥3), ***P<0.001.

[0180] Figure 9 shows the design of Cy5 (receptor) and Cy3 (donor) in NP.

[0181] Figure 10(a) shows the relative fluorescence intensity of the FRET results. (b) AGE also confirmed the FRET results. ***p<0.001.

[0182] Figure 11 shows the change in relative fluorescence intensity (FRET / Cy5), indicating the metabolic state of NP in vivo.

[0183] Figure 12 shows the changes in relative fluorescence intensity (FRET / Cy5) in the liver and kidneys. *p<0.05; **p<0.01; ***p<0.001.

[0184] Figure 13 shows the passive targeting of NP as indicated by miRNA-qPCR results. ***p<0.001.

[0185] Figure 14 shows the use of in vivo fluorescence signal changes to evaluate the metabolism of miRNA, Entranster, and NP.

[0186] Figure 15 shows the relative fluorescence intensity of internal organs, liver, and kidneys in mice at 4h, 8h, and 24h.

[0187] Figure 16 shows the statistical analysis of relative fluorescence intensity. ***Compared with miRNA, P<0.001; compared with Entranster, p<0.05, p<0.01.

[0188] Figure 17 shows fluorescence imaging of tissue sections 24 hours after injection of miRNA, Entranster, and NP.

[0189] Figure 18 is a schematic diagram of miRNAscope.

[0190] Figure 19 shows that in liver and kidney tissue sections, a large number of red dots were observed in the NP group, and some red dots were also observed in the Entranster group, but almost no red dots were observed in the miRNA group.

[0191] Figure 20 shows the statistical analysis of red spots in various cells of the liver and kidney. ***Compared with miRNA, p<0.001; compared with Entranster, p<0.001.

[0192] Figure 21(a) Storage stability test of NP and tFNA. (b, c) Serum stability test of NP and tFNA. (d) DNase I tolerance test of NP and tFNA; Data were analyzed using one-sided Student's t-test or one-way ANOVA and post-hoc analysis (Sidak test) for multiple comparisons, and data are expressed as mean ± SD (n≥3).

[0193] Figure 22 shows the therapeutic effect of NP on acute liver failure in mice. A) Schematic diagram of in vivo drug treatment methods and time points for ALF. B) Gross morphology of the liver in each group. C) Kaplan-Meier survival analysis of mice after different treatments. D) Liver HE staining images (scale bar: 1mm, 300μm, 100μm). Green asterisk: normal hepatocytes; red arrow: hepatocyte vacuolar degeneration; blue arrow: lipid droplets, indicating hepatocyte steatosis; orange arrow: necrotic hepatocytes; N: necrotic area. E, F) Serum ALT and AST level analysis. G, I) Representative images of Ly6G and CD68 expression in the liver based on immunohistochemical staining (scale bar: 50μm, 100μm, and 250μm). H) Histopathological scoring of liver sections based on HE staining. J) Quantitative analysis of the percentage of Ly6g positive cells. K) Liver DHE staining immunofluorescence images (ROS: red; nucleus: blue; 3D thermography: reconstructed ROS fluorescence intensity (scale: 1.5 mm and 250 μm). L) Quantitative analysis of CD68 expression levels. M) Quantitative analysis of relative ROS fluorescence intensity. All data were analyzed using one-way ANOVA and post-hoc analysis (Sidak test), and are expressed as mean ± standard deviation (n≥3). Error bars represent standard deviation. Statistical analysis: (*) compared to the control group; *P<0.05, **P<0.01, ***P<0.001. # (compared to the AKI group) # P<0.05, ## P<0.01, ### P<0.001. & ) compared to the tFNA group; & P<0.05, && P<0.01, &&& P<0.001.

[0194] Figure 23 is a schematic diagram of the mechanism of NP's protective effect on hepatocellular cells in APAP poisoning.

[0195] Figure 24 shows (a) RT-qPCR expression analysis of Keap1 and its downstream related genes. (b) Western blotting analysis of Keap1, Nrf2, and HO-1 protein expression. (c) Quantitative analysis of related protein expression based on Western blotting results.

[0196] Figure 25 shows representative images of Keap1, Nrf2, and HO-1 expression in the liver based on immunohistochemical staining (scale bar: 50 μm, 100 μm, and 200 μm), and quantitative analysis of Keap1, Nrf2, and HO-1 expression levels based on immunohistochemical results.

[0197] Figure 26 shows TUNEL-stained liver immunofluorescence images (TUNEL: green; nucleus: blue; 3D thermal imaging: reconstructed TUNEL fluorescence intensity (scale bar: 200 μm).

[0198] Figure 27 shows the relative fluorescence intensity of TUNEL based on quantitative analysis of TUNEL staining and the percentage of TUNEL-positive cells in the total number of cells based on quantitative analysis of TUNEL staining.

[0199] Figure 28 shows the Western blotting analysis of the protein expression of apoptosis-related proteins Bax, Bcl-2, and Caspase-3, as well as the quantitative analysis of the expression of apoptosis-related proteins based on the Western blotting results.

[0200] Figure 29 shows the relative fluorescence intensities of Bax, Bcl-2, and Caspase-3, and the immunofluorescence images of Bax, Bcl-2, and Caspase-3 expression (Bax, Bcl-2, and Caspase-3: green; nucleus: blue; three-dimensional thermography: reconstructed fluorescence intensities of Bax, Bcl-2, and Caspase-3 (scale bar: 200 μm). All data were analyzed using one-way ANOVA and post-hoc analysis (Sidak test), and are expressed as mean ± standard deviation (n≥3). Error bars represent standard deviation. Statistical analysis: (*) compared to the control group; *P<0.05, **P<0.01, ***P<0.001. # (compared to the AKI group) # P<0.05, ## P<0.01, ### P<0.001. & ) compared to the tFNA group; & P<0.05, && P<0.01, &&& P<0.001.

[0201] Figure 30 illustrates the effects of NP on kidney injury in an I / R-induced AKI mouse model, focusing on pathological, serological, microstructural, and protein expression aspects. A) Schematic diagram of in vivo drug treatment methods and time points for AKI. B, D) HE and PAS stained kidney images (scale bar: 100 μm, 300 μm, and 500 μm). Green arrow: healthy renal tubules; red arrow: coagulative necrosis of renal tubules; red asterisk: hyaline casts; red triangle: mucinous exudation; blue arrow: renal tubular dilatation; orange arrow: loss of boundaries. C, E) Serum CREA and urea level analysis. F) Histopathological scoring of kidney sections based on HE staining. G) Representative transmission electron microscopy images of mitochondria in different groups of kidneys (scale bar: 5 μm and 1.5 μm). Green arrow: healthy mitochondria; red arrow: mitochondrial fragmentation with extravasation of matrix material; red asterisk: disordered or missing mitochondrial cristae; orange arrow: mitochondrial swelling. H) Histopathological scoring of kidney sections based on PAS staining. I) Immunohistochemical images of CD68 expression (scale bars: 250 μm and 100 μm). J) Immunohistochemical images of KIM-1 expression (scale bars: 250 μm and 100 μm). K) Quantitative analysis of CD68 expression based on immunohistochemical results. L) Western blotting analysis of KIM-1 protein expression. M) Quantitative analysis of KIM-1 expression based on Western blotting results. N) Quantitative analysis of KIM-1 expression based on immunohistochemical results. All data were analyzed using one-way ANOVA and post-hoc analysis (Sidak test), and are expressed as mean ± standard deviation (n≥3). Error bars represent standard deviation. Statistical analysis: (*) compared to the control group; *P<0.05, **P<0.01, ***P<0.001. # (compared to the AKI group) # P<0.05, ## P<0.01, ### P<0.001. & ) compared to the tFNA group; & P<0.05, && P<0.01, &&& P<0.001.

[0202] Figure 31 is a schematic diagram of the mechanism of NP's protective effect against I / R-induced AKI.

[0203] Figure 32 shows the Western blotting analysis of p53 protein and the quantitative analysis of p53 expression based on the Western blotting results.

[0204] Figure 33 shows the quantitative analysis of p53 expression by immunohistochemistry and the immunohistochemical images of p53 expression (scale bar: 250 μm and 100 μm).

[0205] Figure 34 shows the quantitative analysis of flow cytometry results and the percentage of RTECs apoptosis in each group as detected by flow cytometry.

[0206] Figure 35 shows TUNEL-stained kidney immunofluorescence images (TUNEL: green; nucleus: blue; 3D thermal imaging: reconstructed TUNEL fluorescence intensity (scale bar: 200 μm), quantitative analysis of TUNEL relative fluorescence intensity based on TUNEL staining, and quantitative analysis of the percentage of TUNEL-positive cells in the total cells based on TUNEL staining).

[0207] Figure 36 shows the Western blotting analysis of the protein expression of apoptosis-related proteins Bax, Bcl-2, and Caspase-3, as well as the quantitative analysis of the expression of apoptosis-related proteins based on the Western blotting results.

[0208] Figure 37 shows the immunohistochemical images of Bax expression (scale bars: 250 μm and 100 μm) and quantitative analysis.

[0209] Figure 38 shows the protein expression of cell cycle-related proteins: Cyclin B1 and PCNA, and the quantitative analysis of cell cycle-related protein expression based on Western blotting results.

[0210] Figure 39 shows the immunohistochemical images of PCNA expression (scale bars: 250 μm and 100 μm) and quantitative analysis. All data were analyzed using one-way ANOVA and post-hoc analysis (Sidak test), and are expressed as mean ± standard deviation (n≥3). Error bars represent standard deviation. Statistical analysis: (*) compared to the control group; *P<0.05, **P<0.01, ***P<0.001. # (compared to the AKI group) # P<0.05, ## P<0.01, ### P<0.001. & ) compared to the tFNA group; & P<0.05, && P<0.01, &&& P<0.001.

[0211] Figure 40 shows the experimental results and quantitative results of BiRDS synthesis verified by agarose gel electrophoresis.

[0212] Figure 41 shows the experimental results of high-efficiency capillary electrophoresis to verify the synthesis of BiRDS.

[0213] Figure 42 shows the transmission electron microscope (TEM) and atomic force microscope (AFM) images of BiRDS, with a scale bar of 100 nm.

[0214] Figure 43 shows the particle size distribution and zeta potential results of dynamic light scattering detection for TDN and BiRDS.

