Nucleic acid construct for inhibiting FABP5, and composition for treating obesity or obesity-induced metabolic diseases
A nucleic acid structure targeting FABP5 and FABP4 genes using RNAi molecules effectively treats obesity and related metabolic diseases by inhibiting gene expression, achieving weight loss and metabolic improvements.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- CURSUS BIO INC
- Filing Date
- 2024-12-16
- Publication Date
- 2026-06-25
AI Technical Summary
Current gene therapies for obesity and obesity-derived metabolic diseases face challenges in delivering siRNA effectively to target organs, leading to off-targeting and variable in vivo effects, and there is a need for safe and effective treatments for conditions like obesity, type 2 diabetes, and hyperlipidemia.
A nucleic acid structure comprising a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to the FABP5 target gene, combined with a multi-cystronic shRNA expression cassette, is developed to inhibit FABP5 and FABP4 expression in adipocytes, using a non-viral vector for delivery.
The nucleic acid structure effectively suppresses FABP5 and FABP4 expression, leading to weight loss, reduction of inflammatory cytokines, lipid accumulation, and improvement of insulin and glucose resistance, providing a treatment for obesity and related metabolic diseases.
Smart Images

Figure KR2024097002_25062026_PF_FP_ABST
Abstract
Description
Nucleic acid construct for FABP5 inhibition and composition for treating obesity or obesity-derived metabolic diseases containing the same
[0001] The present invention relates to a novel gene therapy capable of inhibiting FABP5 (Fatty Acid-binding protein 5), a nucleic acid construct capable of inhibiting the target gene FABP5, or FABP5 and FABP4 (Fatty Acid-binding protein 4), a multi-cystronic shRNA expression cassette, and the use thereof for treating obesity or obesity-derived metabolic diseases.
[0002]
[0003] Gene therapy, which aims to treat diseases by regulating genes, relies on the regulation of DNA expression as a key element. Since the phenomenon of RNA interference was identified, numerous studies on therapeutic strategies using RNA interference (RNAi) strategies have been reported.
[0004] Among these, numerous studies are underway to utilize siRNA as a therapeutic agent by applying RNAi mechanisms to specific diseased organs or tissues. However, limitations such as off-targeting, the complexity of RNA design, and variable in vivo effects have also been reported in the development of therapeutic agents using RNAi mechanisms. Currently, the biggest challenge in the development of siRNA therapeutics is the stable and efficient delivery of siRNA into the cells of the target organ following systemic administration. The scarcity of therapeutic development cases, despite the active research on siRNA, is attributed to the failure to find an effective siRNA delivery system for target disease cells. Therefore, effectively delivering effector sequences to the target to achieve therapeutic effects remains a technical challenge.
[0005] Meanwhile, obesity-derived metabolic syndrome, which includes obesity along with type 2 diabetes and hyperlipidemia, is emerging as a significant problem due to the Westernization of modern society, but there have not been many reported gene therapies that are safe in the human body and can effectively treat obesity and obesity-derived metabolic diseases.
[0006] Therefore, there is a need to develop RNAi therapeutics that can effectively treat obesity and obesity-derived metabolic diseases by selectively delivering them to target organ cells.
[0007]
[0008] While researching gene therapy drugs capable of effectively inhibiting FABP5 to treat obesity or obesity-derived metabolic diseases, the inventors confirmed that using a nucleic acid structure containing a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to the FABP5 target gene can effectively inhibit FABP5 in adipocytes, which are target cells, and achieve weight loss and therapeutic effects for obesity-derived metabolic diseases, thereby completing the present invention.
[0009] Accordingly, the object of the present invention is to provide a nucleic acid structure comprising a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to the FABP 5 target gene, a multi-cystronic shRNA expression cassette, a composition for inhibiting FABP5 comprising the same, and a pharmaceutical composition for preventing or treating obesity or obesity-derived metabolic diseases.
[0010]
[0011] To achieve the above objective, the present invention provides a nucleic acid structure comprising a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to a FABP5 target gene, wherein the RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the polynucleotide sequence, and the polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
[0012] In addition, the present invention relates to a multi-cystronic shRNA expression cassette co-targeting FABP 5 and FABP4 comprising a) a promoter, b) a 5' miR backbone, a first polynucleotide and a 3' miR backbone, c) a 5' miR backbone, a second polynucleotide and a 3' miR backbone, and d) a polyadenylation sequence,
[0013] The first polynucleotide is a polynucleotide sequence encoding a first RNA interference (RNAi) molecule specific to the FABP4 target gene, and the first RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the first polynucleotide sequence, and the first polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 1 to 5 and SEQ ID NOs 11 to 18;
[0014] The present invention provides a multi-cystronic shRNA expression cassette that simultaneously targets FABP5 and FABP4, wherein the second polynucleotide is a polynucleotide sequence encoding a second RNA interference (RNAi) molecule specific to the FABP5 target gene, the second RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the second polynucleotide sequence, and the second polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
[0015] The present invention also provides a composition for inhibiting FABP5 comprising the nucleic acid structure; or the multi-cystronic shRNA expression cassette.
[0016] In addition, the present invention provides a composition for the simultaneous inhibition of FABP4 and FABP5 comprising the multi-cystronic shRNA expression cassette.
[0017] The present invention also provides a pharmaceutical composition for the prevention or treatment of obesity or obesity-derived metabolic diseases comprising the nucleic acid structure; or the multi-cystronic shRNA expression cassette.
[0018] In addition, the present invention provides the use of the nucleic acid structure; or the multi-cystronic shRNA expression cassette for the prevention or treatment of obesity or obesity-derived metabolic diseases.
[0019] In addition, the present invention provides the use of the nucleic acid structure; or the multi-cystronic shRNA expression cassette for the manufacture of a preventive or therapeutic agent for obesity or obesity-derived metabolic diseases.
[0020] The present invention also provides a method for treating obesity or obesity-derived metabolic diseases, comprising the step of administering the nucleic acid structure; or the multi-cystronic shRNA expression cassette, to an individual in need thereof.
[0021]
[0022] The nucleic acid structure or multi-cystronic shRNA expression cassette according to the present invention can be used in the development of treatments for obesity or obesity-derived metabolic diseases because it can achieve effects such as weight loss, reduction of inflammatory cytokines in adipose tissue, reduction of lipids, and improvement of insulin resistance and glucose resistance by targeting adipocytes to effectively suppress the expression of FABP5, or FABP4 and FABP5.
[0023]
[0024] Figure 1 shows the results of confirming the FABP4 expression inhibitory effect of siFABP4-1 to siFABP4-5, which are specific to target genes represented by sequence numbers 1 to 5, in 3T3-L1 and hADSC cells.
[0025] Figure 2 shows the results of confirming the FABP5 expression inhibitory effect of siFABP5-1 to siFABP5-5, which are specific to target genes represented by sequence numbers 6 to 10, in 3T3-L1 and hADSC cells.
[0026] Figure 3 shows the results of confirming the FABP4 expression inhibitory effect of siFABP4-6 to siFABP4-13, which are specific to target genes represented by sequence numbers 11 to 18, in hADSC cells.
[0027] Figure 4 shows the results of confirming the FABP4 expression inhibitory effect of siFABP5-6 to siFABP5-13, which are specific to target genes represented by sequence numbers 19 to 26, in hADSC cells.
[0028] Figure 5 is a figure showing a vector map containing the nucleic acid structure of the present invention.
[0029] FIG. 6 is a figure showing the sequence of a vector map including a nucleic acid structure of the present invention and its components.
[0030] Figure 7 is a figure showing the results of confirming the inhibitory effect on FABP4 and FABP5 mRNA expression by treatment with hVec and hVec / ATS9R containing the nucleic acid structure of the present invention.
