Use of CYP46a1 inhibitors to treat eye and associated diseases
Inhibiting CYP46A1 activity with agents like voriconazole and soticlestat addresses the inefficacy of current XFS/XFG treatments by reducing 24OHC levels, preserving BAB integrity, and decreasing XFM and LOXL1 aggregation, thus treating XFS and XFG effectively.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SANTEN PHARMACEUTICAL CO LTD
- Filing Date
- 2025-12-19
- Publication Date
- 2026-06-25
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure 00000027_0000 
Figure 00000028_0000
Abstract
Description
USE OF CYP46A1 INHIBITORS TO TREAT EYE AND ASSOCIATED DISEASES
[0001] The present invention mainly relates to pharmacological agents or other techniques and procedures that inhibit the function of CYP46A1, or decrease its mRNA and / or protein expression levels to treat XFS and / or XFG.
[0002] Pseudoexfoliative syndrome (XFS) is a systemic disorder that is mainly manifested by the accumulation of fibrillar protein aggregates, termed extrafoliation material (XFM), in the anterior chamber of the eye. It is estimated that about half of XFS patients develop intraocular pressure (IOP) elevation that leads to irreversible optic nerve damage and eventually blindness, a condition known as pseudoexfoliative glaucoma (XFG). Currently, the only treatment available for XFS and / or XFG patients is IOP lowering through medications and / or surgical procedure. Nevertheless, XFS and / or XFG patients are more resistant to IOP lowering treatments, with higher IOP elevation, larger 24-hour IOP fluctuation, and thus faster progression compared to primary open angle glaucoma (POAG) (see, NPL 1).
[0003] Exact etiology of XFS and / or XFG remains unclear, although a number of risk factors have been identified including genetic and non-genetic (environmental) factors (see, NPL 2). Increased expression of genes encoding XFM components, such as LOXL1, fibrillin, fibronectin and other matrix proteins, has been well documented in XFS and / or XFG eyes, and is hypothesized to be a precursor event in the formation and accumulation of XFM deposits. Specifically, LOXL1 is recognized as the most prominent genetic risk factor for XFS. Certain genetic variants of LOXL1 increase its susceptibility to misfolding and aggregation, resulting in the formation of abnormal fibrillar aggregates within the anterior segment of the eye. Aside from this, blood-aqueous-barrier (BAB) breakdown is a notable clinical feature of XFS and / or XFG that has long been noticed and documented (see, for example, NPL 3 and NPL 4). It is thought that XFS and / or XFG patients with BAB breakdown display increased aqueous flare, and higher level of total protein in the anterior chamber. And, it is supposed that the leakage of serum protein into the aqueous humor (AH) is proposed to aggravate XFM aggregation and deposition leading to blockage of AH outflow channel and IOP elevation (see, NPL 5). Despite these observations / findings, the exact cause of BAB breakdown in XFS and / or XFG has been unknown, and there has been no treatment directed to the preservation of BAB integrity in XFS and / or XFG.
[0004] Recently, a whole exome sequencing study identified that XFS and / or XFG patients are significantly more likely to carry damaging variants of CYP39A1 gene (NPL 6). It is known that CYP39A1 protein is a member of the cytochrome P450 superfamily of enzymes and is involved in the conversion of cholesterol to bile acids. In addition to its high level of expression on liver, CYP39A1 is also known to be expressed in ocular tissues, specifically, iris, ciliary body, retina and retinal pigmented epithelial layer.
[0005] [NPL 1] Hollo, Gabor et al. Clinical ophthalmology (Auckland, N.Z.) vol. 9 907-19. 22 May. 2015 [NPL 2] Tomczyk-Socha, Martyna et al. Journal of clinical medicine vol. 12, 10 3580. 21 May. 2023 [NPL 3] Yavrum, Fuat et al. BMC ophthalmology vol. 21, 1 25. 9 Jan. 2021 [NPL 4] Chakraborty, Munmun, and Aparna Rao. Current issues in molecular biology vol. 44, 3 1191-1202. 1 Mar. 2022 [NPL 5] Ritch, Robert et al. Progress in retinal and eye research vol. 22, 3 (2003): 253-75 [NPL 6] Genetics of Exfoliation Syndrome Partnership et al. JAMA vol. 325, 8 (2021): 753-764.
[0006] The purpose of the present invention is to figure out the relationship between CYP39A1 and XFS and / or XFG, which also includes CYP39A1 function, influence of CYP46A1, cholesterol metabolic pathway, XFM components expression, LOXL1 protein processing and blood-aqueous-barrier integrity, and to find a new therapy to inhibit or reduce the deposition of XFM.
[0007] The present inventors have extensively studied to reach the above purpose, and have figured out the pathway including CYP39A1, the reduced level of which could result in the development of XFS and / or XFG, and have found a new therapy to inhibit or reduce the deposition of XFM. The details are as follows.
[0008] According to a recent genetics study (Exfoliation Syndrome Partnership et al., JAMA vol. 325, 8 (2021): 753-764. doi:10.1001 / jama.2021.0507), 34 damaging CYP39A1 variants were identified, which were significantly more likely to be carried by subjects with exfoliation syndrome, compared with those without exfoliation syndrome. These 34 damaging CYP39A1 variants demonstrated significantly lower enzymatic activity compared to the wild-type CYP39A1. In addition to this, the present inventors further demonstrated that four of these damaging variants (G204E, S238C, R389C, G410R), but not the benign common variant (R103H), led to significantly increased and reduced levels of cholesterol metabolites, 24(S)-hydroxycholesterol (24OHC) and 7α-24(S)-dihydroxycholesterol (24DOHC), respectively. The 34 damaging CYP39A1 mutations are: S106L, R462Q, C31S, L132R, T345S, F370V, I295M, T345I, P457L, F307S, K329Q, R72Q, P376R, P415S, H296Q, L165H, S238C, R337H, G204E, G410R, R389H, G61E, c.1066-2A>C, N277S, L271P, F385V, R389C, A416P, C437Y, Y448X, c.639-1G>TAG, M1K, L174P, and P30fs.
[0009] In ocular tissues, cholesterol metabolism is regulated by several enzymes, including CYP46A1 and CYP39A1. CYP46A1 first catalyzes the reaction to convert cholesterol to 24OHC that is further metabolized by CYP39A1 into 7α-24DOHC. Increased level of 24OHC has been reported to trigger neuronal cell death (Yamanaka, Kazunori et al. The Journal of biological chemistry vol. 286, 28 (2011): 24666-73), and its level has been associated with Alzheimer’s disease etiology (Gamba, Paola et al. Antioxidants (Basel) vol. 10, 5 740. 7 May. 2021). This time, the present inventors have discovered that 24OHC induces spontaneous deformation of cell spheroids, which is observed in several ocular cells including human non-pigmented ciliary epithelial cells (NPCE), human trabecular meshwork cells (HTMC), human fetal retinal pigment epithelium cells (hfRPE), and human retinal pigment epithelium cell line (ARPE-19) (see, Tests 1, 2, 7 and 8 below). Of particular interest, NPCEs and RPEs are main components of the blood-aqueous-barrier (BAB) and blood-retinal-barrier (BRB), respectively, thus the above finding implicates that increased level of 24OHC in ocular tissues could impair the ocular barrier systems. Consistent with the spontaneous deformation of cell spheroids, the present inventors also demonstrated that addition of 24OHC itself, reduced level of CYP39A1 expression by knockdown system (CYP39A1-KD) and enhanced CYP46A1 expression all result in impaired cell barrier function, through membrane permeability staining, FITC-dextran permeability assay and impedance-based barrier integrity assays (see, Tests 3 and 4 below). Taken altogether, these experimental data demonstrate that impaired function of CYP39A1 and subsequent accumulation of 24OHC may disturb ocular cell-cell attachment and cell barrier function, which may translate into a physiological impact on the ocular barrier systems, such as the BAB integrity. In addition to the cellular barrier assays, the present inventors further demonstrated the involvement of CYP39A1 in BAB integrity in an animal model through fluorophotometry measurement (see, Test 5 below). Transient knockdown of CYP39A1 gene in the anterior chamber and injection of 24OHC itself increased the level of BAB permeability in mice eyes. This data strongly substantiated the cellular barrier functions data, and directly confirmed that dysfunction of CYP39A1 and subsequent accumulation of 24OHC in the anterior chamber result in the impairment of BAB integrity.