[0215] Figure 44 shows the agarose gel electrophoresis results and quantitative results of the stability of BiRDS at room temperature.

[0216] Figure 45 shows the agarose gel electrophoresis results and quantitative results of the stability of BiRDS in a biological environment at 37℃.

[0217] Figure 46 shows the fluorescence detection and quantitative results of different nucleic acid drugs in MUM2B cells.

[0218] Figure 47 shows the flow cytometry results and quantitative results of different nucleic acid drugs in MUM2B cells.

[0219] Figure 48 shows the results of MUM2B cell viability determination using CCK8 reagent; Figure A shows the viability results of MUM2B cells treated with different concentrations of BiRDS; Figure B shows the viability results of MUM2B cells treated with different nucleic acid drugs over time.

[0220] Figure 49 shows the colony formation results of MUM2B cells after treatment with different nucleic acid drugs.

[0221] Figure 50 shows the scratch assay results of MUM2B cells after treatment with different nucleic acid drugs.

[0222] Figure 51 shows the quantitative results of colony formation and scratch assays of MUM2B cells after treatment with different nucleic acid drugs.

[0223] Figure 52 shows the transwell experiment results of MUM2B cells after treatment with different nucleic acid drugs.

[0224] Figure 53 shows the quantitative results of the transwell experiment after treating MUM2B cells with different nucleic acid drugs.

[0225] Figure 54 shows the flow cytometry results of apoptosis experiments on MUM2B cells after treatment with different nucleic acid drugs.

[0226] Figure 55 shows the quantitative flow cytometry results of apoptosis experiments after MUM2B cells were treated with different nucleic acid drugs; where UP represents the results in the upper right quadrant of the flow cytometry plot, and LP represents the results in the lower right quadrant of the flow cytometry plot.

[0227] Figure 56 shows the immunofluorescence staining of E2F7 cells after MUM2B cells were treated with different nucleic acid drugs.

[0228] Figure 57 shows the immunofluorescence staining of cleaved caspase-3 (C-Caspase-3) in MUM2B cells after treatment with different nucleic acid drugs.

[0229] Figure 58 shows the quantitative results of immunofluorescence staining of E2F7 and C-Caspase-3 in MUM2B cells after treatment with different nucleic acid drugs.

[0230] Figure 59 shows the results of western blot analysis of E2F7, caspase-3, and C-Caspase-3 in MUM2B cells.

[0231] Figure 60 shows the results of Western blot analysis to determine the expression levels of E2F7, caspase-3, and C-Caspase-3 in MUM2B cells.

[0232] Figure 61 shows the fluorescence staining of different nucleic acid drugs penetrating into ocular tissues.

[0233] Figure 62 shows the quantitative results of fluorescence staining of different nucleic acid drugs penetrating into ocular tissues.

[0234] Figure 63 shows the hematoxylin-eosin (HE) staining of normal animal ocular tissues with BiRDS.

[0235] Figures A-C of Figure 64 show the tumor morphology and tumor weight and size statistics of UM animals after treatment with different nucleic acid drugs.

[0236] Figure 65 shows the eye images of UM animals treated with different nucleic acid drugs and HE staining images of eye tumors.

[0237] Figure 66 shows the immunofluorescence staining of E2F7 in UM animals after treatment with different nucleic acid drugs.

[0238] Figure 67 shows the immunofluorescence staining of C-Caspase-3 in UM animals after treatment with different nucleic acid drugs.

[0239] Figure 68 shows the quantitative results of immunofluorescence staining of E2F7 and C-Caspase-3 in UM animals after treatment with different nucleic acid drugs.

[0240] Figure 69 shows the results of western blot analysis of E2F7, caspase-3, and C-Caspase-3 in tumor tissues of UM animals.

[0241] Figure 70 shows the results of western blot analysis of the expression levels of E2F7, caspase-3, and C-Caspase-3 in tumor tissues of UM animals.

[0242] Figure 71 shows the TUNEL staining pattern of dUTP nick end markers mediated by tdt.

[0243] Figure 72 shows the results of Ki-67 immunohistochemical staining.

[0244] Figure 73 shows the quantitative results of TUNEL staining, Ki-67 immunohistochemical staining, and ELISA measurement of IFN-γ.

[0245] Figure 74 shows in vivo fluorescence images of nude mice 24 hours after administration of PBS, miR, TDN, or BiRDS.

[0246] Figure 75 shows the statistical analysis of the relative fluorescence intensity of Cy5 at various time points using in vivo fluorescence imaging. Statistical analysis: Compared with the "BiRDS" group, ****: P < 0.0001.

[0247] Figure 76 shows the statistical analysis of the relative fluorescence intensity of Cy5 by in vivo fluorescence imaging 24 hours later. Statistical analysis: **: P < 0.01; ****: P < 0.0001.

[0248] Figure 77 shows the statistical analysis of the relative expression levels of miR-30a-5p. Error bars represent standard deviations. Statistical analysis: ****: P < 0.0001 between the miR group and the BiRDS group. Detailed Implementation

[0249] In the following examples and experimental cases, reagents and raw materials not specifically described are all commercially available products.

[0250] Example 1: Tetrahedral framework nucleic acid (NP) embedded with miRNA125 and its preparation method

[0251] This embodiment provides a tetrahedral framework nucleic acid (NP) with embedded miRNA, which is assembled from three single-stranded DNA strands (S1-S3) and three miRNA strands through complementary base pairing (Figure 1).

[0252] Taking miRNA125 as an example, the nucleotide sequence of single-stranded DNA S1 is shown in SEQ ID NO.1, the nucleotide sequence of single-stranded DNA S2 is shown in SEQ ID NO.2, the nucleotide sequence of single-stranded DNA S3 is shown in SEQ ID NO.3, and the nucleotide sequence of miRNA125 chain is shown in SEQ ID NO.4, as shown in Table 1.

[0253] Table 1

[0254] In the nucleotide sequences in the table, the uppercase letters represent deoxyribonucleotides, and the lowercase letters represent ribonucleotides.

[0255] Each miRNA strand extends four ribonucleotides from its end, acting as a biological switch. In the complementary base pairing region between any single-stranded DNA and miRNA, the deoxyribonucleotides of the single-stranded DNA are replaced with ribonucleotides, forming an RNA-binding domain. The portion complementary to the biological switch is still designed to be a deoxyribonucleotide, ensuring that the biological switch can be triggered by RNase H, which is widely present in mammalian cells, ultimately opening this delivery platform. Simultaneously, at the vertex corner of each miRNA125, there are six ribonucleotide bases that do not participate in complementary base pairing (Figure 1), enabling miRNA125 to undergo a footpoint-mediated strand substitution (TMSD) reaction with the target.

[0256] Preparation method: Mix three single-stranded DNA strands (molar ratio 1:1:1) and three miRNA strands to obtain a mixture, wherein the molar ratio of any one single-stranded DNA strand to any one miRNA strand is 1:1. Thoroughly mix the above mixture with TM buffer (50mM MgCl2-6H2O and 10mM Tris-HCl), heat to 95℃, then rapidly cool to 4℃ for 30 min to obtain the final product.

[0257] Comparative Example 1

[0258] This comparative example provides the control sample used in the experiment:

[0259] 1. tFNA

[0260] This sample was assembled from four single-stranded DNA strands based on complementary base pairing. The preparation method was the same as in Example 1. Four single-stranded DNA strands (tFNA-S1 to tFNA-S4) were used, with the nucleotide sequence of tFNA-S1 shown in SEQ ID NO.7, the nucleotide sequence of tFNA-S2 shown in SEQ ID NO.8, the nucleotide sequence of tFNA-S3 shown in SEQ ID NO.9, and the nucleotide sequence of tFNA-S4 shown in SEQ ID NO.10, as shown in Table 1.

[0261] 2. miRNA

[0262] The sample was miRNA125.

[0263] The nucleotide sequence is shown in SEQ ID NO.4, as shown in Table 1.

[0264] The technical solution of the present invention will be further explained through experiments below.

[0265] Example 1: Characterization of tetrahedral framework nucleic acids (NPs) embedded with miRNA125

[0266] This experimental example characterizes the NP prepared in Example 1.

[0267] I. Experimental Methods

[0268] The morphology of NPs was observed by capillary gel electrophoresis, atomic force microscopy, and transmission electron microscopy; the hydrodynamic size of NPs was precisely quantified by dynamic light scattering.

[0269] II. Experimental Results

[0270] As shown in Figure 2, NPs exhibited similar relative fluorescence intensity to tFNA in capillary gel electrophoresis, demonstrating their similar structures. The 3' ends of miR125 and mismatched miR125 were modified using Black Hole Quencher-2 (BHQ-2), with the nucleotide sequences of Matched-miRNA125 shown in SEQ ID NO. 5 and Mismatched-miRNA125 in SEQ ID NO. 6. Matched-NP and Mismatched-NP were synthesized using a one-pot method (Figure 3). Due to the successful synthesis and complete framework closure of the NP structure, the relative fluorescence intensity of the Cy5 channel in matched-NP decreased to 3% of that in Mismatched-NP (Figure 3). Atomic force microscopy and transmission electron microscopy were used to observe the morphology of the NPs. Figure 4 shows that the NPs are very small (9.24 ± 0.86 nm) and uniformly distributed. Subsequently, dynamic light scattering was used to further quantify the hydrodynamic dimensions of the NP. The results showed that after encapsulating miRNA125 inside the nanoparticle, the particle size was similar to that of tFNA with a side length of 21 bp (Figure 5). Since the original DNA backbone was replaced by RNA, the NP was more negatively charged than tFNA (Figure 6). To facilitate the binding of miRNA125 loaded in the NP to intracellular targets, the bioswitchable structure in the NP can be triggered by RNase H, which is ubiquitous in mammalian cells, degrading the RNA portion of the DNA-RNA hybrid chain in the bioswitchable structure, thereby opening the NP (Figure 7a). The opening of the nanostructure was then simulated in the extracellular environment. As the enzyme activity of RNase H in the incubation environment increased, the migration rate of the nanostructure gradually slowed down, which also confirmed the change in the three-dimensional conformation of the NP (Figure 7b). Capillary gel electrophoresis also confirmed this result, indicating that after the nanostructure enters the cell at a relatively small size, it opens its three-dimensional structure after being triggered by RNase H, which is conducive to binding to intracellular targets (Figure 8).