[0031] Figure 8 is a figure showing the effect of reducing triglycerides (TG) and free fatty acids (FFA) according to hVec and hVec / ATS9R treatment containing the nucleic acid structure of the present invention.
[0032] Figure 9 is a figure showing the results of confirming cytotoxicity following treatment with hVec / ATS9R containing the nucleic acid structure of the present invention.
[0033] Figure 10 is a figure showing the results of confirming the degree of T cell differentiation by ELISA following treatment with hVec / ATS9R containing the nucleic acid structure of the present invention.
[0034] Figure 11 is a figure showing the results of confirming the degree of T cell differentiation following hVec / ATS9R treatment containing the nucleic acid structure of the present invention through Flow Cytometry analysis.
[0035] Figure 12 is a figure showing the results of confirming the weight loss effect following hVec / ATS9R treatment containing the nucleic acid structure of the present invention.
[0036] Figure 13 is a figure showing the results of confirming the reduction of FABP4, FABP5, and inflammatory cytokine markers in adipose tissue following treatment with hVec / ATS9R containing the nucleic acid structure of the present invention.
[0037] Figure 14 is a figure showing the results of confirming the improvement effect on insulin resistance (A) and glucose resistance (B) following treatment with hVec / ATS9R containing the nucleic acid structure of the present invention.
[0038] Figure 15 is a figure confirming the effect of reducing inflammatory mediators TNF-α, IL-1β, IL-6, and MCP-1 following treatment with hVec / ATS9R containing the nucleic acid structure of the present invention.
[0039] Figure 16 is a figure showing the effect of reducing triglycerides (TG) and free fatty acids (FFA) by treatment with hVec / ATS9R containing the nucleic acid structure of the present invention.
[0040]
[0041] The present invention relates to a nucleic acid structure comprising a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to a FABP 5 target gene, wherein the RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the polynucleotide sequence, and the polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
[0042] The nucleic acid structure according to the present invention can specifically inhibit the expression of FABP 5 expressed in fat cells, thereby inhibiting lipid accumulation and achieving an effect of improving insulin resistance and glucose resistance, and thus can be utilized as a treatment for obesity or obesity-derived metabolic diseases.
[0043] Fatty acid binding proteins (FABPs) are transport proteins for fatty acids and other lipophilic substances such as eicosanoids and retinoids, and are involved in the transport of fatty acids between the intracellular membrane and the extracellular membrane. More than nine types of fatty acid binding proteins are known, and they are known to be highly expressed, particularly in tissues involved in lipid metabolism. In particular, FABP4 (A-FABP) and FABP5 (E-FABP) are known to be FABPs highly expressed in adipocytes and macrophages, and are highly associated not only with obesity but also with obesity-related metabolic diseases, such as diabetes and atherosclerosis.
[0044] The present invention relates to a nucleic acid structure or a multi-cystronic shRNA expression cassette for simultaneously inhibiting FABP5 or FABP4 and FABP5 genes, characterized by comprising a polynucleotide encoding an RNA interference (RNAi) molecule specific to the target gene in order to inhibit the target gene FABP5.
[0045] In the present invention, an RNA interference molecule for inhibiting the expression of a FABP5 target gene comprises an effector sequence of 15 or more adjacent nucleotides that is substantially complementary to the polynucleotide sequence, and the polynucleotide sequence may comprise one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26. The polynucleotide sequences represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26 are sequences identical to the target site sequence for inhibiting FABP5 gene expression.
[0046] In the present invention, the RNA interference molecule comprises an effector sequence that is substantially complementary or completely complementary to the region of the mRNA of FABP5 or a variant thereof, and through this complementarity, can form a specific binding to the mRNA of FABP5 under intracellular conditions. That is, the RNA interference molecule of the present invention comprises an effector sequence of 15 or more adjacent nucleotides that is substantially complementary to one or more regions of the polynucleotide sequences represented by SEQ ID NOs. 6 to 10 and SEQ ID NOs. 19 to 26, and said effector sequence refers to a complementary antisense sequence that forms a specific binding to the mRNA of FABP5.
[0047] The RNA interference molecule substantially complementary to the polynucleotide sequence of the present invention may consist of 15 to 25 nucleotides, preferably 16 to 23, and more preferably 20 to 22 nucleotides.
[0048] In the present invention, "substantially complementary" means including 1 to 6, e.g., 1, 2, 3, 4, 5, or 6 mismatches, as long as the specific binding and expression inhibition effects of the present invention can be achieved.
[0049] Accordingly, the RNA interference molecule of the present invention may include an effector sequence that is completely complementary to the mRNA or variant region of FABP5, but may include 1 to 6 mismatches with respect to these, and such sequences are also included within the scope of the present invention. The present invention may include an RNA interference molecule having 70% or more homology, preferably 80% or more homology, and even more preferably 90% or more homology, with the RNA transcript of the polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
[0050] The effector sequence of the present invention may be a short hairpin RNA (shRNA). shRNA is a sequence of RNA that forms a tight hairpin twist that can be used to silence gene expression through RNA interference. When the nucleic acid construct of the present invention is introduced into a target cell as a vector, shRNA is expressed. The shRNA hairpin structure is cleaved into siRNA by the cell, which then binds to an RNA-induced silencing complex (RISC). This complex specifically binds to mRNA and cleaves it, while mutually substantially complementary siRNA sequences bind to target miRNAs to induce repression of mRNA expression.
[0051] The nucleic acid structure of the present invention may include an effector complement sequence substantially complementary to the effector sequence. In the present invention, the effector sequence may be used interchangeably with an antisense sequence on the shRNA structure, and the effector complement sequence may be used interchangeably with a sense sequence on the shRNA structure. Accordingly, the effector complement sequence of the present invention may be a sequence that is completely complementary to the effector sequence or has 1 to 6 mismatches, and may be a variant thereof having at least 85%, preferably 90%, or more sequence identity with respect to the sequence that is completely complementary to the effector sequence.
[0052] In addition, since the nucleic acid structure of the present invention requires a mismatch in the first nucleotide of the 5' end of the sense sequence due to the characteristics of miR backbone-shRNA, the first sequence of the FABP5 target gene adjacent to the 5' end of the polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26 is changed to C if the nucleotide at the corresponding position is A or T, and to A if it is C or G. Through this, a form including one additional base that causes a mismatch at the 5' end of the polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26 can be included in the nucleic acid structure. For example, when the target gene TAGGATCATCCCTTTGGTTAA of SEQ ID NO. 6 is included in the nucleic acid structure, it can be included in the nucleic acid structure in the form of the CTAGGATCATCCCTTTGGTTAA sequence that causes a mismatch at the 5' end. That is, it can be included in nucleic acid structures in the form of 5'-A or C- (a polynucleotide encoding an RNA interference (RNAi) molecule specific to the FABP 5 target gene)-3'.
[0053] Additionally, the nucleic acid structure of the present invention may additionally include a loop sequence located between the effector sequence and the complement sequence. The loop region included in the nucleic acid structure of the present invention may be a polynucleotide represented by 'TAGTGAAGCCACAGATGTA (SEQ ID NO. 30)', but is not limited thereto. In the present invention, the loop region may include a sequence having at least 85%, preferably 90% or more, and more preferably 95% or more homology with the polynucleotide represented by SEQ ID NO. 30.
[0054] The nucleic acid structure of the present invention is a non-viral vector for delivering a heterogeneous polynucleotide to a target cell, and may be a vector, such as a plasmid, comprising a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to the FABP5 target gene.
