Modified guide RNA for reducing off-target editing

Abstract

Modified synthetic guide RNAs which can be used to broadly reduce off-target editing while retaining on-target editing efficiency.

Description

[0001] Attorney Docket No.: 6391-0012WO01

[0002] MODIFIED GUIDE RNA FOR REDUCING OFF-TARGET EDITING SPECIFICATION

[0003] This application claims the benefit of U. S. Serial No. 63 / 735,995, filed December 19, 2024, and U. S. Serial No. 63 / 929,023, filed December 2, 2025 the entireties of which are incorporated herein by reference.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING A Sequence Listing is provided herewith as a Sequence Listing XML, “6391-0012W001” is 1,414,205 bytes in size and was created on December 12, 2025. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.

[0005] BACKGROUND

[0006] The CRISPR-Cas9 system has fundamentally transformed genetic engineering and molecular biology by enabling precise and efficient genome editing. Originally derived from a natural adaptive immune mechanism in bacteria, CRISPR-Cas9 allows researchers to make targeted modifications to the DNA of various organisms, offering unprecedented potential for applications in medicine, agriculture, and biotechnology (1). The system comprises two main components: the Cas9 nuclease, which acts as molecular scissors to cleave DNA, and the guide RNA (gRNA), which directs the Cas9 to specific DNA sequences for editing (1).

[0007] However, despite its precision, CRISPR-Cas9 is not without its challenges. One of the most significant issues is the occurrence of off-target effects (OTEs), where unintended genomic regions similar to the target sequence are also edited (2, 3). These off-target edits can lead to unwanted genetic changes that can disrupt the function of essential genes, leading to adverse effects on cellular function, viability, development of secondary diseases, or exacerbate existing conditions that pose risks in therapeutic applications.

[0008] Another significant issue affecting Cas9 is its cleavage efficiency. Several factors have been linked to editing efficiency at the intended target which include GC content, chromatin state, and gRNA structure². Depending on target application, the intended target’s design constraints may impede optimal gRNA design, which could lead to reduced activity or an increased risk of off-target effects. Therefore, enhancing the specificity of gRNAs while either maintaining or increasing editing efficiency is crucial for improving the efficacy, safety, and reliability of CRISPR-Cas based genome editing. Attorney Docket No.: 6391-0012WO01

[0009] Efforts to mitigate off-target effects primarily focus on optimizing the design and modification of the gRNA. Enhancing the specificity of gRNA without sacrificing its efficiency is crucial for improving the safety and reliability of CRISPR-Cas9-based genome editing. To mitigate off-target effects and modulate editing efficiency, researchers have developed several strategies focused on improving gRNA design and modifying the CRISPR-Cas9 system. These strategies include rationale gRNA design, chemical modifications of the gRNA, truncated gRNAs, high-fidelity Cas-nuclease variants (HiFi), and CRISPR hybrid RNA-DNA (chRDNA) gRNAs (4 -6, 8). All of these strategies have known trade-offs.

[0010] For example, gRNA design is essential to get the best editing outcome; however, it might not be possible to design a gRNA without potential off-targets while also keeping high on-target editing efficiency. This is further exacerbated when designing base editing therapeutics where disease-causing SNPs limit the design of gRNAs to specific regions. Additionally, current chemical modifications such as the 2'-O-Methyl and phosphorothioates do not broadly eliminate off-target editing.

[0011] On the other hand, high-fidelity Cas nucleases broadly reduce off-target editing but can also reduce on-target editing in a target-dependent manner. The current best strategy to mitigate off-targets while retaining on-target activity is the use of chRDNA gRNAs. The RNA: DNA chimeric nature of these gRNAs distorts the structure of the heteroduplex, slowing the Cas9 cleavage rate and promotes dissociation of the off-target substrate (8). The downside to this type of gRNA is that the number and location of the DNAs in the spacer is unique to each target.

[0012] Therefore, one would have to screen potentially hundreds to thousands of gRNA designs to optimize the on- / off-target editing ratio. The screening of hundreds to thousands of gRNAs is only tenable for therapeutic labs. Notably, none of the chRDNAs increased editing efficiency compared to RNA only gRNAs. Moreover, none of the chRDNAs were tested with gRNAs that exhibited poor on-target editing performance.

[0013] This creates the need for a more universal strategy that can broadly reduce OTEs while retaining on-target activity and improve editing performance across various metrics and editing modalities.

[0014] This disclosure provides potential modification patterns with single base modifications of the gRNA spacer region that reduce off-target editing while retaining on-target activity. Also provided are EINA locations within the gRNA spacer region that either improved on-target editing Attorney Docket No.: 6391-0012WO01

[0015] efficiency for multiple targets or showed strong reductions in off-target editing while retaining on-target activity.

[0016] All references cited herein are incorporated herein by reference in their entireties.

[0017] BRIEF SUMMARY

[0018] In exemplary embodiments the disclosure provides a synthetic guide RNA (“sgRNA”) comprising:(i) a first nucleotide sequence comprising at least one modified nucleotide, wherein the first nucleotide is partially or completely complementary to a target nucleic acid; and (ii) a second nucleic acid sequence which interacts with a CRISPR-associated protein (Cas) polypeptide, wherein the synthetic guide RNA guides the Cas polypeptide to the target nucleic acid, and wherein the synthetic guide RNA exhibits a reduced off-target editing relative to an unmodified gRNA. The disclosure provides a synthetic guide RNA wherein the sgRNA exhibits an enhanced on-target activity. The disclosure provides a synthetic guide RNA wherein at least one modified nucleotide is selected from the group consisting of unlocked nucleic acid (UNA), locked nucleic acid (LNA), 2'fluoro, C3 spacer, dSpacer, and combinations thereof. The disclosure provides a synthetic guide RNA wherein the first nucleic acid and second nucleic acid are a single nucleic acid strand. The disclosure provides a synthetic guide RNA wherein the first nucleic acid and second nucleic acid are two separate nucleic acid strands. The disclosure provides a synthetic guide RNA wherein the first nucleotide sequence is about 14-25 nucleotides in length. The disclosure provides a synthetic guide RNA wherein the at least one modified nucleotide is present at a position selected from the group consisting of nucleotide 1, nucleotide 2, nucleotide 3, nucleotide4, nucleotide 5, nucleotide 6, nucleotide 7, nucleotide 8, nucleotide 9, nucleotide 10, nucleotide 11, nucleotide 12, nucleotide 13, nucleotide 14, nucleotide 15, nucleotide 16, nucleotide 17, nucleotide 18, nucleotide 19, and nucleotide 20, wherein the nucleotides are numbered from the first nucleotide of the 5’ end of the first nucleic acid. The disclosure provides a synthetic guide RNA wherein off-target editing relative to an unmodified gRNA is reduced by at least an amount selected from the group consisting of about 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 99%. The disclosure provides a synthetic guide RNA wherein the first nucleic acid comprises a 3’ modification. The disclosure provides a synthetic guide RNA wherein the first nucleic acid comprises a 5’ modification. The disclosure provides a synthetic guide RNA wherein the at least one modified nucleotide alters base-pairing thermostability. The disclosure provides a synthetic guide RNA wherein said at least one modified nucleotide enhances base-pairing thermostability. The disclosure provides a synthetic guide RNA wherein said at least one modified Attorney Docket No.: 6391-0012WO01

[0019] nucleotide decreases base-pairing thermostability. The disclosure provides a synthetic guide RNA wherein the at least one modified nucleotide is a specificity-altering modification. The disclosure provides a synthetic guide RNA wherein the specificity-altering at least one modified nucleotide is located in the guide sequence. The disclosure provides a synthetic guide RNA wherein at least two nucleotides in the first nucleotide sequence are modified nucleotides. The disclosure provides a synthetic guide RNA wherein one or more modified nucleotides are located within five nucleotides from the 5 '-end of the first nucleotide sequence. The disclosure provides a synthetic guide RNA wherein from about 5% to about 30% of the nucleotides in the first nucleotide sequence are modified nucleotides. The disclosure provides a synthetic guide RNA wherein the at least one modified nucleotide is located within five nucleotides from the 3 '-end of the second nucleotide sequence. The disclosure provides a synthetic guide RNA wherein the modified sgRNA comprises one, two, or three consecutive or non-consecutive modified nucleotides at or near the 5 '-end of the first nucleotide sequence and one, two, or three consecutive or non-consecutive modified nucleotides at or near the 3 '-end of the second nucleotide sequence. The disclosure provides a synthetic guide RNA wherein the modified sgRNA comprises three consecutive modified nucleotides at the 5 ’-end of the first nucleotide sequence and three consecutive modified nucleotides at the 3 '-end of the second nucleotide sequence. The disclosure provides a synthetic guide RNA wherein the modified sgRNA is chemically synthesized.

[0020] The disclosure provides a set or library of RNA molecules comprising two or more synthetic guide RNAs as disclosed herein. The disclosure provides a kit comprising the synthetic guide RNA as disclosed herein. The disclosure provides an array of RNA molecules comprising two or more synthetic guide RNAs as disclosed herein.

[0021] The disclosure provides a method for reducing off-target effect in a cell, the method comprising: introducing into the cell: (a) synthetic guide RNA comprising: (i) a first nucleotide sequence comprising at least one modified nucleotide, wherein the first nucleotide sequence is partially or completely complementary to a target sequence; and (ii) a second nucleic acid sequence which interacts with a CRISPR-associated protein (Cas) polypeptide, wherein the synthetic guide RNA guides the Cas polypeptide to the target nucleic acid, and wherein the synthetic guide RNA exhibits a reduced off-target effect relative to an unmodified gRNA, (b) a Cas polypeptide, an mRNA encoding a Cas polypeptide, or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, wherein the synthetic guide RNA guides the Cas polypeptide to the target nucleic acid, and wherein the synthetic guide RNA induces a gene Attorney Docket No.: 6391-0012WO01

[0022] regulation of the target nucleic acid with an enhanced activity relative to a corresponding unmodified gRNA. The disclosure provides a method for reducing off-target effect, wherein the sgRNA exhibits an enhanced on-target activity. The disclosure provides a method for reducing off-target effect in a cell wherein the at least one modified nucleotide is selected from the group consisting of unlocked nucleic acid (UNA), locked nucleic acid (LNA), 2'fluoro, C3 spacer, dSpacer, and combinations thereof. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the first nucleic acid and second nucleic acid are a single nucleic acid strand. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the first nucleic acid and second nucleic acid are two separate nucleic acid strands. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the first nucleotide sequence is about 20 nucleotides in length. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the at least one modified nucleotide is present at a position selected from the group consisting of nucleotide 1, nucleotide 2, nucleotide 3, nucleotide4, nucleotide 5, nucleotide 6, nucleotide 7, nucleotide 8, nucleotide 9, nucleotide 10, nucleotide 11, nucleotide 12, nucleotide 13, nucleotide 14, nucleotide 15, nucleotide 16, nucleotide 17, nucleotide 18, nucleotide 19, and nucleotide 20, wherein the nucleotides are numbered from the first nucleotide of the 5’ end of the first nucleic acid. The disclosure provides a method for reducing off-target effect in a cell wherein the off-target effect of the synthetic guide RNA relative to an unmodified gRNA is reduced by at least an amount selected from the group consisting of 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 99%. The disclosure provides a method for reducing off-target effect in a cell wherein the first nucleic acid comprises a 3’ modification. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the first nucleic acid comprises a 5’ modification. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the at least one modified nucleotide alters base-pairing thermostability. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein said at least one modified nucleotide enhances base-pairing thermostability. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein said at least one modified nucleotide decreases base-pairing thermostability. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the at least one modified nucleotide is a specificity-altering modification. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the specificity-altering at least Attorney Docket No.: 6391-0012WO01

[0023] one modified nucleotide is located in the guide sequence. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein at least two nucleotides in the first nucleotide sequence are modified nucleotides. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein one or more modified nucleotides are located within five nucleotides from the 5 '-end of the first nucleotide sequence. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein from about 5% to about 30% of the nucleotides in the first nucleotide sequence are modified nucleotides. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the at least one modified nucleotide is located within five nucleotides from the 3 ’-end of the second nucleotide sequence. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA comprises one, two, or three consecutive or non-consecutive modified nucleotides at or near the 5 '-end of the first nucleotide sequence and one, two, or three consecutive or non-consecutive modified nucleotides at or near the 3 '-end of the second nucleotide sequence. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA comprises three consecutive modified nucleotides at the 5 '-end of the first nucleotide sequence and three consecutive modified nucleotides at the 3 '-end of the second nucleotide sequence. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA is chemically synthesized. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the target nucleic acid comprises a target DNA or a target RNA. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the gene regulation comprises genome editing of the target DNA. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the genome editing comprises homologous-directed repair (HDR) or nonhomologous end joining (NHEJ) of the target DNA. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell further comprising introducing a recombinant donor repair template into the cell. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA in (a) and the Cas polypeptide in (b) are introduced into the cell in a ribonucleoprotein (RNP) complex. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the gene regulation induced by the introduction of (a) and (b) is stable in the cell for at least 24 hours. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA Attorney Docket No.: 6391-0012WO01

[0024] in (a) and the Cas polypeptide in (b) are introduced into the cell in a lipofection reagent. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA in (a) and the Cas polypeptide in (b) are introduced into the cell via exosomes. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA in (a) and the Cas polypeptide in (b) are introduced into the cell via lipid nanoparticles. The disclosure provides a method for inducing gene regulation of a target nucleic acid in a cell wherein the modified sgRNA in (a) and the Cas polypeptide in (b) are introduced into the cell via viral vector.

[0025] BRIEF DESCRIPTION OF SEVERAL VIEWS OF THE DRAWINGS

[0026] The invention will be described in conjunction with the following drawings in which like reference numerals designate like elements and wherein:

[0027] Figure 1 is a chart showing the chemical structures of nucleic acid modifications.

[0028] Figure 2 (SEQ ID Nos: 335-338) is a chart showing Single UNA modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for EMX1. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. The top three edited off-targets are shown with mismatches relative to the on-target underlined, all other off-targets exhibited the same reduction in editing as the top three OTE sites.

[0029] Figure 3A (SEQ ID Nos: 339-342) Single UNA modifications within the gRNA spacer reduce editing of off-targets for multiple targets. On- and off- target editing as determined by RHAMPSEQ NGS for AR. Low to high indel formation is indicated by a white to black heat map. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0030] Figure 3B (SEQ ID Nos: 343-346) Single UNA modifications within the gRNA spacer reduce editing of off-targets for multiple targets. On- and off- target editing as determined by RHAMPSEQ NGS for LAG3. Low to high indel formation is indicated by a white to black heat map. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA. Attorney Docket No.: 6391-0012WO01

[0031] Figure 4A (SEQ ID Nos: 335-338) Single UNA modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined by RHAMPSEQ NGS for EMX1. Low to high indel formation is indicated by a white to black heat map. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0032] Figure 4B (SEQ ID Nos: 339-342) Single UNA modifications within the gRNA spacer reduce editing of off-targets when delivered by WT Cas9 RNP. On- and off- target editing as determined by RHAMPSEQ NGS for AR. Low to high indel formation is indicated by a white to black heat map. AR had no off-target editing above 0.5%, only the first five OTEs are shown. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0033] Figure 4C (SEQ ID Nos: 343-346) Single UNA modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined by RHAMPSEQ NGS for LAG3. Low to high indel formation is indicated by a white to black heat map. Only OTEs with editing above 1% are shown for LAG3. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0034] Figure 5A (SEQ ID Nos: 335-338) Single LNA modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for LNA with EMX1. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0035] Figure 5B (SEQ ID Nos: 335-338) Single 2'Fluoro modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for 2'fluoro with EMX1. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA. Attorney Docket No.: 6391-0012WO01

[0036] Figure 5C (SEQ ID Nos: 339-342) Single LNA modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for LNA with AR. Low to high indel formation is indicated by a white to black heat map.. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA

[0037] Figure 5D (SEQ ID Nos: 339-342) Single 2'Fluoro modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for 2'Fluoro with AR. Low to high indel formation is indicated by a white to black heat map.. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0038] Figure 5E (SEQ ID Nos: 343-346) Single LNA modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for LNA with LAG3. Low to high indel formation is indicated by a white to black heat map. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0039] Figure 5F (SEQ ID Nos: 343-346) Single 2'Fluoro modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for 2'Fluoro with LAG3. Low to high indel formation is indicated by a white to black heat map The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0040] Figure 6A (SEQ ID Nos: 335-338) Single LNA modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined by RHAMPSEQ NGS for LNA with EMX1. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0041] Figure 6B (SEQ ID Nos: 335-338) Single 2'Fluoro modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined Attorney Docket No.: 6391-0012WO01

[0042] by RHAMPSEQ NGS for 2'Fluoro with EMX1. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0043] Figure 6C (SEQ ID Nos: 339-342) Single LNA modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined by RHAMPSEQ NGS for LNA with AR. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. AR had no off-target editing above 0.5%, only the first five OTEs are shown. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0044] Figure 6D (SEQ ID Nos: 339-342) Single 2'Fluoro modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined by RHAMPSEQ NGS for 2'Fluoro with AR. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. AR had no off-target editing above 0.5%, only the first five OTEs are shown. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0045] Figure 6E (SEQ ID Nos: 343-346) Single LNA modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined by RHAMPSEQ NGS for LNA with LAG3. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. Only OTEs with editing above 1% are shown for LAG3. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0046] Figure 6F (SEQ ID Nos: 343-346) Single 2'Fluoro modifications within the gRNA spacer reduce editing of off-targets when delivered by RNP. On- and off- target editing as determined by RHAMPSEQ NGS for 2'Fluoro with LAG3. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. Only OTEs with editing above 1% are shown for LAG3. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA. Attorney Docket No.: 6391-0012WO01

[0047] Figure 7A (SEQ ID Nos: 335-338) Single C3 spacer modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for C3 spacer with EMX1. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0048] Figure 7B (SEQ ID Nos: 335-338) Single dSpacer modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for dSpacer with EMX1. Low to high indel formation is indicated by a white to black heat map. Individual values for indel formation are indicated in each cell. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0049] Figure 7C (SEQ ID Nos: 339-342) Single C3 spacer modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for C3 spacer with AR. Low to high indel formation is indicated by a white to black heat map. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0050] Figure 7D (SEQ ID Nos: 339-342) Single dSpacer modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for dSpacer with AR. Low to high indel formation is indicated by a white to black heat map.. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0051] Figure 7E (SEQ ID Nos: 343-346) Single C3 spacer modifications within the gRNA spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for C3 spacer with LAG3. Low to high indel formation is indicated by a white to black heat map. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0052] Figure 7F (SEQ ID Nos: 343-346) Single dSpacer modifications within the gRNA Attorney Docket No.: 6391-0012WO01

[0053] spacer reduce editing of off-targets. On- and off- target editing as determined by RHAMPSEQ NGS for dSpacer with LAG3. Low to high indel formation is indicated by a white to black heat map. The top three edited off-targets are shown with mismatches relative to the on-target underlined for each gRNA.

[0054] Figure 8A (SEQ ID Nos: 335-337) are charts showing a single UNA modification at spacer position 18 reduces off-target editing similar to HiFi-Cas9 in various cell types and nuclease delivery formats; RNP dose titration in K562s with EMX1.

[0055] Figure 8B (SEQ ID Nos: 335-337) are charts showing a single UNA modification at spacer position 18 reduces off-target editing similar to HiFi-Cas9 in various cell types and nuclease delivery formats; RNP dose titration in iPSCs with EMX1

[0056] Figure 8C (SEQ ID Nos: 347-349) are charts showing a single UNA modification at spacer position 18 reduces off-target editing similar to HiFi-Cas9 in various cell types and nuclease delivery formats; RNP dose titration in iPSCs with AAVS1

[0057] Figure 8D are charts showing a single UNA modification at spacer position 18 reduces off-target editing similar to HiFi-Cas9 in various cell types and nuclease delivery formats; Editing with EMX1 and AAVS1 in iPSCs with delivery of Cas-nuclease via mRNA. On- and off- target editing as determined by RHAMPSEQ NGS for EMX1 and AAVS1. The top two edited off-target targets are shown with mismatches underlined relative to the on-target. All other off-targets had < 1% indel. Data is representative of three biological replicates.

[0058] Figure 9 is a chart showing single UNA modifications within the gRNA spacer increase on-target editing efficiency. On-target editing as determined by RHAMPSEQ NGS.

[0059] Figure 10A is a chart showing Single UNA modifications within the gRNA spacer increase on-target editing efficiency with stable-Cas9 genomic expression.

[0060] Figure 10B is a chart showing single UNA modifications within the gRNA spacer increase on-target editing efficiency RNP Cas9 delivery. On-target editing as determined by Attorney Docket No.: 6391-0012WO01

[0061] RHAMPSEQ NGS.

[0062] Figure 11 is a chart showing UNCOVERseq gRNA editing specificity scores.

[0063] Specificity Score=(On-target UMI Reads) / (On and off target UMI Reads).

[0064] Figure 12A is a chart showing placement of a single UNA within the gRNA spacer modulates CRISPR-Cas editing efficiency. Editing for UNA placement in each spacer location for all sixteen targets (Table 8; SEQ ID NO: 352 to SEQ ID NO: 367) is normalized to the editing of the RNA only spacer region crRNAs for the on-target site and the top edited off-target site with stable Cas9 expression. Data is represented as the median ± 95% CI.

[0065] Figure 12B is a chart showing placement of a single UNA within the gRNA spacer modulates CRISPR-Cas editing efficiency. Editing for UNA placement in each spacer location for all sixteen targets (Table 8; SEQ ID NO: 352 to SEQ ID NO: 367) is normalized to the editing of the RNA only spacer region crRNAs for the on-target site and the top edited off-target site with RNP. Data is represented as the median ± 95% CI.

[0066] Figure 13A is a chart showing optimally placed UNA modified gRNAs increase editing specificity. A) Comparison of editing frequencies between ALT-R crRNAs and UNA modified crRNAs. On-target sites are solid black points; off-targets are grey points.

[0067] Figure 13B is a chart showing Tukey box plot showing fold change of all on-targets and off-targets between UNA modified crRNAs and ALT-R crRNAs. Results are from editing rates from on- and off-target sites for each gRNA. UNA modified gRNAs used in comparisons are as follows: SEQ ID NO: 372, SEQ ID NO: 392, SEQ ID NO: 401, SEQ ID NO: 418, SEQ ID NO: 440, SEQ ID NO: 462, SEQ ID NO: 484, SEQ ID NO: 496, SEQ ID NO: 517, SEQ ID NO: 539, SEQ ID NO: 560, SEQ ID NO: 576, SEQ ID NO: 602, SEQ ID NO: 614, SEQ ID NO: 624, SEQ ID NO: 634. Statistical significance was determined using Mann-Whitney test. B) ****P < 0.0001.