[0271] In vivo metabolism and distribution of NP in Experiment Example 2

[0272] I. Experimental Methods

[0273] 1. Agarose gel electrophoresis

[0274] 2. miRNA-qPCR

[0275] II. Experimental Results

[0276] As shown in Figure 9, the 5' and 3' ends of miRNA125 are modified with Cy5 (acceptor) and cy3 (donor), respectively. When the NP structure is intact, interaction occurs between the acceptor (Cy5) and the donor (cy3). During resonance energy transfer (FRET), the fluorescence of the acceptor increases, while the autofluorescence intensity of the donor decreases. When the NP is broken down, the fluorescence of the acceptor will not increase. Changes in the fluorescence intensity of the acceptor help to clearly observe the metabolism and distribution of NPs in vivo. Cy3-NP, Cy5-NP, and FRET-NP were prepared separately, and Cy3-NP and Cy5-NP were mixed in equal proportions to prepare Cy3+5-NP. The relative fluorescence intensity of the four samples was measured. FRET-NP had a weaker relative fluorescence intensity at 570 nm and a stronger relative fluorescence intensity at 670 nm compared to the other groups, indicating that FRET-NP underwent FRET between the acceptor and donor (Figure 10a). Agarose gel electrophoresis also confirmed this result (Figure 10b). Subsequently, FRET-NP and Cy3+5-NP were injected into mice, and the metabolism of NPs and the percentage of intact NPs were observed by changes in relative fluorescence intensity (Channel 1-FRET / Channel 2-Cy5) (Figure 11). Within 8 hours post-injection, the proportion of intact NPs in the liver gradually decreased; while in the kidneys, the proportion of intact NPs peaked at 0.5–1 hour and then gradually decreased (Figure 12). At 24 hours, no intact NPs were found in either the liver or kidneys. To preliminarily assess the delivery efficiency of NPs, naked miRNAs and NPs were injected intraperitoneally, and livers and kidneys were collected at 24 hours. Finally, miRNA-qPCR was used to assess the expression level of miRNA-125. The miRNA-qPCR results showed that the expression level of miRNA-125 in the NP group was higher than that in the blank group in the liver, and also higher than that in the kidneys, reaching the blank group level. However, direct injection of naked miRNA was almost ineffective (Figure 13), confirming that NPs can significantly improve the delivery efficiency of miRNAs.

[0277] To further demonstrate the great potential of NP in miRNA delivery, it was combined with another in vivo RNA transfection reagent, Entranster. TMComparisons were conducted. miRNA, Entranster, and NP groups were prepared using cy5-modified miRNA-125, and in vivo imaging was performed at six time points after injection (Figure 14). Directly injected miRNA-125 showed almost no fluorescence within 45 min. The relative fluorescence intensity of the Entranster and NP groups was similar within 15 min, but the relative fluorescence intensity of the NP group was significantly higher than that of the Entranster group at 30 min. The relative fluorescence intensity of internal organs, as well as the liver and kidneys, was observed at 4 h, 8 h, and 24 h (Figure 15). The results showed statistically significant differences between the NP and Entranster groups in the liver at 8 h and 24 h, and in the kidneys at 24 h (Figure 16). Fluorescence of liver and kidney sections at 24 h was observed; the Cy5 fluorescence in the NP group was significantly stronger than that in the Entranster group, while almost no fluorescence signal was detected in the miRNA group (Figure 17).

[0278] miRNAscope is a stable RNA in situ hybridization assay that detects the spatial distribution of miRNA-125 in tissues through the highly specific binding of probes to miRNA-125 (Figure 18). In liver and kidney tissue sections, numerous red dots appeared in the NP group, some in the Entranster group, but almost no red dots were observed in the miRNA group (Figure 19). Analysis of the number of red dots per cell revealed statistically significant differences between the NP and Entranster groups in liver and kidney samples. These results also confirm that NP has a higher miRNA delivery efficiency compared to the commercially available RNA drug delivery vector Entranster (Figure 20).

[0279] The miRNA in the miRNA delivery vehicle must be protected; therefore, the stability of NP was evaluated. In the storage stability test, NP and tFNA showed similar stability at room temperature, but NP showed outstanding stability at 37°C, which may be related to the presence of a double-stranded RNA structure in its internal composition (Fig. 21a). In the serum stability test, NP showed similar stability results to tFNA at both 2% and 10% serum concentrations (Fig. 21b). Furthermore, after 12h and 24h incubation, the stability results of NP were similar to those of tFNA with increasing serum concentration (Fig. 21c). In the DNase I tolerability test, NP was more stable than tFNA when the DNase I concentration was greater than 5 U / mL. The advantage of NP in the efficient delivery of miRNA undoubtedly promotes the development prospects of miRNA-related drugs limited by unstable miRNAs (Fig. 21d).

[0280] Experimental Example 3: The therapeutic effect of NP on acute liver failure (ALF) in mice.

[0281] I. Experimental Methods

[0282] 1. ALF mouse model: As shown in Figure 22A, Balb / C mice were intraperitoneally injected with 350 mg / kg acetaminophen (APAP), and then given saline, tFNA, or NP (100 μL) every 6 hours to establish an ALF model. Serum and tissue samples were collected 24 hours later.

[0283] 2. Experimental Groups:

[0284] Ctrl Group: Do not inject APAP;

[0285] ALF Group: APAP injection, no follow-up treatment;

[0286] tFNA Group: APAP injection combined with tFNA therapy;

[0287] NP Group: APAP injection combined with NP treatment;

[0288] In the experimental results graph, "1" represents the Ctrl Group, "2" represents the ALF Group, "3" represents the tFNA Group, and "4" represents the NP Group.

[0289] 3. Serological markers: Analysis of serum ALT and AST levels.

[0290] 4. HE staining: Histopathological analysis of liver sections.

[0291] 5. Ly6G staining: Neutrophils can be identified and quantitatively analyzed by using antibodies against Ly6G.

[0292] 6. IHC staining.

[0293] 7. Detection of reactive oxygen species by DHE staining of the liver.

[0294] 8. Western blotting analysis of the expression of Keap1, Nrf2, HO-1, Bax, Bcl-2, and Caspase-3 proteins.

[0295] 9. PCR analysis of the gene expression of Keap1, Nrf2, and HO-1.

[0296] 10. Immunohistochemical staining analysis of the expression of Keap1, Nrf2 and HO-1 in the liver.

[0297] 11. TUNEL staining was used to assess the anti-apoptotic ability of NPs.

[0298] 12. Immunofluorescence staining analysis of the fluorescence intensity of Bax, Bcl-2, and Caspase-3.

[0299] II. Experimental Results

[0300] The mortality rates of mice in different groups are shown in Figure 22C. Kaplan-Meier survival curve analysis showed that the 24-hour survival rate of the ALF group was 0%, which increased significantly to 50% after NP administration, indicating a significant survival advantage for mice treated with NP. Gross morphological results of the livers in each group (Figure 22B) showed that the livers of the control group were smooth and shiny, with uniform texture and a bright, uniform red color. However, the livers of APAP-treated mice exhibited an uneven, rough, and atrophic appearance, with a hardened texture and darkened color, indicating successful establishment of the ALF model. Both tFNA and NP treatments alleviated the pathological state of the liver induced by APAP, but the livers of the NP group were significantly healthier. Similarly, key serological indicators of ALF showed severely impaired liver function in the ALF group, as shown in Figures 22E and F, with the highest levels of AST and ALT. Only the NP-treated group showed a significant decrease in ALT and AST levels, indicating that NP effectively prevented APAP-induced liver injury, thereby improving mouse survival.

[0301] Subsequently, liver tissue was stained with hematoxylin and eosin (HE) as shown in Figure 22D, visually demonstrating the APAP-induced hepatotoxicity and the therapeutic effect of NP on ALF. Histologically, severe liver damage, structural destruction, extensive necrosis areas with numerous vacuolar degenerations and hepatocyte steatosis were observed in the ALF group. After tFNA intervention, liver necrosis decreased but remained severe, while the NP group showed less damage, healthy histopathology, and a small number of lipid droplets. Histopathological scoring of liver sections based on the severity of liver damage further demonstrated that NP treatment did indeed help alleviate APAP-induced liver failure (Figure 22H). Necrotic inflammation is considered a common indicator of ALF. To assess the infiltration of inflammatory cells into the site of liver injury, neutrophil infiltration was monitored by Ly6G staining, and the expression of the macrophage-specific marker CD68 was monitored by IHC. As shown in Figures 22G and I, Ly6G-positive cells and CD68-positive cells (dark brown staining) represent neutrophils and macrophages infiltrating the liver tissue, respectively. Compared with the control group, the ALF group showed severe enhanced neutrophil infiltration and upregulated CD68 expression in the liver, indicating aggravated necrosis and inflammation. Both tFNA and NP treatments improved liver inflammation, with NP treatment showing a more significant effect, significantly reducing the percentage of Ly6G-positive cells and CD68 expression levels. Statistical analysis of histological sections further validated these conclusions (Figure 22 J and L).

[0302] Excessive ROS production can lead to DNA and mitochondrial damage, rapid inflammation, massive ALT release, and ultimately hepatocyte necrosis. To determine whether NP helps clear APAP-induced ROS, liver tissue was stained with DHE. Red fluorescence showed a sharp increase in ROS levels after APAP injection and a significant decrease in ROS levels after NP treatment, confirming the significant protective ability of NP against in vivo oxidative damage (Figure 22K and M). In summary, serological and histological analyses indicate that NP effectively inhibits liver necrosis, reduces inflammation, and maintains ROS homeostasis.

[0303] As shown in Figure 23, the Keap1 / Nrf2 signaling pathway is associated with various oxidative stress diseases and can serve as an important therapeutic target for ALF. Previous studies have shown that miRNA-125 is an effective regulator of the Keap1 / Nrf2 signaling pathway, targeting the Keap1 protein, promoting the dissociation of Keap1 and Nrf2, thereby activating downstream anti-ROS pathways and ultimately achieving therapeutic effects against APAP-induced ALF. Therefore, regulating the Keap1 / Nrf2 pathway by increasing intracellular miRNA-125 expression is a potential approach for treating ALF.