[0055] In particular, the nucleic acid structure of the present invention may include an expression cassette that promotes the expression of a polynucleotide encoding an RNA interference molecule. The expression cassette may include a promoter sequence operably linked to a heterogeneous gene regulatory sequence to enable the expression of a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to the heterogeneous gene FABP5 target gene, and may additionally include a regulatory element, a spacer, an intron, a UTR, and a polyadenylation sequence.
[0056] The present invention may provide a cassette capable of expressing two different types of heterogeneous polynucleotides, in which case it may be composed in the order of a promoter, a 5' miR backbone, a first polynucleotide, a 3' miR backbone, a 5' miR backbone, a second polynucleotide, a 3' miR backbone, and a polyadenylation sequence.
[0057] Accordingly, the present invention provides a multi-cystronic shRNA expression cassette that simultaneously targets FABP 5 and FABP4, comprising a) a promoter, b) a 5' miR backbone, a first polynucleotide and a 3' miR backbone, c) a 5' miR backbone, a second polynucleotide and a 3' miR backbone, and d) a polyadenylation sequence.
[0058] In the present invention, the first polynucleotide is a polynucleotide sequence encoding a first RNA interference (RNAi) molecule specific to the FABP 4 target gene, and the first RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the first polynucleotide sequence, and the first polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 1 to 5 and SEQ ID NOs 11 to 18; the second polynucleotide is a polynucleotide sequence encoding a second RNA interference (RNAi) molecule specific to the FABP 5 target gene, and the second RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the second polynucleotide sequence, and the second polynucleotide sequence may comprise one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
[0059] In the multi-cystronic shRNA expression cassette of the present invention, the 'first polynucleotide' may be a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to the FABP 4 target gene, and the 'second polynucleotide' may be a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to the FABP 5 target gene, but may also be inserted in reverse order.
[0060] The explanation regarding FABP5 described above can be applied equally to FABP4.
[0061] In preparing a multi-cystronic shRNA expression cassette that simultaneously targets FABP4 and FABP5, polynucleotides represented by SEQ ID NOs 1 to 5 and SEQ ID NOs 11 to 18 encoding RNA interference (RNAi) molecules specific to the FABP4 target gene, and polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26 encoding second RNA interference (RNAi) molecules specific to the FABP5 target gene, may be combined in all possible combinations and included in a nucleic acid structure. For example, a combination of the polynucleotide represented by SEQ ID NO. 1 and one of the polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26 may be included in the nucleic acid structure.
[0062] In a preferred embodiment of the present invention, a polynucleotide (SEQ No. 1) encoding an RNA interference (RNAi) molecule specific to the FABP 4 target gene was included as the first polynucleotide, and a polynucleotide (SEQ No. 6) encoding an RNA interference (RNAi) molecule specific to the FABP 5 target gene was included as the second polynucleotide. A vector map according to an embodiment of the present invention and its composition are shown in FIGS. 5 and FIGS. 6, respectively. FIG. 6 shows a vector sequence (Sequence No. 31) according to one embodiment of the present invention, wherein positions 22-610 correspond to a CMV promoter, positions 635-762 correspond to a 5' miR-30E, positions 763-825 correspond to a shFABP4 sequence, positions 826-955 correspond to a 3' miR-30E, positions 1033-1160 correspond to a 5' miR-30E, positions 1161-1223 correspond to a shFABP5 sequence, positions 1224-1353 correspond to a 3' miR-30E, and positions 1398-1619 correspond to an SV40 late polyadenylation sequence.
[0063] In addition, the nucleic acid structure of the present invention may include an antibiotic resistance gene and may include, for example, a nucleic acid sequence encoding a gene of resistance-resistant ampicillin R, neomycin R, kanamycin R, hygromycin R, geneticin R, blasticidin R, gentamicin R, carbenicillin R, chloramphenicol R, nurceotricin R, or furomycin R. In the vector of FIGS. 5 and 6, which is an embodiment of the present invention, a nucleic acid structure was prepared including a kanamycin resistance gene.
[0064] In the present invention, microRNA was used as the backbone of a cassette capable of expressing shRNA, and the nucleic acid structure of the present invention may include a miRNA backbone.
[0065] The miRNA backbone is comprised of: miR-138-5p,miR-145,miR-124-3p,miR-129-5p,miR-487,miR-370,miR-34a,miR-125b,miR-146a,miR-29a,miR-27a-3p,miR-24,miR-16,miR-141,miR-151 It may be one or more selected from the group consisting of miR-181a / c, miR-191, miR-194, miR-195, miR-204, miR-205, miR-214, miR-221, miR-338, miR-30, miR-31, miR-21, miR-125, miR-155, miR-206, miR-125, miR-7, miR-10b, and miR-331-3P, and preferably may be miR-30.
[0066] The present invention also provides a composition for inhibiting FABP5 comprising the nucleic acid structure; or the multi-cystronic shRNA expression cassette. The present invention also provides a composition for the simultaneous inhibition of FABP4 and FABP5 comprising the multi-cystronic shRNA expression cassette.
[0067] The nucleic acid structure of the present invention is delivered to an adipocyte, and by producing siRNA that effectively targets the miRNA of FABP5 within the cell, the expression of FABP5 expressed in the adipocyte can be effectively suppressed. When the nucleic acid structure of the present invention or the multi-cystronic shRNA expression cassette includes a polynucleotide for simultaneously targeting FABP4 and FABP5, suppression of the simultaneous expression of FABP4 and FABP5 is achieved.
[0068] In addition, the present invention provides a composition for inhibiting FABP4 comprising an siRNA sequence complementary to a polynucleotide represented by SEQ ID NOs 1 to 5 and SEQ ID NOs 11 to 18; and a composition for inhibiting FABP5 comprising an siRNA sequence complementary to a polynucleotide represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
[0069] In one embodiment of the present invention, the siRNA sequences described in Tables 3 and 7 are used as siRNA sequences complementary to the polynucleotides represented by SEQ ID NOs 1 to 5 and SEQ ID NOs 11 to 18. Accordingly, the present invention comprises: a sense RNA represented by SEQ ID NO. 32 and an antisense RNA represented by SEQ ID NO. 37; a sense RNA represented by SEQ ID NO. 33 and an antisense RNA represented by SEQ ID NO. 38; a sense RNA represented by SEQ ID NO. 34 and an antisense RNA represented by SEQ ID NO. 39; a sense RNA represented by SEQ ID NO. 35 and an antisense RNA represented by SEQ ID NO. 40; a sense RNA represented by SEQ ID NO. 36 and an antisense RNA represented by SEQ ID NO. 41; a sense RNA represented by SEQ ID NO. 52 and an antisense RNA represented by SEQ ID NO. 60; a sense RNA represented by SEQ ID NO. 53 and an antisense RNA represented by SEQ ID NO. 61; a sense RNA represented by SEQ ID NO. 54 and an antisense RNA represented by SEQ ID NO. 62; A composition for inhibiting FABP4 may be provided, comprising one or more selected from the group consisting of: sense RNA represented by SEQ ID NO. 55 and antisense RNA represented by SEQ ID NO. 63; sense RNA represented by SEQ ID NO. 56 and antisense RNA represented by SEQ ID NO. 64; sense RNA represented by SEQ ID NO. 57 and antisense RNA represented by SEQ ID NO. 65; sense RNA represented by SEQ ID NO. 58 and antisense RNA represented by SEQ ID NO. 66; and sense RNA represented by SEQ ID NO. 59 and antisense RNA represented by SEQ ID NO. 67.