[0010] In addition to the involvement of CYP39A1 in BAB integrity, a recent report (Schloetzer-Schrehardt, Ursula et al. Investigative Ophthalmology & Visual Science 64.8 (2023): 4348-4348) has indicated the involvement of CYP39A1 deficiency and 24-OHC in inducing transcriptional changes. This time, the present inventors demonstrated the effect of CYP39A1 deficiency by knockdown (CYP39A1-KD) in inducing XFM components gene expression and protein secretion level (see, Test 6 below). Furthermore, the present inventors demonstrated that effect of CYP39A1 deficiency on XFM components gene and protein expression was even more pronounced in the presence of Transforming Growth Factor beta-1 (TGFβ1), which has been reported to be elevated in XFS and / or XFG eyes.
[0011] Given that CYP46A1 is upstream to CYP39A1 in the cholesterol metabolism pathway, the present inventors hypothesized that inhibition of CYP46A1 activity could reduce 24OHC levels and restore cellular barrier function and reduce XFM component expression levels even in the presence of impaired CYP39A1 activity. In order to demonstrate this hypothesis, the present inventors tested the effect of CYP46A1 knockdown (CYP46A1-KD) in barrier integrity assay and found that co-reduction of CYP46A1 could restore CYP39A1 induced- barrier function impairment (see, Test 4 below). Following this the present inventors used an array of pharmaceutical agents that have been reported to inhibit CYP46A1 function and then have found that all tested agents are effective in reducing 24OHC level in ARPE and / or NPCE cells, albeit in different degrees (see, Test 7 below). These data demonstrated that inhibition of CYP46A1 may be an effective therapeutic strategy for diseases or conditions associated with increased level of 24OHC, which are triggered by reduced function and / or expression of CYP39A1.
[0012] The efficacy of CYP46A1 inhibitors in reducing 24OHC level suggest that they may be effective in preserving cell barrier function. Indeed, the present inventors demonstrated in various ocular cell types that CYP46A1 inhibitors are effective in preserving cell barrier function that was impaired due to 24OHC treatment or CYP39A1-KD or CYP46A1 overexpression or the combination of these factors (see, Tests 8, 9 and 10 below). This finding suggests that inhibition of CYP46A1 enzymatic activity is an effective therapeutic strategy for diseases / conditions associated with impaired barrier function caused by increased 24OHC levels, including XFS and / or XFG.
[0013] In addition, the present inventors demonstrated that certain CYP46A1 inhibitor compounds, particularly azole compounds, are effective in reducing the expression level of XFM component genes (see, Test 10 below). These azole compounds are known to inhibit not only CYP46A1, but also other CYP enzymes including CYP51A1 that are involved in cholesterol synthesis and act upstream of CYP46A1. This finding demonstrated the importance of homeostatic regulation in cholesterol metabolism pathway that may be impaired in XFS and / or XFG due to mutation and / or deficiency of CYP39A1 gene.
[0014] Topical administration, such as eye drop instillation, is the most practical and preferred mode of administration for the treatment of ocular conditions. The present inventors checked the corneal permeability of three CYP46A1 inhibitors, namely: voriconazole, fluvoxamine and tranylcypromine (HCl), and have found that all three agents can be efficiently delivered to the aqueous humor by topical administration (see, Test 13 below). Such property further supports the potential of these pharmaceutical agents to be used as therapeutic eye drop for the treatment of ocular conditions including XFS and / or XFG. Finally, the present inventors demonstrated that CYP39A1 dysfunction and the subsequent increase of 24-OHC decreased the chaperoning capacity for LOXL1, leading to extracellular release and accumulation of aggregated LOXL1 in the aqueous humor (see, Test 14 below). Treatment with CYP46A1 inhibitor, soticlestat, repaired the chaperoning capacity for LOXL1 and attenuated the level of released LOXL1 aggregate in the extracellular space. In summary, the inventors identified a disease mechanism for XFS / XFG, emphasizing disruptions in cholesterol metabolism due to CYP39A1 dysfunction and elevated 24-OHC levels. These changes impair BAB integrity, increase the production of exfoliation material components, and induce abnormal release of aggregated LOXL1 into the extracellular space. Together, these factors are linked to the early stages of XFM formation and deposition. In conjunction, the inventors demonstrated that restoring cholesterol homeostasis through inhibition of CYP46A1 could repair the impairment of BAB integrity, reduce the expression level of exfoliation material components, and prevent release of aggregated LOXL1 into the extracellular space. These properties strongly support potential therapeutic use of these pharmaceutical agents for the treatment of ocular conditions including XFS and / or XFG.
[0015] The present invention is as described below.
[0016] (Item A1) A pharmaceutical composition comprising an agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels, in use for treating XFS and / or XFG.
[0017] (Item A2) The pharmaceutical composition of Item A1, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, clobenpropit, cimetidine, ranitidine, posaconazole, bicalutamide, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and all their derivatives.
[0018] (Item A3) The pharmaceutical composition of Item A1 or A2, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, clotrimazole, and all their derivatives.
[0019] (Item A4) The pharmaceutical composition of any one of Items A1 to A3, wherein the subject for which the pharmaceutical composition is used has a deficiency or mutation of CYP39A1 gene, its function, its mRNA and / or its gene product, and / or an increased level of cholesterol metabolites including 24OHC and cholesteryl esters, and / or a disruption in the epithelial and / or endothelial barrier functions, and / or an abnormal production and / or extracellular release of fibrillar materials including LOXL1.
[0020] (Item A5) Use of an agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels, in manufacture of a medicament for treating XFS and / or XFG.
[0021] (Item A6) The use of Item A5, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, clobenpropit, cimetidine, ranitidine, posaconazole, bicalutamide, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and all their derivatives.
[0022] (Item A7) The use of Item A5 or A6, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, clotrimazole, and all their derivatives.
[0023] (Item A8) The use of any one of Items A5 to A7, wherein the subject for which the medicament is used has a deficiency or mutation of CYP39A1 gene, its function, its mRNA and / or its gene product, and / or an increased level of cholesterol metabolites including 24OHC and cholesteryl esters, and / or a disruption in the epithelial and / or endothelial barrier functions, and / or an abnormal production and / or extracellular release of fibrillar materials including LOXL1.