[0304] To investigate the mechanism of action of NP on APAP-induced ALF mice, western blotting and IHC staining were used to assess the role of the Keap1 / Nrf2 axis. PCR analysis (Fig. 24a) showed that NP upregulated downstream anti-inflammatory and antioxidant genes in the Keap1 / Nrf2 pathway, such as Ugt1a6, Gclc, Nqo1, and Gsta2, indicating activation of this pathway. Western blotting (Fig. 24b, c) showed elevated Keap1 and decreased Nrf2 and HO-1 in ALF mice. NP treatment reversed these effects by inhibiting Keap1 and restoring Nrf2 and HO-1 levels, helping to eliminate ROS. Immunohistochemical staining in Fig. 25 further confirmed that Keap1 expression was increased in the ALF group and decreased in the NP treatment group. Nrf2 and HO-1 levels were highest in the NP group, consistent with the western blotting results. This indicates that the therapeutic effect of NP on ALF is due to activation of the Keap1 / Nrf2 signaling pathway.

[0305] Oxidative stress and the resulting widespread hepatocyte apoptosis are the main pathological mechanisms of ALF progression, and the two are mutually reinforcing, jointly mediating hepatocyte necrosis. Therefore, TUNEL staining was used to assess the anti-apoptotic ability of NP (Figure 26). Numerous DNA strand breaks (corresponding to apoptotic cells) were observed in hepatocytes of the ALF group, emitting green fluorescence under the catalysis of terminal deoxynucleotidyl transferase. tFNA reduced the production of green fluorescence to some extent, but its effect was far less than that of NP. Combined with the quantitative analysis of the TUNEL fluorescence results in Figure 27, it was confirmed that NP treatment could significantly reduce apoptosis of damaged hepatocytes, with a significant decrease in green fluorescence intensity and the proportion of apoptotic cells.

[0306] The potent anti-apoptotic activity of NP may be related to its excellent ROS scavenging properties and the beneficial anti-apoptotic effect of miRNA-125. Western blotting was used to detect its role in the mitochondrial apoptosis pathway and explore the expression levels of apoptosis-related proteins in each group (Figure 28). NP treatment effectively reversed the upregulation of Bax and Caspase-3 in APAP-intoxicated hepatocytes and inhibited the downregulation of Bcl-2, thus mitigating apoptosis. Immunofluorescence staining of these proteins also confirmed these results (Figure 29). Bax and Caspase-3 showed the brightest green fluorescence in the ALF group, which significantly decreased after tFNA and NP treatment; however, the attenuation in the tFNA group was significantly lower than that in the NP group. Bcl-2 expression showed the opposite trend. In summary, the inhibitory effect of NP on ALF stems from the synergistic inhibition of intracellular oxidative stress and apoptosis. NP exerts its highly efficient ROS scavenging activity by activating the Keap1 / Nrf2 signaling pathway and blocking hepatocyte apoptosis by regulating the mitochondrial apoptosis pathway.

[0307] Experiment 4: The therapeutic effect of NP on acute kidney injury (AKI) in mice.

[0308] I. Experimental Methods

[0309] 1. AKI Mouse Model: An AKI mouse model was established through ischemia-reperfusion (I / R) induced in mice. The experimental protocol is shown in Figure 30A. After anesthetizing the mice, small incisions were made on the skin of both sides of the Balb / C mice, and the kidneys were then dissected and exposed. The renal pedicles were clamped bilaterally using non-traumatic vascular clamps for 30 minutes. The clamps were removed, and reperfusion was initiated. After closing the incisions, physiological saline, tFNA, or NP (100 μL) was administered intraperitoneally every 12 hours. Mice were sacrificed on the third postoperative day, and serum and kidneys were collected.

[0310] 2. Experimental Grouping

[0311] Ctrl Group: No I / R surgery performed;

[0312] AKI Group: Performs I / R surgery, without follow-up treatment;

[0313] tFNA Group: Performing I / R surgery combined with tFNA treatment;

[0314] NP Group: Performing I / R surgery combined with NP treatment;

[0315] In the experimental results graph, "1" represents the Ctrl Group, "2" represents the AKI Group, "3" represents the tFNA Group, and "4" represents the NP Group.

[0316] 3. HE staining: Histopathological analysis of kidney sections.

[0317] 4. PAS staining: Histopathological analysis of kidney sections.

[0318] 5. Immunohistochemistry: Expression of CD68, KIM-1, and p53 in the liver.

[0319] 6. Western blotting: Analysis of the expression of KIM-1, p53, Bax, Bcl-2, Caspase-3, Cyclin B1 and PCNA proteins.

[0320] 7. Flow cytometry: to assess the effect of NP on apoptosis.

[0321] 8. TUNEL staining: to assess the anti-apoptotic ability of NPs.

[0322] II. Experimental Results

[0323] Serum urea and creatinine (CREA) levels were measured in each group to determine renal function (Figures 30C and 30E). Bilateral I / R injury resulted in significantly elevated urea and CREA levels, indicating severe renal function. After treatment with tFNA and NP, these serum biochemical indicators were significantly reduced, with the NP group showing the lowest urea and CREA levels, indicating that NP was more beneficial than tFNA for the recovery of renal excretory function. HE and PAS staining more clearly showed the histopathological damage of the kidneys (Figures 30B and 30D). Compared with the control group, the AKI group showed severe renal tubular damage, disordered arrangement, numerous areas of coagulative necrosis forming hyaline casts, loss of brush borders, and mucinous exudation. After tFNA application, coagulative necrosis decreased, and a large amount of hyaline material and mucinous exudate were visible in the damaged tubules. NP treatment significantly reduced renal tubular damage in I / R-induced AKI, significantly reduced tubular necrosis and hyaline casts, and preserved brush borders. Our histopathological observations were supported by semi-quantitative analysis of the degree of renal tubular injury using HE and PAS staining (Figures 30F and H). Kidneys in each group were scored from 0 to 4 points based on the percentage of tubular injury. Results showed that the AKI group had the highest tubular necrosis score. After treatment with tFNA and NP, the tubular necrosis score decreased, with the most significant decrease observed in the NP group.

[0324] I / R injury often leads to mitochondrial damage and dysfunction in the kidneys, resulting in various pathological states of AKI. To determine the protective effect of NP on mitochondria, transmission electron microscopy was used to observe the morphology of mitochondria in renal tubular epithelial cells. A representative part is shown in Figure 30G. I / R injury leads to extensive mitochondrial damage, characterized by cristae swelling, disarray, or loss, and fragmentation with extravasation of matrix material. In the tFNA-treated group, mitochondrial rupture was mild, but swelling persisted. However, after NP treatment, mitochondria were dense and elongated, with well-formed cristae and normal morphology, suggesting that NP can significantly reverse AKI-induced mitochondrial damage in renal tubular cells. Immunohistochemistry was used to monitor CD68 expression in macrophages (Figures 30I and K). The results showed that NP significantly alleviated AKI-induced tubulointerstitial infiltration of inflammatory cells (including macrophages), as evidenced by a significant decrease in CD68 expression. To evaluate the therapeutic effect of NP on ischemic AKI, the expression of kidney injury molecule-1 (KIM-1), a key biomarker in the early stage of kidney injury, was detected by immunohistochemistry (Fig. 30J and M) and western blotting (Fig. 30L and N). Immunohistochemical results showed that I / R injury significantly upregulated KIM-1 expression in the renal tubules, which almost returned to the control mouse level after NP treatment. Western blotting further supported this result; NP significantly reversed the increase in KIM-1 expression caused by ischemic injury. Overall, the I / R-induced AKI mouse model was successfully established, and NP showed improvements in pathology, serology, microstructure, and protein expression, demonstrating its effectiveness in treating kidney injury.

[0325] p53 is a phosphorylated nuclear protein encoded by the tumor suppressor gene p53, which is closely involved in important biological functions such as cell cycle regulation, DNA repair, and apoptosis. As shown in Figure 31, I / R injury can lead to cellular stress in renal tubular epithelial cells (RTECs), including ROS accumulation, hypoxia, and DNA damage, thereby activating p53 expression. Dysregulation of p53 has been shown to be a key factor in apoptosis and G2 / M phase arrest through different signaling pathways, which is a potential mechanism for cell or tissue necrosis during AKI. On the one hand, p53 upregulation can cause mitochondrial damage, activate its subordinate apoptotic pathway, and thus induce apoptosis in RTEC cells. On the other hand, nuclear p53 transcriptional inhibition of cyclin-dependent kinase 1 (CDK1) binding to cyclin B1 and expression of proliferating cell nuclear antigen (PCNA) leads to G2 / M phase arrest in RTECs, subsequently inhibiting cell proliferation. Studies have found that miRNA-125 can interact with p53, downregulating its expression, thereby coordinating the transcription of downstream apoptosis proteins and cell cycle-related proteins, inhibiting apoptosis and G2 / M phase arrest.

[0326] Therefore, to investigate the mechanism by which NP improves I / R-induced AKI in mice, Western blotting (Figure 32) and immunohistochemical staining (Figure 33) first demonstrated that NP can normalize the upregulated p53 level induced by AKI, while tFNA alone has a negligible effect on p53 expression. Flow cytometry confirmed the effect of NP on apoptosis. The percentage of apoptotic cells (Figure 34) confirmed that NP has a good inhibitory effect on I / R-induced apoptosis in RTEC cells. Kidney TUNEL staining further confirmed the above findings (Figure 35). The number of apoptotic cells in the AKI model increased significantly, and the green fluorescence intensity was significantly enhanced. Fluorescence decreased after tFNA and NP intervention, and the fluorescence intensity of the NP group was weaker, suggesting that NP is more effective than tFNA in reversing I / R-induced apoptosis. Therefore, Western blotting was used to further investigate the expression levels of proteins related to the mitochondrial apoptosis pathway. As shown in Figure 36, the levels of pro-apoptotic proteins Bax and Caspase-3 were highest in the AKI group and lowest in the NP group. Conversely, the expression level of the anti-apoptotic protein Bcl-2 was lowest in the AKI group. Similar conclusions were reached after Bax immunohistochemical staining (Figure 37). These results indicate that NP significantly enhances the inhibitory effect of miRNA-125 on I / r-induced apoptosis by activating p53 to regulate downstream proteins related to the mitochondrial apoptosis pathway, namely Bax, Bcl-2, and Caspase-3.