[0068] Figure 14A and Figure 14B. UNA modifications within the gRNA spacer improve editing specificity with sgRNAs. On / off-target editing as determined by RHAMPSEQ NGS. Attorney Docket No.: 6391-0012WO01

[0069] EMX1 ALT-R sgRNA: SEQ_ID_644, EMX1 UNA modified sgRNA: SEQ_ID_646, AAVS1 ALT-R sgRNA: SEQ_ID_645, AAVS1 UNA modified sgRNA: SEQ_ID_647. EMX1 On-target: SEQ_ID_335, OTE1: SEQ_ID_336, OTE2: SEQ_ID_337. AAVS1 On-target:

[0070] SEQ_ID_347, OTE1: SEQ_ID_348, OTE2: SEQ_ID_349.

[0071] Figure 15.(SEQ ID NO: 648) Labeling scheme for placement of nucleic acid modifications. Cas9 target site example, EMX1, where the gRNA spacer region is underlined and numbered from 1-20 starting at the PAM adjacent base. The PAM is indicated by bold letters.

[0072] DETAILED DESCRIPTION

[0073] The current disclosure provides novel designs of modified synthetic guide RNAs (sgRNAs”) for CRISPR systems, which have reduced off-target editing, relative to conventional gRNAs, while retaining on-target editing efficiency. Utilizing the same working mechanism of heteroduplex distortion to decrease off-target editing, a list of five nucleic acid modifications with different structural properties was generated as potential gRNA spacer modifications candidates: unlocked nucleic acid (UNA), locked nucleic acid (LNA), 2'fluoro, C3 spacer, and dSpacer (See Figure 1). UNAs are acyclic RNA mimics that have a highly flexible structure due to the missing bond between C2' and C3' atoms of the ribose ring (9). UNAs, depending on their position in the duplex, can either increase or decrease mismatch discrimination against RNA / DNA target strands while simultaneously decreasing the thermodynamic stability of the duplex (9). These properties make it the ideal test modification for gRNA duplex distortion to reduce off-target editing. Contrastingly, LNAs are in many ways the polar opposites of UNAs. LNAs contain a methylene bridge that connects the 2'-oxygen of ribose with the 4'-carbon (10). This bridge results in a locked confirmation, reducing the conformational flexibility of the ribose and increases the local organization of the phosphate backbone (10). Furthermore, LNAs have an increased affinity for complementary RNA / DNA making the modification ideal for testing comparisons with UNAs. In addition to UNAs and LNAs, the 2'fluoro has been studied for therapeutic applications due to its unique properties of small size and high electronegativity. 2'fluoro nucleotides replace the 2'-hydrooxyl group in a RNA monomer with a fluorine molecule and have increased binding affinity and nuclease resistance while retaining similar structural properties to standard RNA bases meaning it may have a subtler effect on duplex distortion (11). Lastly, abasic modifications such as the C3 spacer and dSpacer offer two different chemical structures (flexible - C3 spacer, Attorney Docket No.: 6391-0012WO01

[0074] standard deoxyribose sugar phosphate backbone - dSpacer) while also providing a universal mismatch with no nucleotide base being present. The disclosure provides a list of potential modification patterns with, for example, single base modifications of the gRNA spacer region that reduces off-target editing while retaining on-target activity.

[0075] The modified sgRNAs as disclosed herein can be used to broadly reduce off-target editing while retaining on-target editing efficiency with, for example, a WT-Cas9 enzyme. This may satisfy known gaps in editing efficiencies of HiFi Cas nuclease systems where the HiFi enzyme reduces both on / off-target editing. Furthermore, the screening required to optimize placement of individual gRNA spacer modifications to enhance the on / off-target editing ratio is dramatically lower than what is required for optimization of chRDNAs. These results open the door for these modified sgRNAs to be used in a wider context compared to chRDNAs, including, for example, phenotypic screens, cell line engineering, therapeutic development, etc.

[0076] The modified sgRNAs as disclosed herein have the advantage of increasing WT Cas9 gRNA specificity while retaining on-target cleavage efficiency with the use of a single modified base in the gRNA spacer region. The modified sgRNAs as disclosed herein have the further advantage of decreasing the amount of gRNA screening necessary to find top performing gRNA, i.e., gRNAs with high on-target / low off-target activity.

[0077] The term “nucleic acid” refers to a nucleotide polymer, and unless otherwise limited, includes analogs of natural nucleotides that can function in a similar manner (e.g., hybridize) to naturally occurring nucleotides. The term “nucleic acid” encompasses multi-stranded, as well as single-stranded molecules. In double- or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid templates described herein may be any size depending on the sample (from small cell-free DNA fragments to entire genomes), including but not limited to 50-300 bases, 100-2000 bases, 100-750 bases, 170-500 bases, 100-5000 bases, 50-10,000 bases, or 50-2000 bases in length. In some instances, templates are at least 50, 100, 200, 500, 1000, 2000, 5000, 10,000, 20,000 50,000, 100,000, 200,000, 500,000, 1,000,000 or more than 1,000,000 bases in length. Methods described herein provide for the amplification of nucleic acids, such as nucleic acid templates. Methods described herein additionally provide for the generation of isolated and at least partially purified nucleic acids and libraries of nucleic acids. Nucleic acids include but are not limited to those comprising DNA, RNA, circular RNA, cfDNA (cell free DNA), cfRNA (cell free RNA), siRNA (small interfering RNA), cffDNA (cell free fetal Attorney Docket No.: 6391-0012WO01

[0078] DNA), mRNA, tRNA, rRNA, miRNA (microRNA), synthetic polynucleotides, polynucleotide analogues, any other nucleic acid consistent with the specification, or any combinations thereof. The length of polynucleotides, when provided, are described as the number of bases and abbreviated, such as nt (nucleotides), bp (bases), kb (kilobases), or Gb (gigabases).

[0079] The term nucleic acid includes any form of DNA or RNA, including, for example, genomic DNA; complementary DNA (cDNA), which is a DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification; DNA molecules produced synthetically or by amplification; mRNA; and non-coding RNA.

[0080] The term nucleic acid encompasses double- or triple-stranded nucleic acid complexes, as well as single-stranded molecules. In double- or triple-stranded nucleic acid complexes, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands).

[0081] The term nucleic acid also encompasses any modifications thereof, such as by methylation and / or by capping. Nucleic acid modifications can include addition of chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and functionality to the individual nucleic acid bases or to the nucleic acid as a whole. Such modifications may include base modifications such as 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, substitutions of 5 -bromo-uracil, sugar-phosphate backbone modifications, unusual base pairing combinations such as the isobases isocytidine and isoguanidine, and the like. More particularly, in some embodiments, nucleic acids, can include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other type of nucleic acid that is an N- or C-glycoside of a purine or pyrimidine base, as well as other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino polymers (see, e.g., Summerton and Weller (1997) “Morpholino Antisense Oligomers: Design, Preparation, and Properties,” Antisense & Nucleic Acid Drug Dev.

[0082] 7:1817-195; Okamoto et al. (20020) “Development of electrochemically gene-analyzing method using DNA-modified electrodes,” Nucleic Acids Res. Supplement No. 2:171-172), and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. The term nucleic acid also encompasses locked nucleic acids (LNAs). Attorney Docket No.: 6391-0012WO01

[0083] The nucleic acid(s) can be derived from a completely chemical synthesis process, such as a solid phase-mediated chemical synthesis, from a biological source, such as through isolation from any species that produces nucleic acid, or from processes that involve the manipulation of nucleic acids by molecular biology tools, such as DNA replication, PCR amplification, reverse transcription, or from a combination of those processes.

[0084] As used herein, the term “complementary” refers to the capacity for precise pairing between two nucleotides, i.e., if a nucleotide at a given position of a nucleic acid is capable of hydrogen bonding with a nucleotide of another nucleic acid to form a canonical base pair, then the two nucleic acids are considered to be complementary to one another at that position. Complementarity between two single-stranded nucleic acid molecules may be “partial,” in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single-stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.

[0085] The term “oligonucleotide” is used to refer to a nucleic acid that is relatively short, generally shorter than 200 nucleotides, more particularly, shorter than 100 nucleotides, most particularly, shorter than 50 nucleotides. Typically, oligonucleotides are single-stranded DNA molecules. The term “oligonucleotide,” as used herein, refer to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and to any other type of polynucleotide which is an N glycoside of a purine or pyrimidine base (a single nucleotide is also referred to as a “base” or “residue”). There is no intended distinction in length between the terms “nucleic acid”, “oligonucleotide” and “polynucleotide”, and these terms can be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single- stranded RNA. For use in the present invention, an oligonucleotide also can comprise nucleotide analogs in which the base, sugar or phosphate backbone is modified as well as non-purine or non-pyrimidine nucleotide analogs. An oligonucleotide may comprise ribonucleotides, deoxyribonucleotides, modified nucleotides (e.g., nucleotides with 2' modifications, synthetic base analogs, etc.) or combinations thereof.

[0086] The term “ribonucleotide” encompasses natural and synthetic, unmodified and modified ribonucleotides. Modifications include changes to the sugar moiety, to the base moiety and / or to the linkages between ribonucleotides in the oligonucleotide. Attorney Docket No.: 6391-0012WO01

[0087] The term “polypeptide” refers to any linear or branched peptide comprising more than one amino acid. Polypeptide includes protein or fragment thereof or fusion thereof, provided such protein, fragment or fusion retains a useful biochemical or biological activity.

[0088] Next Generation Sequencing (NGS) allows rapid and high-throughput sequencing of DNA and RNA. Unlike earlier methods such as Sanger sequencing, which sequences one DNA fragment at a time, NGS enables the simultaneous sequencing of millions of DNA fragments, making it much faster, cheaper, and more efficient. In NGS, a DNA or RNA from the sample is extracted and fragmented into smaller pieces. These fragments are then attached to short synthetic DNA sequences called adapters, which are needed for binding to the sequencing platform. The DNA fragments with adapters are amplified (copied many times) to create a "library" of DNA fragments. This increases the amount of DNA available for sequencing. Most NGS platforms, like Illumina, use a method called "sequencing by synthesis." Each fragment is attached to a solid surface and copied in place. Fluorescently-labeled nucleotides (A, T, C, and G) are added one by one. As they bind to the complementary strand, the machine detects the fluorescent signal, allowing the sequence of bases to be read. The massive amount of sequencing data is analyzed using bioinformatics tools. The overlapping DNA fragments are assembled back into their original sequence by aligning them to a reference genome or constructing new genomes (de novo sequencing). NGS allows for High Throughput, since millions to billions of DNA fragments can be sequenced in parallel, producing vast amounts of data, is cost-effective, and can sequence entire genomes or large sets of genes in days, making it much faster than older sequencing methods.

[0089] When a group of substituents is disclosed herein, it is understood that all individual members of those groups and all subgroups and classes that can be formed using the substituents are disclosed separately. When a Markush group or other grouping is used herein, all individual members of the group and all combinations and subcombinations possible of the group are intended to be individually included in the disclosure. As used herein, “and / or” means that one, all, or any combination of items in a list separated by “and / or” are included in the list; for example, “1, 2 and / or 3” is equivalent to “1, 2, 3, 1 and 2, 1 and 3, 2 and 3, or 1, 2, and 3”.

[0090] As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of’ excludes any element, step, or ingredient not specified in the claim element. As used herein, “consisting essentially of’ does not Attorney Docket No.: 6391-0012WO01

[0091] exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term “comprising”, particularly in a description of components of a composition, in a description of a method, or in a description of elements of a device, is understood to encompass those compositions, methods, or devices consisting essentially of and consisting of the recited components or elements, optionally in addition to other components or elements. The disclosure as illustratively described herein suitably may be practiced in the absence of any element, elements, limitation, or limitations which is not specifically disclosed herein.

[0092] As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a method” includes a plurality of such methods and reference to “the nanoparticle” includes reference to one or more nanoparticles and equivalents thereof known to those skilled in the art, and so forth. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope as disclosed herein claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.

[0093] As used herein, the term "about" when used in conjunction with a stated numerical value or range has the meaning reasonably ascribed to it by a person skilled in the art, i.e., denoting somewhat more or somewhat less than the stated value or range.

[0094] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, the term "patient" refers to an animal, preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey and human), and most preferably a human. In some embodiments, the subject is a non-human animal such as a farm animal (e.g., a horse, pig, or cow) or a pet (e.g., a dog or cat). In a specific embodiment, the subject is an elderly human. In another embodiment, the subject is a human adult. In another embodiment, the subject is a human child. In yet another embodiment, the subject is a human infant.

[0095] CRISPR-associated (Cas) proteins useful in certain embodiments as disclosed herein may include: Cas9: The most well-known CRISPR protein, primarily from Streptococcus pyogenes Attorney Docket No.: 6391-0012WO01

[0096] (SpCas9), which cuts double-stranded DNA with high precision using a single-guide RNA (sgRNA); SaCas9 (Staphylococcus aureus) — smaller than SpCas9, useful for viral delivery; NmCas9 (Neisseria meningitidis) — recognizes a different protospacer adjacent motif (PAM) and offers alternative targeting sites; StlCas9 (Streptococcus thermophilus) — used for organisms with specific PAM requirements; Cas9 Nickase Variants (Cas9n); Cas9 modified to create singlestrand cuts (nicks) instead of double-strand breaks; HiFi Cas9 was developed as an alternative to Cas9 to create an enzyme that maintained potent on-target editing activity but had reduced off-target editing activity; Dead Cas9 (dCas9), A catalytically inactive form of Cas9. Used for gene regulation and visualization, as it can bind to DNA without cutting it; Casl2 (Cpfl), Alternative to Cas9, derived from Francisella novicida (FnCpfl) and Acidaminococcus (AsCpfl), Creates staggered (sticky) ends rather than blunt ends; Casl2a — recognizes a T-rich PAM, useful for AT -rich genomes; Casl2b — smaller Casl2 variant, suitable for viral delivery systems; Casl2f (Cpfl Mini), a Smaller variant useful for gene-editing applications with size constraints; AsCasl2a Ultra is an enhanced variant of the original AsCasl2a, a CRISPR-associated protein from the Cast 2a family (formerly known as Cpfl) derived from Acidaminococcus species; MAD7 is a CRISPR-associated protein that belongs to the Cast 2 family (a Type V CRISPR system). Developed by the company Inscripta; Casl3, Targets RNA instead of DNA, useful for RNA interference and detection; Cast 3a (formerly C2c2) — cleaves RNA and has been used in diagnostics; Cast 3b — different RNA cleavage specificity and applications in gene silencing; Casl3d — smaller version of Casl3, enabling delivery via compact vectors; Cas3, Known for its processive degradation of DNA; Csfl, Type III (RNA-Targ eting): Csm and Cmr Complexes, Type III CRISPR systems target RNA with Csm and Cmr protein complexes, Useful for viral RNA degradation in bacterial immunity.

[0097] CRISPR guide RNA (gRNA) directs the Cas9 enzyme to a specific location in the genome where it needs to make a cut. The gRNA is designed to match a target DNA sequence, ensuring the CRISPR-Cas9 system edits only the intended site. The guide RNA is made up of two main parts: CRISPR RNA (crRNA) which is a sequence of about 20 nucleotides that is complementary to the target DNA sequence. Its primary function is to guide the Cas9 protein to the exact location in the genome where the DNA cut should be made; and Trans-activating CRISPR RNA (tracrRNA) which aids in forming a stable complex with the Cas9 enzyme. It’s necessary for the activation of the Cas9 protein, enabling it to perform its function as molecular scissors. Attorney Docket No.: 6391-0012WO01

[0098] A CRISPR eukaryotic expression cassette typically consists of several elements that together allow the CRISPR system to function efficiently within eukaryotic cells. These elements include the necessary components for gene editing, such as the Cas protein (usually Cas9) and the guide RNA (gRNA), such as the sgRNA as disclosed herein, system. In certain embodiments as disclosed herein, additional components for a eukaryotic CRISPR expression cassette may include a promoter for Cas Protein Expression, such as CMV (Cytomegalovirus) promoter, EFla (Elongation factor- la) promoter, Ubiquitin C (UbC) promoter, or Tissue-specific promoters for targeted Cas9 expression, e.g., neuron-specific promoters like Synapsin (Syn) or liver-specific like Albumin promoter. In certain embodiments as disclosed herein, additional components for a eukaryotic CRISPR expression cassette may include Cas Protein Coding Sequence, such as HiFi Cas, or SpCas9, Cpfl / Casl2a, SaCas9, or other Cas9 variants. In certain embodiments as disclosed herein, additional components for a eukaryotic CRISPR expression cassette may include Nuclear Localization Signal (NLS) to ensure proper transport of the Cas9 protein into the nucleus of the eukaryotic cell. In certain embodiments as disclosed herein, additional components for a eukaryotic CRISPR expression cassette may include a Promoter for gRNA Expression, such as a U6 promoter, an Hl promoter, or a Tissue-specific Pol II promoters. In certain embodiments as disclosed herein, additional components for a eukaryotic CRISPR expression cassette may include a Guide RNA (gRNA) Expression Unit, such as gRNA scaffold, or Multiplexing gRNAs. In certain embodiments as disclosed herein, additional components for a eukaryotic CRISPR expression cassette may include a Polyadenylation Signal (pA), or a Selectable Marker such as Antibiotic resistance genes, or Fluorescent markers. In certain embodiments as disclosed herein the expression cassette may include Viral Vector Elements, such as Lentiviral vectors, AAV (Adeno-associated virus) vectors, or Self-inactivating (SIN) elements. In certain embodiments as disclosed herein the expression cassette may include Inducible Systems, such as Tet-On / Tet-Off systems or CRISPRa / i systems, or Insulator Sequences such as cHS4 insulators.

[0099] A Cas NLS (Nuclear Localization Signal) is a short peptide sequence that is added to CRISPR-associated (Cas) proteins, like Cas9, to help them enter the nucleus of a eukaryotic cell. Since gene-editing processes like CRISPR-Cas9 target DNA, which is located in the cell’s nucleus, it's essential that Cas proteins efficiently reach this compartment. The Nuclear Localization Signal (NLS) is a specific sequence of amino acids that is recognized by the cell's transport machinery. This sequence acts like a "tag" that signals the cell to transport the Cas protein into the nucleus. The NLS binds to nuclear import proteins, which then facilitate the Attorney Docket No.: 6391-0012WO01

[0100] passage of the Cas protein through nuclear pores, channels that regulate movement between the cytoplasm and the nucleus. By attaching an NLS to Cas proteins, scientists ensure that these proteins reach the nucleus quickly and efficiently, enabling precise and effective gene editing within the target DNA.

[0101] There are several effective strategies for introducing the sgRNAs and / or CRISPR components (like plasmids, ribonucleoprotein complexes, or mRNA) as disclosed herein as disclosed herein into target cells. Exemplary embodiments as disclosed herein include Viral Vectors, such as Adeno-Associated Virus (AAV) which are widely used for CRISPR delivery because they are generally safe, induce minimal immune response, and have been approved in some gene therapy applications. However, their small packaging capacity (around 4.7 kb) limits the size of CRISPR systems they can carry, so they work best for smaller Cas proteins (like Cas9 variants or Casl2a); Lentivirus and Retrovirus: Lentiviral vectors have a larger capacity than AAV and can integrate the CRISPR components into the host genome, allowing for stable, longterm expression. However, this integration can cause insertional mutagenesis; Adenovirus: Adenovirus vectors can carry larger payloads, including the standard SpCas9 and multiple gRNAs. They are non-integrating, but they can induce stronger immune responses, which may limit their use in some settings.

[0102] Additional methods for introducing the sgRNAs and / or CRISPR proteins as disclosed herein into target cells includes, for example, Lipid Nanoparticles (LNPs) which are commonly used for delivering RNA-based therapies, including mRNA for Cas proteins and gRNA complexes. They are a non-viral delivery method that is scalable and relatively low-risk, with minimal immune response and no genomic integration. LNPs are currently used in clinical applications and are effective for delivery in vivo, especially in the liver and other tissues with good blood flow; Electroporation, which involves applying an electrical field to create temporary pores in the cell membrane, allowing the sgRNAs and / or CRISPR components (like plasmids, ribonucleoprotein complexes, or mRNA) as disclosed herein to enter the cell. It is especially effective for cell lines, primary cells, and immune cells such as T-cells. This method is efficient but can be harsh on sensitive cells, leading to higher cell mortality. Additional methods for introducing the sgRNAs and / or CRISPR components (like plasmids, ribonucleoprotein complexes, or mRNA) as disclosed herein into target cells includes, for example, Ribonucleoprotein (RNP) Complexes which involves directly delivering the Cas9 protein precomplexed with guide RNA, such as the sgRNA as disclosed hereininto cells, usually via Attorney Docket No.: 6391-0012WO01

[0103] electroporation or lipid-based transfection. This approach has advantages: it minimizes the risk of off-target effects, reduces immune response, and is transient, avoiding genomic integration. Lipid-Based Transfection Agents (lipofection) uses lipid-based reagents to encapsulate CRISPR plasmids or RNP complexes and facilitate their uptake by cells. This is straightforward and widely used for cell lines, but its efficiency can vary across cell types and is generally less effective for primary or difficult-to-transfect cells.

[0104] Other methods for introducing the sgRNAs and / or CRISPR components (for example, plasmids, ribonucleoprotein complexes, or mRNA) as disclosed herein into target cells includes, for example, physical methods such as Microinjection, which directly injects the sgRNAs and / or CRISPR components (for example, plasmids, ribonucleoprotein complexes, or mRNA) as disclosed herein into cells, typically used in single-cell embryos or zygotes for generating transgenic animals. This is a precise but labor-intensive approach; Nanoneedles and Microfluidics: Emerging physical methods like nanoneedles or microfluidic devices can introduce the sgRNAs and / or CRISPR components (for example, plasmids, ribonucleoprotein complexes, or mRNA) as disclosed herein with minimal damage to cells. They’re promising for in vitro applications and high-throughput settings but are still being developed. Exosome-Mediated Delivery, which can be engineered to carry the sgRNAs and / or CRISPR components (for example, plasmids, ribonucleoprotein complexes, or mRNA) as disclosed herein and target them to specific cells. This is a promising, non-viral, cell-derived delivery method that may allow for targeted delivery with minimal immune response.

[0105] Next Generation Sequencing (NGS) allows rapid and high-throughput sequencing of DNA and RNA. Unlike earlier methods such as Sanger sequencing, which sequences one DNA fragment at a time, NGS enables the simultaneous sequencing of millions of DNA fragments, making it much faster, cheaper, and more efficient. In NGS, a DNA or RNA from the sample is extracted and fragmented into smaller pieces. These fragments are then attached to short synthetic DNA sequences called adapters, which are needed for binding to the sequencing platform. The DNA fragments with adapters are amplified (copied many times) to create a "library" of DNA fragments. This increases the amount of DNA available for sequencing. Most NGS platforms, like Illumina, use a method called "sequencing by synthesis." Each fragment is attached to a solid surface and copied in place. Fluorescently-labeled nucleotides (A, T, C, and G) are added one by one. As they bind to the complementary strand, the machine detects the fluorescent signal, allowing the sequence of bases to be read. The massive amount of sequencing data is analyzed Attorney Docket No.: 6391-0012WO01

[0106] using bioinformatics tools. The overlapping DNA fragments are assembled back into their original sequence by aligning them to a reference genome or constructing new genomes (de novo sequencing). NGS allows for High Throughput, since millions to billions of DNA fragments can be sequenced in parallel, producing vast amounts of data, is cost-effective, and can sequence entire genomes or large sets of genes in days, making it much faster than older sequencing methods.