[0024] (Item A9) A method for treating XFS and / or XFG, comprising administering a therapeutically effective amount of an agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels to a subject in need thereof.
[0025] (Item A10) The method of Item A9, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, clobenpropit, cimetidine, ranitidine, posaconazole, bicalutamide, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and all their derivatives.
[0026] (Item A11) The method of Item A9 or A10, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, clotrimazole, and all their derivatives.
[0027] (Item A12) The method of any one of Items A9 to A11, wherein the subject has a deficiency or mutation of CYP39A1 gene, its function, its mRNA and / or its gene product, and / or an increased level of cholesterol metabolites including 24OHC and cholesteryl esters, and / or a disruption in the epithelial and / or endothelial barrier functions, and / or an abnormal production and / or extracellular release of fibrillar materials including LOXL1.
[0028] (Item B1) A pharmaceutical composition comprising an agent reducing or modulating the level of cholesterol metabolites, in use for treating XFS and / or XFG.
[0029] (Item B2) The pharmaceutical composition of Items B1, wherein the cholesterol metabolites include 24OHC and cholesteryl esters.
[0030] (Item B3) Use of an agent reducing or modulating the level of cholesterol metabolites, in manufacture of a medicament for treating XFS and / or XFG.
[0031] (Item B4) The use of Item B3, wherein the cholesterol metabolites include 24OHC and cholesteryl esters.
[0032] (Item B5) A method for treating XFS and / or XFG, comprising administering a therapeutically effective amount of an agent reducing or modulating the level of cholesterol metabolites to a subject in need thereof.
[0033] (Item B6) The method of Item B5, wherein the cholesterol metabolites include 24OHC and cholesteryl esters.
[0034] (Item C1) A pharmaceutical composition comprising an agent enhancing the function of CYP39A1 or increase its mRNA and / or protein expression level, in use for treating XFS and / or XFG.
[0035] (Item C2) Use of an agent enhancing the function of CYP39A1 or increase its mRNA and / or protein expression level, in manufacture of a medicament for treating XFS and / or XFG
[0036] (Item C3) A method for treating XFS and / or XFG, comprising administering a therapeutically effective amount of an agent enhancing the function of CYP39A1 or increase its mRNA and / or protein expression level to a subject in need thereof.
[0037] (Item D1) Adeno-associated virus or lentiviral vector which can be delivered to the eyes of mammals (including humans), in use for helping deliver and translate / transcribe CYP46A1 silencing RNAs and / or CYP39A1 mRNAs into protein within the anterior segment or posterior segment, or both segments, of the eye and / or to the optic nerve and / or brain visual center neurons to increase the expression of the CYP39A1 protein endogenously.
[0038] (Item E1) Use of full-length monoclonal antibody, nanobody or truncated antibody, or bi-specific agonist or partial agonist antibody as inhibitors of CYP46A1 and / or stimulators of CYP39A1 for treatment of XFS and / or XFG.
[0039] (Item F1) A pharmaceutical composition comprising an agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels, in use for reducing the level of LOXL1 misfolding, aggregation and extracellular release in the anterior segment of the eyes.Effect of Invention
[0040] As shown in the experimental results mentioned below, it was demonstrated that some agents inhibiting the function of CYP46A1 are effective in reducing 24OHC level in ocular cells (in ARPE and NPCE cells), and it was also demonstrated in NPCE, hfRPE, ARPE and HEK cells that CYP46A1 inhibitors are effective in preserving cell barrier function that was impaired due to 24OHC treatment, CYP46A1 overexpression or CYP39A1-KD. Furthermore, it was also demonstrated that CYP46A1 inhibitors are effective in reducing the expression level of XFM components in hTM cells, and in reducing the abnormal release of LOXL1 aggregate into the extracellular space, thereby reducing the formation of fibrillar aggregates. These findings suggest that inhibition of CYP46A1 enzymatic activity is an effective therapeutic strategy for diseases / conditions associated with impaired barrier function and / or increased expression and aggregation of XFM components caused by increased 24OHC levels, including XFS and / or XFG.
[0041] [Rectified under Rule 91, 26.02.2026]Fig. 1 shows the result of Test 1.Fig. 2 shows the result of Test 2.Fig. 3 shows the methodology and result of Test 3Fig. 4 shows the methodology and result of Test 4Fig. 5 shows the results of Test 5Fig. 6 shows the results of Test 6Fig. 7 shows the results of Test 6 in which TGFβ1 was presentFig. 8 shows examples of chemical inhibitors of CYP46A1.Fig. 9 shows the result of Test 7, in which ARPE-19 cells were used.Fig. 10 shows the result of Test 7, in which NPCE cells were used.Fig. 11 shows the result of Test 8, in which ARPE-19 cells were used.Fig. 12 shows the result of Test 8, in which NPCE cells were used.Fig. 13 shows the result of Test 9.Fig. 14 shows the methodology of Test 10.Fig. 15 - Fig. 17 show the results of Test 10.Fig. 18 shows the methodology of Test 11.Fig. 19 and 20 shows the results of Test 11.Fig. 21 shows the results of Test 12 in which mRNA transcript level was measured.Fig. 22 shows the results of Test 12 in which secreted protein level was measured.Fig. 23 shows the results of Test 13.Fig. 24 to 32 show the results of Test 14.
[0042] Some embodiments of the present invention are explained in detail below.
[0043] The agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels includes all known and future chemical inhibitors of CYP46A1 as pharmacological agents to treat XFS and / or XFG, and more specifically it includes voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, clobenpropit, cimetidine, ranitidine, posaconazole, bicalutamide, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and all their derivatives.
[0044] The agent reducing or modulating the level of cholesterol metabolites includes all known and future chemical modulators of cholesterol metabolites as pharmacological agents to treat XFS and / or XFG. The agent enhancing the function of CYP39A1 or increase its mRNA and / or protein expression level includes all known and future chemical stimulators of CYP39A1 as pharmacological agents to treat XFS and / or XFG.
[0045] In addition, the agent also includes full-length monoclonal antibodies, nanobody or truncated antibodies, or bi-specific agonist or partial agonist antibodies as inhibitors of CYP46A1 and / or stimulators of CYP39A1.
[0046] The present inventors have found that 24OHC induces spontaneous deformation of cell spheroids in ocular cells, and also demonstrated that addition of 24OHC itself and reduced level of CYP39A1 expression by knockdown system (CYP39A1KD) both result in impaired cell barrier function. It has been known that the impairment of cell barrier function may cause blood-aqueous-barrier (BAB) breakdown which is a clinical feature of XFS and / or XFG. Thus, the agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels, or enhancing the function of CYP39A1 or increase its mRNA and / or protein expression level may be an agent for treating XFS and / or XFG.