[0327] p53 is a cross-target between apoptosis and cell cycle arrest. Western blotting was used to detect the expression levels of Cyclin B1 and PCNA in kidney tissues of each group (Figure 38). Compared with the control group, I / R surgery significantly inhibited the protein levels of Cyclin B1 and PCNA, consistent with the biological characteristics of I / R injury. TFNA restored the levels of these proteins to some extent; however, its enhancement was much lower than that of NP treatment. Immunohistochemical staining of PCNA, as shown in Figure 39, also revealed similar results; in the AKI group, the brown staining, symbolizing PCNA expression, was significantly lighter, but recovered to a depth similar to the control group after NP intervention. Therefore, the identification of cell cycle-related protein expression levels indicates that NP effectively eliminated the reduction in Cyclin B1 and PCNA expression caused by AKI, thereby inhibiting G2 / M phase arrest, promoting cell repair and proliferation, and ultimately accelerating damage repair.

[0328] In summary, the NP prepared in this invention can improve the delivery efficiency of miRNA, has high stability and good biocompatibility, effectively inhibits liver necrosis, reduces inflammation, maintains ROS homeostasis, and blocks hepatocyte apoptosis, thus effectively treating APAP-induced liver injury. At the same time, NP can significantly reverse I / r-induced apoptosis, effectively treating kidney injury, thus opening up new avenues for innovative treatment of liver and kidney-related diseases.

[0329] Example 2: Functionalized tetrahedral framework nucleic acid for inhibiting uveal melanoma and its preparation method

[0330] This embodiment provides a tetrahedral framework nucleic acid BiRDS that inhibits uveal melanoma, which is prepared according to the following method:

[0331] BiRDS consists of three single-stranded DNA strands (S1-S3) and miR-30a-5p. S1-S3 and miR-30a-5p were added to TM buffer (10 mM Tris-HCl, pH 7.5, 50 mM magnesium chloride) in a molar ratio of 1:1:1:3, denatured at 95°C for 10 min, and then rapidly cooled to 4°C for 20 min using a thermal cycler. Synthesized in a one-pot process based on the principles of complementary base pairing and self-assembly.

[0332] All oligonucleotide sequences and miRNAs were synthesized by Sangon Biotech Co., Ltd. (Shanghai).

[0333] The nucleotide series of S1-S3 and miR-30a-5p are shown in Table 2, SEQ ID NO.11-14.

[0334] Table 2

[0335] In the nucleotide sequences in the table, the uppercase letters represent deoxyribonucleotides, and the lowercase letters represent ribonucleotides.

[0336] Comparative Example 2

[0337] This comparative example provides the control sample used in the experiment:

[0338] 1. TDN

[0339] The sample was prepared by adding three single-stranded DNA strands (S1-S3) in a 1:1:1 molar ratio to TM buffer (10mM Tris-HCl, pH 7.5, 50mM magnesium chloride), denaturing at 95°C for 10 min, and then rapidly cooling to 4°C for 20 min on a thermal cycler.

[0340] The technical solution of the present invention will be further explained through experiments below.

[0341] To facilitate experimental observation, the 5' end of miR-30a-5p was modified with a fluorescent sulfonyl-cyanine 5 (Cy5) residue. In the comparative TDN sample, S1 was also modified with Cy5.

[0342] Example 5: Characterization of Functionalized Tetrahedral Framework Nucleic Acids (BiRDS)

[0343] This experimental example characterizes the BiRDS prepared in Example 2.

[0344] I. Experimental Methods

[0345] 1. Synthesis of BiRDS and Characterization of its Structure, Size, and Other Properties

[0346] The successful synthesis and structure of BiRDS were verified and observed using 2% agarose gel electrophoresis (105V, 25min), high-performance capillary electrophoresis, Zetasizer Nano ZS90 system (Malvern Panalytical, UK), atomic force microscopy (AFM, Shimadzu, Kyoto, Japan) and transmission electron microscopy (TEM, Hitachi, Tokyo, Japan).

[0347] 2. Stability testing of BiRDS in biological environments

[0348] BiRDS was stored in TM buffer at room temperature (25°C) for 1–7 days; or incubated at 37°C with 10% FBS (Corning Inc., NY, USA) for 0.5–48 h. The activity and degradation of BiRDS were assessed by agarose gel electrophoresis (105 V, 25 min), and the gels were exposed to light using a gel imaging system (Bio-Rad, USA).

[0349] II. Experimental Results

[0350] 1. Synthesis of BiRDS and its structure, size, and other properties

[0351] The agarose gel electrophoresis results are shown in Figure 40: BiRDS was synthesized stepwise from three single-stranded DNA molecules (S1-S3) and miR-30a-5p. BiRDS contained three miR-30a-5p molecules, with the strongest Cy5 fluorescence intensity. Compared to unprotected naked miR-30a-5p, the miR-30a-5p delivered by BiRDS exhibited greater stability and less degradation. Capillary electrophoresis results, shown in Figure 41, further confirmed the stable and efficient synthesis of BiRDS. TEM and AFM images (Figure 42) revealed a triangular nanocomposite structure in BiRDS, suggesting that it can facilitate its entry into tissues and cells through an angular attack mechanism. The results of dynamic light scattering (DLS) are shown in Figure 43. The particle size of BiRDS is (10.94±1.31) nm and the zeta potential is (-7.52±2.78) mV. Compared with the classic TDN, it has a smaller size and a lower zeta potential.

[0352] 2. Stability of BiRDS

[0353] The stability test results are shown in Figures 44 and 45: BiRDS can be stored at room temperature (25℃) for 7 days with an activity of 88.06% ± 3.61%. Furthermore, under 10% fetal bovine serum (FBS) and 37℃ conditions, the activity of BiRDS can be maintained at 93.38% ± 2.52% for 24 hours, and degradation only occurs after 48 hours, with an activity of 61.53% ± 13.01%. These experimental results provide a basis for the potential in vivo application of BiRDS.

[0354] The above results demonstrate that BiRDS, exhibiting a triangular nanocomposite structure, was successfully prepared using the method described in Example 2. This structure possesses properties such as small size, ease of synthesis, and high stability, making it suitable for efficient and stable miRNA delivery systems and showing great potential for clinical application.

[0355] Experiment Example 6: Effects of Functionalized Tetrahedral Framework Nucleic Acids (BiRDS) on Cells

[0356] The BiRDS and TDN samples used in this experiment were prepared according to the method of Example 2 or Comparative Example 2. The sequence of miR-30a-5p is shown in Table 2.

[0357] I. Experimental Methods

[0358] 1. Cell Culture

[0359] MUM2B cells (Hunan Fenghui Biotechnology Co., Ltd., China), human invasive choroidal melanoma cells, were cultured at 37°C, 5% CO2, 90% RMPI 1640 medium with 10% FBS and 100 U / mL penicillin / streptomycin (Hyclone, USA).

[0360] 2. Experimental Grouping

[0361] The experiment was divided into five groups: negative control (NC), miR-30a-5p (miR), miR combined with liposomes (miR+Lipo), TDN, and BiRDS. In the NC group, the nucleic acid drug was single-stranded RNA synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), without transfection reagents. In the miR group, the nucleic acid drug was naked miR-30a-5p, without transfection reagents. In the miR+Lipo group, miR-30a-5p was transfected into MUM2B cells according to the manufacturer's instructions (Thermo Fisher Scientific, USA) using Lipofectamine 3000 transfection reagent. The nucleic acid drug in the TDN group was TDN; and the nucleic acid drug in the BiRDS group was BiRDS. The concentration of each nucleic acid drug was 100 nM. When treating cells with the above nucleic acid drugs, the concentration of FBS in the culture medium was 1% to reduce the formation of nanoparticle protein coronas.

[0362] The nucleotide sequence of the single-stranded RNA in group NC is SEQ ID NO.15: uuguacuacacaaaaguacug.

[0363] 3. Cellular uptake

[0364] MUM2B cells were seeded in confocal culture dishes (Corning Inc., NY, USA) and cultured for 24 h. Cells were treated with different nucleic acid drugs according to their groupings, and cultured in the dark for 24 h. Afterward, cells were fixed with 4% paraformaldehyde (Servicebio, China) for 60 min, stained with phalloidin (Servicebio, China) for 30 min, and stained with 4',6-diamidinyl-2-phenylindole (DAPI) (Servicebio, China) for 10 min. Cells were washed three times with PBS between each step, and finally blocked with 10% glycerol (Servicebio, China). The intracellular nanomaterial infiltration was observed using a laser confocal microscope (FV3000, Olympus, Japan). Flow cytometry (Beckman Coulter, USA) was used to detect the uptake of different nucleic acid nanomaterials by MUM2B cells.

[0365] 4. Cell proliferation assay

[0366] The effects of different nucleic acid drugs on the proliferation of UM cells were investigated using CCK8 and colony formation assays.

[0367] In the CCK8 assay, MUM2B cells were first seeded uniformly into 96-well plates (Corning Hydraulics, USA) and cultured for 24 h. Then, different nucleic acid drugs were added for treatment. CCK8 reagent (HYK0301, MCE, USA) was then added at 24 h, 48 h, and 72 h, and the OD value at 450 nm was measured using a microplate reader (Varioska LUX system, Thermo Scientific, USA). Each group was repeated five times, and cell viability was calculated. In addition, cells were treated with 0, 50 nM, 100 nM, 150 nM, 200 nM, and 250 nM BiRDS for CCK8 assays.

[0368] In the colony formation assay, MUM2B cells were first seeded into 6-well plates (3 wells per group) and cultured for 24 hours. Then, different nucleic acid drugs were added according to the grouping. The culture medium was changed every 2–3 days, and the cells were cultured for 7–14 days until visible clones appeared. Cells were fixed with 4% paraformaldehyde for 60 minutes and stained with crystal violet (Servicebio, China) for 15 minutes. Each step involved washing the cells three times with PBS. Finally, photographs were taken and the number of clones was counted.

[0369] 5. Cell migration and invasion experiments

[0370] The effects of different nucleic acid drugs on the migration and invasion of UM cells were investigated using scratch assays and transwell assays.