[0070] In addition, in one embodiment of the present invention, the siRNA sequences described in Tables 4 and 8 are used as siRNA sequences complementary to the polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26. Accordingly, the present invention comprises a sense RNA represented by SEQ ID NO. 42 and an antisense RNA represented by SEQ ID NO. 47; a sense RNA represented by SEQ ID NO. 43 and an antisense RNA represented by SEQ ID NO. 48; a sense RNA represented by SEQ ID NO. 44 and an antisense RNA represented by SEQ ID NO. 49; a sense RNA represented by SEQ ID NO. 45 and an antisense RNA represented by SEQ ID NO. 50; a sense RNA represented by SEQ ID NO. 68 and an antisense RNA represented by SEQ ID NO. 76; a sense RNA represented by SEQ ID NO. 69 and an antisense RNA represented by SEQ ID NO. 77; a sense RNA represented by SEQ ID NO. 70 and an antisense RNA represented by SEQ ID NO. 78; a sense RNA represented by SEQ ID NO. 71 and an antisense RNA represented by SEQ ID NO. 79; A composition for inhibiting FABP5 may be provided, comprising one or more selected from the group consisting of: sense RNA represented by SEQ ID NO. 72 and antisense RNA represented by SEQ ID NO. 80; sense RNA represented by SEQ ID NO. 73 and antisense RNA represented by SEQ ID NO. 81; sense RNA represented by SEQ ID NO. 74 and antisense RNA represented by SEQ ID NO. 82; and sense RNA represented by SEQ ID NO. 75 and antisense RNA represented by SEQ ID NO. 83.
[0071] Furthermore, the present invention provides a pharmaceutical composition for the prevention or treatment of obesity or obesity-derived metabolic diseases comprising the nucleic acid structure of the present invention; or a multi-cystronic shRNA expression cassette. When the nucleic acid structure of the present invention; or the multi-cystronic shRNA expression cassette is administered to obese individuals, it exhibits excellent effects in inhibiting weight loss and lipid accumulation in the obese individuals.
[0072] In addition, the present invention provides the use of the nucleic acid structure; or the multi-cystronic shRNA expression cassette for the prevention or treatment of obesity or obesity-derived metabolic diseases; or the use of the nucleic acid structure; or the multi-cystronic shRNA expression cassette for the manufacture of a treatment for obesity or obesity-derived metabolic diseases.
[0073] The present invention also provides a method for treating obesity or obesity-derived metabolic diseases, comprising the step of administering the nucleic acid structure; or a multi-cystronic shRNA expression cassette, to an individual in need thereof.
[0074] The above-mentioned individual is preferably a mammal, including humans, and includes all patients requiring treatment for obesity or obesity-derived metabolic diseases, including patients currently undergoing treatment for obesity or obesity-derived metabolic diseases, patients who have received treatment for obesity or obesity-derived metabolic diseases, and patients who need to receive treatment for obesity or obesity-derived metabolic diseases; it may also include patients who have undergone surgical procedures for the treatment of obesity or obesity-derived metabolic diseases.
[0075] In addition, the nucleic acid structure of the present invention; or the multi-cystronic shRNA expression cassette may be processed in combination with other existing drugs or treatment methods for treating obesity or obesity-derived metabolic diseases. When the nucleic acid structure of the present invention; or the multi-cystronic shRNA expression cassette is processed in combination, it may be processed simultaneously or sequentially with other drugs or treatment methods for treating obesity or obesity-derived metabolic diseases.
[0076] The pharmaceutical composition of the present invention may further include a gene delivery vehicle to maximize the preventive or therapeutic effect of obesity or obesity-derived metabolic diseases.
[0077] The above-mentioned gene delivery vehicle may include, without limitation, a nucleic acid delivery vehicle known in the art capable of forming a complex with a nucleic acid structure, and may be one or more selected from the group consisting of cationic lipids, cationic polymers, cationic polypeptides, and cationic polysaccharides.
[0078] The above cationic lipids are cholesterol, polyethylene glycol (PEG), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-triethylammonium chloride (DOTMA), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate (DOTAP), 3β-[N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), N-decyl-N,N-dimethyldecane-1-aminium bromide (DDAB), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), 4-(dimethylamino)-butanoic acid, (6Z, 9Z, 28Z, 31Z)-hephtatiaconta 6,9,28,31-tetraene-19-yl4-(dimethylamino)butanoate (D-Lin-MC3-DMA), [4-hydroxybutyl]azandyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 3α-[N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol hydrochloride (DC-Chol), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleoyl-3-dimethylaminopropane (DLin-DAP), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-Dioleoyl-3-dimethylammonium propane (DODAP), Bis-guanidinium-spermidine-cholesterol (BGTC), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydecyl)amino)ethyl)(2-hydroxydecyl)amino)ethyl)piperazine-1-yl)ethylazandiyl)dododecane-2-ol (C12-200), Nt-butyl-N'-tetradecylamino-propionamidine (diC14-amidine), N-(1,2-dimyristyl oxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N,N-Dioleyl-N,N-Dimethylammonium Chloride (DODAC), N-(1-(2,3-Dioleyl Oxyl)propyl)-N-2-(Spermine Carboxamide)ethyl)-N,It may be one or more selected from the group consisting of N-dimethylammonium trifluoroacetate (DOSPA) and aminopropyl-dimethyl-bis(dodecyloxy)-propaneaminium bromide (GAP-DLRIE), or may be in the form of a liposome-based or lipid-based delivery vehicle such as a liposome, phytosome, ethosome, lipid nanoparticle, lipid-like nanoparticle, lipid emulsion, lipoplex, or lipid micelle.
[0079] The above cationic polymers are DEAE-dextran, poly-L-lysine (PLL), poly-L-ornithine (PLO), polyamidoamine (PAMAM), poly-(propylenimine) (PPI), polyacrylimide (PPI), polyethyleneimine (PEI), branched PEI (BPEI), linear PEI (LPEI), PDMAEMA (polymethacrylic acid N,N-dimethylaminoethyl ester), poly(β-amino ester) (PBAE), branched PBAE, linear PBAE, and poly(4-hydroxy-L-proline ester. PHP), poly[α-(4-aminobutyl)-L-glycolic acid] (PAGA), poly(δ-valerolactone, PVL), aminated PAHA (aminated poly(α-hydroxy acids)), polyphosphoester (PPE), polylactide (poly(lactic acid)) (PLA), cationic polyactides (CPLAs), polycarbonates, polycarbonates generated from carbon dioxide (CPCHC), polyurethanes (PUs), conjugated polymers (CPs), HCPE-PEI, histone, gelatin, protamine, cyclodextrin, or chitosan may beThe above polymer may be one or more selected from the group consisting of polymersomes, polymeric nanoparticles, dendrimers, nanospheres, polyplexes, and polymeric micelles.
[0080] The above cationic polypeptide is protamine, cell penetrating peptide (CPP), chimeric CPP, pH-dependent CPP, nucleoline, spermine, spermidine, poly-L-lysine (PLL), basic polypeptide, poly-arginine, transportan, MPG peptide, HIV (Human Immunodeficiency Virus)-binding peptide, trans-activating transcriptional activator (tat), HIV-1 tat (HIV), tat-derived peptide, Oligoarginine, penetratin family member, penetratin, Antennapedia-derived peptide, Drosophila Antennapedia peptide (pAntp), Islet-1 peptide (pIsl), antimicrobial-derived CPP, Buforin-2, bactenecin 7 peptide fragment 15-24 (Bac715-24), syncytin B (SynB), SynB(1), vascular endothelial cadherin-derived cell penetrating peptide (pVEC), human calcitonin (hCT)-derived peptide,Selected from the group consisting of sweet arrow peptide (SAP), model amphipathic peptide (MAP), KALA, PptG20, proline-rich peptide, loglomere, arginine-rich peptide, calcitonin-peptide, fibroblast growth factor (FGF), lactoferrin, histone, VP22 peptide, herpes simplex virus (HSV), VP22 (herpes simplex), protein transduction domain (PTD), lysine-rich peptide, Pep-1, and L-oligomer It may be Type 1 or higher.