[0047] The CYP46A1 inhibitor used herein also includes salts thereof, which are not particularly limited as long as they are pharmaceutically acceptable salts. For example, the salts include a salt with an inorganic acid such as hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, sulfuric acid, and phosphoric acid, preferably a salt with nitric acid; a salt with an organic acid such as acetic acid, fumaric acid, maleic acid, succinic acid, citric acid, tartaric acid, adipic acid, gluconic acid, glucoheptonic acid, glucuronic acid, terephthalic acid, methanesulfonic acid, lactic acid, hippuric acid, 1,2-ethanedisulfonic acid, isethionic acid, lactobionic acid, oleic acid, pamoic acid, polygalacturonic acid, stearic acid, tannic acid, trifluoromethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, lauryl sulfate, methyl sulfate, naphthalenesulfonic acid, and sulfosalicylic acid; a salt with a halide ion such as bromine ion, chlorine ion, and iodine ion; a salt with an alkali metal such as lithium, sodium, and potassium; a salt with an alkaline earth metal such as calcium and magnesium; a salt with a metal such as iron and zinc; a salt with ammonia; a salt with an organic amine such as triethylenediamine, 2-aminoethanol, 2,2-iminobis(ethanol), 1-deoxy-1-(methylamino)-2-D-sorbitol, 2-amino-2-(hydroxymethyl)-1,3-propanediol, procaine, and N,N-bis(phenylmethyl)-1,2-ethanediamine.
[0048] The CYP46A1 inhibitor used herein also includes hydrates or solvates thereof.
[0049] When the CYP46A1 inhibitor used herein has a geometric or optical isomer, such isomer or a salt thereof is also included in the scope of the present invention. In addition, when the CYP46A1 inhibitor has a proton tautomer, such tautomer or a salt thereof is also included within the scope of the present invention.
[0050] When a CYP46A1 inhibitor used herein has a crystalline polymorph or a crystal polymorph group (crystal polymorph system), the crystalline polymorph or crystal polymorph group (crystal polymorph system) is also included within the scope of the present invention. Here, the term "crystal polymorph group (crystal polymorph system)" refers to individual crystal forms appearing at each stage or the entire process, said crystal forms can vary depending on the conditions and states of the production, crystallization, storage, etc. of the crystals, as well as state after formulation.
[0051] The concentration of the CYP46A1 inhibitor used herein can vary depending on the administration route or dosage form, for example, in the case of eyedrops, it is 0.000001% (w / v) to 10% (w / v), preferably 0.000005% (w / v) to 5% (w / v), more preferably 0.00001% (w / v) to 3% (w / v), even more preferably 0.00005% (w / v) to 2% (w / v), and particularly preferably 0.0001% (w / v) to 1% (w / v).
[0052] The present agent, pharmaceutical composition and medicament can be administered through topical ocular, intracameral, intravitreal, intraretinal, sub-choroidal, sub-conjunctival or by other safe, effective, and well-accepted routes of delivery. The present agent can be formulated in suitable buffered solutions (containing accepted preservatives or preservative-free).
[0053] Preferred formulations for topically-administration to eyes include an eyedrop, an eye gel, and an ophthalmic ointment.
[0054] The eyedrop can be prepared with some optional additives selected from, for example, a tonicity agent, a buffer agent, a surfactant, a stabilizing agent, a preservative, or the like, as needed. The pH of the eyedrop is not limited as long as the pH is in an acceptable range for ophthalmic formulations, generally a range of 2 - 8 is preferable.
[0055] The ophthalmic ointment can be prepared with a widely-used base material.
[0056] The present agent may be conjugated or co-formulated with other known IOP-lowering agents and known neuroprotective / cytoprotective agents (small molecules, peptides, other proteins) to enhance the overall efficacy and thus effective treatment of the diseases.
[0057] The dosage and administration of the CYP46A1 inhibitor used herein are not particularly limited as long as they are sufficient to achieve the desired efficacy, and can be appropriately selected depending on the symptoms of the disease, the age and weight of the patient, the dosage form of the drug, etc. For example, the composition can be administered by eyedrop at a dose of 1 to 5 drops, preferably 1 to 3 drops, more preferably 1 to 2 drops, and particularly preferably 1 drop; 1 to 6 times a day, preferably 1 to 4 times a day, more preferably 1 to 3 times a day, even more preferably 1 to 2 times a day, and particularly preferably once a day; every day to once a week, preferably every day. Here, one drop is usually about 0.01 to about 0.1 mL, preferably about 0.015 to about 0.07 mL, more preferably about 0.02 to about 0.05 mL, and particularly preferably about 0.03 mL.
[0058] The CYP46A1 inhibitor used herein is useful as an agent for treating and / or preventing pseudoexfoliative syndrome (XFS) and / or pseudoexfoliative glaucoma (XFG).
[0059] Here is each test result and formulation examples, which are shown in order to make it easy to understand the present invention, but should not be limited thereto.
[0060] Test 1 Method: The effect of 24OHC on three-dimensional cell spheroid formation of four different ocular cell types was examined. Human immortalized NPCE cells were a kind gift from Prof. M. Coca-Prados (Yale School of Medicine) maintained in DMEM supplemented with 10% fetal bovine serum (FBS). Primary HTMCs were purchased (Cat# 6590, Sciencell Research Laboratories) and maintained in Fibroblast Medium (Cat# 6591, Sciencell Research Laboratories) according to manufacturer instructions. ARPE-19 cells were purchased from ATCC and maintained in DMEM High Glucose medium (Hyclone SH30022.01) according to manufacturer instructions. Human fetal RPE (HfRPE) cells were purchased from ATCC (CRL-4000) and maintained in DMEM-F12 (1:1) medium (ATCC 30-2006) according to manufacturer instructions. For all cells lines, 1000 cells were seeded per well and cultured for total duration of 6 days. 8 μM 24OHC or its solvent control (DMSO) were added into the culture at the beginning of the culture with no media change. All cell lines were incubated at 37°C with 5% CO2. Imaging was performed with 100x magnification.
[0061] Result: The results are shown in Figure 1. For all cell lines, an intact cell spheroid with smooth surface was formed and maintained for the entire duration of 6 days. In contrast, addition of 24OHC into the culture resulted in deformed spheroids, which appeared to be loosely formed with no intact surface and some scattered cells were observed outside of the spheroid.
[0062] Conclusion: Increased level of 24OHC impaired cell-cell attachment and induced spontaneous deformation of cell spheroids in multiple types of ocular cells. These experimental data suggest that increased level of 24OHC in ocular tissues could impair cell-cell attachment and the ocular cell barrier systems.
[0063] Test 2 Method: Cell barrier permeability function in live ARPE-19 spheroids that was treated with 24OHC or in which the expression of CYP39A1 has been silenced were assessed by monitoring the accessibility of a Tetramethylrhodamine (TRITC) labelled 40kDa dextran (dextran-TRITC) as an indicator to determine permeability changes. Briefly, ARPE spheroids were cultured as described previously. 4 μM 24OHC or its solvent control (DMSO) was added into the culture for a duration for 72 hours. For CYP39A1 knockdown system (CYP39A1KD), control cells were transfected with either pLKO.1-puro empty vector (negative control, Sigma-Aldrich SHC001) or containing commercially available shRNAs that targeted human CYP39A1 (Sigma-Aldrich; Clone ID: TRCN0000064443; target sequence: CCTGAATTGTTCAAACCTGAA). Spheroids were harvested at 72 h time point and incubated in media containing dextran-TRITC for 2 h in CO2incubator. Spheroids were stained with TO-PRO3 nuclear stain and then washed in PBS and fixed in 4% paraformaldehyde (PFA) for 1 h at room temperature. For CYP39A1 immunostaining, spheroids were further blocked in blocking buffer (5% BSA, 0.05% TX-100, PBS) for 1 h at room temperature, incubated overnight in CYP39A1-specific primary antibody (synthesized specifically by Genemed Synthesis for our use) at 4°C and subsequently washed three times with PBS and incubated with FITC labelled secondary antibody for 1 h at room temperature. The spheroids were then mounted onto slides using a cytocentrifuge (Thermo Fisher Scientific) and FluorSave Reagent (Merck Millipore). Images were acquired on a Zeiss ELYRA PS.1 super-resolution system equipped with 405, 488, and 561 nm lasers (50 mW, 200 mW, 200 mW, and 150 mW, respectively) for excitation. A Zeiss 63x, 1.4NA Plan-Apochromat oil immersion objective lens was used together with a cooled EMCCD camera (iXon EM+DU885, Andor). 5 images per section per channel were acquired with z-stacks increments at 0.1 μm between z-slices. Structured illumination reconstruction and alignment was completed using the ZEN software (Zeiss).