[0107] All references throughout this application, for example patent documents, including issued or granted patents or equivalents and patent application publications, and non-patent literature documents or other source material are hereby incorporated by reference herein in their entireties, as though individually incorporated by reference. None is admitted to be prior art.

[0108] The invention will be illustrated in more detail with reference to the following Examples, but it should be understood that the present invention is not deemed to be limited thereto.

[0109] EXAMPLES

[0110] Example 1. Assessment of UNA modifications on Cas9 Editing

[0111] crRNAs for the guide EMX1 were designed and produced with UNA modifications that were placed sequentially along the gRNA spacer (SEQ ID NO: 4 to SEQ ID NO: 23) to determine what effect UNAs would have on Cas9 editing. The crRNAs retained the 3’ modifications of IDT’s standard crRNA XT to ensure proper annealing to the tracrRNA; however, the 2’-O-Methyls and phosphorothioate linkages on the 5’ end of the crRNA were removed to confirm that any reduction in editing was due solely to the single UNA modification. These modified sgRNAs were compared to IDT’s standard crRNA XT as well as the published EMX1 chRDNA design (SEQ ID NO: 1, SEQ ID NO: 2) (11). All XT and modified sgRNAs used throughout the invention disclosure were annealed to IDT’s tracrRNA except for the published EMX1 chRDNA, which uses a published RNA: DNA tracrRNA (SEQ ID NO: 2, SEQ ID NO: 3) (8). Cas9 editing was assessed with HEK293 cells constitutively expressing WT Cas9 (ATCC HEK293-Cas9) in order to maximize the number of OTEs. In brief, HEK293-Cas9 cells were nucleofected with modified sgRNAs (10 pM), incubated for 72 hrs., gDNA was collected with QuickExtract, known editing sites were prepped for NGS using RHAMPSEQ, and analyzed using CRISPy (Table 1, 2). Nearly all UNA placements along the spacer yielded significant decreases in off-target editing while retaining on-target editing efficiency as compared to the standard XT modified gRNA (Figure Attorney Docket No.: 6391-0012WO01

[0112] 2). These results were comparable to the reduction seen in off-target editing with the chRDNA control gRNA. Only UNAs placed in positions 16, 15, 11, 6, 5, and 2 saw reduction in on-target editing. Sequence mismatches within the OTE target did not seem to influence the broad reduction of editing (Figure 2). For example, position 15 had mismatches for all 3 OTEs relative to the on-target; however, editing was reduced for all sites including the on-target. This creates indirect evidence that the structural features of the UNA modified gRNA-gDNA heteroduplex within the Cas9 enzyme maybe affecting enzyme kinetics. These results were the first instance that a single UNA modification in the gRNA spacer region can broadly reduce OTEs.

[0113] Following the results of UNA -modified EMX1 gRNAs, additional guides were ordered for targets AR and LAG3 (SEQ ID NO: 24 to SEQ ID NO: 65). UNAs were placed within the spacer in a similar manner as the EMX1 guides described above. However, the crRNA XT 5’ modifications. 2’-O-Methyl and phosphorothioates, were also added back into the design to test whether the UNA modification could combine with these modifications while still providing a functional gRNA. The UNA-modified sgRNAs were tested for editing capabilities similarly to the EMX1 gRNAs described above with previously built RHAMPSEQ panels that included the highest edited OTEs for each target (Table 3, 4). For both AR and LAG3, single UNAs placed along the gRNA spacer reduced off-target editing while retaining on-target editing (Figure 3A and Figure 3B). Similar to EMX1, UNAs placed in positions 12-14 broadly reduced off-target editing, creating the possibility that a UNA base could be placed in a singular location for most gRNAs to reduce OTE editing. However, UNAs placed at certain locations did show increases in OTE editing, which highlights that there may be important sequence context to how the UNA modification affects editing.

[0114] Table 1. EMX1 HiFi 32plex RHAMPSEQ Panel - RHC. W1014A901B0294D

[0115] ihAmpSeq %Indel in IIEK293-C as9 cells with %Indel in unedited Chroni Start End Strand

[0116] Assav ID XT 2-pait gRNA IIEK293-C as9 cells EMXl iGS IR

[0117] H. D049F13291 chr2 72933853 72933873 + 98.85 0.35 284F7Z0Z

[0118] EMX1JGS 2R

[0119] H.0F2DC25AE chrl5 43817549 43817569 + 85.4 0.62 6F8476Z0Z

[0120] EMX1JGS 6R

[0121] H. D0DD1BA39 chr5 9227034 9227054 + 26.43 0.02 4D745BZ0Z

[0122] EMX1JGS 3R

[0123] H.0209198AA9 chr5 45358962 45358982 + 4.92 0.02 7B4B0Z0Z

[0124] EMXl_iGS_5R

[0125] H. DE5AE16BF chr8 127788996 127789016 + 4.82 0.06

[0126]

[0127] 5A94BCZ0Z Attorney Docket No.: 6391-0012WO01

[0128] EMXl iGS 7R

[0129] H.3FF9CD566E chr3 4989913 4989933 + 2.9 0.04 B2454Z0Z

[0130] EMX1JGS 9R

[0131] H. F5E73CF629 chr3 34001466 34001486 + 2.51 0.11 85480Z0Z,

[0132] EMXl_picks_3

[0133] RH. EDC43F229 chr4 25059120 25059142 + 9.96 7.69 18D423Z0Z

[0134] EMX1JGS 4R

[0135] H.5961DD885E chr2 218980334 218980354 + 1.95 0 8A438Z0Z

[0136] EMXl_picks_l

[0137] RH.4C7CC5E7 chr6 110170195 110170217 + 1.33 0.69 B805479Z0Z

[0138] EMXl_iGS_13

[0139] RH.73ECEF96 chrl2 63795301 63795321 + 78.32 77.75 CF324F0Z0Z

[0140] EMXl iGS lO

[0141] RH A4994D64F, chr6 9118563 9118583 + 045 003 98547CZ0Z

[0142] EMXl_iGS_12

[0143] RH.3369C9084 chrll 43726382 43726402 + 0.35 0.02 5F64ACZ0Z

[0144] EMX1JGS 20

[0145] RH.5AECBF55 chr22 29209831 29209851 + 0.31 0.05 6499472Z0Z

[0146] EMXl_aGS_2R

[0147] H.5DC785865B chrX 53440758 53440781 + 0.27 0.02 8E4BDZ0Z

[0148] EMXl iGS 11

[0149] RH.0575AAFD chrl 234357116 234357136 + 0.29 0.05 B47F4B4Z0Z

[0150] EMXl_picks_2

[0151] RH. A15AB0DB chrll 6265868 6265890 + 1.8 1.64 1005440Z0Z

[0152] EMXl_iGS_19

[0153] RII.9E7531076 chr4 53164820 53164840 1 1.89 1.76 76E454Z0Z

[0154] EMXl_picks_8

[0155] RH.7D16F71AF chrlO 128309468 128309490 + 0.32 0.24 1724BEZ0Z

[0156] EMXl_iGS_18

[0157] RH.1414AACB chr3 63482435 63482455 + 0.15 0.07 AF3D4F2Z0Z

[0158] EMXl aGS IR

[0159] H.269461AAFC chrl 23394119 23394142 + 0.07 0.01 394BF. Z.0Z.

[0160] EMXl_iGS_17

[0161] RH.2037479DF chrl 2 121970230 121970250 + 0.07 0.01 B2E4B4Z0Z

[0162] EMX1_ picks_6

[0163] RH. F64EE96D4 chr2 202842752 202842774 + 0.1 0.07 445444Z0Z

[0164] EMXl_aGS_3R

[0165] H.9492583992F chr5 147453621 147453644 + 0.08 0.05 A405Z0Z

[0166] EMX1JGS 8R

[0167] H. AE575FC0EF chrl6 56150160 56150180 + 0.11 0.11 1B470Z0Z

[0168] EMXl_picks_7

[0169] RH. B8A71E4B chrll 30280257 30280279 + 001 001 6B474. AAZ0Z

[0170] EMX1JGS 15

[0171] RH.042CD79E7 chr7 73900798 73900818 + 0.03 0.04 BFA4F2Z0Z

[0172] EMX1_ picks_9

[0173] RH. CDF7A091 chrl4 42687599 42687621 + 0.37 0.38

[0174]

[0175] 3EB7433Z0Z Attorney Docket No.: 6391-0012WO01

[0176] EMXl_picks 1

[0177] 0RH.9D8FEE22 chr2 217513380 217513402 + 0.06 0.09 EAE845EZ0Z

[0178] EMXl_picks_4

[0179] RH.53B8E1C96 chr7 140837898 140837920 + 0 0.03 01745AZ0Z

[0180] EMXl_iGS_14

[0181] RH.3779C1B5D chrl 35353288 35353308 + 0.02 0.06 4224D6Z0Z

[0182] EMX1_ picks_5

[0183] RH. B009628D8 clir4 86335534 86335556 + 2.29 3.14 63040DZ0Z

[0184] Table 2. EMX1 Topl0v2 RHAMPSEQ Panel - J IHC. F3644FF7B16242C

[0185] rliAnipSeq " / olndel in IIEK293-Cas9 cells witli %Indel in unedited Chrom Start End Strand

[0186] Assax ID XT 2-partgRNA IIEK293-Cas9 cells EMXIOnTRH.l

[0187] 7730AC8CEF4 chr2 72933852 72933875 + 98.45 0.39 4C5Z0Z

[0188] EMXIOTEOOl

[0189] RH.9DDB49A8 chrl 5 43817548 43817571 + 90.14 0.68 2C8C440Z0Z

[0190] EMX1OTE002

[0191] RH.2CA5E0423 chr5 45358958 45358981 - 89.81 0.07 5C34DFZ0Z

[0192] EMX1OTE003

[0193] RH.96864F3D2 chr5 9227033 9227056 + 34.35 0.04 166494Z0Z

[0194] EMX1OTE004

[0195] RH.4280E8204 chr8 127788995 127789018 + 11.07 0.09 0AD43FZ0Z

[0196] EMX1OTE005

[0197] RH. D532A8C0 chrX 53440757 53440780 - 4 19 001 428444DZ0Z

[0198] EMX1OTE006

[0199] RH.3027735429 chr2 218980333 218980356 + 2.59 0 F444AZ0Z

[0200] EMX1OTE007

[0201] RH.68CE2561A chr3 4989912 4989935 + 2.08 0.16 33A4E0Z0Z

[0202] EMX1OTE008

[0203] RH.6737976A5 chr3 34001465 34001487 + 4.14 0.06 2694DEZ0Z

[0204] EMX1OTE009

[0205] RH.83FDB76D chr6 9118559 9118582 - 1.27 0.07

[0206]

[0207] 02914D1Z0Z

[0208] Table 3. AR Top25 RHAMPSJ EQ Panel - RHC.639E9BFE3C594AC

[0209] rliAnipSeq %Indel in IIEK293-C as9 cells with %Indel in unedited Ch rom Start End Strand

[0210] Assav ID XT 2-partgRNA IIEK293-C as9 cells ARall_001RH.7

[0211] 5FE149A32D54 chrX 67545904 67545927 + 82.33 0.225 B1Z0Z

[0212] ARall_002RH.8

[0213] 72507C6EA824 chrl 27592690 27592713 - 56.88 0.035 02Z0Z

[0214] ARall_003RH.8

[0215] CB5A0C40F20 chr7 22126332 22126355 - 47.49 0.165 449Z0Z

[0216] ARall_004RH.6

[0217] 3C10B389D134 chrl 7 14626781 14626804 - 74.17 0.095 B2Z0Z

[0218] ARall_006RH.3

[0219] 9A2EBF9F2B5 chrl 2 122113355 122113378 - 44.095 0.1 4B5Z0Z

[0220] ARall_007RII.

[0221] A42E04C6C9F chr20 46362538 46362561 - 58.045 0.015

[0222]

[0223] E402Z0Z Attorney Docket No.: 6391-0012WO01

[0224] ARall_008RH.

[0225] DD4A477DA2 chr6 150412433 150412455 - 1.5 0.01 BE484Z0Z

[0226] ARall_009RH. E

[0227] 7C332E7797B4 chr8 70014900 70014923 - 25.13 0.12 D1Z0Z

[0228] ARall_010RH 7

[0229] 7B9DAB45DE7 chrl8 26782003 26782026 + 2.985 0.06 493Z0Z

[0230] ARall 011RH. B

[0231] 2361525E71D4 chrlO 75605945 75605968 - 27.365 0.055 72Z0Z

[0232] ARall_012RHC

[0233] 1142667FCD24 clirl 5 32101670 32101693 - 42.175 0.21 FAZOZ ARall_O13RH. O

[0234] 6AD4BD86962 chr6 110986340 110986364 + 9.845 0.08 4B4Z0Z

[0235] ARall_O14RH. O

[0236] F19F82DA9BE chrl 195970288 195970311 + 53.82 0.16 474Z0Z

[0237] ARall_015RHF

[0238] BA89781A3834 chrl9 39394095 39394118 - 1.04 0.025 52Z0Z

[0239] ARall_016RH.7

[0240] 5BA692504684 chr2 99538778 99538801 + 9.875 0.12 E1Z0Z

[0241] ARall_017RH.

[0242] A23BC0BFC3F chr4 33488669 33488692 + 45.61 0.165 24ADZ0Z

[0243] ARall_018RH.9

[0244] 0EB6C97E22B chr6 111617768 111617791 + 5.2 0.54 44FZ0Z

[0245] ARall_019RH.7

[0246] 970A6B4B83F4 chrl 7 41631349 41631371 - 0 185 0 105 79Z0Z

[0247] ARall_020RHE

[0248] 1B19AC4C2C2 chrl 7 16212979 16213002 + 0.81 0.015 40FZ0Z

[0249] ARall_021RH.7

[0250] C5D69DOC906 clirl 7 80396918 80396939 - 3.075 0.07 497Z0Z

[0251] ARall_022RH.9

[0252] D7B9B43CF60 chr9 129737563 129737586 - 3.51 0.125 4F6Z0Z

[0253] ARall_023RH.7

[0254] 8F3FBC3F5864 chrlO 116741323 116741346 - 2.565 0 6BZ0Z

[0255] ARall_024RH 0

[0256] 9480DEF1ED9 chr6 43246482 43246503 + 0.37 0.19 4CEZ0Z

[0257] ARall_026RH.3

[0258] 95B3BFE67834 chr7 155641558 155641581 - 0.795 0.12 78Z0Z

[0259] ARGSi 375RH.

[0260] 7DBF9C142C0 clirl 2 1819410 1819434 + 0.06 0.19 E459Z0Z

[0261] Table 4. LAG3s9 Top50RHA MPSEQ Panel - RHC. CF702EBACB4E415

[0262] rhAmpSeq %Indel in HEK293-C,'as9 cells with %Indel in unedited Chrom Start End St mud

[0263] Assay II) XT 2-part sRNA IIEK293-Cas9 cells LAG3_site_9_0

[0264] 01RH.22F7C9E chrl 2 6773276 6773299 - 72.365 0.33 936284EBZ0Z

[0265] LAG3_site_9_0

[0266] 02RH.81494F08 chr8 1944116 1944139 - 10.565 0.39

[0267]

[0268] 8811466Z0Z Attorney Docket No.: 6391-0012WO01

[0269] LAG3_site_9_0

[0270] 03RH.773DE39 chrl 64133480 64133503 + 67.115 0.13 66F1A425Z0Z

[0271] LAG3_site_9_0

[0272] 04RH.2DAA13 chrl8 23732318 23732341 + 76.19 1.99 6F92E4418Z0Z

[0273] LAG3_site_9_0

[0274] 05RH. AA877E6 chrl 4 90593844 90593867 - 69.79 0.215 FA6A24D1Z0Z

[0275] LAG3_sito_9_0

[0276] 06RH.42A5229 chr5 149864107 149864130 + 76.275 0.065 000A84E1Z0Z

[0277] LAG3_site_9_0

[0278] 07RH. FFAF111 chr3 67021410 67021433 - 61.765 0.065 8A8B0446Z0Z

[0279] LAG3_site_9_0

[0280] 08RH.2AAFE2 chr2 217789960 217789983 + 62.935 0.09 0057E848FZ0Z

[0281] LAG3_site_9_0

[0282] 09RH. E62DOB3 chrl 5 69319847 69319870 - 53.38 0.055 D0D5A441Z0Z

[0283] LAG3_site_9_0

[0284] 10RH.30C85EB chr8 102730074 102730097 - 24.86 0 E71D2458Z0Z

[0285] LAG3_site_9_0

[0286] 11RH.577D19B chrlO 23362361 23362384 - 46.45 0.16 C5F2D4E6Z0Z

[0287] LAG3_site_9_0

[0288] 12RH. D669B4

[0289] chr7 101283211 101283234 58.37 0.045 ACA170426Z0 - Z LAG3_site_9_0

[0290] 13RH.096A095 chrl 6 75111804 75111827 + 37.275 0.1 24D584DCZ0Z

[0291] LAG3_site_9_0

[0292] 14RH. EBEB4A

[0293] chr22 47924625 47924648 78.11 0.23 10DF6A476Z0 +

[0294] Z LAG3_site_9_0

[0295] 15RH.05731F31 chrl 202586267 202586290 + 38.505 0.11 83CE49FZ0Z

[0296] LAG3_site_9_0

[0297] 16RH.94FCDF2 chr3 10338273 10338296 - 18.62 0 4B2744C1Z0Z

[0298] LAG3_site_9_0

[0299] 17RH.69928A1 chr3 42907094 42907117 + 64.49 0 C36EA400Z0Z

[0300] LAG3_site_9_0

[0301] I8RH F8988587 chr8 29646304 29646327 - 28745 0 16 91CA4E9Z0Z

[0302] LAG3_site_9_0

[0303] 19RH.5971518 chr7 4961802 4961825 - 37.645 0.07 BF622404Z0Z

[0304] LAG3_site_9_0

[0305] 20RH.71FCD97 chr3 10473746 10473769 + 32.595 0.21 C250849FZ0Z

[0306] LAG3_site_9_0

[0307] 21RH. E1C04B4 chrX 109930511 109930534 - 44.76 0.19 20B954EFZ0Z

[0308] LAG3 site 9 0

[0309] 22RH.9545B4F chr5 173295131 173295154 + 3.23 0.045 17F384FAZ0Z

[0310] LAG3_site_9_0

[0311] 23RH 6E61C68 chrl 179806581 179806604 + 35 485 0085 111A04E3Z0Z

[0312] LAG3_site_9_0

[0313] 24RH.8D87AF chrl 43279798 43279821 - 29.105 0.16 C0F87B498Z0Z

[0314] LAG3_site_9_0

[0315] 25RH. F28C401 chr20 57124384 57124407 + 10.395 0

[0316]

[0317] CEC594E2Z0Z Attorney Docket No.: 6391-0012WO01

[0318] LAG3_site_9_0

[0319] 26RH. F61CF56 chr2 151203105 151203128 + 81.325 0 7366B4B4Z0Z

[0320] LAG3_site_9_0

[0321] 27RH.9A8922F chrl 7 5976298 5976321 + 0.95 0.285 8978E459Z0Z

[0322] LAG3_site_9_0

[0323] 28RH.4758D12 chrl2 120684762 120684785 - 5.905 0.08 43C474CEZ0Z

[0324] LAG3_sito_9_0

[0325] 29RH.5E87643

[0326] chr7 50764042 50764065 8.075 0.145 3ABDA48AZ0 - Z LAG3_site_9_0

[0327] 30RH.65F088E chr9 133804569 133804592 - 10.73 0.065 456544B6Z0Z

[0328] LAG3_site_9_0

[0329] 31RH. CE5A756 chrl l 17496696 17496719 + 4.63 0.015 BD29246DZ0Z

[0330] LAG3_site_9_0

[0331] 32RH. D536E45 chrl6 55491673 55491697 - 1838 005 A63054B1Z0Z

[0332] LAG3_site_9_0

[0333] 33RH.47A3C43 chrl 7 63474374 63474397 - 7.1 0 0F91F4F1Z0Z

[0334] LAG3_site_9_0

[0335] 34RH. BFD9C6 chr5 113119765 113119788 - 5.025 0.08 8929F74B7Z0Z

[0336] LAG3_site_9_0

[0337] 35RH. A0E5EA

[0338] chrl6 51868589 51868612 3.74 0.105 C0B38B494Z0 - Z LAG3_site_9_0

[0339] 36RH.9EA0AF

[0340] chrl 8 77403690 77403713 + 2.315 0.295 DC49C1441Z0

[0341] Z LAG3_site_9_0

[0342] 37RH.5B57CF9 chr7 129460833 129460856 + 6.29 0.01 2561343AZ0Z

[0343] LAG3_site_9_0

[0344] 38RH. E7505CA chr6 27632534 27632557 + 4.55 0.07 DE877479Z0Z

[0345] LAG3_site_9_0

[0346] 39RH.75F1D6D chrl 184664107 184664130 - 7.155 0.05 3A92B4F1Z0Z

[0347] LAG3_site_9_0

[0348] 40RH.6A33D94 chr22 50224159 50224183 - 5.56 0.19 DE87244AZ0Z

[0349] I, AG3_site_9_0

[0350] 41RH 3C16D84 chr7 157032941 157032964 + 6 835 004 DF842480Z0Z

[0351] LAG3_site_9_0

[0352] 42RH4CE38D0 chr6 123513131 123513154 - 4.645 0.195 F6FED475Z0Z

[0353] LAG3_site_9_0

[0354] 43RH.2370197 chr5 86093859 86093882 + 9.235 0.155 ECA9046EZ0Z

[0355] LAG3_site_9_0

[0356] 44RH. FACAAE chr2 106630587 106630611 + 6.115 0.03 5EF874494Z0Z

[0357] LAG3_site_9_0

[0358] 45RH.043F18D chrl 77338615 77338638 + 11.98 0.025 3D32B45BZ0Z

[0359] LAG3_site_9_0

[0360] 46RH.094A283 chr3 171739147 171739170 - 2.33 0.155 8661C445Z0Z

[0361] LAG3_sito_9_0

[0362] 47RH.61AB514 chr21 19492741 19492764 + 12.18 0.025

[0363]

[0364] C7E9344EZ0Z Attorney Docket No.: 6391-0012WO01

[0365] LAG3_site_9_0

[0366] 48RH.2E6B147 chr2 68706891 68706914 - 5.825 0.14 6100D41FZ0Z

[0367] LAG3_site_9_0

[0368] 49RH. D5C63D chr8 24745109 24745132 - 5.28 0.095 1E118241BZ0Z

[0369] LAG3_site_9_0

[0370] 50RH.0B2507D chr9 126674774 126674797 - 2.165 0.165

[0371]

[0372] 048C5483Z0Z

[0373] Example 2. RNP delivery of UNA-modified sgRNAs at subsaturating doses.