[0371] In the scratch assay, MUM2B cells were first evenly seeded into 6-well plates. After the cells were fully confluent, a vertical line was drawn in the center of each well with a yellow tip. Different nucleic acid drugs were added according to the group assignments. Cell migration was observed and recorded under an inverted optical microscope at 0h and 24h, the migration distance was measured, and the wound closure rate was calculated.

[0372] In the transwell assay, Matrigel (Corning, 354234, USA) was first evenly spread on the bottom of a 24-well chamber (LABSELECT, 14341, China) to form a thin film, and then hydrated with serum-free medium. Cells were evenly seeded in the upper chamber with serum-free medium, and different nucleic acid drugs were added according to the grouping. Complete medium containing 10% fetal bovine serum was added to the lower chamber, allowing MUM2B cells to penetrate the membrane from the upper chamber into the lower chamber. After culturing for 24 hours, cells located at the bottom of the transwell insert were fixed with 4% paraformaldehyde for 15 minutes and stained with crystal violet for 10 minutes. Each step was followed by rinsing with PBS three times. Finally, the number of invading cells was observed and recorded under a microscope.

[0373] 6. Apoptosis experiment

[0374] MUM2B cells were evenly seeded in 6-well plates and cultured for 24 h. Different nucleic acid drugs were then added according to the assigned groups. Analysis was performed using the Annexin V-FITC apoptosis detection kit (Beyotime, C1062L, China) and flow cytometry (Beckman Coulter, USA). Fluorescence compensation was adjusted using FlowJO v10 software (USA).

[0375] 7. Detect the expression levels of E2F7, caspase-3, and cleaved caspase-3.

[0376] In gene therapy for tumors, miRNAs can bind to the mRNA of target genes, thereby inhibiting the translation of target genes into functional proteins. Previous studies have shown that E2F7 is one of the direct downstream target genes of miR-30a-5p. Existing research indicates that E2F7 can inhibit apoptosis in prostate cancer cells, while E2F7 deficiency can induce apoptosis in skin cancer cells. Caspase-3, as an apoptosis marker, is cleaved and activated upon stimulation by apoptotic signals, thereby initiating the apoptotic caspase cascade.

[0377] To further verify the effects of different nucleic acid drugs on UM cell apoptosis, the expression levels of E2F7, caspase-3, and cleaved caspase-3 (C-Caspase-3) were detected by immunofluorescence and Western blot methods, respectively.

[0378] Immunofluorescence method: MUM2B cells were first seeded in confocal culture dishes, and nucleic acid drugs were added the next day. After 24 hours of treatment, the cells were fixed with 4% paraformaldehyde for 30 minutes, the cell membrane was disrupted with 0.5% Triton X-100 (Servicebio, China), and blocked with 5% goat serum (Servicebio, China). The cells were then incubated overnight at 4°C with primary antibodies. The E2F7 antibody (24489-1-AP, Proteintech, USA) was diluted 1:200, and the cleaved caspase-3 antibody (AF-7022, Affinity, Jiangsu, China) was diluted 1:100. The next day, the cells were incubated on a shaker with the corresponding fluorescent secondary antibody (ZSGB-BIO, China) for 60 minutes. The secondary antibody was fluorescently labeled with Alexa Fluor 647 (red fluorescence). The cytoskeleton and nuclei were then stained with FITC and DAPI, respectively. Finally, the confocal dishes were sealed with 10% glycerol. Cells were washed three times with PBS at each step. The fluorescence intensity of the target protein was observed using a confocal microscope (FV3000, Olympus, Japan).

[0379] Western blot method: Total protein from adherent MUM2B cells was obtained using a total protein extraction kit (KeyGEN, Jiangsu, China). Based on protein molecular weight, 10% separating gels and 5% stacking gels were prepared (Servicebio, China). The voltage for the separating gel was 130V, and the voltage for the stacking gel was 80V. The protein was transferred to a PVDF membrane (MILLIPORE, Germany) and incubated at 250mA on ice for 1 hour. Blocking was performed with 5% skim milk powder for 1 hour. Primary antibody was incubated overnight. The antibodies used were as follows: E2F7 antibody (24489-1-AP, Proteintech, USA) diluted 1:1000; caspase-3 antibody (ab184787, Abcam, USA) diluted 1:2000; cleaved caspase-3 antibody (AF-7022, Affinity, Jiangsu, China) diluted 1:2000; and Actin antibody (380624, ZENBIO, USA) diluted 1:10000. The bands were washed three times with Tris-buffered saline (TBS) and Tween-20 (TBST) (Servicebio, China), incubated with the corresponding secondary antibody (ZSGB-BIO, China) for 1 hour, washed three times with TBST, and then developed in an imaging system (Syngene, Bangalore, India). Finally, the gray values ​​of the bands were analyzed using ImageJ software.

[0380] II. Experimental Results

[0381] 1. Cellular uptake of BiRDS

[0382] The confocal microscopy results are shown in Figure 46: MUM2B cells showed the highest uptake of BiRDS and TDN, with no statistically significant difference between the two groups. Naked miR-30a-5p had limited cell penetration, while Lipofectamine showed a certain promoting effect on miR-30a-5p cell entry. Consistent phenomena were observed in the flow cytometry results (Figure 47). These results indicate that BiRDS, like classic TDN, has high cell penetrability and can efficiently enter cells to exert its effects.

[0383] 2. BiRDS inhibits the proliferation, migration, and invasion of UM cells.

[0384] The CCK8 detection results are shown in Figure 48. BiRDS has the ability to inhibit cell proliferation, and between 0 nM and 100 nM, the inhibitory effect increases with increasing concentration, but with further increases in concentration, the inhibitory effect no longer has statistical significance. Therefore, 100 nM is the optimal inhibitory concentration of BiRDS and was used for subsequent in vitro experiments. MUM2B cells were treated with 100 nM of different nucleic acid drugs for 24 h, 48 h, and 72 h consecutively. It was observed that the inhibitory effect of BiRDS on MUM2B cell proliferation increased with time, and was significantly stronger than that of the miR group and the miR+Lipo group. A consistent trend was observed in the colony formation experiments (Figures 49 and 51). Compared with the miR group and the miR+Lipo group, the BiRDS group had the lowest number of cell colonies, and the difference was statistically significant. This further confirms that BiRDS can effectively inhibit the proliferation of UM cells.

[0385] The results of the scratch test are shown in Figures 50 and 51: BiRDS inhibited the healing of scratch wounds and showed an inhibitory effect on migration, and the inhibitory effect was stronger than that of the miR group and the miR+Lipo group.

[0386] The transwell assay results are shown in Figures 52 and 53: Compared with the NC and TDN groups, the number of cells penetrating the lower chamber in the miR, miR+Lipo, and BiRDS groups was significantly reduced, with the BiRDS group showing the lowest number of cells entering the lower chamber. BiRDS demonstrated a significant ability to inhibit cell invasion.

[0387] The above experimental results indicate that BiRDS significantly inhibits the proliferation, migration, and invasion of MUM2B cells, and its effect is known to be stronger than that of the miR group and the miR+Lipo group. BiRDS at 100 nM exhibits the best inhibitory effect on proliferation. These results suggest that BiRDS carrying miR-30a-5p can effectively inhibit the malignant phenotype of UM cells in vitro, thereby potentially inhibiting distant metastasis of UM and preventing the formation of lethal UM.

[0388] 3. BiRDS promotes UM cell apoptosis through the miR-30a-5p / E2F7 axis

[0389] The apoptosis assay results are shown in Figures 54 and 55: Compared with other experimental groups, BiRDS significantly promoted apoptosis in MUM2B cells. There was no statistically significant difference between the miR group and the NC group. This may be due to the structural instability, rapid degradation, and poor cellular uptake of naked miR-30a-5p. With the aid of Lipofectamine transfection reagent, the apoptosis rate in the miR+Lipo group (6.26% ± 0.80%) was higher than that in the miR group (3.40% ± 0.87%), but still significantly lower than that in the BiRDS group (20.78% ± 0.97%). These results confirm the potential of BiRDS as a promising miRNA drug delivery system.

[0390] The immunofluorescence results of E2F7 are shown in Figures 56 and 58: Compared with the NC group, the expression level of E2F7 was downregulated in the miR group, and was significantly lowest in the BiRDS group. The immunofluorescence results of C-Caspase-3 are shown in Figures 57 and 58: C-Caspase-3 expression was significantly enhanced in the BiRDS group, and apoptosis had not yet occurred in the miR and NC groups, while the BiRDS group had triggered the strongest apoptotic caspase cascade.

[0391] The results of the western blot experiment are shown in Figures 59 and 60: Compared with naked miR-30a-5p and miR-30a-5p transfected with lipofectamine, miR-30a-5p delivered by BiRDS can significantly downregulate the expression of E2F7 and caspase-3 in UM cells, while upregulating the expression of cleaved caspase-3, thereby leading to stronger apoptosis.

[0392] The results showed that BiRDS significantly promoted apoptosis of MUM2B cells, and that this promotion was achieved through the miR-30a-5p / E2F7 axis. This also indicates that miR-30a-5p plays a role as a tumor suppressor in UM cells.

[0393] The experimental results above demonstrate that BiRDS is a highly efficient and stable miRNA delivery system that can be efficiently taken up by MUM2B cells, inhibiting the proliferation, migration, and invasion of MUM2B cells, and promoting apoptosis of MUM2B cells, thus demonstrating its potential for treating UM.

[0394] Example 7: Functionalized tetrahedral framework nucleic acid BiRDS corresponds to in vivo inhibition of UM

[0395] The BiRDS and TDN samples used in this experiment were prepared according to the method of Example 2 or Comparative Example 2. The sequence of miR-30a-5p is shown in Table 2.

[0396] I. Experimental Methods

[0397] 1. Establishment of a nude mouse xenograft animal model (UM)

[0398] Animal research was approved by the Medical Ethics Committee of West China School of Stomatology, Sichuan University, approval number WCHSIRB-D-2024-507. Three-week-old female Balb / c nude mice were purchased from Jiangsu Jianyao Technology Co., Ltd., China. Tumor models were established starting at 4-5 weeks of age. Mice were anesthetized with bromoethanol (Nanjing Aibei, China), and 5×10⁻⁶ mice were harvested. 5 5 μL of MUM2B cells in good logarithmic growth phase were inoculated into the choroid of mice using a Hamilton microsyringe under a stereomicroscope (Morcato, Germany), followed by treatment with erythromycin eye ointment. The model was successfully established one day later.