[0064] Result: The results are shown in Figure 2. While spheroids from control cells showed background labeling by dextran TRITC, a more intense labelling was observed in spheroids that were treated with 24OHC (left image), and cells where CYP39A1 expression was reduced (right image). CYP39A1 immunostaining confirmed the reduced expression level of CYP39A1 in our knockdown system.
[0065] Conclusion: Consistent with the spontaneous deformation of spheroids that were treated with 24OHC (Test 1), cell barrier permeability staining further substantiated that 24OHC itself or CYP39A1 knockdown both impaired cell barrier function, which may translate into a physiological impact on ocular barrier systems, such as BAB integrity.
[0066] Test 3 Method: Cell barrier permeability function in hfRPE cellsthat were treated with 24OHC or in which the expression of CYP46A1 has been enhanced (hfRPE-CYP46A1) was assessed by FITC Dextran permeability assay as illustrated in Figure 3-1. Briefly, 20,000 cells were cultured on a TranswellTM6.5 mm insert with polyester membrane of 0.4 μm pore size. The culture media was changed into DMEM / F12 supplemented with 2% FBS one day before treatment. The cells were treated with either DMSO as vehicle control or 2.5 μM 24-OHC in 2% FBS media for 24 hours. 1 mg / mL of 40kDa dextran-FITC was added into the apical chamber, and phenol red free DMEM / F12 serum free media was added into the basolateral chamber. The cells were incubated at room temperature for 30 minutes. 100 μL of media from the basolateral chamber was removed into a black-walled clear bottom 96-well plate and level of fluorescence was measured using a plate reader.
[0067] Result: The results are shown in Figure 3-2. Treatment of 24-OHC itself (left image) and / or overexpression of CYP46A1 in hfRPE-CYP46A1 cells (right image) both increased the cell barrier permeability, as indicated by higher FITC dextran intensity in the basolateral chamber.
[0068] Conclusion: Consistent with the spontaneous deformation of spheroids and cell barrier permeability staining (Tests 1 and 2), this assay further substantiated in a quantitative manner that 24OHC itself or cholesterol metabolic imbalance induced by excessive CYP46A1 activity impairs cell barrier permeability function, which may translate into a physiological impact on ocular barrier systems, such as BAB integrity.
[0069] Test 4 Method: Cell integrity function in hfRPE cells and HEK cells that were treated with 24OHC or in which the expression of CYP39A1 and CYP46A1 has been manipulated to induce cholesterol metabolic imbalance were assessed by impedance-based measurement xCELLigence barrier integrity assay, as illustrated in Figure 4-1. Briefly, 20,000 cells HfRPE cells / well or 10,000 cells HEK cells / well were seeded on a 96-well xCELLigence PET e-plate. For hfRPE cells, culture media was changed into DMEM / F12 supplemented with 2% FBS one day before treatment. The cells were treated with either DMSO as vehicle control or 2.5 μM 24-OHC in 2% FBS DMEM / F12 media. Drug treatment (if any) started on 168-hours (7 days post seeding) as indicated by the first arrow; and was refreshed on 216-hour. HEK cells with a higher endogenous CYP39A1 expression level relative to the negligible endogenous CYP39A1 expression level in hfRPE cells were selected for complementary knockdown experiment. HEK cells were seeded in DMEM complete media and treated with different silencing RNAs (non-targeting, CYP39A1-specific and / or CYP46A1-specific siRNAs, as indicated) along with transfection reagent, lipofectamine. Cell index was monitored for the following 72 hours post transfection.
[0070] Result: The results are shown in Figure 4-2. 24-OHC treatment consistently caused an impairment in the cell barrier integrity of hfRPE cells, as demonstrated by the lower cell index value compared to the vehicle (DMSO) control (top image). Reduced expression of CYP39A1 by siRNA treatment in HEK cells results in lower cell index values at 60 and 72 hours, which could be rescued to the basal level upon addition of CYP46A1 siRNA (bottom image).
[0071] Conclusion: In agreement with the findings in Tests 1-3, these complementary assays showed that treatment of 24OHC itself or cholesterol metabolic imbalance caused by either enhanced CYP46A1 expression or reduced CYP39A1 expression resulted in reduced cell barrier integrity. Importantly, this result shows that knockdown of CYP46A1 along with CYP39A1 knockdown could restore the barrier integrity to basal level. This demonstrates the potential use of CYP46A1 expression reduction or inhibition as potential therapeutic strategy in maintaining BAB integrity.
[0072] Test 5 Method: The effect of 24-OHC and CYP39A1 knockdown on actual BAB function was measured in mice eyes by fluorophotometry. Briefly, mouse Cyp39a1-specifc siRNA or 24-OHC was intracamerally (IC) injected into fellow eye of Negative control (NC) siRNA or vehicle (Veh) injected eye. At day 6 or day 7 post injection, BAB function was measured by systemic administration of fluorescein by intraperitoneal injection, followed by measurement of fluorescein level in the ocular anterior chamber by using an ocular fluorophotometer (FluorotronTMMaster; OcuMetrics). In addition to fluorophotometry, iris and ciliary body tissues were collected for gene expression analysis.
[0073] Result: The results are shown in Figure 5. IC injection of mouse Cyp39A1-specific siRNA compared to NC siRNA resulted in increased level of fluorescein in the anterior chamber, indicating compromised BAB function (Figure 5-1). In addition, gene expression analysis in eyes injected with Cyp39A1 siRNA compared with NC siRNA control eyes confirmed reduced expression level of Cyp39a1 as well as reduced expression level of Tight junction protein-1 (Tjp-1), a membrane protein that plays a key role in regulating the structure and function of tight junctions, particularly in epithelial and endothelial cells (Figure 5-2). Consistent with the effect of Cyp39A1-siRNA, IC injection of 24-OHC resulted in increased level of fluorescein in the anterior chamber, indicating compromised BAB function (Figure 5-1).
[0074] Conclusion: This animal experimental data strongly supported the cellular experimental results in Tests 1-5 and conclusively demonstrated that 24-OHC itself or CYP39A1 knockdown both impaired BAB integrity. This was demonstrated by the level of systemic fluorescein that enters into the anterior chamber and reduced expression level of Tjp1 as a marker of BAB function.