[0081] The above cationic polysaccharide may be chitosan, glycol chitosan, or a derivative thereof.
[0082] Accordingly, for example, the gene carrier of the present invention may be one or more selected from the group consisting of chitosan, glycol chitosan, protamine, polylysine, polyarginine, polyamidoamine (PAMAM), polyethyleneimine, polypropyleneimine, dextran, hyaluronic acid, albumin, polymer polyethyleneimine (PEI), polyamine, and polyvinylamine, and the gene carrier may be in the form of a polyamidoamine (PAMAM) dendrimer, a polypropyleneimine (PPI) dendrimer, or a polylysine dendrimer.
[0083] In addition, when the gene delivery vehicle is polyarginine, the polyarginine may be R4 to R17, preferably R4 to R10, and may be used in a form combined with a target sequence that targets adipocytes. In a preferred embodiment, the polyarginine may be in the form of a peptide represented by SEQ ID NO. 29, which is a structure comprising an ATS and an R9 (arginine) peptide, wherein arginine is bound to an adipocyte targeting sequence (ATS). The adipocyte targeting sequence (ATS) may be used by substituting a known ATS sequence.
[0084] The nucleic acid structure of the present invention and the gene delivery vehicle can form a complex through electrical interaction, and the gene / delivery vehicle complex formed in this way binds more specifically to macrophages in visceral fat, which play an important role in the inflammatory response of obesity-derived metabolic syndrome, thereby significantly increasing the therapeutic effect on obesity or obesity-derived metabolic syndrome.
[0085] The nucleic acid structure and the gene delivery vehicle can form a complex in a mass ratio of 1:2 to 5, and preferably can stably form a complex in a mass ratio of 1:3.
[0086] In the present invention, obesity-derived metabolic diseases may be one or more selected from the group consisting of type 2 diabetes, hyperlipidemia, non-alcoholic fatty liver disease, arteriosclerosis, and hypertension. These diseases are diseases caused by lipid accumulation, weight gain, insulin resistance, and glucose resistance induced by obesity, and can be improved and treated by the composition of the present invention, which inhibits lipid accumulation and has the effect of reducing weight and improving insulin resistance and glucose resistance.
[0087] When the composition of the present invention is administered subcutaneously in a single dose, it is most densely distributed in the skin at the administration site, and then gradually distributed to the target organs, namely subcutaneous fat and visceral fat.
[0088] The pharmaceutical composition of the present invention may be administered together with a pharmaceutically acceptable carrier, and when administered orally, in addition to the active ingredient, it may further include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a colorant, a flavoring agent, etc. In the case of an injectable, the pharmaceutical composition of the present invention may be used by mixing a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, etc. Additionally, when administered topically, the composition of the present invention may use a base, an excipient, a lubricant, a preservative, etc.
[0089] The formulations of the composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injectables, it can be prepared in the form of a unit ampoule or a multiple dosing form. It can also be formulated into other solutions, suspensions, tablets, pills, capsules, sustained-release formulations, etc.
[0090] Meanwhile, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil. Additionally, fillers, anticoagulants, lubricants, wetting agents, fragrances, preservatives, etc. may be additionally included.
[0091] The pharmaceutical composition of the present invention may be administered orally or parenterally. The routes of administration of the pharmaceutical composition according to the present invention are not limited to these, but may be administered, for example, through the oral cavity, aerosol, buccal, skin, intradermal, inhalation, intramuscular, nasal cavity, ocular, pulmonary, intravenous, intraperitoneal, nasal cavity, ocular, oral, ear, injection, patch, subcutaneous, sublingual, topical, or transdermal route.
[0092] For such clinical administration, the pharmaceutical composition of the present invention may be formulated into a suitable formulation using known techniques. For example, for oral administration, it may be mixed with an inert diluent or an edible carrier, sealed in a hard or soft gelatin capsule, or compressed into a tablet. For oral administration, the active ingredient may be mixed with an excipient and used in the form of an ingestible tablet, buccal tablet, troche, capsule, elixir, suspension, syrup, wafer, etc. Additionally, various formulations such as for injection or parenteral administration may be manufactured according to known techniques in the relevant art or commonly used techniques.
[0093] The effective dosage of the pharmaceutical composition of the present invention varies depending on the patient's body weight, age, gender, health condition, diet, time of administration, method of administration, excretion rate, and severity of the disease, and can be easily determined by a person skilled in the art.
[0094]
[0095] The numerical values described in this specification above should be interpreted to include equivalent ranges unless otherwise specified.
[0096]
[0097] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention, and the scope of the invention is not limited by these embodiments.
[0098]
[0099] Example 1. Adipocyte Differentiation
[0100] For the evaluation of the efficacy of the present invention, 3T3-L1 cells were placed in a 6-well plate at a cell density of 2×10⁶ 5 The cells were cultured in cells / well until they reached an 80% confluent state. After reaching the confluent state, to induce adipocyte differentiation, the DMEM medium (10% FBS, 1% penicillin-streptomycin) was replaced with a differentiation induction medium containing insulin (1 μg / mL), dexamethasone (1 μM), and IBMX (0.5 mM). After treating with the induction medium for 48 hours, the medium was replaced with a maintenance medium containing insulin (1 μg / mL) and cultured for an additional 7 to 10 days, replacing the medium with fresh medium every 2 days.
[0101] Human adipose tissue-derived stem cells (hADSCs) were placed in a 6-well plate at a cell density of 2×10⁶ 5Cells were cultured in cells / well until they reached a confluent state. After reaching a confluent state, to induce adipocyte differentiation, the α-MEM medium (10% FBS, 1% penicillin-streptomycin) was replaced with a differentiation induction medium containing insulin (1 μg / mL), dexamethasone (1 μM), IBMX (0.5 mM), and rosiglitazone (1 μM). After treating with the induction medium for 48 hours, the medium was replaced with a maintenance medium containing insulin (1 μg / mL) and cultured for an additional 14 to 21 days, replacing the medium with fresh medium every 2 days.
[0102]
[0103] Example 2. Securing FABP4, FABP5 binding sequence and confirming efficacy
[0104] 2.1 Co-Binder siRNA Sequence (human, mouse) Acquisition and Optimization
[0105] To secure sequences that bind commonly to both human and mouse sequences, we screened for siRNAs present in the alignments of humans and mice that had no more than one base pair mismatch with the gene sequence in both types. The criteria applied for selecting siRNA candidates included a length of 21 bp, a GC content of 30–60%, and no more than one mismatch in coverage within the alignment. For FABP4, 12 candidates were identified, and considering factors such as codon optimization, five siRNA candidates (siFABP4-1 to siFABP4-5) were finally selected. Similarly, for FABP5, 14 candidates were identified, and applying the same criteria, five final siRNA candidates (siFABP5-1 to siFABP5-5) were selected. The finally selected siRNA candidates were optimized based on codon usage frequency and RNA structure prediction analysis to enable efficient targeting and expression inhibition effects.
[0106] Subsequently, to analyze the efficacy of inhibiting FABP4 and FABP5 expression, the siRNA candidate groups were treated to the two cell lines prepared in Example 1, respectively, and the mRNA reduction rate was measured using RT-qPCR. 1 μg of siRNA was treated after reacting with 2 μg of lipofectamine 2000 at room temperature for 20 minutes. The FABP target sequences targeted by each siRNA candidate sequence and their mRNA expression inhibitory effects in the two cell types are shown in Tables 1 and 2 and Figures 1 and 2. In addition, the siRNA sequences used to inhibit FABP4 and FABP5 expression are shown in Tables 3 and 4.