[0399] 2. Animal grouping

[0400] The model mice were randomly divided into five groups of six mice each: PBS group, TDN group, miR-30a-5p (miR) group, BiRDS group, and programmed death-ligand 1 (pd-l1) antibody group. The first four groups received 1 μL and 5 μL eye drops twice daily; the pd-l1 antibody group received a tail vein injection of 5 mg / kg anti-pd-l1 (HY-P99145, MCE, USA) every three days as a positive control. After two weeks, the mice were sacrificed, and tumor tissue samples were collected. Gross morphology of the tumors was photographed, and tumor weight and diameter were measured.

[0401] The concentration of nucleic acid in the above eye drops is 1 μM, and the solvent is TM buffer.

[0402] 3. Biosafety testing

[0403] Normal mice (Balb / c nude mice) were randomly divided into three groups of six each: PBS group, miR group, and BiRDS group. Each group received 5 μL of eye drops twice daily. After two weeks, the mice were sacrificed, and ocular tissue samples were collected. Hematoxylin and eosin (HE) staining was performed using an HE staining kit (C0105S, Beyotime, China).

[0404] 4. Measurement of penetration into ocular tissues

[0405] Tumors removed from the eyes of nude mice were sectioned sagittally and fixed with 4% paraformaldehyde (Servicebio, China). The sections were stained with DAPI (Servicebio, China) for 10 min, washed three times with PBS, and finally blocked with 10% glycerol (Servicebio, China). Cy5 signal was observed using a laser confocal microscope (FV3000, Olympus, Japan) to compare the penetration of different nucleic acid nanomaterials into ocular tissues.

[0406] 5. Histological analysis

[0407] (1) Complete dissection of the mouse eyeball and tumor. The tumor removed from the nude mouse eye was cut into tissue sections in the sagittal plane and subjected to immunofluorescence staining, HE staining, TUNEL assay, and immunohistochemistry. E2F7 is a transcription factor that is highly expressed in cancer tissue and promotes cancer cell proliferation. Ki-67 immunohistochemical staining was used to verify miR-30a-5p targeting and silencing of E2F7.

[0408] Immunofluorescence staining: Performed according to the immunofluorescence method described in Experiment 6, Method 7. The difference was that the secondary antibody was fluorescently labeled with Alexa Fluor 488 (green); and the cytoskeleton was not FITC stained.

[0409] HE staining experiments were performed using an HE staining kit (C0105S, Beyotime, China).

[0410] Immunohistochemical experiment: Paraffin sections were first subjected to antigen retrieval, incubated with Ki-67 antibody (ab16667, abcam, USA, 1:100) for 1 h at room temperature, then incubated with the corresponding secondary antibody for 1 h, stained with DAB chromogenic solution, and finally Ki-67 expression was observed under an optical microscope (Olympus, Japan).

[0411] TUNEL assays were performed using a one-step TUNEL apoptosis assay kit (HY-K1078, MCE, USA).

[0412] (2) Cut mouse ocular tumor tissue into pieces and prepare homogenized solutions for Western blot and ELISA detection.

[0413] The Western blot experiment was performed according to the steps of the Western blot method described in Experiment Example 6, Experiment Method 7.

[0414] IFN-γ concentrations were detected using a BCA protein assay kit (P0012S, Beyotime, China) and an ELISA kit (BY-EM220140, BYabscience, China).

[0415] 4. Statistical Analysis

[0416] Survival analysis data for miR-30a-5p in UM cancer patients were obtained from starBase online (starBase). ImageJ software was used to process and analyze relevant images and bands to obtain quantitative data and 3D thermal images. All experimental quantitative data are expressed as mean ± standard deviation (SD). GraphPad Prism 9 (GraphPad Software, USA) software was used for analysis, and appropriate statistical tests were selected according to different groups. A p-value < 0.05 was considered statistically significant.

[0417] II. Experimental Results

[0418] 1. The penetration of BiRDS into ocular tissues

[0419] The results of the immunofluorescence staining experiment are shown in Figures 61 and 62: In the fundus fluorescent sections, the Cy5 fluorescence signal in the BiRDS group was significantly increased, approximately 16 times and 3 times that of the miR group and TDN group, respectively. Similarly, in vivo fluorescence imaging of healthy nude mice administered the various drugs revealed that, compared with the miR group and TDN group, the drug concentration in the BiRDS group was the highest at all time points and lasted the longest (Figures 74 and 75). In particular, 24 hours after drug administration, the drug concentration in the BiRDS group was approximately 11 times and 3 times that of the miR group and TDN group, respectively (Figure 76). In addition, quantitative PCR analysis showed (Figure 77) that the expression level of miR-30a-5p in the fundus tissue of the BiRDS group was approximately 15 times that of the miR group (forward primer: CCTGTAAACATCCTCGACTGGAAGCTTA (SEQ ID NO:16); reverse primer was a universal primer, and the reference gene was U6). These findings demonstrate that BiRDS can effectively penetrate the complex structures of the eye and reach retinal tumor lesions, maintaining a sustained high concentration of drug. Therefore, BiRDS meets the prerequisites for treatment of eye diseases in the form of eye drops. This promotes topical ocular medication and home treatment of a range of eye diseases, thereby improving patient compliance and efficacy.

[0420] 2. Biosafety of BiRDS

[0421] The results of the HE staining experiment are shown in Figure 63: no obvious pathological changes were observed under a microscope, and no significant differences were observed between the BiRDS group and the PBS group. These results indicate that BiRDS has good biocompatibility and can be used in vivo.

[0422] 3. The effect of BiRDS on tumor growth

[0423] Tumor morphology, weight, and size are shown in Figure 64: the tumors in the BiRDS group had the smallest morphology. The tumor weight and diameter were (23.28±4.52) mg and (3.08±0.08) mm, respectively, with no statistically significant difference compared to the pd-l1 antibody group. HE staining results of mouse eyes and tumor tissue are shown in Figure 65: In nude mice, the PBS, TDN, and miR groups showed significant protrusion of the eyeball and periorbital swelling. HE histological examination revealed that in the PBS group, UM growth was significant, breaking through the base and invading surrounding nerves, glands, and muscle tissue, leading to complete destruction of the internal eye structure. In contrast, the BiRDS and pd-l1 antibody groups showed the ability to preserve the intact eye structure, with relatively limited tumor foci and an appearance similar to normal healthy eyes. The results indicate that BiRDS nano-eye drops can effectively inhibit the growth of UM in vivo.

[0424] 4. BiRDS nano eye drops inhibit UM in vivo via the miR-30a-5p / E2F7 axis.

[0425] Immunofluorescence results of tumor tissues are shown in Figures 66-68: Compared with the PBS and miR groups, the expression level of E2F7 in the BiRDS group was significantly decreased, while the expression level of cleaved caspase-3 was significantly increased, leading to UM cell apoptosis. Western blot results are shown in Figures 69 and 70: In the BiRDS group, E2F7 and caspase-3 were significantly downregulated, while cleaved caspase-3 was significantly upregulated; the difference was not statistically significant compared with the pd-l1 antibody group. This confirms that BiRDS nanoparticle eye drops can induce UM cell apoptosis through the miR-30a-5p / E2F7 axis.

[0426] Furthermore, the TDT-mediated dUTP nick-end labeling (TUNEL) staining results of tumor sections are shown in Figure 71: tumor cell apoptosis occurred in the miR group, BiRDS group, and pd-l1 antibody group, with the latter two groups showing particularly prominent apoptosis. This is because naked miR-30a-5p nanodrops may penetrate the eyeball through the sclera to reach the tumor site in the fundus. In contrast, BiRDS nanodrops can pass directly through the cornea in addition to via the scleral bypass. The results indicate that BiRDS has a very good effect on inducing apoptosis.

[0427] The Ki-67 immunohistochemical staining results are shown in Figure 72: the percentage of Ki-67 positive cells in the BiRDS group was the lowest (2.80% ± 0.62%), which was statistically significantly lower than that in the PBS group (14.33% ± 1.82%) and the miR group (10.79% ± 1.62%), but not statistically significant compared to the pd-l1 antibody group (5.22% ± 1.06%). Consistent findings were observed in the enzyme-linked immunosorbent assay (ELISA) results for interferon-γ (IFN-γ) (Figure 73): compared to the PBS and miR groups, IFN-γ was significantly increased in the BiRDS group, indicating that IFN-γ has the ability to activate the immune system and exert anti-tumor effects. Therefore, BiRDS nanoparticle eye drops are an effective method for inhibiting UM cell proliferation and promoting cancer cell apoptosis in vivo through the miR-30a-5p / E2F7 axis.

[0428] The above results indicate that BiRDS exhibits excellent biocompatibility and high ocular tissue permeability when applied to UM animals, making it suitable as a nano-eye drop that effectively inhibits UM growth in vivo and induces apoptosis in tumor cells.

[0429] The above experimental examples demonstrate that this invention successfully prepared BiRDS with a triangular nanocomposite structure. BiRDS is characterized by its small size, ease of synthesis, and high stability. BiRDS significantly inhibits the proliferation, migration, and invasion of MUM2B cells, with a stronger inhibitory effect than miR-30a-5p transfected with commercial transfection reagents. The inhibitory effect of BiRDS at 100 nM is optimal. When applied to UM animals, BiRDS exhibits excellent biosafety and high ocular tissue permeability, making it suitable for use as nano-eye drops. BiRDS effectively inhibits the growth of UM in vivo and induces apoptosis in tumor cells. The tumor-inhibiting effect of BiRDS is significantly better than miR-30a-5p and comparable to the therapeutic effects of commercial tumor immunotherapy drugs.