[0075] Test 6 Method: The effect of CYP39A1 knockdown on the expression level of XFM components was measured in human trabecular meshwork cells (hTM cells) treated with either non-targeting or CYP39A1 silencing siRNAs with or without the addition of TGFβ1. Briefly, 5,000 hTM cells / well were seeded in a 96 well plate in complete media, and respective siRNAs were added along with a transfection reagent, lipofectamine, 4 hours after seeding. The media supernatant and / or the cell lysate are collected after 48 hours. In the case of co-treatment with TGFβ1, the cells were seeded and transfected in serum free medium and TGFβ1 was added 24 hours after seeding. The media supernatant and / or the cell lysate are collected after 48 hours. For qPCR, total RNA was recovered with the RNeasy kit (Qiagen, Valencia, California, USA), and reverse-transcribed into cDNA using random hexamer primers (Invitrogen Corp) with Superscript III reverse transcriptase (Invitrogen Corp). All qPCR reactions comprising the Power SYBR Green PCR Master Mix (Applied BioSystems, California, USA) were performed in triplicate in volumes of 10 μL in 384-well microtitre plates. Measurement of Elastin protein level was performed with commercially available enzyme-linked immunosorbent assay (ELISA) kit for Elastin (Abcam) according to the manufacturer instructions.
[0076] Result: The results are shown in Figures 6 and 7. Reduced expression of CYP39A1 by knockdown system (CYP39A1-KD) alone results in increased mRNA expression level of XFM components fibrillin 1 and elastin, reduced expression of LOXL1, and no changes in the expression level of LTBP2 (Figure 6 top images). Consistent with changes in the mRNA level, CYP39A1-KD results also in increased level of secreted elastin protein in the media (Figure 6 bottom image). TGFβ1 treatment interestingly results in reduced expression of CYP39A1, which could be further reduced when CYP39A1-KD was combined with TGFβ1 treatment. The addition of CYP39A1-KD to TGFβ1 treated cells resulted in a synergistic increase in the mRNA transcript level of XFM component genes, including fibrillin 1, elastin and LTBP2, and no difference in the level of LOXL1 (Figure 7 top images). Consistent with changes in the mRNA level, addition of CYP39A1-KD to TGFβ1 treated cells also resulted in a synergistic increase in the level of secreted elastin protein (Figure 7 bottom image).
[0077] Conclusion: These results demonstrate that CYP39A1 deficiency impacts the expression level of XFM components both on the transcript level and protein secretion level. This effect was more pronounced in the presence of TGFβ1, a known inducer of XFM components expression in ocular cells, suggesting potential functional interaction between cholesterol metabolism and TGFβ1 signaling pathway. Overall, CYP39A1 deficiency could contribute to XFS and XFG pathogenesis not only through BAB permeability impairment, but also through direct production of XFM components.Test 7 Method: The effect of pharmaceutical agents that have been reported to inhibit CYP46A1 function in reducing 24OHC level was measured in NPCE and ARPE-19 cells. Measurement of 24OHC level was performed with commercially available competitive ELISA kit for 24OHC (Abcam; ab204530) according to the manufacturer instructions. For treatment of the test agents, the cells were washed and incubated with media without FBS in the presence of each test agent (50 μM) for 24h. Subsequently, media was harvested and centrifuged. 100 μL media was used for the competitive ELISA.
[0078] Result: Pharmaceutical agents that have been reported to inhibit CYP46A1 function include: for example, voriconazole, fluvoxamine, tranyl-L-cypromine, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, posaconazole, bicalutamide, clobenpropit, cimetidine, ranitidine, soticlestat, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and others (see, Figure 8). As indicated in the respective charts, 11 of the above-mentioned CYP46A1 inhibitors were tested and found to significantly reduce the level of 24OHC relative to the control group in both NPCE and ARPE-19 cells (see, Figures 9 and 10). A similar trend can be observed between the two cell types, namely: voriconazole, ranitidine and thioperamide are among the compounds that have the highest effect on 24OHC level reduction.
[0079] Conclusion: all tested CYP46A1 inhibitors were effective in reducing 24OHC level in ARPE and / or NPCE cells. This result demonstrates that inhibition of CYP46A1 activity may be an effective therapeutic strategy for diseases or conditions with increased 24OHC level.
[0080] Test 8 Method: Cell barrier permeability assay with or without 24OHC treatment and / or CYP39A1 expression silencing was performed as described previously (Test 2). Each test pharmaceutical agent was added 24 h before spheroids were harvested and processed for dextran-TRITC labelling and imaging, as described previously.
[0081] Result: The results are shown in Figures 11 and 12. First column on the left showed control cells without any test agent treatment. Consistent with previous result (Test 2), control cells treated with 24OHC or CYP39A1 knockdown displayed a more intense labelling of dextran-FITC, signifying impaired cell barrier function. In addition, the combined effect of 24OHC treatment with CYP39A1 knockdown resulted in an even greater intensity of dextran-FITC penetration. In subsequent columns, 6 CYP46A1 inhibitors were tested, as indicated on the top of each column. The treatment of each pharmaceutical agents resulted in reduced dextran-TRITC penetration compared to the control cells in the first column in all or at least one condition (24OHC treatment, CYP39A1KD, or combination of both), indicating their efficacy in improving cell barrier function under these conditions.
[0082] Conclusion: All tested CYP46A1 inhibitors were effective in preserving cell barrier function that was impaired due to the treatment of 24OHC and / or reduced CYP39A1 expression. This result further substantiates that inhibition of CYP46A1 enzymatic activity could be an effective therapeutic strategy for diseases / conditions associated with impaired barrier function caused by increased 24OHC levels and / or reduced CYP39A1 level.
[0083] Test 9 Method: Cell barrier permeability and integrity assay were performed in hfRPE cells in which the expression of CYP46A1 has been enhanced and / or HEK cells in which expression of CYP39A1 has been knocked down, as described previously (Test 3 and 4). For hfRPE cells, the cells were treated with either DMSO as vehicle control or 1 μM soticlestat in 10% FBS DMEM / F12 media for 6 days (FITC-dextran assay) or at 168-hour (7 days post seeding) as indicated by the first arrow, and refreshed on 216-hour (xCELLigence assay). For HEK cells, the cells were treated with either DMSO as vehicle control or selected pharmaceutical agents at the time of seeding.
[0084] Result: The results are shown in Figure 13. Top images showed the effect of Soticlestat treatment on hfRPE cells with enhanced CYP46A1 expression. As previously shown in Figure 3, enhanced CYP46A1 expression resulted in increased barrier permeability. Compared to the vehicle control, soticlestat treatment resulted in significantly reduced FITC-dextran level (top left image) and increased cell index measurement (top right image), indicating preserved cell barrier function. Such effect was similarly shown in complementary knockdown experiment in HEK cells with CYP39A1 knockdown. As previously shown in Figure 4, reduced CYP39A1 expression resulted in reduced barrier function. Compared to vehicle control, treatment of soticlestat along with other selected CYP46A1 inhibitors (voriconazole and tranyl-L-cypromine) significantly increased cell index measurement level indicated preserved cell barrier function (bottom image).
[0085] Conclusion: All tested CYP46A1 inhibitors (soticlestat, voriconazole and tranyl-L-cypromine) were effective in preserving cell barrier function that was impaired due cholesterol metabolic imbalance induced by either enhanced CYP46A1 expression or reduced CYP39A1 expression. This result is consistent with the result in Test 8 and further substantiates that pharmaceutical inhibition of CYP46A1 enzymatic activity could be an effective therapeutic strategy for diseases / conditions associated with impaired barrier function caused by cholesterol metabolic imbalance.