[0107]
[0108] Group FABP4 Target Sequence 3T3L1hADSC siFABP4-1TAGGTAGGAGATAACAAGTAT (Sequence No. 1) 54.23% 48.33% siFABP4-2TGTAGGAGTGGGCTTTGCCAC (Sequence No. 2) 48.55% 58.12% siFABP4-3ACCACCATAAAGAGAAAACGA (Sequence No. 3) 64.43% 72.68% siFABP4-4ACTTGTCTCCAGTGAAAACTT (Sequence No. 4) 81.66% 43.55% siFABP4-5ACCTGGAAACTTGTCTCCAGT (Sequence No. 5) 75.16% 42.58%
[0109] Group FABP5 Target Sequence 3T3L1hADSCsiFABP5-1TAGGATCATCCCTTTGGTTAA (Sequence No. 6) 52.15% 35.12%siFABP5-2TAGGAGTGTGTCATGAACAAT (Sequence No. 7) 38.54% 46.75%siFABP5-3GGCCAAGCCAGACTGTATCAT (Sequence No. 8) 55.87% 65.24%siFABP5-4TCTTGTAACCTGGGAGAGAAG (Sequence No. 9) 59.47% 66.18%siFABP5-5CCTGGGAGAGAAGTTTGATGA (Sequence No. 10) 65.31% 52.85%
[0110] GroupSense Strand (5-3)Antisense Strand (3-5)siFABP4-1TAGGTAGGAGATAACAAGTATUU(Sequence No. 32)AUACUUGUUAUCUCCUACCUAUU(Sequence No. 37)siFABP4-2TGTAGGAGTGGGCTTTGCCACUU(Sequence No. 33)GUGGCAAAGCCCACUCCUACAUU(Sequence No. 38)siFABP4-3ACCACCATAAAGAGAAAACGAUU(Sequence No. 34)UCGUUUUCUCUUUAUGGUGGUUU(Sequence No. 39)siFABP4-4ACTTGTCTCCAGTGAAAACTTUU(Sequence No. 35)AAGUUUUCACUGGAGACAAGUUU(Sequence No. 40)siFABP4-5ACCTGGAAACTTGTCTCCAGTUU(Sequence No 36)ACUGGAGACAAGUUUCCAGGUUU(Sequence No. 41)
[0111] GroupSense Strand (5-3)Antisense Strand (3-5)siFABP5-1TAGGATCATCCCTTTGGTTAAUU(Sequence No. 42)UUAACCAAAGGGAUGAUCCUAUU(Sequence No. 47)siFABP5-2TAGGAGTGTGTCATGAACAATUU(Sequence No. 43)AUUGUUCAUGACACACUCCUAUU(Sequence No. 48)siFABP5-3GGCCAAGCCAGACTGTATCATUU(Sequence No. 44)AUGAUACAGUCUGGCUUGGCCUU(Sequence No. 49)siFABP5-4TCTTGTAACCTGGGAGAGAAGUU(Sequence No. 45)CUUCUCUCCCAGGUUACAAGAUU(Sequence No. 50)siFABP5-5CCTGGGAGAGAAGTTTGATGAUU(Sequence No 46)UCAUCAAACUUCUCUCCCAGGUU(Sequence No. 51)
[0112]
[0113] As shown in Figures 1 and 2, it was confirmed that the siRNA candidates of the present invention had excellent inhibitory effects on FABP4 and FABP5 mRNA expression in both types of cells.
[0114]
[0115] 2.2 Acquisition and Optimization of Human Combined Sequences
[0116] siRNA candidates based on human sequences were screened, and optimized to expect efficient targeting and expression inhibitory effects based on codon usage frequency and RNA structure prediction analysis. For FABP4, eight siRNA candidates (siFABP4-6 to siFABP4-13) were finally selected from the candidates, considering factors such as codon optimization. Similarly, for FABP5, eight final siRNA candidates (siFABP5-6 to siFABP5-13) were selected from the candidates.
[0117] Subsequently, to analyze the efficacy of inhibiting FABP4 and FABP5 expression, the hADSCs prepared in Example 1 were treated with each siRNA candidate, and the mRNA reduction rate was measured using RT-qPCR. 1 μg of siRNA was treated after reacting with 2 μg of lipofectamine 2000 at room temperature for 20 minutes. The FABP sequences targeted by each siRNA candidate sequence and their mRNA expression inhibitory effects on hADSCs are shown in Tables 5 and 6 and Figures 3 and 4. Additionally, the siRNA sequences used to inhibit FABP4 and FABP5 expression are shown in Tables 7 and 8.
[0118] Group FABP4 target sequences hdSc siFABP4-6GGAAACTTGTCTCCAGTGAAA (Sequence No. 11)58.57 siFABP4-7GGAAAGTCAAGAGCACCATAA (Sequence No. 12)35.03 siFABP4-8GCGTCATGAAAGGCGTCACTT (Sequence No. 13)69.73 siFABP4-9GCGTCACTTCCACGAGAGTTT (Sequence No. 14)35.17 siFABP4-10GACGTTGACCTGGACTGAAGT (Sequence No. 15)35.33 siFABP4-11GAAGGTGATGTAATGATGTAT (Sequence No. 16)55.45 siFABP4-12GGTGATGTAATGATGTATTCA (Sequence No. 17)54.38 siFABP4-13GGTAGGAGATAACAAGTATGT (Sequence No. 18)41.08
[0119] Group FABP5 target sequences hdSc siFABP5-6GGCCAAGCCAGATTGTATCAT (Sequence No. 19) 46.02 siFABP5-7GATGGGAAGGAAAGCACAATA (Sequence No. 20) 65.96 siFABP5-8GGGAAGGAAAGCACAATAACA (Sequence No. 21) 44.75 siFABP5-9GGAAGGAAAGCACAATAACAA (Sequence No. 22) 58.51 siFABP5-10GGAAAGCACAATAACAAGAAA (Sequence No. 23) 61.36 siFABP5-11GTCACCTGTACTCGGATCTAT (Sequence No. 24) 59.87 siFABP5-12GAGCAAATCTCCATACTGTTT (Sequence No. 25) 44.36 siFABP5-13GCAAATCTCCATACTGTTTCT (Sequence No. 26)30.78
[0120] GroupSense Strand (5-3)Antisense Strand (3-5)siFABP4-6GGAAACTTGTCTCCAGTGAAAUU(Sequence No. 52)UUUCACUGGAGACAAGUUUCCUU(Sequence No. 60)siFABP4-7GGAAAGTCAAGAGCACCATAAUU(Sequence No. 53)UUAUGGUGCUCUUGACUUUCCUU(Sequence No. 61)siFABP4-8GCGTCATGAAAGGCGTCACTTUU(Sequence No. 54)AAGUGACGCCUUUCAUGACGCUU(Sequence No. 62)siFABP4-9GCGTCACTTCCACGAGAGTTTUU(Sequence No. 55)AAACUCUCGUGGAAGUGACGCUU(Sequence No. 63)siFABP4-10GACGTTGACCTGGACTGAAGTUU(Sequence No 56)ACUUCAGUCCAGGUCAACGUCUU(Sequence No. 64)siFABP4-11GAAGGTGATGTAATGATGTATUU(Sequence No. 57)AUACAUCAUUACAUCACCUUCUU(Sequence No. 65)siFABP4-12GGTGATGTAATGATGTATTCAUU(Sequence No. 58)UGAAUACAUCAUUACAUCACCUU(Sequence No. 66)siFABP4-13GGTAGGAGATAACAAGTATGTUU(Sequence No. 59)ACAUACUUGUUAUCUCUACCUU(Sequence No. 67)
[0121] GroupSense Strand (5-3)Antisense Strand (3-5)siFABP5-6GGCCAAGCCAGATTGTATCATUU(Sequence No. 68)AUGAUACAAUCUGGCUUGGCCUU(Sequence No. 76)siFABP5-7GATGGGAAGGAAAGCACAATAUU(Sequence No. 69)UAUUGUGCUUUCCUUCCCAUCUU(Sequence No. 77)siFABP5-8GGGAAGGAAAGCACAATAACAUU(Sequence No. 70)UGUUAUUGUGCUUUCCUUCCCUU(Sequence No. 78)siFABP5-9GGAAGGAAAGCACAATAACAAUU(Sequence No. 71)UUGUUAUUGUGCUUUCCUUCCUU(Sequence No. 79)siFABP5-10GGAAAGCACAATAACAAGAAAUU(Sequence No 72)UUUCUUGUUAUUGUGCUUUCCUU(Sequence No. 80)siFABP5-11GTCACCTGTACTCGGATCTATUU(Sequence No. 73)AUAGAUCCGAGUACAGGUGACUU(Sequence No. 81)siFABP5-12GAGCAAATCTCCATACTGTTTUU(Sequence No. 74)AAACAGUAUGGAGAUUUGCUCUU(Sequence No. 82)siFABP5-13GCAAATCTCCATACTGTTTCTUU(Sequence No. 75)AGAAACAGUAUGGAGAUUUGCUU(Sequence No. 83)
[0122]
[0123] As shown in Figures 3 and 4, it was confirmed that all siRNA candidates of the present invention can effectively inhibit FABP4 and FAPB5 in hADSC.