[0374] To ensure that UNA-modified sgRNAs were not affecting overall editing of the gRNA due to the saturating conditions of the stable Cas9 expression system, these gRNAs (SEQ ID NO: 4 to SEQ ID NO: 65) were used with non-saturating doses of RNP (1 pM RNP, WT-Cas9 V3, with 3 pM electroporation enhancer) in HEK293 cells. Library prep and RHAMPSEQ panels were prepared as described above. For all targets, if a UNA was placed in the seed region (positions 1-10), there was a dramatic decrease in on-target editing (Figure 4A - Figure 4C).

[0375] This stands in contrast to the mod walk performed in the stable expression cell line where UNAs could be placed in the seed region and retain on-target editing. These results illustrate that depending on the expression / delivery of Cas9, the placement of the UNA maybe fine-tuned to elicit the desired on- / off-target editing ratio. Additionally, placement of the UNA in position 18 (SEQ ID NO: 6, SEQ ID NO: 28, SEQ ID NO: 48) showed the greatest retention of on-target editing and reduction of off-target editing when delivering Cas9 as RNP showing that UNAs are not lowering off-target editing thru reduction in total editing and that there is possibly a target agnostic location for UNA modifications.

[0376] Example 3. Assessment of LNA and 2 'Fluoro modifications on Cas9 Editing

[0377] Following the results of UNA modifications to Cas9 editing additional modifications including the LNA and 2'fluoro were tested for their effect on Cas9 editing. gRNAs with a single modification placed along each base of the gRNA spacer were ordered for three targets: EMX1, AR, and LAG3 (SEQ ID NO: 66 to SEQ ID NO: 185). These gRNAs were tested in the same manner previously described using the HEK293-Cas9 stable expression system with saturating conditions along with non-saturating conditions with RNP delivery. Under saturating conditions with Cas9 stable expression, both the LNA and 2'fluoro modified sgRNAs reduced off-target editing (Figure 5A - Figure 5F). 2'fluoro modifications, however; did not yield as dramatic of a reduction in off-target editing as the UNA or LNA modifications possibly due to the fact the chemical structure is not as markedly different from a standard RNA. Correspondingly, the Attorney Docket No.: 6391-0012WO01

[0378] 2'fluoro retained on-target editing when placed at nearly all locations along the gRNA spacer for each target. Interestingly, the placement of the modification that yielded the best on / off-target editing ratio was unique to each modification within the seed region of the gRNA (position 9 for the LNA [SEQ ID NO: 77, SEQ ID NO: 117, SEQ ID NO: 137,], position 6 for 2'fluoro [SEQ ID NO: 100, SEQ ID NO: 160, SEQ ID NO: 180], which provides further evidence that the divergent chemical structure of these modifications is what is influencing nuclease editing. Similarly to the UNA, neither the LNA nor 2'fluoro showed strong evidence that mismatch discrimination is the primary reason for reduction in off-target editing. In contrast, placement of the LNA in several locations near the 5’ end of the gRNA significantly increased off-target editing with similar findings for 2'fluoro placement in positions 8-12.

[0379] RNP delivery at non-saturating RNP concentrations was used to ascertain whether the modifications were lowering off-target editing by reducing the overall editing efficiency of the Cas nuclease. LNA modifications showed a target dependent retention in on-target editing efficiency (Figure 6A - Figure 6F). For targets EMX1 and AR, LNA placement at positions 5 and 6 had the greatest impact on on-target editing, whereas most LNA placements along the spacer for LAG3 led to total editing reduction. Intriguingly, LNA placement at position 9 (SEQ ID NO: 77, SEQ ID NO: 117) exhibited the same reduction in off-target editing while retaining on-target editing as was seen in the stable expression Cas9 cell line. Impact of 2'fluoro modifications on editing outcomes were likewise influenced in a target dependent manner with RNP delivery. For EMX1, on-target activity was broadly maintained with 2'fluoro placement throughout the spacer region though reduction in off-target editing was only appreciably seen with placement at positions 1, 2, 6 (SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 105). Likewise, AR saw retention in on-target activity with multiple 2'fluoro placements throughout the spacer, however; little off-target activity was seen in any gRNA used. LAG3 exhibited a universal reduction in on-target editing with 2'fluoro modifications and very little reduction in off-target edits showing the 2'fluoro modification cannot be used for gRNA with this amount of off-target editing. Additionally, there is a high likelihood that sequence context of the duplex matters for the effectiveness of the modifications to influence editing. A highly diverse set of gRNAs will be needed to tease the mechanistic underpinnings that effect duplex distortion and editing rate. Overall, both the LNA and 2'fluoro lowered off-target editing while maintaining on-target editing efficiency dependent on target and nuclease delivery / expression. Attorney Docket No.: 6391-0012WO01

[0380] Example 4. Assessment of Cas9 editing with abasic site gRNAs

[0381] The last set of modifications to be tested for their effect on Cas nuclease editing were the abasic modifications: C3 spacer and dSpacer. gRNAs with a single modification placed along each base of the gRNA spacer were ordered for three targets: EMX1, AR, and LAG3 (SEQ ID NO: 186 to SEQ ID NO: 305). These gRNAs were tested in the same manner previously described using the HEK293-Cas9 stable expression system with saturating conditions. For all targets, placement of the abasic site modifications lowered off-target editing (Figure 7A - Figure 7F).

[0382] The reduction in off-target editing was most pronounced with abasic modifications placed in positions 11-17. In contrast, modification placement in the seed region (1-10) led to significant reduction in total editing for both the C3 spacer and dSpacer. Overall, there was no major on / off-target editing differences in modification placement between the C3 spacer and dSpacer, indicating that the structural differences between these two modifications is not the main reason for off-target editing reduction; lending support to the hypothesis that the lack of base pairing at the abasic site alters the duplex structure to affect nuclease editing.

[0383] Example 5. Comparison of UNA modified gRNAs with HiFi-Cas9

[0384] A RNP dose titration in K562s was used to assess how modified gRNAs influenced editing at lower RNP doses compared to HiFi-Cas9. A RNP dilution series (0.0625 - 4 pM) was utilized with a gRNA with the UNA modification in position 18 on the spacer and a standard end-blocking AltR modified crRNA with either WT-Cas9 or HiFi-Cas9 (SEQ ID NO: 06, SEQ ID NO: 306). The RNP complex was nucleofected into K562s with 3 pM electroporation enhancer and assessed for editing using RHAMPSEQ. The UNA modified gRNA complexed with WT-Cas9 showed a similar dose-response curve as a standard gRNA complexed with HiFi-Cas9 for on-target editing (Figure 8A - Figure 8D). In addition, the off-target editing for UNA gRNAs mirrored the reduction in off-target editing using HiFi. Interestingly, when combining the UNA gRNA with HiFi-Cas9, the editing at the on-target was reduced and is comparable to what was previously shown with chrDNAs and HiFi nucleases (8). To show that UNA modified gRNAs could impact editing in clinically relevant cell types, a RNP dose titration was used with two target sites (EMX1 and AAVS1) in induced pluripotent stem cells (iPSCs). In iPSCs, the EMX1 UNA modified gRNA mirrored what was previously seen in K562s with retention of on-target editing while reducing off-target editing similarly to HiFi-Cas9 (Figure 8A - Figure 8D). For the AAVS1 target site, on-target editing increased when using UNA modified gRNAs or HiFi-Cas9 compared Attorney Docket No.: 6391-0012WO01

[0385] to standard gRNAs and WT-Cas9 while simultaneously lowering the off-target editing. Lastly, to show that the reduction in editing is independent of the delivery format of the Cas-nuclease, Cas9 mRNA (WT and HiFi) was used in combination with standard or LINA modified gRNAs for the targets EMX1 and AAVS1. Both sites show comparable on / off-target editing ratios as was seen with RNP delivery of Cas9. These results highlight that LINA modified gRNAs can perform similar to HiFi systems and can provide therapeutic utility with their reduction of off-target editing.

[0386] Example 6. Assessment of UNA modifications on Cas9 on-target editing

[0387] crRNAs for the guide PCSK9 were ordered with UNA modifications that were placed sequentially along the gRNA spacer (SEQ ID NO: 367 - SEQ ID NO: 388) to see what effect UNAs would have on Cas9 on-target editing. These modified gRNAs were compared to IDT’s standard AltR™ crRNA (SEQ ID NO; 368). All gRNAs used throughout the invention disclosure were annealed to IDT’s tracrRNA. Cas9 editing was assessed with HEK293 cells constitutively expressing WT Cas9 (ATCC HEK293-Cas9) or with WT-Cas9 RNP delivery. In brief, HEK293-Cas9 stably expressing Cas9 were nucleofected (Lonza) with 5 pM of modified gRNAs. Non-stably expressed cells were nucleofected with 4 pM RNP, WT-Cas9 V3 (IDT), with 3 pM electroporation enhancer (IDT). All samples were incubated for 72 hrs., gDNA collected with QuickExtract, the on-target editing site was amplified and prepped for NGS using RHAMPSEQ, and analyzed using CRISP AltRations as previously described10. crRNAs with UNAs placed at positions 20-17 (SEQ ID NO: 369 - SEQ ID NO: 372) increased editing compared to an RNA only crRNA with the PCSK9 target site with both stable Cas9 expression and RNP (Figure 9).

[0388] To ensure that this effect wasn’t limited to a single target site, additional sites were chosen for on-target editing analysis (SEQ ID NO: 389 - SEQ ID NO: 415) and measured in a similar manner as described above except for a shortened UNA modification walk through the spacer (Positions 20 - 11). Once again, increased on-target editing efficiency was seen with each target site; however, each target site had a differing pattern for optimal placement of the UNA within the spacer region, demonstrating the influence of the target site sequence on the UNA’s effectiveness for editing modulation (Figure 10). These results were the first instance that a single UNA modification in the gRNA spacer region can broadly increase on-target editing.

[0389] In some embodiments, in a spacer sequence, positions are numbered from the 5’ to the 3’ end of the spacer sequence, wherein Position 20 being the first nucleotide at the 5’ end and Attorney Docket No.: 6391-0012WO01

[0390] Position 1 being the last nucleotide at the 3 ’end for a typical 20 nt spacer. For truncated gRNAs, a spacer sequence can be modified to remove one, two, or three nucleotides from the 5’ end (e.g., truncated gRNAs having a spacer with 19 nucleotides has nucleotide positions 19 to 1, instead of positions 20 to 1).

[0391] Example 7. Assessment of UNA modifications on Cas9 on / off-target editing

[0392] To more broadly assess the effect of UNA modifications on Cas9 editing, sixteen gRNAs were chosen to sequentially place the UNA within the gRNA spacer based on their wide ranging editing specificities as described previously (See Kinney reference at Figure 3, Table 1; and SEQ ID NO: 369 to SEQ ID NO: 388, SEQ ID NO: 390 to SEQ ID NO: 399, SEQ ID NO: 401 to SEQ ID NO: 410, SEQ ID NO: 412 to SEQ ID NO: 421, SEQ ID NO: 434 to SEQ ID NO: 643)u. As described herein, all UNA modified gRNAs were compared to IDT’s standard AltR™ crRNAs (SEQ ID NO: 367, SEQ ID NO: 389, SEQ ID NO: 300, SEQ ID NO: 411, SEQ ID NOs: 422 -433), delivered in stably expressing Cas9 cells and RNP delivery, gDNA extracted, and editing assessed with RHAMPSEQ. As was seen previously, each target had a unique pattern of optimally placed UNAs within the spacer. To compare UNA placement across multiple target sites, editing at each UNA placement within the spacer across the sixteen target sites was normalized to the editing of either the on-target or top edited off-target site of the standard AltR™ crRNA for the corresponding site (Figure 12). Normalizing the data in this way allowed trends to emerge where specific locations within the spacer region had a higher probability of either A) increasing editing compared to an unmodified spacer B) retention of on-target editing while lowering off-targeting editing C) partial decrease in on-target editing or D) complete elimination of editing (Figure 4;

[0393] Table 9). Across all gRNAs placement of the UNA in Tier 1 positions 20 and 19 had the greatest probability of retaining on-target editing; however, off-target editing could also be retained for a few target sites indicating these UNA locations would work best for high specificity gRNAs with already low numbers of off-targets (Table 9). Similarly to positions 20 and 19, UNAs placed at locations 18, 17, 14, 12, and 10 had a high on-target editing retention probability and were coupled with a higher rate of decreasing off-target editing compared to positions 20 and 19. This makes these positions a good choice for gRNAs with a lower specificity that may have some concerning off-targets that cannot be avoided with gRNA design considerations. Positions 16, 15, 13, 11, 9, 8, 7, 4 had a highly variable performance for on-target editing retention meaning that the target sequence highly influences the impact of UNAs on CRISPR-Cas editing. Due to their lower Attorney Docket No.: 6391-0012WO01

[0394] probability of being the ideal placement of UNAs within the spacer, we designated them as Tier 2 sites, which should be tested if Tier 1 sites do not yield desired editing levels (Table 9). Lastly, Tier 3 sites (6, 5, 3, 2, 1) knocked down editing levels for nearly all gRNAs tested with UNAs located in positions 6 and 5 knocking down editing levels comparable to unedited samples (Figure 12; Table 9)

[0395] To highlight the impact of UNAs placed in optimized positions compared to standard AltR™ crRNAs, we picked UNA locations for each of the sixteen gRNAs that satisfied the ability to either increase or retain on-target editing efficiency while simultaneously lowering off-target editing. UNA locations for each of the gRNAs that satisfied these conditions were as follows: PDCDls8 - 14, LAG3 - 12, FANCF tgt 13 - 10, TRAC - 14, EMX1 - 18, HBB - 17, AR - 15, HEK Site 3 - 14, HPRT 38087 - 18, PD1 - 20, B2M - 12, PCSK9 - 17, APOBEC3A - 20, APBB2 - 20, ADI - 20, APP1 - 18 (SEQ ID NO: 372, SEQ ID NO: 392, SEQ ID NO: 401, SEQ ID NO: 418, SEQ ID NO: 440, SEQ ID NO: 462, SEQ ID NO: 484, SEQ ID NO: 496, SEQ ID NO: 517, SEQ ID NO: 539, SEQ ID NO: 560, SEQ ID NO: 576, SEQ ID NO: 602, SEQ ID NO: 614, SEQ ID NO: 624, SEQ ID NO: 634.). Of the sixteen gRNAs, 94% of gRNAs had UNAs placed in Tier 1 locations with many sites having multiple Tier 1 and 2 locations that satisfied our optimized position criteria (Table 9). When comparing editing at all on / off-target sites for all gRNAs between standard AltR™ and optimally placed UNA modified crRNAs with stable Cas9 expression, large decreases in off-target editing (median fold change = 0.06; ~15-fold decrease in editing) with corresponding retention in on-target editing (median fold change = 1.01) was observed (Figure 13A and Figure 13B). This demonstrates that UNAs increase the specificity of CRISPR-Cas editing systems and can provide utility for translational and therapeutic applications.

[0396] Table 5. AAVS130plex RHAMPSEQ Panel - RHC.4C1B1FCBAB3C4CF

[0397] rhAnipSeq Assay II) ( hi'orn Sta rt End Strand

[0398] AAVS1 10RH5276F0443F0947DZ0Z chrl 1 61343764 61343784 +

[0399] AAVS1 11RH.326B01606E5349AZ0Z chr8 22778070 22778090 +

[0400] AAVS1 12RH. D732DA5AB2CE425Z0 13078255 13078257

[0401] Z chrlO 1 1 +

[0402] AAVS1 13RH.591A8C2B5F804E0Z0Z chr22 44303220 44303240 +

[0403] 11884677 11884679

[0404]

[0405] AAVS1 14RH.4915BB09183E47BZ0Z chrll 8 8 + Attorney Docket No.: 6391-0012WO01

[0406] AAVSl 15RH.0BEF35537BC04CEZ0Z chr7 2104507 2104527 +

[0407] 14380294 14380296 AAVS 1 16RH.845BF9B0C9BE4DEZ0Z chr8 9 9 + AAVSl 17RH. E32167A541C549BZ0Z chrll 27064833 27064853 + AAVSl 18RH.71A673C6AE994B9Z0Z chrl7 75895457 75895477 + AAVSl 19RH.237C51E0EE8842FZ0Z chr7 74106811 74106831 +

[0408] 10709248 10709250 AAVSl 1RH.65D655F066094DDZ0Z chrl2 6 6 + AAVSl 20RH.693B74B4EB6247FZ0Z chr7 51607198 51607218 + AAVSl 21RII.53DE392E0E5B424Z0Z chr2 87285027 87285047 1

[0409] 10818790 10818792 AAVSl 22RH. D5A48E6C8D3641CZ0Z chrl2 1 1 + AAVSl 23RH.92CED1A8F57E4BCZ0Z chr22 22573603 22573623 + AAVSl 24RH 199456172B464BEZ0Z chr6 53335292 53335312 +

[0410] 11394480 11394482 AAVS 1 25RH.3C2FD4ABC63C405Z0Z chrlO 3 3 + AAVSl 26RH62CF0917A576466Z0Z chr6 70199680 70199700 +

[0411] 11157656 11157658 AAVSl 27RH.69E4AAC76E13468Z0Z chr2 0 0 + AAVSl 28RH.75E60456C358483Z0Z chrl6 32025810 32025830 + AAVS 1 29RH. EDD5F0DB80F5425Z0Z chr9 97300272 97300292 + AAVSl 2RH. E7465CE90E094D9Z0Z chr6 36797686 36797706 + AAVSl 30RH. FCEA75769A4041CZ0Z chr20 53642954 53642974 + AAVSl 3RH.6020640C45F04A2Z0Z chrl9 55115751 55115771 + AAVSl 4RH.3B9DEA095A3B4B0Z0Z chrl9 16064179 16064199 + AAVS 1 5RH.41 ABDA09EC8842FZ0Z chr21 41521017 41521037 + AAVSl 6RH.84A59E6D3C6C408Z0Z chrl5 89933458 89933478 +

[0412]

[0413] AAVSl 7RH.3CB73ACAEC0B48DZ0Z chrl8 48222163 48222183 + Attorney Docket No.: 6391-0012WO01

[0414] 20453140 20453142

[0415] AAVSl 8RH.6A976D8D5655470Z0Z chr2 3 3 +

[0416] 10596056 10596058

[0417]

[0418] AAVS1 9RH. C363F.2AF2FCA423Z0Z chr13 2 2 +

[0419] Table 6. Oligos - (m denotes 2’-O-Me1hyl, * denotes phosphorothioate linkage, + denotes LNA base, iSpC3 denotes C3 spacer, i2FC denotes 2’Fhioro, idSp deno

[0420]

[0421] tes dSpacer.)

[0422] Sequence II) Name Sequence Description SEQ ID NO: 1 mG*mA*mGrUrCrCrGrArGrCrArGrArArGrArArGrArA

[0423] EMX1 XT crRNA with IDT’s XT Modification.

[0424] rGrUrUrUrUr. ArGr. ArGrCrUrAmU+G*+C*mU

[0425] SEQ ID NO: 2 rGAGrUCCrGArGCrAGrArArGrA. YrGArArGrUrUrUrU

[0426] EMXl chRDNA Chimeric RNA: DNA crRNA r. ArGrArGrGrArUrUrGrCrU

[0427] AGCrArArUrCrCrArArGrLWrArArArArUrArArGrGrC

[0428] SEQ ID NO: 3 Cariou chACR rUr. ArGrUrCrCrGrUrUrArLTCrArArCrUrUrGrArArArAr Chimeric RNA: DNA tracrRNA ArGrUrGrGCACCrGrArGrLTrCGGTGrCrUrLT

[0429] SEQ ID NO: 4 / 5UNA-rG / rArGrUrCrCrGrArGrCrArGrArArGrArArGr

[0430] EMX1 UNA 20 crRNA with a single UNA base.

[0431] ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0432] SEQ ID NO: 5 rG / iUNA-r. A / rGrUrCrCrGrArGrCrArGrArArGrArArGrA

[0433] EMX1_UNA_19 rArGrl Tri Tri Tri TrArGrArGrCrI TrAml T+G*+C*ml T crRNA with a single UNA base. SEQ ID NO: 6 rGrA / iUNA-rG / rUrCrCrGrArGrCrArGrArArGrArArGrA

[0434] EMX1 UNA 18rcrRNA with a single UNA base.

[0435] . ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0436] SEQ ID NO: 7 rGrArG / iUNA-rU / rCrCrGrAiGrCrAiGrArArGrAiArGrA

[0437] EMX1 UNA 17 crRNA with a single UNA base.

[0438] rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0439] SEQ ID NO: 8 rGrArGrU / iUNA-rC / rCrGrArGrCrArGrArAiGrAiArGrA

[0440] EMX1 UNA 16 crRNA with a single UNA base.

[0441] r. ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0442] SEQ ID NO: 9 rGr. ArGrUrC / iUNA-rC / rGrArGrCrArGrArArGrArArGrA

[0443] EMX1 UNA 15 crRNA with a single UNA base.

[0444] r. ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0445] SEQ ID NO: 10 rGrArGrUrCrC / itlNA-rG / rArGrCrArGrArArGrArArGrA

[0446] EMX1 UNA 14rcrRNA with a single UNA base.

[0447] . ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0448] SEQ ID NO: 11 rGrArGrUrCrCrG / iUNA-rA'rGrCrArGrArArGrArArGrA

[0449] EMX1 UNA 13 crRNA with a single UNA base.

[0450] rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0451] SEQ ID NO: 12 rGrArGrUrCrCrGrA / iUNA-rG / rCrArGrAiAiGiAiArGrA

[0452] EMX1 UNA 12 crRNA with a single LINA base.

[0453] r. ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0454] SEQ ID NO: 13 rGr. ArGrUrCrCrGrArG / iUNA-rC / rArGrArArGrArArGrA

[0455] EMX1 UNA 11 crRNA with a single UNA base.

[0456] r. ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0457] SEQ ID NO: 14 rGrArGrUrCrCrGrArGrC / iUNA-rA / rGrArArGrArArGrA

[0458] EMX1 UNA 10 crRNA with a single UNA base.

[0459] r. ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0460] SEQ ID NO: 15 rGrArGrUrCrCrGrArGrCrA / iUNA-rG / rArArGrArArGrA

[0461] EMX1 UNA 9rcrRNA with a single UNA base.

[0462] . ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0463] SEQ ID NO: 16 rGrArGrUrCrCrGrArGrCrArG / iUNA-rA / rArGrArArGrA

[0464] EMX1 UNA 8 crRNA with a single UNA base.

[0465] rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0466] SEQ ID NO: 17 rGr ArGrUrCrCrGr ArGrCr ArGr A i UN A-r A / rGr Ar ArGr A

[0467] EMX1 UNA 7 crRNA with a single LINA base.

[0468] rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0469] SEQ ID NO: 18 EMX1 UNA 6 rGr ArGrUrCrCrGr ArGrCr ArGr ArAiLTNA-rG / rArArGrA crRNA with a single UNA base.