[0086] Test 10 Method: To perform a large-scale pharmacology test of CYP46A1 inhibitors in various dose ranges, the inventors established an assay with hfRPE-CYP46A1 cells, as described in Tests 3 and 4 previously, using cell confluency level as a read-out for cell barrier function (Figure 14). Briefly, 2 x 103cells were seeded in each well in a 96-well plate. The cells were allowed to attached overnight at 37°C with 5% CO2. The cell media was switched to DMEM / F12 supplemented with 5% FBS and live-cell imaging was performed at an interval of every 4 hours in the IncuCyte S3 machine. On Day 2, the cells were washed twice in PBS before subjecting to drug treatment. The drugs were diluted to concentrations mentioned in the figures in DMEM / F12 supplemented with 1% lipoprotein deficient serum (LPDS, Sigma-Aldrich). The cells were treated for another 8 days and data analysis was performed using the IncuCyte Analysis software. For effective dose (EC50) calculation, confluency values were normalized and then plotted with non-linear fit curve([Agonist] vs. normalized response -- Variable slope) using GraphPad Prism software.
[0087] Result: The results of this test were shown in Figures 15-17. Figure 15 demonstrated the principles of this assay: Consistent with the results of cell barrier function assays (Tests 3 and 4), overexpression of CYP46A1 resulted in dramatic reduction of cell confluency. This reduction was rescued by co-expression of CYP39A1 which restored the cholesterol metabolic imbalance induced by CYP46A1 overexpression (left image). Consistent with the outcome of Test 9, treatment with soticlestat efficiently rescued the reduced cell confluency induced by CYP46A1 overexpression (right image). Figure 16 showed the efficacy of various CYP46A1 inhibitors in two to three selected doses. The result in this figure was summarized in Table 1. Figure 17 showed the EC50curve and values of selected CYP46A1 inhibitors.
[0088] Conclusion: The established cell confluency assay based on CYP46A1 overexpression in hfRPE cells efficiently measured the function of CYP46A1 activity on barrier function. The efficacy and EC50 value of various CYP46A1 inhibitors could be compared.
[0089] Test 11 Method: The effect of selected CYP46A1 inhibitors on CYP46A1 enzymatic activity was evaluated and measured by mass-spectrometry (see, Figure 18). Detailed description as follows: (Preparation of D7-Cholesterol: methyl-β-cyclodextrin (MBCD) complexes) D7-Cholesterol and unlabelled cholesterol was mixed at a ratio of 1:4 in chloroform and dried under nitrogen gas. Dried cholesterol was subsequently dissolved in 20 mM of MBCD to a ratio of 1:20. The complex solution was sonicated in a water bath at 37°C for 30 minutes and placed in a 37°C water bath for 30 minutes before filtering it using a 0.2 μm filter. (24-OHC Enzymatic Assay) 3 x 106Cells were seeded in a 15-cm dish and left to attach overnight at 37°C with 5% CO2. Treatment of the cells started 2 days after seeding for 16 hours. After 16 hours, the cells were washed with PBS twice and once with serum free media (SFM). Labelling solution was prepared by diluting the complex solution 3-fold in SFM and ACAT inhibitor was added at a concentration of 1 μg / mL. Drugs were added into the labelling solution before incubating the cells for 3 hours at 37°C with 5% CO2. After 3 hours, the cells were washed as mentioned before. The cells were subsequently incubated in SFM supplemented with ACAT inhibitor and drugs for another 4 hours before harvesting. To harvest the cells, the cells were placed on ice and washed thrice with ice cold 150 mM NaCl. The cells were then harvested by scraping the plate with a cell scraper and ice cold NaCl. The cell suspension was then centrifuged at 3,000 x g for 5 minutes at 4°C. The cell pellets were kept on ice and extraction was performed immediately. (Lipid Extraction) The cell pellets were extracted using a two-phase modified Bligh and Dyer lipid extraction protocol. Briefly, each sample was extracted by sequential addition of methanol, chloroform and 3.8 mM tricine (1:1:0.5 v / v / v), with sample vortexted between each addition. The samples were subsequently centrifuged at 14,000 x g at 4°C for 20 minutes. The bottom chloroform fraction was collected and processed for liquid chromatography mass spectrometry (LC-MS). (Liquid chromatography and mass spectrometry) For detection of D7-24 OHC, the lipid extracts were analyzed in triplicate using a Waters Acquity ultra performance liquid chromatography system (UPLC) (Massachusetts, USA) in tandem with a mass spectrometer (Synapt G2-Si, Waters). A C18 UPLC column (Acquity UPLC CSH column, 1.0 x 50 mm, 1.7 μm, Waters) was used for separation and the mobile phase comprised of two solvents: 5 mM ammonium formate in 1:1 methanol:water as mobile phase ‘A’, 5 mM ammonium formate in isopropanol as mobile phase ‘B’. The UPLC program is as follows: the column was first equilibrated for 2 min at 1% B with a flow rate of 0.1 mL / min. The gradient was then increased from 1% B to 95% B over 10 min (flow rate of 0.1 mL / min) before B was further increased to 99% for a 3 min wash. The column was re-equilibrated for 2 min at 1% B. Column temperature was maintained at 30°C and eluent from the LC system was directed into the MS. High-resolution mass spectrometry was then performed in positive ESI modes with a mass range of 100 to 1,700 m / z and a resolution of>10,000. Cone and desolvation gas flows was set at 40.0 and 600.0 (L / h) respectively, with a desolvation temperature of 200°C. The ESI capillary voltage was 2.0 kV for positive mode ionization. Mass calibration was performed using sodium formate prior to injection of the samples. A quality control (QC) sample comprising of equal aliquots of each sample was run at regular intervals during the batch LC-MS runs. The lipid extracts were dried under nitrogen gas and reconstituted with mobile phase ‘B’ before LC-MS analysis. The injection volume of each sample was 2 μl. The raw LC-MS data obtained from the lipid extracts was processed using a XCMS-based peak finding algorithm [1]. The QC samples were used to adjust for instrumental drift and cell count normalization was performed. Metabolite identities were confirmed based on mass spectral comparison with available metabolite standards: precursor ions for D7-24 is m / z 374.38.
[0090] Result: The results of this test were shown in Figures 19 and 20. Figure 19 demonstrated the principles of this assay. As expected, treatment of CYP46A1 inhibitor, soticlestat, resulted in significant reduction in the level of d7-24 OHC, but no changes in the level of d7-cholesterol, demonstrating almost complete inhibition of CYP46A1 enzymatic activity. Subsequently, selected CYP46A1 inhibitor compounds were tested based on their respective EC50dose identified in Test 10, previously. All tested CYP46A1 inhibitors demonstrated more than 50% inhibition of CYP46A1 activity (Figure 20).
[0091] Conclusion: These findings confirmed that the tested CYP46A1 inhibitors directly inhibited its enzymatic activity contributing to the cellular outcomes such as barrier function.
[0092] Test 12 Method: XFM component gene and protein expression in hTM cells with CYP39A1 knockdown were performed as described previously (Test 6). Each test pharmaceutical agent was added at the time of seeding.