[0124]
[0125] Example 3. Design of shRNA targeting FABP4 and FABP5
[0126] We designed shRNAs capable of targeting FABP4 and FABP5 and inhibiting their expression, and constructed a vector. We used 'TAGTGAAGCCACAGATGTA' (Sequence No. 30) as the loop sequence and designed the shRNAs in the sense-loop-antisense sequence based on it. The designed shRNAs were inserted into the vector to enable appropriate expression. Additionally, to construct 22 bp miR30-based shRNAs, we inserted additional sequences at the 5' or 3' ends of the sense sequence based on the gene sequences of human target genes. Due to the characteristics of miR30-shRNA, a mismatch is required at the very first nucleotide of the 5' end of the 22 bp sense sequence; therefore, if the nucleotide at that position was A or T, it was changed to C, and if it was C or G, it was changed to A.
[0127] In this vector, shRNAs were designed to target the FABP4 target sequence (TAGGTAGGAGATAACAAGTAT) denoted by SEQ ID NO. 1 and the FABP5 target sequence (TAGGATCATCCCTTTGGTTAA) denoted by SEQ ID NO. 6, the inhibitory efficacy of FABP4 and FABP5 previously confirmed. In this case, a mismatch was introduced at the 5' end of the sense sequence. The sense sequence is a sequence (effector complement sequence) complementary to the antisense RNA (including the effector sequence) that is complementary to the target sequence. Through the introduction of such a mismatch, an A or C is obtained at the first position adjacent to the 5' end of the sequence identical to the target sequence. The prepared vector map is shown in Fig. 5, and the vector sequence is shown in Fig. 6.
[0128]
[0129] Example 4. Vector Validity Evaluation
[0130] A therapeutic vector (hVEC) was prepared as in Example 3, and the inhibitory effect by the vector (mVEC) described in the existing patent KR10-2016-0084631 was compared and evaluated. The mVEC is a vector prepared based on the existing commercial cassette psiRNA-DUO.
[0131] In the additional experimental group, a complex formed by mixing each vector with the gene delivery vehicle ATSR9 at a mass ratio of 1:3 for 20 minutes at room temperature was administered. The gene delivery vehicle ATSR9 is a delivery vehicle capable of targeting macrophages in visceral fat and consists of an ATS peptide sequence (CKGGRAKDC, SEQ ID NO. 27) capable of selectively targeting adipocytes and macrophages in visceral fat, and nine arginine sequences (RRRRRRRRR, R9, SEQ ID NO. 28) that facilitate the formation of an ionic complex with the vector and intracellular introduction. The monomer of the peptide delivery vehicle is 'C-KGGRAKD-RRRRRRRRR-C' (SEQ ID NO. 29).
[0132] Each experimental group was treated with 2 µg of the gene standard (total amount 4 µg) in adipocytes prepared as in Example 1. The culture medium was replaced after 4 hours, and genes and lipids were extracted after 24 and 72 hours, respectively. Specifically, mRNA was extracted using the RNeasy mini kit after 24 hours, and mRNA expression levels were compared via RT-qPCR. After 72 hours, lipids were quantitatively analyzed using Abcam’s Free Fatty Acid Assay Kit - Quantification (ab65341), Triglyceride Assay Kit - Quantification (ab65336), and Cholesterol Assay Kit - HDL & LDL / VLDL (ab65390). The results confirming changes in mRNA expression and lipid reduction following treatment with the therapeutic vector are shown in Figure 7.
[0133] As shown in Figures 7 and 8, the hVEC treatment of the present invention alone showed improved inhibition of FABP4 and FABP5 expression levels and reduction of free fatty acids (FFA) and triglycerides (TG) compared to the mVEC experimental group. In particular, in the experimental group administered with the carrier ATS9R, very significant inhibition of FABP4 and FABP5 expression levels and reduction of FFA and TG were confirmed, suggesting that they exhibit a very potent obesity treatment effect.
[0134]
[0135] Example 5. Evaluation of cytotoxicity and immunogenicity
[0136] 1 × 10⁻⁶ hADSC per well in a 96-plate 4 Cells were seeded and cultured for 24 hours at 37°C under 5% CO2 conditions. Subsequently, hVEC / ATS9R prepared in the examples, diluted to various concentrations, was treated as a sample and cultured for 24 hours. Cells without sample treatment were used as a control. After 24 hours of culture, 10 μl of CCK-8 reagent was added to each well and reacted at 37°C for 2 hours. Subsequently, absorbance was measured at 450 nm using an ELISA reader, cell viability was calculated according to each concentration, and cytotoxicity was evaluated by deriving IC50 values using software; the results are shown in Figure 9.
[0137] As shown in Figure 9, when analyzing cytotoxicity in hADSC using a CCK assay, the IC50 concentration was found to be 180 μg / ml, confirming that there is no toxicity even at very high concentrations.
[0138]
[0139] In addition, T cell differentiation was evaluated to assess immunogenicity. First, ELISA and flow cytometry analyses were performed. Jurkat T cells were plated in a 24-well plate at a rate of 1 × 10⁶ per well. 6 Cells were seeded and cultured for 48 hours at 37°C under 5% CO2 conditions. The treatment groups were treated with therapeutic genes at concentrations (1 μg, 3 μg, 9 μg) and ATS9R at a 1:3 weight ratio. After culture was complete, the cell supernatant was collected, suspended solids were removed by centrifugation, and protein concentrations in the supernatant were measured using ELISA kits for IFNγ, IL-4, and IL-17A to confirm whether the concentration increase rate of each cytokine was less than 20%. For the evaluation of T cell differentiation via flow cytometry, cultured T cells were washed with PBS, and staining was performed on Th1 (IFNγ), Th2 (IL-4), Th17 (IL-17A), and memory T cells (CD45RO, CD62L, etc.) using appropriate concentrations of fluorescently labeled antibodies at 4°C for 30 minutes. Stained cells were analyzed using a flow cytometry instrument, and the differentiation rates of Th1, Th2, Th17, and memory T cells were compared with a control group to determine if each differentiation rate was less than 20%. The results of the immunogenicity evaluation are shown in Figures 10 and 11.