[0430] Therefore, this invention successfully prepared BiRDS from three single-stranded nucleic acids S1-S3 and miR-30a-5p in a molar ratio of 1:1:1:3 in a buffer solution. It is a tFNA-based bioswitchable miRNA delivery system that encapsulates miRNA in tFNA nanomaterials for protection and achieves efficient delivery and controlled release of miRNA via an RNase H-responsive mechanism. BiRDS has a tetrahedral structure, exhibiting high stability and good biocompatibility. It can cross the blood-retinal barrier and be used as eye drops for the treatment of ocular diseases. When used to treat umbilicus (UM), miR-30a-5p allows for non-invasive and simple treatment, suitable for long-term, frequent administration. This solves the problem of adverse reactions caused by invasive treatments in ophthalmic diseases, including pain, bleeding, inflammation, infection, and even choroidal / retinal detachment and visual impairment, thus improving patient compliance and quality of life. In summary, this invention is the first to apply BiRDS carrying miR-30a-5p to UM in the form of nano-eye drops, filling the research gap in non-invasive UM inhibition based on miRNA and showing great application potential.

Claims

1. A functionalized tetrahedral framework nucleic acid, characterized by: It is a tetrahedral framework nucleic acid with embedded miRNA; the tetrahedral framework nucleic acid is assembled from 3 DNA single strands and 3 miRNA strands through complementary base pairing; the miRNA strand includes miRNA and 2-6 ribonucleotides at the ends; 4-8 bp of ribonucleic acid on the miRNA does not participate in the complementary pairing to form the tetrahedral framework nucleic acid; the 2-6 deoxyribonucleotides at the ends of the DNA single strand are complementary to the 2-6 ribonucleotides at the ends of the miRNA strand, and the portion of the DNA single strand that is complementary to the miRNA is a ribonucleotide.

2. The functionalized tetrahedral framework nucleic acid of claim 1, wherein: The miRNA chain has 2-6 ribonucleotides at its terminal; preferably, it has 4 ribonucleotides at its terminal.

3. The functionalized tetrahedral framework nucleic acid of claim 1 or 2, wherein: The ribonucleotide at the end of the miRNA chain is located at the 3' end of the miRNA; preferably, there are no other nucleotides between the miRNA and the ribonucleotide at the end of the miRNA chain.

4. The functionalized tetrahedral framework nucleic acid of any one of claims 1-3, wherein: The ribonucleotide at the end of the miRNA chain is cuua.

5. The functionalized tetrahedral framework nucleic acid of any one of claims 1-4, wherein: In the miRNA chain, the length of the miRNA is 18-25 bp; preferably, the length of the miRNA is 22-24 bp; preferably, the length of the miRNA is 22 bp.

6. The functionalized tetrahedral framework nucleic acid of any one of claims 1-5, wherein: The three miRNA chains have the same nucleotide sequence.

7. The functionalized tetrahedral framework nucleic acid of any one of claims 1-6, wherein: In the miRNA chain, the 4-8 bp ribonucleic acid starting from the 8th-11th ribonucleotide of the miRNA does not participate in the complementary pairing to form a tetrahedral framework nucleic acid, and the remaining ribonucleotides of the miRNA are complementary to the ribonucleotides on the DNA single strand to form a tetrahedral framework nucleic acid. Preferably, in the miRNA chain, the 6bp ribonucleic acid starting from the 9th ribonucleotide of the miRNA does not participate in the complementary pairing to form a tetrahedral framework nucleic acid; preferably, the 1st to 8th ribonucleotides and the 15th to 22nd ribonucleotides of the miRNA complement the ribonucleotides on the DNA single strand to form a tetrahedral framework nucleic acid.

8. The functionalized tetrahedral framework nucleic acid of any one of claims 1-7, wherein: The structure of the DNA single strand is ribonucleic acid 1-deoxyribonucleic acid 2-ribonucleic acid 3-deoxyribonucleic acid 4, wherein ribonucleic acid 1 and ribonucleic acid 3 are complementary to the miRNA, and deoxyribonucleic acid 4 is complementary to the ribonucleotide at the end of the miRNA strand; Preferably, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are 7-10 bp, the length of deoxyribonucleic acid 4 is 2-6 bp, and the total length of the single strand of DNA is 39-111 bp; Preferably, the lengths of ribonucleic acid 1 and ribonucleic acid 3 are 8 bp, the length of deoxyribonucleic acid 4 is 4 bp, and the total length of the DNA single strand is 63 bp.

9. The functionalized tetrahedral framework nucleic acid of claim 8, wherein: The ribonucleic acid 1 is complementary to the ribonucleic acid at the 3' end of the miRNA that does not participate in complementary pairing, and the ribonucleic acid 3 is complementary to the ribonucleic acid at the 5' end of the miRNA that does not participate in complementary pairing.

10. The functionalized tetrahedral framework nucleic acid of claim 8 or 9, wherein: The ribonucleic acid 1, ribonucleic acid 3, deoxyribonucleic acid 4, and miRNA strand of the single-stranded DNA form three edges of a triangular face of a tetrahedral framework, and the deoxyribonucleic acid 2 of the three single-stranded DNA forms the remaining three edges of the tetrahedral framework.

11. The functionalized tetrahedral framework nucleic acid of any one of claims 1-10, wherein: The tetrahedral framework nucleic acid has a BiRDS structure.

12. The functionalized tetrahedral framework nucleic acid of any one of claims 1-11, wherein: The miRNA in the miRNA chain is selected from miRNA125; preferably, the sequence of miRNA125 contains nucleotides 1-22 of SEQ ID NO.4, or has at most 1, 2, 3, or 4 nucleotide variations (mutations, deletions, and / or additions) compared to nucleotides 1-22 of SEQ ID NO.

4.

13. The functionalized tetrahedral framework nucleic acid of claim 12, wherein: The nucleotide sequence of the miRNA chain includes SEQ ID NO.

4.

14. The functionalized tetrahedral framework nucleic acid of any one of claims 1-13, wherein: The nucleotide sequences of the three DNA single strands are shown in SEQ ID NO.1-SEQ ID NO.

3.

15. A method of preparing a functionalized tetrahedral framework nucleic acid according to any one of claims 1 to 14, characterized in that, The process includes the following steps: mixing the three single-stranded DNA strands and the three miRNA strands; Preferably, the mixture is incubated using a thermal cycler. Preferably, the molar ratio of the three single-stranded DNA strands is 1:1:1; Preferably, the molar ratio of the three single-stranded DNA strands to the miRNA strand is 1:1:1:1-3; more preferably, the molar ratio is 1:1:1:

3.

16. Use of the functionalized tetrahedral framework nucleic acid according to any one of claims 1-14 in the preparation of a medicament for treating diseases.

17. Use according to claim 16, characterized in that: The disease is acute liver injury and / or acute kidney injury.

18. A pharmaceutical composition, characterized by: It comprises the functionalized tetrahedral framework nucleic acid as described in any one of claims 1-14, and pharmaceutically acceptable excipients.

19. The pharmaceutical composition according to claim 18, characterized by: The pharmaceutical composition is a pharmaceutical composition for treating acute liver injury and / or acute kidney injury.

20. The functionalized tetrahedral framework nucleic acid of any one of claims 1-11, wherein: The miRNA in the miRNA chain is selected from miR-30a-5p; preferably, the sequence of miR-30a-5p contains nucleotides 1-22 of SEQ ID NO.14, or has at most one, two, three, or four nucleotide variations (mutations, deletions, and / or additions) compared to nucleotides 1-22 of SEQ ID NO.

14.

21. The functionalized tetrahedral framework nucleic acid of claim 20, wherein: The nucleotide sequence of the miRNA chain includes SEQ ID NO.

14.

22. The functionalized tetrahedral framework nucleic acid according to claim 20 or 21, characterized in that: (a) The nucleotide sequence of the DNA single strand described in the first paragraph is SEQ ID NO.11 or SEQ ID NO.17; (b) The nucleotide sequence of the DNA single strand described in Clause 2 is SEQ ID NO. 12 or SEQ ID NO. 18; and / or (c) The nucleotide sequence of the DNA single strand described in Article 3 is SEQ ID NO.13 or SEQ ID NO.

19.

23. The functionalized tetrahedral framework nucleic acid of any one of claims 20-22, wherein: The nucleotide sequence of the DNA single strand described in the first paragraph is SEQ ID NO.11, the nucleotide sequence of the DNA single strand described in the second paragraph is SEQ ID NO.12, and the nucleotide sequence of the DNA single strand described in the third paragraph is SEQ ID NO.

13.

24. The functionalized tetrahedral framework nucleic acid of any one of claims 20-22, wherein: The nucleotide sequence of the DNA single strand described in the first paragraph is SEQ ID NO.17, the nucleotide sequence of the DNA single strand described in the second paragraph is SEQ ID NO.18, and the nucleotide sequence of the DNA single strand described in the third paragraph is SEQ ID NO.

19.

25. A method of producing the functionalized tetrahedral framework nucleic acid of any one of claims 1-11 and 20-24, wherein, The process includes the following steps: mixing the three single-stranded DNA strands and the three miRNA strands; Preferably, the mixture is incubated using a thermal cycler. Preferably, the molar ratio of the three single-stranded DNA strands is 1:1:1; Preferably, the molar ratio of the three single-stranded DNA strands to the miRNA strand is 1:1:1:1-3; more preferably, the molar ratio is 1:1:1:

3.

26. Use of the functionalized tetrahedral framework nucleic acid according to any one of claims 1-11 and 20-24 in the preparation of a medicament for treating a disease.

27. Use according to claim 26, characterized in that: The disease is an eye disease; optionally, the eye disease is a fundus disease.

28. Use according to claim 26, characterized in that: The diseases mentioned are post-stroke depression, cardiovascular disease, cancer, peripheral nerve injury, or knee osteoarthritis.

29. Use according to claim 28, characterized in that: The cancers mentioned are selected from head and neck squamous cell carcinoma, non-small cell lung cancer, prostate cancer, renal cell carcinoma, breast cancer, hepatocellular carcinoma, and uveal melanoma.

30. Use according to claim 29, characterized in that: The cancer in question is uveal melanoma.

31. A pharmaceutical composition comprising: It comprises the functionalized tetrahedral framework nucleic acid as described in any one of claims 1-11 and 20-24, and pharmaceutically acceptable excipients.

32. The pharmaceutical composition according to claim 31, characterized in that: The pharmaceutical composition is a pharmaceutical composition for treating eye diseases.

33. The pharmaceutical composition according to claim 31, wherein: The pharmaceutical composition is a pharmaceutical composition for treating uveal melanoma.