[0470] r.'\rGrUrUrUrUrArGrArGrCrlTAmU+G*+C*mC

[0471]

[0472] Attorney Docket No.: 6391-0012WO01

[0473] SEQ ID NO: 19 EMX1 UNA 5 rGrArGrUrCrCrGrArGrCrArGrArArG / iUNA-rA / rArGrA r. ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 20 EMX1_UNA_4 rGrArGrUrCrCrGrArGrCrArGrArArGrA / 'iUNA-rA / rGrA crRNA with a single UNA base rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0474] SEQ ID NO: 21 EMX1 UNA 3 rGrArGrUrCrCrGrArGrCrArGrArArGrArA / iUNA-rG / rA crRNA with a single UNA base.

[0475] r. ArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0476] SEQ ID NO: 22 EMX1 UNA 2 rGr. ArGrUrCrCrGrArGrCrArGrArArGrArArG / ilNJA-r.'V crRNA with a single UNA base.

[0477] r. ArGrUrUrUrUrArGr. ArGrCrUrAmU+G*+C*mU

[0478] SEQ ID NO: 23 rGrArGrUrCrCrGrArGrCrArGrArArGrArArGrA / iUNA-r

[0479] EMX1 UNA 1 A / rGrUrUrUrUrArGrArGrCrUrAmU+G*+C*iiiU crRNA with a single UNA base. SEQ ID NO: 24 AR XT mG*mU*mUrGrGrArGrCrArUrCrUrGrArGrUrCrCrArG crRNA with IDT’s XT Modification rGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0480] SEQ ID NO: 25 LAG3 Site 9 XT niG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGiGrArGrG crRNA with IDT’s XT Modification.

[0481] rGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0482] SEQ ID NO: 26 AR UNA-20 / 5lNJA-rG / *mU*mUrGrGr. ArGrCrArllrCrlTrGrArGrUrC

[0483] rCrArGrGrl Jrl Jrl Jrl Jr ArGr ArGrCrt T Ami J+G*+C*ml I crRNA with a single UNA base. SEQ ID NO: 27 AR UNA 19 mG* / iUNA-rU / *mUrGrGrArGrCrArUrCrUrGrArGrUrCr Cn\rGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 28 AR_UNA_18 mG*mU* / iUNA-rU / rGrGrArGrCrArUrCrUrGrArGrUrCr CrArGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 29 AR UNA-17 mG*mU*mU / iUNA-rG / rGr. ArGrCrArUrCrUrGrArGrUr crRNA with a single UNA base.

[0484] CrCrArGrGrUrUrUrUrArGrArGrCrUr. AmU+G*+C*mU

[0485] SEQ ID NO: 30 AR UNA-16 mG*mU*mUrG / iUNA-rG / rArGrCrArUrCrLJrGrArGrtir crRNA with a single UNA base.

[0486] CrCrArGrGrlTrlTrlTrlTrArGrArGrCrUrAmlT+G*+C*mU

[0487] SEQ ID NO: 31 AR UNA 15 mG*mU*mUrGrG / iUNA-rA / rGrCrArUrCrUrGrArGrUr CrCrArGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 32 mG*mU*mUrGrGrA / iUNA-rG / rCrArUrCrUrGrArGrUr

[0488] AR_UNA_14 CrCrArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*inU crRNA with a single UNA base. SEQ ID NO: 33 AR UNA-13 mG*mU*mUrGrGrArG / iUNA-rC / rArUrCrUrGrArGrUr crRNA with a single LINA base.

[0489] CrCrArGrGrUrUrUrUrArGrArGrCrUr. AmU+G*+C*mU

[0490] SEQ ID NO: 34 AR UNA-12 mG*mU*mUrGrGr. ArGrC / iUNA-rA / rUrCrUrGrArGrlir CrCrArGrGrlTrlTrUrUrArGrArGrCrUr. AmU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 35 AR UNA-11 niG*mU*mUrGrGrArGrCrA / iLTNA-rU / rCrUrGrArGrUr CrCrArGrGrUrUrUrUrArGrArGrCrUr. AniU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 36 AR I NA 10 mG*mU*mUrGrGrArGrCrArU / iUNA-rC / rUrGrArGrUr CrCrArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 37 AR I NA 9 mG*mU*mUrGrGrArGrCrArUrC / iUNA-rU TGrArGrUr crRNA with a single LINA base.

[0491] CrCrArGrGrUrUrUrUrArGrArGrCrUr. AmU+G*+C*mU

[0492] SEQ ID NO: 38 AR UNA 8 mG*mU*mUrGrGr. ArGrCrArUrCrll / iUNA-rGrArGrlir crRNA with a single UNA base.

[0493] CrCrArGrGrLWrUrUrArGrArGrCrUrArnLT+G*+C*rnU

[0494] SEQ ID NO: 39 AR_UNA_7mG*mU*mUrGrGrArGrCrArUrCrUrG / iLTNA-rA'rGrUr CrCrArGrGrUrUrUrUrArGrArGrCrUr. AniU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 40 AR_UNA_6 mG*mU*mUrGrGrArGiGrArUrCrUrGrA / iLlNA-rG / rUr CrCrArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 41 mG*mU*mUrGrGrArGrCrArUrCrUrGrArG / iUNA-rU / r

[0495] AR UNA 5 crRNA with a single UNA base.

[0496] CrCrArGrGrUrUrUrUrArGrArGrCrUr. AmU+G*+C*mU

[0497]

[0498] Attorney Docket No.: 6391-0012WO01

[0499] SEQ ID NO: 42 mG^iU*mUrGrGrArGrCrArUrCrUrGrArGrU / iLlNA-rC

[0500] AR_UNA_4 crRNA with a single UNA base.

[0501] / rCrArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0502] SEQ ID NO: 43 AR I INA_3 mG*mU*mUrGrGrArGrCrArUrCrUrGrArGrUrC'iUNA- crRNA with a single UNA base rC / rArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0503] SEQ ID NO: 44 AR UNA 2 mG*mU*mUrGrGrArGrCrArUrCrLJrGrArGrUrCrC / iUN crRNA with a single UNA base.

[0504] A-rA / rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0505] SEQ ID NO: 45 AR UNA l mG*mU*mUrGrGrArGrCrArUrCrEIrGrArGrEJrCrCrA / i crRNA with a single UNA base.

[0506] UNA-rG / rGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU

[0507] SEQ ID NO: 46 / 5UNA-rG / *mA*mArGrGrCrUrGrArGrArUrCrCrUrGrG

[0508] LAG3s9_UNA_20 crRNA with a single UNA base.

[0509] r. ArGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0510] SEQ ID NO: 47 mG* / iUNA-rA / ^iAinGrGrCrUrGrArGrArUrCrCrUrGr

[0511] I, AG3s9_ITNA_19 crRNA with a single UNA base GrArGrGrGrUrUrUrUrArGrArGrCrUrAntU+G*+C*mU

[0512] SEQ ID NO: 48 mG*mA* / iUNA-rArGrGrCrUrGrArGrArUrCrCrUrGrGr

[0513] LAG3s9_UNA_18 crRNA with a single UNA base.

[0514] ArGrGrGrUrUrUrUrAi'GrArGrCrUrAmU+G*+C*mU

[0515] SEQ ID NO: 49 LAG3s9_EJNA_17 mG*mA*mA / iUNA-rG / rGrCrUrGrArGrArUrCrCrETrGr crRNA with a single UNA base.

[0516] GrArGrGrGrI H Tri H TrArGrArGrCrt Jr Ami J+G*+C*ml J

[0517] SEQ ID NO: 50 LAG3s9_UNA_16 mG^iA*mArG / iUNA-rG / rCrUrGrArGrArUrCrCrUrGr crRNA with a single UNA base.

[0518] Gr2VGrGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0519] SEQ ID NO: 51 mG*mA*mArGrG / iUNA-rOrUrGrArGrArUrCrCrUrGr

[0520] LAG3s9_UNA_15 GrArGrGrGrUrUrUrUrArGrArGrCrUrAntU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 52 LAG3s9_UNA_14 mG*mA*mArGrGrC / iUNA-rU / rGrArGrArUrCrCrUrGr crRNA with a single UNA base.

[0521] GrArGrGrGrUrUrUrUrArGrArGrCrUrAntU+G*+C*mU

[0522] SEQ ID NO: 53 LAG3s9_EJNA_13 mG*mA*mArGrGrCrU / iUNA-rG / r. ArGrArUrCrCrGrGr crRNA with a single UNA base.

[0523] GrArGrGrGrEWrEWrArGrArGrCrUrArnET+G*+C*mU

[0524] SEQ ID NO: 54 mG*mA*mArGrGrCrUrG / iLTNA-rA / rGrArUrCrCrUrGr

[0525] LAG3s9_UNA_12 crRNA with a single UNA base.

[0526] Gr2\rGrGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0527] SEQ ID NO: 55 mG*mA*mArGrGrCrUrGrA / iUNA-rG / rArUrCrCrUrGr

[0528] LAG3s9_UNAJl GrArGrGrGrUrUrUrUrArGrArGrCrUrAntU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 56 mG*mA*mArGrGrCrUrGrArG / iUNA-rArUrCrCrUrGr

[0529] LAG3s9_UNA_10 crRNA with a single ETNA base.

[0530] GrArGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0531] SEQ ID NO: 57 mG*mA*mArGrGrCrUrGrArGrA / iUNA-rlVrCrCrGrGr

[0532] LAG3s9_UNA_9 crRNA with a single UNA base.

[0533] GrArGrGrGrETrETrETrETrArGrArGrCrUrAmET+G*+C*mU

[0534] SEQ ID NO: 58 mG^A*mArGrGrCrUrGrArGrArU / iLJNA-rC / rCrUrGr

[0535] LAG3s9_UNA_8 crRNA with a single UNA base.

[0536] GrArGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0537] SEQ ID NO: 59 mG*mA*mArGrGrCrUrGrArGrArUrC / iUNA-rC / rUrGr

[0538] LAG3s9_E’NA_7 GrArGrGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU crRNA with a single UNA base. SEQ ID NO: 60 LAG3s9_UNA_6 mG*mA*mArGrGrCrUrGrArGrArUrCrC / iUNA-rU / rGr crRNA with a single ETNA base.

[0539] GrArGrGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU

[0540] SEQ ID NO: 61 mG*mA*mArGrGrCrUrGrArGrArUrCrCrLViUNA-rG / r

[0541] LAG3s9_UNA_5 crRNA with a single UNA base.

[0542] GrArGrGrGrETrETrETrETrArGrArGrCrUrAmET+G*+C*mU

[0543] SEQ ID NO: 62 mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrG / iUNA-rG

[0544] LAG3s9_UNA_4 crRNA with a single UNA base.

[0545] / rArGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0546] SEQ ID NO: 63 mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGrG / iUNA- LAG3s9_E’NA_3 crRNA with a single UNA base.

[0547] r. AJrGrGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0548] SEQ ID NO: 64 mG*niA*mArGrGrCrUrGrArGrArEJrCrCrUrGrGrA / iEJN

[0549] LAG3s9_UNA_2 crRNA with a single EJNA base.

[0550] A-rG / rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0551]

[0552] Attorney Docket No.: 6391-0012WO01

[0553] SEQ ID NO: 65 mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGrGrArG / i

[0554] LAG3s9_UNA_l crRNA with a single UNA base.

[0555] LWA-rG / rGrUrUrUrUrArGrArGrCrUrAiiiU+G*+C*mU

[0556] SF. Q ID NO: 66 EMX1 LNA 20 +GrArGrUrCrCrGrArGrCrArGrArArGrArArGrArArGrU crRNA with a single LNA base rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0557] SEQ ID NO: 67 rG+ArGrUrCrCrGrArGrCrArGrArArGrArArGrAiArGrU

[0558] EMX1 LNA 19 crRNA with a single LNA base.

[0559] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0560] SEQ ID NO: 68 EMX1 LNA 18 rGrA+GrUrCrCrGrArGrCrArGrArArGrArArGrArArGrU crRNA with a single LNA base.

[0561] rUrUrUr. ArGr. ArGrCrUrAmU+G*+C*mU rGrArG+TrCrCrGrArGrCrArGrArArGrArArGrArArGrU

[0562] SEQ ID NO: 69 EMX1 LNA 17rcrRNA with a single LNA base.

[0563] UrUrUrArGrArGrCrUrAmU+G*+C*mU rGrArGrU+CrCrGrArGrCrAiGrAiAiGrAiArGiAiAiGrU

[0564] SEQ ID NO: 70 EMX1 LNA 16 crRNA with a single LNA base rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0565] SEQ ID NO: 71 rGrArGrUrC+CrGrArGrCrArGrArArGrArArGrAiAiGrU

[0566] EMX1 LNA 15 crRNA with a single LNA base.

[0567] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0568] SEQ ID NO: 72 rGr. ArGrUrCrC+Gr. ArGrCrArGrArArGrArArGrArArGrU

[0569] EMX1 LNA 14 rl Tri Tri TrArGrArGrCrI Tr Ami J+G*+C*ml 1 crRNA with a single LNA base. SEQ ID NO: 73 rGrArGrUrCrCrG+ArGrCrArGrArArGrArArGrArArGrU

[0570] EMX1 LNA 13 crRNA with a single LNA base.

[0571] rUrUrUr / \rGr / \rGrCrUn\mU+G*+C*mU

[0572] SEQ ID NO: 74 TGrArGrUrCrCrGrA+GrCrArGrArArGrArArGrArArGrU

[0573] EMX1 LNA 12 crRNA with a single LNA base.

[0574] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0575] SEQ ID NO: 75 EMX1 LNA 11 rGrArGrUrCrCrGrArG+CrArGrArArGrArArGrArArGrU crRNA with a single LNA base.

[0576] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0577] SEQ ID NO: 76 rGr. ArGrUrCrCrGrArGrC+ArGrArArGrArArGrArArGrU

[0578] EMX1 LNA 10 crRNA with a single LNA base.

[0579] rUrUrUrArGrArGrCrUrAmU+G*+C*mU rGrArGrUrCrCrGrArGrCrA+GrArArGrArArGrArArGrU

[0580] SEQ ID NO: 77 EMX1 LNA 9 crRNA with a single LNA base.

[0581] rUrUrUr / \rGr / \rGrCrUn\mU+G*+C*mU rGrArGrUrCrCrGrAiGrCrAiG+AiAiGrAiAiGrAiAiGrU

[0582] SEQ ID NO: 78 EMX1 LNA 8 crRNA with a single LNA base.

[0583] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0584] SEQ ID NO: 79 EMX1 LNA 7 rGrArGrUrCrCrGrArGrCrArGrA+ArGrArArGrArArGrU crRNA with a single LNA base.

[0585] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0586] SEQ ID NO: 80 rGr. ArGrUrCrCrGrArGrCrArGrArA+GrArArGrArArGrU

[0587] EMX1 LNA 6 crRNA with a single LNA base.

[0588] rUrUrUrArGrArGrCrUrAmU+G*+C*mU rGrArGrUrCrCrGrArGrCrArGrArArG+ArArGrArArGrU SEQ ID NO: 81 EMX1 LNA 5 crRNA with a single LNA base. rUrUrUrArGrArGrCrUrAmU+G*+C*mU rGrArGrUrCrCrGrArGrCrArGrArArGrA+ArGrArArGrU

[0589] SEQ ID NO: 82 EMX1 LNA 4 rUrUrUrArGrAiGrCrUrAmU+G*+C*niU crRNA with a single LNA base. SEQ ID NO: 83 rGrArGrUrCrCrGrArGrCrArGrAiAiGrArA+GrArArGrU

[0590] EMX1 LNA 3 crRNA with a single LNA base.

[0591] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0592] SEQ ID NO: 84 EMX1 LNA 2 rGr. ArGrUrCrCrGrArGrCrArGrArArGrArArG+ArArGrU crRNA with a single LNA base.

[0593] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0594] rGr.4rGrUrCrCrGr.4rGrCr. ArGr Ar ArGr Ar ArGrA+ArGrU

[0595] SEQ ID NO: 85 EMX1 LNA 1rcrRNA with a single LNA base.

[0596] UrUrUrArGrArGrCrUrAmU+G*+C*mU / 52FG / rArGrUrCrCrGrArGrCrArGrArArGrArArGrArAr crRNA with a single 2'Fluoro SEQ ID NO: 86 EMXl_2Fluor_20

[0597] GrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU modification.

[0598] SEQ ID NO: 87 crRNA with a single 2'Fluoro EMXl_2Fluor_19 rG / i2FA / iGrUrCrCrGrArGrCrArGrArArGrArArGrArAr GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0599]

[0600] Attorney Docket No.: 6391-0012WO01

[0601] crRNA with a single 2'Fluoro SEQ ID NO: 88 EMXl_2Fluor_18 rGrA / i2FG / rUiCrCrGrArGrCrArGrArArGrArArGrArAr

[0602] modification. GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU

[0603] SF. Q ID NO: 89 crRNA with a single 2'Fluoro EMXl_2F1uor_17 rGrArG / i2FU / rCrCrGrArGrCrArGrArArGrArArGrArAr

[0604] modification. GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU rGrArGrU / i2FC / rCrGrArGrCrArGrArArGrArArGrArAr crRNA with a single 2'Fluoro SEQ ID NO: 90 EMXl_2Fluor_16 modification. GrUrUrLWrArGrArGrCrUrAmU+G*+C*mU rGr. ArGrUrC / i2FC / rGrArGrCr. ArGr. Ar. ArGrArArGrArAr crRNA with a single 2'Fluoro SEQ ID NO: 91 EMXl_2Fluor_15

[0605] modification GrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0606] crRNA with a single 2'Fluoro rGrArGrUrCrC / i2FG / rArGrCrArGrArArGrArArGrArAr

[0607] SEQ ID NO: 92 EMXl_2Fluor_14 modification. GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU rGrArGrUrCrCrG / i2FA / rGrCrArGrArArGrAiAiGrAiAr crRNA with a single 2'Fluoro SEQ ID NO: 93 EMXl_2F1uor_13 modification. GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU rGrArGrUrCrCrGrA / i2FG / rCrArGrArArGrArArGrArAr crRNA with a single 2'Fluoro SEQ ID NO: 94 EMXl_2Fluor_12 modification. GrUrUrLWrArGrArGrCrUrAmU+G*+C*mU

[0608] rGr. ArGrUrCrCrGrArG / 'i2FG rArtirAr.lrtirArArGrArAr crRNA with a single 2'Fluoro SEQ ID NO: 95 EMXl_2Fluor_l 1 Grl Tri Tri Tri Tr ArGr ArGrCrI Tr Ami '+G*+C*ml T modification crRNA with a single 2'Fluoro rGrArGrUrCrCrGrArGrC / i2FA / rGrArArGrArArGrArAr SEQ ID NO: 96 EMXl_2Fluor_10 modification. GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU

[0609] crRNA with a single 2'Fluoro TGrArGrUrCrCrGrArGrCrA / i2FG / rArArGrArArGrArAr SEQ ID NO: 97 EMXl_2Fluor_9 modification. GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU rGrArGrUrCrCrGrArGrCrArG'i2FA / rArGrArArGrArAr crRNA with a single 2'Fluoro SEQ ID NO: 98 EMXl_2Fluor_8 modification. GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0610] crRNA with a single 2'Fluoro rGrArGrUrCrCrGrArGrCrArGrA'i2FA / rGrArArGrArAr SEQ ID NO: 99 EMXl_2Fluor_7

[0611] modification. GrUrUrLTrUrArGrArGrCrUrAmU+G*+C*mU

[0612] crRNA with a single 2'Fluoro rGrArGrUrCrCrGrArGrCrArGrArA'i2FG / rArArGrArAr

[0613] JEQIDNO: 100 ENIXl_2Fluor_6 modification. GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU

[0614] crRNA with a single 2'Fluoro rGrArGrUrCrCrGrArGrCrArGrArArG / i2FA / rArGrArAr

[0615] JEQIDNO: 101 EMXl_2Fluor_5 modification. GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU rGrArGrUrCrCrGrArGrCrArGiAiAiGiA / i2FArGrArAr crRNA with a single 2'Fluoro TEQIDNO: 102 EMXl_2Fluor_4

[0616] modification. GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0617] crRNA with a single 2'Fluoro rGrArGrUrCrCrGrArGrCrArGrArArGrArA / i2FG / rArAr JEQIDNO: 103 EMXl_2Fluor_3 modification. GrUrUrLTrUrArGrArGrCrUrAmU+G*+C*mU

[0618] crRNA with a single 2'Fluoro rGrArGrUrCrCrGrArGrCrArGrArArGrArArG / i2FA'rAr JEQIDNO: 104 EMXl_2Fluor_2 modification. GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU rGrArGrUrCrCrGrArGrCrArGrArArGrArArGrAi2FA / 'r crRNA with a single 2'Fluoro JEQIDNO: 105 EMXl_2Fluor_l modification. GrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU +GrUrUrGrGrArGrCrArUrCrUrGrArGrUrCrCrArGrGr(J TEQIDNO: 106 crRNA with a single LNA base. AR LNA 20

[0619] rUrUrUrArGrArGrCrUrAmU+G*+C*mU rG+TrUrGrGrArGrCrArUrCrUrGrArGrUrCrCrArGrGrU JEQIDNO: 107 crRNA with a single LNA base. AR LNA 19 rUrUrUrArGrArGrCrUrAmU+G*+C*mU rGrU+TrGrGr. ArGrCr. ArUrCrUrGrArGrUrCrCrArGrGrU

[0620] JEQIDNO: 108 AR LNA 18 crRNA with a single LNA base.

[0621] rLTrUrUrArGrArGrCrUrAmU+G*+C*mU rGrUrU+GrGrArGrCrArUrCrUrGrArGrUrCrCrArGrGrU

[0622] JEQIDNO: 109 AR LNA 17 crRNA with a single LNA base.

[0623] rUrUrUrArGrArGrCrUrAmU+G*+C*mU rGrUrUrG+GrArGrCrArUrCrUrGrArGrUrCrCrArGrGrU 1EQIDNO: 110 crRNA with a single LNA base. AR LNA 16

[0624] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0625]

[0626] Attorney Docket No.: 6391-0012WO01

[0627] 1EQIDNO: 111 AR LNA 15 rGrUrUrGrG+ArGrCrArUrCrUrGrArGrUrCrCrArGrGrU rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0628] 1EQIDNO: 112 AR LNA 14 rGrUrUrGrGrA+GrCrArUrCrUrGrArGrUrCrCrAiGrGrU crRNA with a single LNA base rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0629] 1EQ ID NO: 113 AR LNA 13 rGrUrUrGrGrArG+CrArUrCrUrGrArGrUrCrCrArGrGrU crRNA with a single LNA base.

[0630] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0631] 1EQ ID NO: 114 AR LNA 12 rGrUrUrGrGrArGrC+ArUrCrUrGrArGrUrCrCrArGrGrU crRNA with a single LNA base.