[0140] As shown in Figure 10, the increase in IFNγ, IL-4, and IL-17A proteins was less than 20% as a result of evaluating T cell differentiation using ELISA, and as shown in Figure 11, it was confirmed that the differentiation rates of Th1, Th2, Th17, and memory T cells were less than 20% in the evaluation of T cell differentiation through Flow Cytometry analysis.
[0141]
[0142] Example 6. Evaluation of the efficacy of treating obesity and obesity-induced diabetes in an animal model
[0143] The efficacy of the therapeutic gene hVEC / ATS9R, whose efficacy was confirmed in Example 4, was verified in an obese animal model. mVEC / ATS9R was used as the control group. C57BL / 6J mice were purchased from Orient Bio and underwent a one-week acclimatization period. Starting from week 3, a 60% kcal High Fat Diet (HFD, Central lab Animal, inc) was fed mixed with regular feed. From week 6, only HFD was fed, and HFD was provided additionally for eight weeks. By week 20, body weight reached 45–55g, and fasting blood glucose levels were confirmed to exceed 250 mg / dl. The therapeutic gene was administered to these mice at a dose of 0.5 mg / kg (a total therapeutic dose of 2 mg / kg including 1.5 mg of ATS9) via abdominal subcutaneous injection three times a week, and administration continued for six weeks. The results of measuring body weight changes by week of administration are shown in Figure 12. In addition, the results of analyzing changes in the expression of FABP4 and FABP5 and changes in inflammatory cytokines in adipose tissue during the treatment period are shown in Figure 13.
[0144] As confirmed in Figure 12, it was confirmed that hVEC / ATS9R effectively targets adipose tissue in obese model mice and reduces body weight by decreasing the expression levels of FABP4 and FABP5.
[0145] In addition, as confirmed in Figure 13, after administering the hVEC / ATS9R of the present invention for 6 weeks in an animal model of obesity-derived type 2 diabetes, inhibition of FABP4 and FABP5 and reduction of inflammatory cytokine markers, which are biomarkers in adipose tissue, were effectively achieved.
[0146]
[0147] In addition, intraperitoneal recombinant insulin was administered after 6 weeks of administration (3 times a week) in the above obesity-derived type 2 diabetes animal model, and the decrease in blood glucose levels after 60 minutes and the processing rate after glucose administration were confirmed. The results are shown in Fig. 14.
[0148] As confirmed in Figure 14, in both the mVEC / ATS9R and hVEC / ATS9R administration groups of the present invention, blood glucose levels decreased by approximately 100 dg / ml, and it was confirmed that the processing speed after glucose administration was also effectively improved. Through the above results, it was confirmed that the administration of mVEC / ATS9R and hVEC / ATS9R can achieve an effect of improving insulin resistance and glucose resistance.
[0149] Additionally, the inhibitory effect on inflammatory mediator (cytokine) genes (TNF-α, IL-1β, IL-6, MCP-1) and lipid-reducing effect following administration of mVEC / ATS9R and hVEC / ATS9R in an obesity-derived type 2 diabetes animal model were measured and are shown in Figures 15 and 16.
[0150] As shown in Figures 15 and 16, in an obesity-derived type 2 diabetes animal model administered mVEC / ATS9R and hVEC / ATS9R, an effective reduction in blood inflammatory cytokines was confirmed, and FFA and TG were also confirmed to be effectively reduced.
Claims
1. FABP 5 (Fatty Acid-binding protein 5) is a nucleic acid construct comprising a polynucleotide sequence encoding an RNA interference (RNAi) molecule specific to a target gene, A nucleic acid structure wherein the RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the polynucleotide sequence, and the polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
2. The nucleic acid structure according to claim 1, wherein the nucleic acid structure comprises an effector complement sequence substantially complementary to the effector sequence.
3. A nucleic acid structure according to paragraph 2, wherein the nucleic acid structure comprises a loop sequence located between the effector sequence and the effector complement sequence.
4. A nucleic acid structure according to claim 1, wherein the nucleic acid structure comprises a multi-cystronic shRNA expression cassette.
5. A nucleic acid structure according to claim 1, wherein the nucleic acid structure comprises a miRNA backbone.
6. The method of item 5, wherein the miRNA backbone is miR-129-5p, miR-27a-3p, miR-92b-3p, miR-200a, miR-148, miR-370, miR-409-5p, miR-127-5p, miR-496, miR-633, miR-874, miR-132-3p, miR-128, miR-136-5p,miR-138-5p,miR-145,miR-124-3p,miR-129-5p,miR-487,miR-370,miR-34a,miR-125b,miR-146a,miR-29a,miR-27a-3p,miR-24,miR-16,miR-141 A nucleic acid construct that is one or more selected from the group consisting of miR-151, miR-181a / c, miR-191, miR-194, miR-195, miR-204, miR-205, miR-214, miR-221, miR-338, miR-30, miR-31, miR-21, miR-125, miR-155, miR-206, miR-125, miR-7, miR-10b, and miR-331-3P.
7. In paragraph 1, the nucleic acid structure is a nucleic acid structure included in a non-viral vector. 8.a) Promoter, b) 5' miR backbone, 1st polynucleotide and 3' miR backbone, c) 5' miR backbone, 2nd polynucleotide, 3' miR backbone, and d) a polyadenylation sequence; comprising a multi-cystronic shRNA expression cassette co-targeting FABP 5 and FABP4, The first polynucleotide is a polynucleotide sequence encoding a first RNA interference (RNAi) molecule specific to the FABP4 target gene, and the first RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the first polynucleotide sequence, and the first polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 1 to 5 and SEQ ID NOs 11 to 18; A multi-cystronic shRNA expression cassette for co-targeting FABP5 and FABP4, wherein the second polynucleotide is a polynucleotide sequence encoding a second RNA interference (RNAi) molecule specific to the FABP5 target gene, wherein the second RNA interference molecule comprises an effector sequence of 15 or more adjacent nucleotides substantially complementary to the second polynucleotide sequence, and the second polynucleotide sequence comprises one or more selected from the group consisting of polynucleotides represented by SEQ ID NOs 6 to 10 and SEQ ID NOs 19 to 26.
9. A composition for inhibiting FABP5 comprising a nucleic acid structure of any one of claims 1 to 7; or a multi-cystronic shRNA expression cassette of claim 8.
10. A composition for the simultaneous inhibition of FABP4 and FABP5 comprising the multi-cystronic shRNA expression cassette of claim 8.
11. A pharmaceutical composition for the prevention or treatment of obesity or obesity-derived metabolic diseases comprising a nucleic acid structure of any one of claims 1 to 7; or a multi-cystronic shRNA expression cassette of claim 8.
12. The composition of claim 11, wherein the composition further comprises a gene delivery vehicle.
13. A composition according to claim 12, wherein the gene delivery vehicle is one or more selected from the group consisting of cationic lipids, cationic polymers, cationic polypeptides, and cationic polysaccharides.
14. A composition according to claim 13, wherein the gene delivery vehicle is in the form of a peptide represented by SEQ ID NO.
29.
15. A composition according to claim 12, wherein the nucleic acid structure and the gene delivery vehicle form a complex.
16. A composition according to claim 15, wherein the nucleic acid structure and the gene delivery vehicle form a complex in a mass ratio of 1:2 to 5.
17. A composition according to claim 11, wherein the obesity-derived metabolic disease is one or more selected from the group consisting of type 2 diabetes, hyperlipidemia, non-alcoholic fatty liver disease, arteriosclerosis, and hypertension.
18. A method for treating obesity or obesity-derived metabolic diseases, comprising the step of administering a nucleic acid structure of any one of claims 1 to 7; or a multi-cystronic shRNA expression cassette of claim 8 to an individual requiring it.