[0093] Result: The results of this test were shown in Figures 21 (mRNA transcript level) and 22 (Elastin protein level). Out of the selected CYP46A1 inhibitors, azole compounds that are known to inhibit not only CYP46A1, but also other CYP enzymes including CYP51A1 that is involved in cholesterol synthesis and acts upstream of CYP46A1, such as voriconazole, clotrimazole, and ketoconazole demonstrated a dose dependent reduction in the expression level of certain XFM component genes such as Elastin, Fibrillin, and some cases Loxl1. The outcomes measured from gene expression analysis was strongly recapitulated in the level of secreted protein (Figure 22), demonstrating that CYP46A1 inhibitors could effectively reduce the level of XFM component protein secretion.
[0094] Conclusion: This data demonstrated that CYP46A1 inhibitor compounds, in particular, the azole compounds, could effectively reduce the expression level of XFM components. This further emphasized the potential therapeutic use of these compounds for XFS and / or XFG, by both maintaining BAB integrity and repression of XFM components production.
[0095] Test 13 Method: Cornea penetration potential of three CYP46A1 inhibitors was tested in Japanese white rabbits. Briefly, 0.1% fluvoxamine solution, 1% voriconazole suspension, and 0.1% tranylcypromine (HCl) solution were prepared by mixing with a conventional vehicle. 50 μL single instillation of each formulation was applied to both eyes of Japanese white rabbits by sequential cassette dosing method. The concentration of each CYP46A1 inhibitor in the aqueous humor at 0.5, 1 and 2 h was measured with LC-MS / MS method as free form (ng / mL).
[0096] Result: The results are shown in Figure 23. After a single instillation of each formulation, each of the CYP46A1 inhibitor (fluvoxamine, voriconazole and tranylcypromine (HCl)) can be detected in the aqueous humor. As indicated in the concentration-time profile chart, each agent reached the highest concentration at 0.5 h after instillation. Elimination of fluvoxamine tends to be slower than the other agents.
[0097] Conclusion: Three CYP46A1 inhibitors (voriconazole, fluvoxamine and tranylcypromine (HCL)) can be efficiently delivered to the aqueous humor by topical instillation. This result supports the potential use of these CYP46A1 inhibitors to be developed as therapeutic eye drops for the treatment of ocular conditions including XFS and / or XFG.
[0098] [Rectified under Rule 91, 26.02.2026]Test 1424 OHC treatment for 48 hours in hfRPE cells stably expressing LOXL1 lead to release of LOXL1 protein into extracellular media (Figures 24E and 24F). This was abrogated by co-treatment with the LXR inhibitor GSK2033, which is known to induce cholesterol efflux (Figures 25B and 25C). This implies that cholesterol efflux, likely from cell membrane could lead to release of LOXL1 into extracellular media. In support of this line of reasoning, we used MBCD to extract cholesterol from cells, and this led to release of LOXL1 protein (Figures 25D and 25E). Supplementing cholesterol during MBCD treatment reduces cholesterol loss - we found that this also partially rescued the LOXL1 release phenotype (Figures 25D and 25E). We next then stably expressed LOXL1 in CYP46A1 expressing cells hfRPE cells (Figures 26A-26D). CYP46A1 expressing cells have higher 24-OHC levels (Figures 26E and 30C; as a result we found that they have lower intracellular cholesterol levels (Figures 30B and 30C) and higher extracellular esterified cholesterol levels (Figures 30B and 30C). We found that compared to hfRPE cells expressing LOXL1 only, there is enhanced release of LOXL1 protein in the extracellular media of CYP46A1 expressing cells (Figures 26A-26D). This is abrogated by either soticlestat (Figure 26B) or GSK2033 treatment (Figure 26D) showing proof of concept that CYP46A1 inhibition and the reduction of 24-OHC levels in cells could decrease LOXL1 release into the media. Expression of CYP39A1 in CYP46A1 and LOXL1 expressing hfRPE cells also reduces 24-OHC levels (Figure 26E) and reduces LOXL1 levels in extracellular media. To determine physiological relevance of our finding that 24-OHC can lead to LOXL1 release, we find that there are increased esterified cholesterol in XFG / XFS Aqueous Humor compared to disease free Aqueous humor, with highest levels in XFG Aqueous Humor (Figure 25A), consistent with the in vitro observation that there is increased cholesterol efflux from cells into extracellular media, since aqueous humor is the extracellular fluid that bathes cells of the anterior chamber. Given that LOXL1 is a component of exfoliative deposits in XFS, we hypothesize that there should be increased levels of LOXL1 protein in aqueous humor from XFG / XFS patients. Indeed, we observed higher abundance of LOXL1 in aqueous humor from XFS / XFG patients compared to disease free aqueous humor, with the highest levels found in XFG patients, consistent with advanced stage of disease (Figure 26H). This imply that elevated 24-OHC could directly cause exfoliative deposition by inducing cholesterol efflux via LXR activation, which in turn leads to increased release of LOXL1 protein in to aqueous humor. Increased amounts of LOXL1 protein could then lead to deposition of LOXL1 containing exfoliation material.
Claims
1. A pharmaceutical composition comprising an agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels, in use for treating XFS and / or XFG.
2. The pharmaceutical composition of claim 1, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, clobenpropit, cimetidine, ranitidine, posaconazole, bicalutamide, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and all their derivatives.
3. The pharmaceutical composition of claim 1 or 2, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, clotrimazole, and all their derivatives.
4. The pharmaceutical composition of any one of claims 1 to 3, wherein the subject for which the pharmaceutical composition is used has a deficiency or mutation of CYP39A1 gene, its function, its mRNA and / or its gene product, and / or an increased level of cholesterol metabolites including 24OHC and cholesteryl esters, and / or a disruption in the epithelial and / or endothelial barrier functions.
5. Use of an agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels, in manufacture of a medicament for treating XFS and / or XFG.
6. The use of claim 5, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, clobenpropit, cimetidine, ranitidine, posaconazole, bicalutamide, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and all their derivatives.
7. The use of claim 5 or 6, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, clotrimazole, and all their derivatives.
8. The use of any one of claim 5 to 7, wherein the subject for which the medicament is used has a deficiency or mutation of CYP39A1 gene, its function, its mRNA and / or its gene product, and / or an increased level of cholesterol metabolites including 24OHC and cholesteryl esters, and / or a disruption in the epithelial and / or endothelial barrier functions.
9. A method for treating XFS and / or XFG, comprising administering a therapeutically effective amount of an agent inhibiting the function of CYP46A1 or decreasing its mRNA and / or protein expression levels to a subject in need thereof.
10. The method of claim 9, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, thioperamide, selegiline, clotrimazole, ketoconazole, fluconazole, clobenpropit, cimetidine, ranitidine, posaconazole, bicalutamide, Cholesterol 24-hydroxylase-IN-1, Cholesterol 24-hydroxylase-IN-2, and all their derivatives.
11. The method of claim 9 or 10, wherein the agent is selected from the group consisting of voriconazole, fluvoxamine, tranyl-L-cypromine, soticlestat, clotrimazole, and all their derivatives.
12. The method of any one of claims 9 to 11, wherein the subject has a deficiency or mutation of CYP39A1 gene, its function, its mRNA and / or its gene product, and / or an increased level of cholesterol metabolites including 24OHC and cholesteryl esters, and / or a disruption in the epithelial and / or endothelial barrier functions.