[0632] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0633] 1EQIDNO: 115 AR LNA ll rGrUrUrGrGrArGrCrA+TrCrUrGrArGrUrCrCrArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base. rGrUrUrGrGrArGrCrAiU+CrLTiGrAiGrUrCrCiAiGrGrU

[0634] 1EQIDNO: 116 AR LNA 10 crRNA with a single LNA base rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0635] 1EQ ID NO: 117 AR LNA 9 rGrUrUrGrGrArGrCrArUrC+TrGrArGrUrCrCrArGrGrU crRNA with a single LNA base.

[0636] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0637] 1EQIDNO: 118 AR LNA 8 rGrUrUrGrGrArGrCrArUrCrU+GrArGrUrCrCrArGrGrU

[0638] rl Tri Tri TrArGrArGrCrI Tr Ami T+G*+C*ml T crRNA with a single LNA base.

[0639] 1EQIDNO: 119 AR LNA 7 rGrUrUrGrGrArGrCrArUrCrUrG+ArGrUrCrCrArGrGrU rUrUrUr / \rGr / \rGrCrUn\mU+G*+C*mU crRNA with a single LNA base.

[0640] 1EQIDNO: 120 AR LNA 6 TGrUrUrGrGrArGrCrArUrCrUrGrA+GrUrCrCrArGrGrU rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0641] 1EQIDNO: 121 AR_LNA_5 rGrUrUrGrGrArGrCrArUrCrUrGrArG+TrCrCrArGrGrU crRNA with a single LNA base.

[0642] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0643] 1EQIDNO: 122 AR LNA 4 rGrUrUrGrGrArGrCrArUrCrUrGrArGrU+CrCrArGrGrU crRNA with a single LNA base.

[0644] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0645] 1EQIDNO: 123 rGrUrUrGrGrArGrCrArUrCrUrGrArGrUrC+CrArGrGrU

[0646] AR LNA 3 rUrUrUr / \rGr / \rGrCrUn\mU+G*+C*mU crRNA with a single LNA base.

[0647] rGrUrUrGrGrAiGrCrAiUrCrUrGtAiGrUrCrC+AiGrGrU

[0648] 1EQIDNO: 124 AR LNA 2 rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0649] 1EQIDNO: 125 AR LNA l rGrUrUrGrGrArGrCrArUrCrUrGrArGrUrCrCrA+GrGrU crRNA with a single LNA base.

[0650] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0651] 1EQIDNO: 126 LAG3_LNA_20 +GrArArGrGrCrUrGrArGrArUrCrCrUrGrGrArGrGrGrU crRNA with a single LNA base.

[0652] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0653] 1EQIDNO: 127 LAG3 LNA 19 rG+ArArGrGrCrUrGrArGrArUrCrCrUrGrGrArGrGrGrU rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0654] 1EQIDNO: 128 rGrA+. ArGrGrCrUrGrArGrArLTrCrCrUrGrGrArGrGrGrU

[0655] LAG3 LNA 18 rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0656] 1EQIDNO: 129 LAG3 LNA 17 rGrArA+GrGrCrUrGrArGrArUrCrCrUrGrGrAiGrGrGrU crRNA with a single LNA base.

[0657] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0658] 1EQIDNO: 130 LAG3 LNA 16 rGrArArG+GrCrUrGrArGrArUrCrCrUrGrGrArGrGrGrU crRNA with a single LNA base.

[0659] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0660] 1EQIDNO: 131 rGrArArGrG+CrUrGrArGrArUrCrCrUrGrGrArGrGrGrU

[0661] LAG3 LNA 15rLTrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0662] rGrArArGrGrC+TrGrArGrArUrCrCrUrGrGrArGrGrGrU

[0663] 1EQIDNO: 132 LAG3 LNA 14 rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0664] 1EQIDNO: 133 LAG3 LNA 13 rGrArArGrGrCrU+GrArGrArUrCrCrUrGrGrAiGiGiGrU crRNA with a single LNA base.

[0665] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0666]

[0667] Attorney Docket No.: 6391-0012WO01

[0668] JEQIDNO: 134 rGrArArGrGrCrLAG+ArGrArLACrCrUrGrGrArGrGrGrU

[0669] LAG3 LNA 12 rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base. JF. QIDNO: 135 I. AG3 LNAJ 1 rGrArArGrGrCrUrGrA+GrArUrCrCrUrGrGrAiGrGiGrU crRNA with a single LNA base rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0670] JEQIDNO: 136 LAG3 LNA 10 rGrArArGrGrCrUrGrArG+ArUrCrCrUrGrGrArGrGrGrU crRNA with a single LNA base.

[0671] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0672] JEQIDNO: 137 LAG3 LNA 9 rGr. Ar. ArGrGrCrUrGrArGrA+TrCrCrlirGrGrArGrGrGrU crRNA with a single LNA base.

[0673] rUrUrUr. ArGr. ArGrCrUrAmU+G*+C*mU

[0674] JEQIDNO: 138 rGrArArGrGrCrUrGrArGrArU+CrCrUrGrGrArGrGrGrU

[0675] LAG3 LNA 8rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base.

[0676] rGrArArGrGrCrUrGrAiGrAiUrC+CrUrGrGrAiGrGiGrU

[0677] JF. QIDNO: 139 I. AG3 I. NA 7 crRNA with a single LNA base rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0678] JEQIDNO: 140 LAG3 LNA 6 rGr. ArArGrGrCrUrGrArGrArUrCrC+TrGrGrAiGrGrGrU crRNA with a single LNA base.

[0679] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0680] JEQIDNO: 141 LAG3 LNA 5 rGr. Ar. ArGrGrCrUrGrArGrArGrCrCrU+GrGrArGrGrGrU

[0681] rt Jrt Jrt JrArGrArGrCrt Ir Ami J+G*+C*ml T crRNA with a single LNA base. JEQIDNO: 142 LAG3 LNA 4 rGrArArGrGrCrUrGrArGrArUrCrCrUrG+GrArGrGrGrU rUrUrUr / \rGr / \rGrCrUn\mU+G*+C*mU crRNA with a single LNA base. JEQIDNO: 143 LAG3 LNA 3 rGrArArGrGrCrUrGrArGrArUrCrCrUrGrG+ArGrGrGrU rUrUrUrArGrArGrCrUrAmU+G*+C*mU crRNA with a single LNA base. JEQIDNO: 144 LAG3 LNA 2 rGrArArGrGrCrUrGrArGrArUrCrCrUiGrGrA+GrGrGiU crRNA with a single LNA base.

[0682] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0683] JEQIDNO: 145 LAG3 LNA 1 rGrArArGrGrCrUrGrArGrArUrCrCrUrGrGrArG+GrGrU crRNA with a single LNA base.

[0684] rUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0685] crRNA with a single 2'Fluoro JEQIDNO: 146 AR_2Fluoro_20 / 52FG / rUrUrGrGrArGrCrArUrCrUrGrArGrUrCrCrArGr GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU modification. rG / i2FU / rUiGrGrArGrCrArUrCrUrGrArGrUrCrCrArGr crRNA with a single 2'Fluoro JEQIDNO: 147 AR_2Fluoro_19 GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU modification.

[0686] JEQIDNO: 148 AR_2Fluoro_18 rGrU / i2FU / rGrGrArGrCrArUrCrUrGrArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0687] JEQIDNO: 149 AR_2Fluoro_17 rGrUrU / i2FG / rGrArGrCrArUrCrUrGr. ArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrLWrArGrArGrCrUrAmU+G*+C*mU modification.

[0688] JEQIDNO: 150 AR_2Fluoro_16 rGrUrUrG / i2FG / rArGrCrArUrCrUrGrArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU modification.

[0689] JEQIDNO: 151 AR_2Fluoro_15 rGrUrUrGrG / i2FA / rGrCrArUrCrUrGrArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU modification.

[0690] JEQIDNO: 152 AR_2Fluoro_14 rGrUrUrGrGrA / i2FG / rCrArUrCrUrGrArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0691] JEQIDNO: 153 AR_2Fluoro_13 rGrUrUrGrGrArG / i2FC / rArUrCrUrGrArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrLWrArGrArGrCrUrAmU+G*+C*mU modification.

[0692] crRNA with a single 2'Fluoro JEQIDNO: 154 AR_2Fluoro_12 rGrUrUrGrGrArGrC / i2FA / rLTrCrUrGrArGrUrCrCrArGr GrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU modification.

[0693] crRNA with a single 2'Fluoro JEQIDNO: 155 AR_2Fluoro_l 1 rGrUrUrGiGrArGrCrA / i2FIT / rCrUrGrArGrUrCrCrArGr GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU modification.

[0694] JEQIDNO: 156 AR_2Fluoro_10 rGrUrUrGrGrArGrCrArU / i2FC / rUrGrArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAmL’+G*+C*mU modification.

[0695]

[0696] Attorney Docket No.: 6391-0012WO01

[0697] JEQ ID NO: 157 AR_2Fluoro_9 rGrUrUrGrGrArGrCrArUrC / i2FU / rGrArGrLTrCrCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU modification. JEQ ID NO: 158 AR_2Fluoro_8 rGrUrUrGrGrArGrCrArUrCrU / i2FG / rArGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGiCrUrAmU+G*+C*mU modification. JEQ ID NO: 159 AR_2Fluoro_7 rGrUrUrGrGrArGrCrArUrCrUrG'i2FA / rGrUrCrCrArGr crRNA with a single 2'Fluoro GrUrUrLWrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 160 AR_2Fluoro_6 r<rrl ’rl ’r(rr(rr.\.r(irCrArI ’rCrl ’r(ir \ i 21 (i rl ’rCrCrAr(ir crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU modification crRNA with a single 2'Fluoro JEQ ID NO: 161 AR_2Fluoro_5 rGrUrUrGrGrArGrCrArUrCrUrGrArG / i2FU / rCrCrArGr GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU modification. JEQ ID NO: 162 AR_2Fluoro_4 rGrUrUrGrGrArGrCrArUrCrUrGrArGrU / i2FC / rCrArGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGiCrUrAmU+G*+C*mU modification. JEQ ID NO: 163 AR_2Fluoro_3 rGrUrUrGrGrArGrCrArUrCrUrGrArGrUrC / i2FG'rArGr crRNA with a single 2'Fluoro GrUrUrLWrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 164 AR_2Fluoro_2 rGrUrUrGrGrArGrCrArUrCrUrGrArGrUrCrC / i2FA / rGr crRNA with a single 2'Fluoro GrI Tri TrI Tri r ArGr ArGrCrt Tr Ami '+G*+C*ml T modification JEQ ID NO: 165 AR_2Fluoro_l rGrUrUrGrGrArGrCrArUrCrUrGrArGrUrCrCrA / i2FG / r crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU modification. JEQ ID NO: 166 LAG3_2Fluoro_20 / 52FG / rArArGrGrCrUrGrArGrArUrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU modification. JEQ ID NO: 167 LAG3_2Fluoro_19 rG / i2FA / rArGrGrCrUrGrArGrArUrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 168 LAG3_2Fluoro_18 rGr. A 'i2FA 'rGrGrCrUrGrArGr.'XrUrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro GrUrUrLTrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0698] crRNA with a single 2'Fluoro JEQ ID NO: 169 LAG3_2Fluoro_17 rGrArA / i2FG / iGrCrUrGrArGrArUrCrCrUrGrGrArGrGr GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU modification.

[0699] crRNA with a single 2'Fluoro JEQ ID NO: 170 rGrArArG / i2FG / rCrUrGrAiGrArUrCrCrUrGrGrArGrGr

[0700] LAG3_2Fluoro_16 GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU modification. JEQ ID NO: 171 LAG3_2Fluoro_15 rGrArArGrG / i2FC / rUrGrArGrArUrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. 1-GrArArGrGrC 'i2FU / rGrArGr. ArUrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro JEQ ID NO: 172 LAG3_2Fluoro_14

[0701] GrUrUrLTrUrArtjrArt3rCrUrAmU+G*+C*mU modification. JEQ ID NO: 173 LAG3_2Fluoro_13 rGrArArGrGrCrU / i2FG / rArGrArUrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU modification. JEQ ID NO: 174 crRNA with a single 2'Fluoro LAG3_2Fluoro_12 rGrArArGrGrCrUrG / i2FA / rGrArUrCrCrUrGrGrArGrGr GrUrUrUrUrArGrArGrCrUrAmL+G*+C*mU modification. JEQ ID NO: 175 LAG3_2Fluoro_l 1 rGrArArGrGrCrUrGrA / i2FG / rArUrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro GrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. rGrArArGrGrCrUrGrArG / 'i2FA WrCrCrUrGrGrArGrGr crRNA with a single 2'Fluoro JEQ ID NO: 176 LAG3_2Fluoro_10 modification. GrUrUrLTrUrArt3rArGrCrUrAmU+G*+C*mU

[0702] crRNA with a single 2'Fluoro rGrArArGrGrCrUrGrArGrA / i2FU / rCrCrUrGrGrArGrGr JEQ ID NO: 177 LAG3_2Fluoro_9 modification. GrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0703] crRNA with a single 2'Fluoro rGrArArGrGrCrUrGrArGrArU / i2FC / rCrUrGrGrArGrGr JEQ ID NO: 178 LAG3_2Fluoro_8 modification. GrUrUrUrUrArGrArGrCrUrAmL+G*+C*mU

[0704] rGrArArGrGrCrUrGrArGrArUrC i2FC / rUrGrGrArGrGr crRNA with a single 2'Fluoro JEQ ID NO: 179 LAG3_2Fluoro_7 modification. GrUrUrUrUrArGrArGrCrUrAmL’+G*+C*mU

[0705]

[0706] Attorney Docket No.: 6391-0012WO01

[0707] crRNA with a single 2'Fluoro JEQ ID NO: 180 LAG3_2Fluoro_6 rGrArArGrGrCrUrGrArGrArUrCrC / i2FU / rGrGrArGrGr

[0708] modification. GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU

[0709] JEQ ID NO: 181 crRNA with a single 2'Fluoro I, AG3_2Fluoro_5 rGrArArGrGrCrUrGrArGrArUrCrCrU / i2FG / rGrArGrGr

[0710] modification. GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU rGr. ArArGrGrCrUrGrArGrArUrCrCrUrG / i2FG-rArGrGr crRNA with a single 2'Fluoro JEQ ID NO: 182 LAG3_2Fluoro_4

[0711] modification. GrUrUrLWrArGrArGrCrUrAmU+G*+C*mU rGr. Ar. ArGrGrCrUrGrArGrArNrCrCrUrGrG / i2FA'rGrGr crRNA with a single 2'Fluoro JEQ ID NO: 183 LAG3_2Fluoro_3

[0712] modification GrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0713] crRNA with a single 2'Fluoro rGrArArGrGrCrUrGrArGrArUrCrCrUrGrGrA / i2FG / rGr

[0714] JEQ ID NO: 184 LAG3_2Fluoro_2 modification. GrUrUrUrUrArGrArGrCrUrAinL+G*+C*mU

[0715] crRNA with a single 2'Fluoro rGrArArGrGrCrUrGrArGrArUrCrCrUrGrGrArG / i2FG / r JEQ ID NO: 185 I, AG3_2Fluoro_1 modification. GrUrUrUrUrArGrArGrCrUrAniL+G*+C*mU / 5SpC3 / *mU*mUrGrGrArGrCrArUrCrUrGrArGrUrCrCr

[0716] crRNA with a single C3 spacer JEQ ID NO: 186 AR_c3_20 / \rGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU(SEQ modification. ID NO: 186)

[0717] mG* / iSpC3 / *mUrGrGrAiGrCrArUrCrUrGrArGrUrCrCr

[0718] crRNA with a single C3 spacer JEQ ID NO: 187 AR_c3_19 ArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU (SEQ modification ID NO: 187)

[0719] mG*mU* / iSpC3 / rGrGrAiGrCrArUrCrUrGrArGrUrCrCr crRNA with a single C3 spacer JEQ ID NO: 188 AR_c3_18 ArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SEQ modification.

[0720] ID NO: 188)

[0721] mG*mU*mU / iSpC3 / rGrArGrCrArUrCrUrGrArGrUrCrC crRNA with a single C3 spacer JEQ ID NO: 189 AR_c3_17 rArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. (SEQIDNO: 189)

[0722] mG*mU*mUrG / iSpC3 / rArGrCrArUrCrUrGr. ArGrUrCrC

[0723] crRNA with a single C3 spacer JEQ ID NO: 190 AR_c3_16 rArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. (SEQIDNO: 190)

[0724] mG*mU*mUrGrG / iSpC3 / rGrCrArUrCrUrGrArGrUrCrC crRNA with a single C3 spacer JEQ ID NO: 191 AR_c3_15 r. ArGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*niU

[0725] modification. (SEQIDNO: 191)

[0726] mG*mU*mUrGrGrA / iSpC3 / rCrArUrCrUrGrArGrUrCrC crRNA with a single C3 spacer JEQ ID NO: 192 AR_c3_14 rArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0727] (SEQIDNO: 192)

[0728] mG*mU*mUrGrGrArG / iSpC3 / rArUrCrUrGrArGrUrCrC crRNA with a single C3 spacer JEQ ID NO: 193 AR_c3_13 rArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0729] (SEQIDNO: 193)

[0730] mG*mU*mUrGrGrArGrC / iSpC3 / rUrCrUrGrArGrUrCrC

[0731] crRNA with a single C3 spacer JEQ ID NO: 194 AR_c3_12 rArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. (SEQIDNO: 194)

[0732] mG*mU*mUrGrGrArGrCrA / iSpC3 / rCrUrGrArGrUrCrC crRNA with a single C3 spacer JEQ ID NO: 195 AR_c3_l 1 rArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. (SEQIDNO: 195)

[0733] mG*m(J*mUrGrGrArGrCrArU (SEQ ID NO: 196) crRNA with a single C3 spacer JEQ ID NO: 196 AR_c3_10 / iSpC3 / rUrGrArGrUrCrCrAiGrGiUrUrUrUrArGrArGrCr modification.

[0734] UrAmU+G*+C*mU (SEQ ID NO: 649)

[0735] mG*mU*mUrGrGrArGrCrArUrC (SEQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 197 AR_c3_9 197) / iSpC3 / rGrArGrUrCrCrArGrGrUrUrUrUrArGrArGr modification.

[0736] CrUrAmU+G*+C*mU (SEQ ID NO: 650)

[0737] mG*mU*mUrGrGrArGrCrArUrCrU(SEQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 198 AR_c3_8 198) / iSpC3 / rArGrUrCrCrArGrGrUrUrUrUrArGrArGrCr modification. UrAmU+G*+C*mU(SEQ ID NO: 651)

[0738] mG*mU*mUrGrGrArGrCrArUrCrUrG(SEQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 199 AR_c3_7 199) / iSpC3 / rGrUrCrCrAiGrGrUrUrUrUrArGrArGrCrUr

[0739] modification. AmU+G*+C*mU (SEQ ID NO: 652)

[0740] mG*mU*mUrGrGrArGrCrArUrCrUrGrA (SEQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 200 AR_c3_6 200) / iSpC3 / rUrCrCrArGrGrUrUrUrUrArGrArGrCrUrA modification.

[0741] mU+G*+C*mU (SEQ ID NO: 653)

[0742] mG*mU*mUrGrGrArGrCrArUrCrl 'rGrArG (SEQ ID

[0743] NO: crRNA with a single C3 spacer JEQ ID NO: 201 AR_c3_5

[0744] 201) / iSpC3 / rCrCrArGrGrUrUrUrUr. ArGr. ArGrCrUrAmU modification. G!C*ml ' (SEQ ID NO: 654)

[0745] mG*mU*mUrGrGrArGrCrArUrCrUrGrArGrU (SEQ ID crRNA with a single C3 spacer JEQ ID NO: 202 AR_c3_4 NO:

[0746] modification.

[0747] 202) / iSpC3 / rCrArGrGrUrUrUrUrArGrArGrCrUrAmU+G

[0748]

[0749] Attorney Docket No.: 6391-0012WO01

[0750] *+C*mU(SEQIDNO: 655)

[0751] mG*mU*mUrGrGrArGrCrArUrCrUrGrArGrUrC(SEQ

[0752] ID NO: crRNA with a single C3 spacer JEQ ID NO: 203 AR_c3_3

[0753] 203) / iSpC3 / rArGrGrUrUrUrUrArGrArGrCrUrAmU-G* modification +C*mU(SEQ ID NO: 656)

[0754] mG*niU*mUrGrGrArGrCrArLTrCrUrGrArGrUrCrC(SEQ

[0755] ID NO: crRNA with a single C3 spacer JEQ ID NO: 204 AR_c3_2

[0756] 204) / iSpC3 / rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C modification. *mU(SEQ ID NO: 657)

[0757] mG*mU*mUrGrGrArGrCrArUrCrUrGrAiGrUrCrCrA(S

[0758] JEQ ID NO: 205 AR_c3_l EQ ID NO: crRNA with a single C3 spacer 205) / iSpC3 / rGrUrUrUrUrArGrArGrCrUrAmU+G*+C*m modification. UfSEQIDNO: 658)

[0759] / 5SpC3 / *mA*mArGrGrCrNrGrArGrArUrCrCrUrGrGr. Ar crRNA with a single C3 spacer JEQ ID NO: 206 LAG3s9_c3_20 GrGrGrLWrLWrArGrArGrCrUrAmU+G*+C*mU(SEQ modification.

[0760] ID NO: 206)

[0761] mG* / iSpC3 / *mAmGrGrCrLTrGr. ArGrArUrCrCrUrGrGr. A

[0762] crRNA with a single C3 spacer JEQ ID NO: 207 LAG3s9_c3_19 rGrGrGrLWrLTrLTrArGrArGrCrUrArnLT+G*+C*mU

[0763] (SEQ ID NO: 207) modification. mG*mA* / iSpC3 / rGrGrCrUrGrArGrArUrCrCrUrGrGrAr

[0764] JEQ ID NO: 208 LAG3s9_c3_18 crRNA with a single C3 spacer GrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SEQ

[0765] ID NO: 208) modification. mG*mA*mA / iSpC3 / rGrCrUrGrArGrArUrCrCrUrGrGrA crRNA with a single C3 spacer JEQ ID NO: 209 LAG3s9_c3_17 rGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SE modification.

[0766] Q ID NO: 209)

[0767] mG*mA*mArG / iSpC3 / rCrUrGrArGrArUrCrCrUrGrGrA crRNA with a single C3 spacer JEQ ID NO: 210 LAG3s9_c3_16 rGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SE modification.

[0768] Q ID NO: 210)

[0769] mG*mA*mArGrG / iSpC3 / rUrGrArGrArUrCrCrUrGrGrA

[0770] JEQ ID NO: 211 crRNA with a single C3 spacer LAG3s9_c3_15 rGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SE

[0771] Q ID NO: 211) modification. mG*m A*mArGrGrC / i SpC3 'rGrArGrArUrCrCrUrGrGr A

[0772] JEQ ID NO: 212 LAG3s9_c3_14 crRNA with a single C3 spacer rGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SE modification. Q ID NO: 212)

[0773] mG*mA*mArGrGrCrU / iSpC3 / rArGrArUrCrCrUrGrGrA crRNA with a single C3 spacer JEQ ID NO: 213 LAG3s9_c3_13 rGrGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU(SE modification.

[0774] Q ID NO: 213)

[0775] mG*mA*mArGrGrCrUrG / iSpC3 rGrArUrCrCrUrGrGrA crRNA with a single C3 spacer JEQ ID NO: 214 LAG3s9 c3 12 rGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SE modification.

[0776] Q ID NO: 214)

[0777] mG*m A*m ArGrGrCrUrGrA / i SpC3 r ArUrCrCrUrGrGr A crRNA with a single C3 spacer JEQ ID NO: 215 LAG3s9_c3_l 1 rGrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SE

[0778] Q ID NO: 215) modification. mG*mA*mArGrGrCrUrGrArG(SEQ ID NO:

[0779] JEQ ID NO: 216 LAG3s9_c3_10 crRNA with a single C3 spacer 216) / iSpC3 / rUrCrCrUrGrGrArGrGrGrUrUrUrUrArGrAr modification. GrCrUrAmU+G*+C*mU(SEQ ID NO: 659)

[0780] mG*mA*mArGrGrCrUrGrArGrA(SEQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 217 LAG3s9_c3_9 217) / iSpC3 / rCrCrUrGrGrArGrGrGrUrUrUrUrArGrArGr modification.

[0781] CrLrAmU+G*+C*mU(SEQ ID NO: 660)

[0782] mG*mA*mArGrGrCrUrGrArGrArU(SEQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 218 LAG3s9 c3 8 218) / iSpC3 / rCrUrGrGrArGrGrGrUrUrUrUrArGrArGrCr modification.

[0783] UrAmU+G*+C*mU(SEQ ID NO: 661)

[0784] mG*m A*m ArGrGrCrt JrGrArGrArt JrC(SF. Q ID NO:

[0785] JEQ ID NO: 219 LAG3s9_c3_7 crRNA with a single C3 spacer 219) / iSpC3 / rUrGrGrArGrGrGrUrUrLTrLTrArGrArGrCrUr modification. AmU+G*+C*mU(SEQ ID NO: 662)

[0786] mG*mA*mArGrGrCrUrGrArGrArUrCrC(SEQ ID NO:

[0787] JEQ ID NO: 220 crRNA with a single C3 spacer LAG3s9_c3_6 220) / iSpC3 / rGrGrArGrGrGrUrUrUrUrArGrArGrCrUrA modification.

[0788] mU+G*+C*mU(SEQ ID NO: 663)

[0789] mG*mA*m. ArGrGrCrUrGrArGrArUrCrCrU(SEQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 221 LAG3s9_c3_5 221) / iSpC3 / rGrArGrGrGrUrUrUrUr. ArGrArGrCrUrAmU

[0790] modification. +G*+C*mU(SEQ ID NO: 664)

[0791] mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrG(SEQID

[0792] NO: crRNA with a single C3 spacer JEQ ID NO: 222 LAG3s9_c3_4

[0793] 222) / iSpC3 / rArGrGrGrUrUrUrUrArGrArGrCrUrAmU+ modification. G*+C*mU(SEQ ID NO: 665)

[0794] mG*mA*mArGrGrCrUrGr. ArGr. ArUrCrCrUrGrG(SEQ

[0795] JEQ ID NO: 223 crRNA with a single C3 spacer LAG3s9_c3_3 ID NO:

[0796] modification.

[0797]

[0798] 223) / iSpC3 / rGrGrGrUrUrUrUrArGrArGrCrUrAmU-G* Attorney Docket No.: 6391-0012WO01

[0799] +C*mU(SEQ ID NO: 666)

[0800] mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGrGrA(SEQ

[0801] ID NO: crRNA with a single C3 spacer JEQ ID NO: 224 LAG3s9_c3_2 224) / iSpC3 / rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C modification *mU(SEQ ID NO: 667)

[0802] mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGrGrArG(S

[0803] EQ ID NO: crRNA with a single C3 spacer JEQ ID NO: 225 LAG3s9_c3_l

[0804] 225) / iSpC3 / rGrUrUrUrUrArGrAiGrCrUrAmU+G*+C*m modification. U(SEQIDNO: 668)

[0805] / 5SpC3 / *mA*mGrUrCrCrGrArGrCrArGrArArGrArArGr crRNA with a single C3 spacer JEQ ID NO: 226 EMX1 C3 20 ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SEQ modification.

[0806] ID No: 226)

[0807] mG* / iSpC3 / *mGrUrCrCrGrArGrCrArGrArArGrArArGr crRNA with a single C3 spacer JEQ ID NO: 227 EMXl_c3_19 ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SEQ modification.

[0808] ID No: 227)

[0809] mG*m A* / i SpC3 / rUrCrCrGr ArGrCrArGrArArGrArArGr

[0810] JEQ ID NO: 228 EMXl_c3_18 crRNA with a single C3 spacer ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU(SEQ modification. ID No: 228)

[0811] mG*mA*mG / iSpC3 / rCrCrGrArGrCrArGrArArGrArArG

[0812] JEQ ID NO: 229 crRNA with a single C3 spacer EMXl_c3_17rArArGrUrUrUrUrArGrArGrCrUrAmU I G* I C*mU(SE

[0813] Q ID No: 229) modification. mG*mA*mGrU / iSpC3 / rCrGrArGrCrArGrAiAiGiArArG crRNA with a single C3 spacer JEQ ID NO: 230 EMX1 C3 16 rAr ArGrUrUrUrUrArGr ArGrCrUrAmU+G*+C*mU(SE modification.

[0814] Q ID No: 230)

[0815] mG*mA*mGrUrC / iSpC3 / rGrArGrCrArGrArArGrArArG crRNA with a single C3 spacer JEQ ID NO: 231 EMX1 c3 15 rAr ArGrUrUrUrUrArGr ArGrCrUrAmU+G*+C*mU(SE modification.

[0816] Q ID No: 231)

[0817] mG*m A*mGrt TrCrC / i SpC3,'r ArGrCr ArGr Ar ArGr Ar ArG

[0818] JEQ ID NO: 232 EMXl_c3_14 crRNA with a single C3 spacer rAr ArGrUrUrUrUrArGr ArGrCrUrAmU+G*+C*mU

[0819] (SEQIDNo: 232) modification. mG*mA*mGrUrCrCrG / iSpC3 / rGrCrArGrArArGrArArG

[0820] JEQ ID NO: 233 crRNA with a single C3 spacer EMXl_c3_13 rArArGrUrUrUrUrArGrArGrCrUrAmU I G* I C*mU(SE

[0821] Q ID No: 233) modification. mG*mA*mGrUrCrCrGrA / iSpC3 / rCrArGrArArGrArArG crRNA with a single C3 spacer JEQ ID NO: 234 EMX1 C3 12 rAr ArGrUrUrUrUrArGr ArGrCrUrAmU+G*+C*mU(SE modification Q ID No: 234)

[0822] mG*mA*mGrUrCrCrGrArG / iSpC3 / rArGrArArGrArArG crRNA with a single C3 spacer JEQ ID NO: 235 EMXl_c3_ll rAr ArGrUrUrUrUrArGr ArGrCrUrAmU+G*+C*mU(SE modification.

[0823] Q ID No: 235)

[0824] mG*mA*mGrUrCrCrGrArGrC(SEQ ID NO:

[0825] JEQ ID NO: 236 EMXl_c3_10 crRNA with a single C3 spacer 236) / iSpC3 / rGrArArGrArArGrArArGrUrUrUrUr. ArGr. Ar modification. GrCrUrAmU+G*+C*mU(SEQ ID NO: 669)

[0826] mG*niA*mGrUrCrCrGr / \rGrCrA(SEQ ID NO:

[0827] JEQ ID NO: 237 E\[\'l c3 9 crRNA with a single C3 spacer 237) / iSpC3 / rAr ArGr Ar ArGr Ar ArGrUrUrUrUrArGr ArGr

[0828] modification. CrUrAmU+G*+C*mU(SEQ ID NO: 670)

[0829] mG*mA*mGrUrCrCrGrArGrCrAiG(SEQ ID NO:

[0830] crRNA with a single C3 spacer JEQ ID NO: 238 EMXl_c3_8 238) / iSpC3 / rArGr Ar ArGr Ar ArGrUrUrUrUrArGr ArGrCr modification UrAmU+G*+C*mU(SEQ ID NO: 671)

[0831] mG*mA*mGrUrCrCrGrArGrCrArGrA(SEQ ID NO:

[0832] crRNA with a single C3 spacer JEQ ID NO: 239 EMXl_c3_7 239) / iSpC3 / rGr Ar ArGr Ar ArGrUrUrUrUrArGr ArGrCrUr modification.

[0833] AmU+G*+C*mU(SEQ ID NO:672)

[0834] mG*mA*mGrUrCrCrGrArGrCrArGrArA(SEQ ID NO:

[0835] JEQ ID NO: 240 EMXl_c3_6 crRNA with a single C3 spacer 240) / iSpC3 / rArArGrArArGrt Tri Tri Tri JrArGrArGrCrI JrA

[0836] mU+G*+C*mU (SEQ ID NO: 673) modification. mG*niA*mGrUrCrCrGrArGrCrArGrArArG(SEQ ID NO:

[0837] JEQ ID NO: 241 E\[\'l c3 5 crRNA with a single C3 spacer 241) / iSpC3 / rArGr Ar ArGrUrUrUrUrArGr ArGrCrUrAmU

[0838] +G*+C*mU (SEQ ID NO: 674) modification. mG*mA*mGrUrCrCrGrArGrCrAiGrAiAiGrA(SEQID

[0839] JEQ ID NO: 242 EMXl_c3_4 NO: crRNA with a single C3 spacer 242) / iSpC3 / rGr Ar ArGrUrUrUrUrArGr ArGrCrUrAmU+ modification. G*+C*mU (SEQ ID NO: 675)

[0840] mG*mA*mGrUrCrCrGrArGrCrArGrArArGrArA(SEQ

[0841] ID NO: crRNA with a single C3 spacer JEQ ID NO: 243 EMXl_c3_3 243) / iSpC3 / rAr ArGrUrUrUrUrArGr ArGrCrUrAmU-G* modification.

[0842] +C*mU (SEQIDNO: 676)

[0843] mG*mA*mGrLIrCrCrGrArGrCrArGrArArGrArArG(SEQ

[0844] JEQ ID NO: 244 crRNA with a single C3 spacer EMXl_c3_2 ID NO:

[0845] modification.

[0846]

[0847] 244) / iSpC3 / rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C Attorney Docket No.: 6391-0012WO01

[0848] *mU (SEQIDNO: 677)

[0849] mG*mA*mGrUrCrCrGrArGrCrArGrArArGrArArGrA(S

[0850] F. QIDNO: crRNA with a single C3 spacer JEQ ID NO: 245 EMXl_c3_l

[0851] 245) / iSpC3 / rGrUrUrUrUrArGrArGrCrLTrAmU+G*+C*m modification UfSEQIDNO: 658)

[0852] crRNA with a single dSpacer JEQ ID NO: 246 AR_dSpacer_20 / 5dSp / *mU*mUrGrGrArGrCrArUrCrUrGrArGrUrCrCrA rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0853] crRNA with a single dSpacer JEQ ID NO: 247 AR_dSpacer_19 mG* / idSp / *mUrGrGrArGrCrArUrCrUrGrArGrUrCrCrA rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. mG*mU* / idSp / rGrGrArGrCrArUrCrUrGrArGrUrCrCrA crRNA with a single dSpacer JEQ ID NO: 248 AR_dSpacer_18

[0854] rGrGrUrUrUrUrArGrArGrCrUrAmU I G* I C*mU modification. JEQ ID NO: 249 AR dSpacer l? mG*mU*mU / idSp / rGrArGrCrArUrCrUrGrArGrUrCrCr crRNA with a single dSpacer ArGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU modification. JEQ ID NO: 250 AR_dSpaccr_16 mG*mU*mUrG / idSp / rArGrCrArUrCrUrGrArGrUrCrCr crRNA with a single dSpacer ArGrGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU modification. mG*ml T*ml JrGrG / idSp / rGrCrArl JrCrI JrGrArGrI JrCrCr crRNA with a single dSpacer JEQ ID NO: 251 AR_dSpacer_15

[0855] . ArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification crRNA with a single dSpacer JEQ ID NO: 252 AR_dSpacer_14 mG^iU*mUrGrGrA / idSp / rCrArUrCrUrGrArGrUrCrCr ArGrGrUrUrUrUrArGrArGrCrUrAmU I G* I C*mU modification. JEQ ID NO: 253 AR dSpacer l 3 mG*mU*mUrGrGrArG / idSp / rArUrCrUrGrArGrUrCrCr crRNA with a single dSpacer ArGrGrUrUrUrUrArGrArGrCrUrAntU+G*+C*mU modification.

[0856] crRNA with a single dSpacer JEQ ID NO: 254 AR_dSpacer_12 mG*mU*mUrGrGrArGrC / idSp / rUrCrUrGrArGrUrCrCr ArGrGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 255 AR dSpacer l 1 mG*mU*mUrGrGr. ArGrCr. A / idSp / rCrUrGr. ArGrUrCrCr crRNA with a single dSpacer. ArGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification crRNA with a single dSpacer JEQ ID NO: 256 AR dSpacer lO mG^iU*mUrGrGrArGrCrArU / idSp / rUrGrArGrUrCrCr ArGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU modification. mG*mU*mUrGrGrArGrCrArUrC / idSp / rGrArGrUrCrCr crRNA with a single dSpacer JEQ ID NO: 257 AR_dSpacer_9

[0857] ArGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU modification. JEQ ID NO: 258 AR_dSpacer_8 mG*mU*mUrGrGrArGrCrArUrCrU / idSp / rArGrUrCrCr crRNA with a single dSpacer ArGrGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 259 AR_dSpacer_7 mG*mU*mUrGrGrArGrCrArUrCrUrG / idSp / rGrUrCrCr crRNA with a single dSpacer ArGrGrLWrLWrArGrArGrCrUrAmU+G*+C*mU modification.

[0858] crRNA with a single dSpacer JEQ ID NO: 260 AR_dSpacer_6 mG*mU*mUrGrGrArGrCrArUrCrUrGrA / idSp / rUrCrCr ArGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU modification.

[0859] crRNA with a single dSpacer JEQ ID NO: 261 AR_dSpacer_5 mG*mU*mUrGrGrAiGrCrArUrCrUrGrArG / idSp / rCrCr ArGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU modification. mG*mU*mUrGrGrArGrCrArUrCrUrGrArGrU / idSp rCr crRNA with a single dSpacer JEQ ID NO: 262 AR_dSpacer_4

[0860] ArGrGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 263 AR_dSpacer_3 mG*mU*mUrGrGrArGrCrArUrCrUrGrArGrUrC / idSp / r crRNA with a single dSpacer modification. ArGrGrLWrLWrArGrArGrCrUrAmU+G*+C*mU mG*mU*mUrGrGrArGrCrArLTrCrUrGrArGrUrCrC / idSp crRNA with a single dSpacer JEQ ID NO: 264 AR_dSpacer_2

[0861] / rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0862] crRNA with a single dSpacer JEQ ID NO: 265 AR dSpacer l mG*mU*mUrGrGrArGrCrArUrCrUrGrArGrUrCrCrA / id Sp / rGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 266 crRNA with a single dSpacer LAG3s9_dSpacer_20 / 5dSp / *mA*mArGrGrCrUrGrArGrArUrCrCrUrGrGrArG rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0863]

[0864] Attorney Docket No.: 6391-0012WO01

[0865] mG* / idSp / *mAmGrGrCrUrGrArGrArUrCrCrUrGrGrAr crRNA with a single dSpacer JEQ ID NO: 267 LAG3 s9_dSpacer_ 19

[0866] GrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification. JEQ ID NO: 268 mG*mA* / idSp / rGrGrCrUrGrAiGrArUrCrCrUrGrGrArG crRNA with a single dSpacer LAG3s9_dSpacer_l 8 modification. rGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0867] JEQ ID NO: 269 crRNA with a single dSpacer LAG3s9_dSpacer_17 mG*mA*mA / idSp / rGrCrUrGrArGrArUrCrCrUrGrGrAr

[0868] modification. GrGrGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU

[0869] crRNA with a single dSpacer mG*mA*mArG / idSp / rCrUrGrArGrArUrCrCrUrGrGrAr JEQ ID NO: 270 LAG3s9_dSpacer_16

[0870] modification GrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0871] crRNA with a single dSpacer mG*mA*mArGrG / idSp / rUrGrArGrArUrCrCrUrGrGrAr

[0872] JEQ ID NO: 271 LAG3 s9_dSpacer_ 15 modification. GrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0873] crRNA with a single dSpacer mG*mA*inArGrGrC / idSp / rGrArGrArUrCrCrUrGrGrAr JEQ ID NO: 272 LAG3s9_dSpacer_l 4

[0874] modification. GrGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU mG*mA*mArGrGrCrU / idSp / rArGr. ArUrCrCrUrGrGrAr crRNA with a single dSpacer JEQ ID NO: 273 LAG3s9_dSpacer_13 modification. GrGiGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU

[0875] crRNA with a single dSpacer mG*mA*mArGrGrCrUrG / idSp / rGrArUrCrCrUrGrGrAr JEQ ID NO: 274 LAG3s9_dSpacer_12 GrGrGrI H H H r ArGr ArGrCrt Jr Ami T+G*+C*ml J modification crRNA with a single dSpacer mG*mA*mArGrGrCrUrGrA / idSp / rArUrCrCrUrGrGrAr JEQ ID NO: 275 LAG3s9_dSpacer_l 1 modification. GrGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0876] crRNA with a single dSpacer mG*mA*mAiGrGrCrUrGrArG / idSp / rUrCrCrUrGrGrAr JEQ ID NO: 276 LAG3 s9_dSpacer_ 10 modification. GrGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU mG*mA*mArGrGrCrUrGrArGrA / idSp / rCrCrUrGrGrAr crRNA with a single dSpacer JEQ ID NO: 277 LAG3 s9_dSpacer_9

[0877] modification. GrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mArGrGrCrUrGrArGrArU / idSp / rCrUrGrGrAr crRNA with a single dSpacer JEQ ID NO: 278 LAG3 s9_dSpacer_8

[0878] modification. GrGrGrLWrLWrArGrArGrCrUrAmU+G*+C*mU mG*mA*mArGrGrCrUrGrArGrArUrC / idSp / rUrGrGrAr crRNA with a single dSpacer JEQ ID NO: 279 LAG3 s9_dSpacer_7 modification. GrGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0879] crRNA with a single dSpacer mG^A^nArGrGrCrUrGrArGrArUrCrOidSp'rGrGrAr

[0880] JEQ ID NO: 280 LAG3 s9_dSpacer_6 modification. GrGrGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU mG*mA*mArGrGrCrUrGrArGrArUrCrCrU / idSp rGrAr crRNA with a single dSpacer JEQ ID NO: 281 LAG3 s9_dSpacer_5

[0881] modification. GrGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0882] crRNA with a single dSpacer mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrG / idSp'rAr JEQ ID NO: 282 LAG3 s9_dSpacer_4

[0883] modification. GrGrGrLWrLWrArGrArGrCrUrAmU+G*+C*mU niG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGrG / idSp / r crRNA with a single dSpacer JEQ ID NO: 283 LAG3 s9_dSpacer_3 modification. GrGrGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0884] crRNA with a single dSpacer mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGrGrA / 'idSp JEQ ID NO: 284 LAG3 s9_dSpacer_2 modification. / rGrGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mArGrGrCrUrGrArGrArUrCrCrUrGrGrArG / id crRNA with a single dSpacer JEQ ID NO: 285 L AG3 s9_dSpacer_ 1

[0885] modification. Sp / rGrUrUrUrUr. ArGrArGrCrUrAmU+G*+C*inU / 5dSp / *mA*mGrUrCrCrGrArGrCrArGrArArGrArArGrA crRNA with a single dSpacer JEQ ID NO: 286 EMXl_dSpacer_20

[0886] modification. rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0887] crRNA with a single dSpacer mG* / idSp / *mGrUrCrCrGrArGrCrArGrArArGrArArGrA

[0888] JEQ ID NO: 287 EMXl_dSpacer_19 modification. rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0889] crRNA with a single dSpacer mG*mA* / idSp / rUrCrCrGrArGrCrArGrArArGrArArGrA

[0890] JEQ ID NO: 288 EMXl_dSpacer_18 modification. rArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mG / idSp / rCrCrGr. ArGrCrArGrArArGrArArGr crRNA with a single dSpacer JEQ ID NO: 289 EMXl_dSpacer_17 modification. ArArGrUrUrUrUrArGrArGrCrUrAniU+G*+C*mU

[0891]

[0892] Attorney Docket No.: 6391-0012WO01

[0893] crRNA with a single dSpacer JEQ ID NO: 290 mG*niA*mGrU / idSp / rCrGrArGrCrArGrArArGrArArGr

[0894] EMXl_dSpacer_16 modification. ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0895] JEQ ID NO: 291 crRNA with a single dSpacer EMX1_dSpacer_15 mG*mA*mGrUrC / idSp / rGrArGrCrArGrArArGrArArGr

[0896] modification. ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mGrUrCrC / idSp / rArGrCrArGrArArGrArArGr crRNA with a single dSpacer JEQ ID NO: 292 EMXl_dSpacer_14 modification. ArArGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mGrUrCrCrG / idSp / rGrCrArGrArArGrArArGr crRNA with a single dSpacer JEQ ID NO: 293 EMXl_dSpacer_13 modification. ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0897] crRNA with a single dSpacer mG*mA*mGrUrCrCrGrA / idSp / rCrArGrArArGrArArGr

[0898] JEQ ID NO: 294 EMXl_dSpacer_12 modification. ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0899] crRNA with a single dSpacer mG*mA*mGrUrCrCrGrArG / idSp / rArGrArArGrArArGr JEQ ID NO: 295 EMXI dSpacer l 1 modification. ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mGrUrCrCrGrArGrC / idSp / rGrArArGrArArGr crRNA with a single dSpacer JEQ ID NO: 296 EMXl dSpacer lO modification. ArArGrLWrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mGrUrCrCrGrArGrCrA / idSp / rArArGrArArGr crRNA with a single dSpacer JEQ ID NO: 297 EMXl_dSpacer_9 modification ArArGrI H H H lr ArGr ArGrCrt Tr Ami 1+G*+C*ml niG*ni. A*mGrUrCrCrGrArGrCrArG / idSp / rArGrArArGr crRNA with a single dSpacer JEQ ID NO: 298 EMXI dSpacerJ modification. / V2\rGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0900] crRNA with a single dSpacer mG*mA*mGrUrCrCrGrArGrCrArGrA / idSp / rGrArArGr JEQ ID NO: 299 EMXI dSpacerJ modification. ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU

[0901] crRNA with a single dSpacer mG*mA*mGrUrCrCrGrArGrCrArGrArA / idSp / rArArGr JEQ ID NO: 300 EMXI dSpacerJ modification. ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU mG*mA*mGrUrCrCrGrArGrCrArGrArArG / idSp / rArGr crRNA with a single dSpacer JEQ ID NO: 301 EMXI dSpacerJ

[0902] modification. ArArGrLWrLWrArGrArGrCrUrAmU+G*+C*mU niG*mA*mGrUrCrCrGrArGrCrArGrArArGrA / idSp / rGr crRNA with a single dSpacer JEQ ID NO: 302 EMXI dSpacerJ modification. / V2\rGrUrUrUrUrArGrArGrCrUrAinU+G*+C*mU

[0903] crRNA with a single dSpacer mG*mA*mGrUrCrCrGrArGrCrArGrArArGrArA / idSp / r

[0904] JEQ ID NO: 303 EMXI dSpacerJ ArArGrUrUrUrUrArGrArGrCrUrAmU+G*+C*mU modification.

[0905] mG*mA*mGrUrCrCrGrArGrCrArGrArArGrAiAiG / idSp crRNA with a single dSpacer 1EQ ID NO: 304 EMXI dSpacerJ modification. / rArGrUrUrUrUr. ArGrArGrCrUrAmU+G*+C*mU mG*mA*mGrUrCrCrGrArGrCrArGrArArGrArArGrAid crRNA with a single dSpacer > EQ ID NO: 305 EMX 1 _dSpacer_ 1

[0906] Sp / rGrUrUrUrUr. ArGr. ArGrCrUrAmU+G*+C*mU modification.

[0907] / AltRl / rGrArGrUrCrCrGrArGrCrArGrArArGrAr. ArGrAr JEQ ID NO: 306 crRNA with IDT AltR modifications EMXl crRNA ArGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 / / AltRl / rGrGrGrGrCrCrArCrUrArGrGrGrArCrArGrGrAr JEQ ID NO: 307 AAVS1 crRNA crRNA with IDT AltR modifications UrGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[0908] / AltRl / rGrG / iUNA- 1EQ ID NO: 308 crRNA with a single LINA modification AAVSl_UNAaltR_18 rG / rGrCrCrArCrUrArGrGrGr. ArCrArGrGrArUrGrUrUrU

[0909] rUr. ArGr. ArGrCrUr. ArUrGrCrU / AltR2 /

[0910]

[0911] Attorney Docket No.: 6391-0012WO01

[0912] Table 7. Top Modification Placement

[0913] Top Placement of single Modification

[0914] modifications within gRNA Spacer

[0915] LNA 9

[0916] 2 ’Fluoro 6

[0917] C3 spacer 11-18

[0918]

[0919] dSpacer 11-18

[0920] Table 8. gRNA s pacer region sequences

[0921] Target Site Sequence (5’-3) SEQ ID PDCDls8 GAGCAGGGCTGGGGAGAAGG SEQ ID NO:

[0922] 352 LAG3 GAAGGCTGAGATCCTGGAGG SEQ ID No: 353 FANCF tgt 13 GCTGCAGAAGGGATTCCATG SEQ ID NO:

[0923] 354 TRAC TGTGCTAGACATGAGGTCTA SEQ ID NO:

[0924] 355 EMX1 GAGTCCGAGCAGAAGAAGAA SEQ ID NO:

[0925] 356 HBB CTTGCCCCACAGGGCAGTAA SEQ ID NO:

[0926] 357 AR GTTGGAGCATCTGAGTCCAG SEQ ID NO:

[0927] 358 HEK Site 3 GGCCCAGACTGAGCACGTGA SEQ ID NO:

[0928] 359 HPRT 38087 AATTATGGGGATTACTAGGA SEQ ID NO:

[0929] 360 PD1 GGCGCCCTGGCCAGTCGTCT SEQ ID NO:

[0930] 361 B2M CTTACCCCACTTAACTATCT SEQ ID NO:

[0931] 362 PCSK9 CCCGCACCTTGGCGCAGCGG SEQ ID NO:

[0932] 363 APOBEC3A CGGTCAAGATGGACCAGCAC SEQ ID NO:

[0933] 364 APBB2 TTGGGACAACGTTGTCCAGC SEQ ID NO:

[0934] 365 ADI CTACGAGGAGCATTTGCACT SEQ ID NO:

[0935] 366 APP1 GCGGAATTGACAAGTTCCGA SEQ ID NO:

[0936]

[0937] 367 Attorney Docket No.: 6391-0012WO01

[0938] Table 9. Optimal placements for UNA modifications within the gRNA spacer region Tier UNA Position* in Spacer Description Highest probability of either increasing on-target editing 1 20, 19, 18, 17, 14, 12, 10 and / or retaining on-target editing efficiency and reducing off-target editing High target variability of 2 16, 15, 13, 11, 9, 8, 7, 4 retention of on-target editing efficiency

[0939]

[0940] 3 6, 5, 3, 2, 1 Disrupts editing efficiency

[0941] *UNA positions are numbered from the 5’ to the 3’ end of the spacer sequence, wherein Position 20 being the first nucleotide at the 5’ end and Position 1 being the last nucleotide at the 3 ’end.

[0942] Table 10. Oligos

[0943] Sequence ID Name Sequence Description 'AltRl / rCrCrCrGrCrArCrCrUrUrGrGrCrGrCrArGrCrGrGrGr

[0944] SEQ ID NO: 368 PCSK9sl crRNA UrUrUrUrArGrArGrCrUrArUiGiCrU / AltRZ'

[0945] ZAltRU / iUNA- SEQ ID NO: 369 PCSK9 UNA20 rC / rCrCrGiCrArCrCrUrUrGrGrCrGrCrAiGrCrGrGtGrUrUrU crRNA with single UNA base rUrAiGrAiGrCrUrArUrGrCrUZAltR2Z

[0946] ZAltRl / rC / iUNA- SEQ ID NO: 370 PCSK9 UNA19 iC / rCtGiCrAiCrCrUrUrGiGiCrGtCrArGrCiGiGiGrUrUrUrU crRNA with single UNA base rAiGrAiGrCrUrArUrGiCrUZAltR2Z

[0947] ZAltRlZrCrCZiUNA- SEQ ID NO: 371 PCSK9 UNA18 rOrGrCrAiCrCrUrUrGrt^ crRNA with single UNA base rGrAiGrCrUrArUiGrCrU / AltR2Z

[0948] ZAltRl / rCrCrC / iUNA- SEQ ID NO: 372 PCSK9 UNA17 rG rCrArCiCrUrUrGrGrCrGrCrArGrCrGrGrGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU AltR2Z

[0949] ZAltRlZrCrCrCrGZiUNA- SEQ ID NO: 373 PCSK9 UNA16 rCZrArCrCrUrUrGrGrCrGrCrArGtCrGrGrGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArUrGrCrUZAltR2Z

[0950] / AltRl / iCrCrCrGrC / iUNA- SEQ ID NO: 374 PCSK9 UNA15 rA'rCrCrUrUiGiGrCrGrCrAiGrCrGrGrGrUrUrUrUrAiGrAr crRNA with single UNA base GrCrUrArUrGrCrUZAltR2Z

[0951] 'AltRlZrCrCrCrGrCrAZiUNA- SEQ ID NO: 375 PCSK9 UNA14 rCZiCrUrUiGiGrCiGiCrAiGiCiGrGrGrUrUrUrUrAiGrAiGr crRNA with single UNA base CrUrArUrGrCrU'AltR2Z

[0952] AltRlZrCrCrCrGrCrArCZiUNA- SEQ ID NO: 376 PCSK9 UNA13 iC / rUrUiGiGrCrGrCrArGrCrGrGrGiUrUrUrUrArGr. ArGrCr crRNA with single UNA base UrArUrGrCrUZAltR2Z

[0953] ZAltRlZrCrCrCrGrCrArCiCZiUNA- SEQ ID NO: 377 PCSK9 UNA12 rU'rUrGtGrCrGrCrArGrCrGrGrGrUrUrUrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2Z

[0954] / AltRl / rCrCrCrGrCrArCrCrU / iUNA- SEQ ID NO: 378 PCSK9_UNA11 rt T'rGrGrCrGrCrArGrCrGrGrGrI Jrl H H lr ArGr ArGrCrI JrAr crRNA with single UNA base UrGrCrU / AltR2 /

[0955] / AltRl / iCrCrCrGrCrArCiCrUrU / iUNA- SEQ ID NO: 379 PCSK9 UNA10 rG / rGrCrGiCrAiGrCiGiGrGrUrUrUrUrArGrArGiCrUrArUr crRNA with single UNA base GrCrU'AltR2Z

[0956] ZAltRl / iCiCiCrGiCrArCiCrUrUrG / iUNA- SEQ ID NO: 380 PCSK9 UNA9 rG / rCrGrCrAiGiCiGiGiGrUrUrUrUrArGrArGrCrUrArUrGr crRNA with single UNA base

[0957]

[0958] CrUZAltR2Z Attorney Docket No.: 6391-0012WO01

[0959] / AltRl / rCrCrCrGrCrArCrCrUrUrGrG / iUNA- SEQ ID NO: 381 PCSK9 UNA8 rC / rGrCrAiGrCrGrGrGrUrUrUrUrArGrAi'GiCrUrArUrGrCr crRNA with single UNA base U / A11R2 /

[0960] / AltRl / rCrCrCrGrCrArCrCrUrUrGrGrC / iUNA- SEQ ID NO: 382 PCSK9 UNA7 rG'rCrArGrCrGrGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU / crRNA with single UNA base AltR2 /

[0961] / AltRl / rCrCrCrGrCrArCrCrUrUrGrGrCrG / iUNA- SEQ ID NO: 383 PCSK9 UNA6 rC / rArGrCiGiGiGrUrUrUrUrArGrArGrCrUrArUiGrCrU / Alt crRNA with single UNA base R2 /

[0962] 'AltRl / rCrCrCrGrCrArCrCrUrUrGrGrCrGrC / itlNA- SEQ ID NO: 384 PCSK9 UNA5 rA'iGiCrGrGiGrUrUrUrUrAiGrAiGiCrUrArUrGiCrU / AltR2 crRNA with single UNA base SEQ ID NO: 385 / AltRl / rCrCrCrGrCrArCrCrUrUrGrGrCrGrCrA / iUNA- PCSK9 UNA4 crRNA with single UNA base rG / rCrGrGrGrUrUrUrUrAiGrAiGrCrUrArUrGrCrU / A11R2 /

[0963] SEQ ID NO: 386 PCSK9 UNA3 / AltRl / iCiCrCrGiCrAiCiCrUrUrGiGiCrGrCrArG / iUNA- crRNA with single UNA base rC / rGrGrGrUrUrUrUrArGrAr^^

[0964] SEQ ID NO: 387 PCSK9 IJNA2 / AltRl / rCrCrCrGrCrArC^^ crRNA with single UNA base rG / rGrGrUrUrUrUrArGrAr^

[0965] SEQ ID NO: 388 / AltRl / rCrCrCrGrCrArCiCrUrUrGiGrCrGrCrArGrCrG / iUN

[0966] PCSK9 UNA1 crRNA with single UNA base A-iG / rGrUrUrUrUrArGr. ArGrCrUrArl'rGrCrU / AltR2 /

[0967] SEQ ID NO: 389 APP1 crRNA / AltRl / rGrCiGrGrArArUrUrGrArCrArArGrUrUrCrCiGrArG crRNA rUrUrUrUrArGrArGrCrUrArtrGrCrU / AltR2 /

[0968] ''AltRl / ZiUNA- SEQ ID NO: 390 APP1 UNA20 rG / iCrGrGrArArUrUrGr. AiCrArArGrUrUrCrCrGrArGrUrUr crRNA with single UNA base UrUr. ArGrArGrCrUrArUrGrCrU / AltR2 /

[0969] / AltRl / rG / iUNA- SEQ ID NO: 391 APP1 UNA19 rC / iGiGrArArUrUrGrArCrArAiGrUrt'rCrCrGrArGrUrUrUr crRNA with single UNA base UrArGr. ArGrCrUrArUrGrCrU / AltR2 /

[0970] / AltRl / rGrC / iUNA- SEQ ID NO: 392 APP1 UNA18 rG / rGrArArUrUrGrAiCrArArGrUrUrCrCrGrArGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUrArUrGrCrU / AltR2 /

[0971] / AltRl / rGiCiG / iUNA- SEQ ID NO: 393 APP1 UNA17 iG / rArArUrUrGrAiCrArAiGrUrUrCrCtGrAiGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU / AltR2'

[0972] / AltRl / rGrCrGrG / iUNA- SEQ ID NO: 394 APP1 UNA16 rA'rArUrUrGrArCrArArGrUrUiCrCrGrArGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArUrGrCrU AltR2 /

[0973] / AltRl / rGrCrGrGrA / iUNA- SEQ ID NO: 395 APP1 UNA15 rA'rUrUrGrArCrArArGrUrUiCiCrGrArGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[0974] / AltRl / rGrCrGrGrArA / iUNA- SEQ ID NO: 396 APP1 UNA14 rU / rUtGrArCrArAiGrUrUrCrCrGrArGrUrUrUrUrArGrArGr crRNA with single UNA base Crl JrArt JrGrCrt T / AltR2 /

[0975] / AltRl / iGrCiGiGrArArU / iUNA- SEQ ID NO: 397 APP1 UNA13 rU / rGrArCrArAiGrUrUrCrCrGrArGrUrUrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[0976] / AltRl / rGiCiGiGrArArUrU / iUNA- SEQ ID NO: 398 APP1 UNA12 rG / rArCrArArGrUrUrCrCrGrArGrUrUrUrUrArGrArGiCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[0977] / AltRl / rGrCiGiGrArArUrUrG / iUNA- SEQ ID NO: 399 APP1 UNA11 rA'rCrArArGrUrUrCrCiGrAiGrUrUrUrUrArGrArGrCrUrAr crRNA with single UNA base UrGrCrU / AltR2 /

[0978] / AltRl / iGiGiCrGrCrCrCrUiGiGiCrCrArGrUrCrGrUrCrUrGr

[0979] SEQ ID NO: 400 PD1 crRNA UrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 / crRNA / AltRU / iUNA- SEQ ID NO: 401 PD1 UNA20 rGZrGrCrGiCiCrCrUrGrGrCrCrArGrUrCiGrtlrCrUrGrUrUrU crRNA with single UNA base rUrArGrAiGiCrUrArUrGrCrU / AltR2 /

[0980] ZAltRl / iG / iUNA- SEQ ID NO: 402 PD1 UNA19 rG / rCrGrCrCrCrUrGrGrCrCrAiGrUrCrGrUrCrUrGrUrUrUrU crRNA with single UNA base rAiGrAiGiCrUrArUrGrCrU / AltR2'

[0981] ZAltRlZrGrGZiUNA- SEQ ID NO: 403 PD1 UNA18 iC / iGiCiCrCrUrGrGrCiCrAiGrUiCiGrUrCrUrGrUrUrUrUrA crRNA with single UNA base

[0982]

[0983] rGrAiGrCrUrArUrGrCrU / AltR2Z Attorney Docket No.: 6391-0012WO01

[0984] / AltRl / rGrGrC / iUNA- SEQ ID NO: 404 PD1 UNA17 rG / rCrCrCrUiGrGiCiCrAiGrUrCrGrUrCrUrGrUrUrUrUrAiG crRNA with single UNA base rArGrCrUrArUrGrCrU / AltR2 /

[0985] / AltRl / rGrGrCrG / iUNA- SEQ ID NO: 405 PD1 UNA16 rC / tCrCrUrGiGrCrCrArGrUtCtGrUrCrUrGrUrUrUrUrArGrA crRNA with single UNA base rGrCrt Tr Art JrGrCrt J / A1tR2 /

[0986] / AltRl / rGrGrCrGrC / iUNA- SEQ ID NO: 406 PD1 UNA15 rC / rCrUrGiGiCrCrArGrUrCrGrUrCrUrGrUrUrUrUrArGrAr crRNA with single UN A base GrCrUrArUrGrCrU / AltR2 /

[0987] / AltRl / rGrGrCiGrCrC / iUNA- SEQ ID NO: 407 PD1 UNA14 rC / rUrGrGrCiCrAiGrUrCrGrUrCrUrGrUrUrUrUrAiGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[0988] ATRI rtirtirt rtirt rCrC il XA- SEQ ID NO: 408 PD1 UNA13 rU / rGrGrCrCrArGrUrCrGrUrCrUrGrUrUrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[0989] / AltRl / iGrGrCrGrCrCrCrU / iUNA- SEQ ID NO: 409 PD1 UNA12 rG / rGrCrCrAiGrUrCrGrUrCrUrGrtJrUrUrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[0990] / AltRl / rGrGrCrGrCrCrCrUrG / iUNA- SEQ ID NO: 410 PD1 UNA11 rG / rCrCrArGrUrCiGrUrCrUiGrUrUrUrUrArGrArGiCrUrAr crRNA with single UNA base UrGrCrU / AltR2 /

[0991] SEQ ID NO: 411 / AltRl / rUrGrUrGrCrUrArGrArCrArUrGrArGrGrUrCrUrArG

[0992] TRAC crRNA crRNA rUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[0993] / AltRl / / iUNA- SEQ ID NO: 412 TRAC UNA20 rU / rGrUrGrCrUr. ArGrArCrArUrGrArGrGrUrCrUrArGrUrUr crRNA with single UNA base UrUrArGrArGrCrUrArUrGrt2rU / AltR2 /

[0994] 'AltRl / rU / iUNA- SEQ ID NO: 413 TRAC UNA19 rG / rUrGrCrUrAiGrArCrArUrGrArGrGrUrCrUrArGrUrUrUr crRNA with single UNA base UrArGrArGrCrUrArUrGrCrU / AltR2 /

[0995] AltRl / rUrtj / iUNA- SEQ ID NO: 414 TRAC UNA18 rU / rGrCrUrAiGrArCrArUrGrArGrGrUrCrUrArGrUrUrUrUr crRNA with single UNA base ArGr. ArGrCrUrArUrGrCrU / AltR2 /

[0996] / AltRl / rUrGrU / iUNA- SEQ ID NO: 415 TRAC UNA17 rG / rCrUrAiGrAiCrArUiGrArGiGrUrCrtJrAiGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU AltR2 /

[0997] / AltRl / rUrGrUrG / iUNA- SEQ ID NO: 416 TRAC UNA16 rC / rUrArGrArCrArtJrGrArGrGrUrCrUrArGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArtJrGrCrtJ / AltR2 /

[0998] / AltRl / rUrGrUrGrC / iUNA- SEQ ID NO: 417 TRAC UNA15 rU / rArGrArCrArUrGrArGrGrUrCrUrArGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[0999] A lRI i. rtnl iGrt rt il W- SEQ ID NO: 418 TRAC UNA14 rA'rGrArCrArUrGrArGrGrUrCrUrArGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArtJrGrCrU / AltR2 /

[1000] AltRl / rUrGrUrGrCrUrAiUNA- SEQ ID NO: 419 TRAC UNA13 rG / rArCrArUrGrArGrGrUrCrUrArGrUrUrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1001] / AHRl / rUiGrUrGiCrUrAiG / iLiNA- SEQ ID NO: 420 TR. AC_UN. A12 rA'iCrArUrGrArGiGrUrCrUrArGrUrLWrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1002] / AltRl / rUrGrUrGrCrUrArGrATUNA- SEQ ID NO: 421 TRAC UNAl 1 rC / rArUrGrAiGiGrUrCrUrArGrUrUrtJrUrArGrArGiCrUrAr crRNA with single UNA base UrGrCrU \||R2

[1003] SEQ ID NO: 422 'AltRl / rGr. ArGrCrArGrGrGrCrUrGrGrGrGr. ArGrArArGrGrG

[1004] PDCDls8_crRNA crRNA rUrUrUrUrArGrArGrCrUrArUrCfrCrU'AltR2 /

[1005] SEQ ID NO: 423 / AltR 1 / rGrArArGrGrCrt TGr ArGr Art TrCrCrl JrGrGrArGrGrG

[1006] LAG3_crRNA crRNA rUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1007] SEQ ID NO: 424 FANCF tgtl 3_crRNA / AltRl / rGiCrUrGrCrArGrArAiGrt3rt3rArtJrUrCrCrArUrGrG crRNA rUrUrUrUrAiGrAiGrCrUrArUrGrCrU / AltR2 /

[1008] SEQ ID NO: 425 EMXl crRNA / AltRl / rGrArGrUrCrCrGrArGrCrArGrArArGrArArGrArArG crRNA rUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1009] SEQ ID NO: 426 AltRl / rCrUrUrGrCrCrCiCrArCrArGrGrGrCrArGrUrAiAiGr

[1010] HBB crRNA crRNA

[1011] UrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2

[1012]

[1013] Attorney Docket No.: 6391-0012WO01

[1014] SEQ ID NO: 427 AR crRNA / AltRl / iGrUrUrGiGr / XrGrCrArUiCrUrGrAiGrUrCrCrArGrG crRNA rUrUrUrUrAiGrAiGrCrUrArUrGrCrU / AltR2 /

[1015] SEQ ID NO: 428 HEK Site 3_crRNA / AltRl / rGrGrCrCrCrArGrArCrUrGrArGrCrArCrGrUrGrArGr UrUrUrUrArGrArGi€rUrAi'UrGrCrU / AltR2 / crRNA SEQ ID NO: 429 HPRT 38087_crRNA / AltRl / rArArUrUrArUrGrGrGrGrArUrUrArCrUrArGrGrArG crRNA rUrUrUrUrArGr. ArGrCrUrArUrGrCrU / AltR2 /

[1016] SEQ ID NO: 430 B2M_crRNA / AltRl / rCrUrUrArCrCrCrCrArCrUrUrArArCrUrArUrCrUrGr crRNA UrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1017] SEQ ID NO: 431 APOBEC3A_crRNA / AltRl / rCrGrGrUrCrArArGrArUrGrGrArCrCrArGrCrArCrGr UrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 / crRNA SEQ ID NO: 432 APBB2 crRNA / AltRl / rUrUiGiGiGrArCrArAiCrGrUrUrGrUrCrCrArGrCtGr crRNA UrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1018] SEQ ID NO: 433 ADI crRNA / AltRl / rCrUrArCrGrArGrGrArGrCrArUrUrUrt^ crRNA UrUrUrUrArGrArGrCrUrA'UrGrCrU / AltR2.

[1019] / AltRl / / iUNA- SEQ ID NO: 434 PDCD1 8 UNA20 iG / rArGrCrAiGiGrGrCrUrGrGrGrGrArGrArArGrGrGrUrUr crRNA with single UNA base UrUrArGrArGiCrUrArUrGiCrU / AltR2 /

[1020] / AltRl / rG / iUNA- SEQ ID NO: 435 PDCD1 8 UNA19 rA'rGrCrArGiGrGrCrUrGrGrGrGrArGrArArGrGrGrUrUrUr crRNA with single UNA base UrArGrArGiCrUrArUrGrCrU / AltR2 /

[1021] AltRl / rGrA / iUNA- SEQ ID NO: 436 PDCD1 8 UNA18 iG rCrAiGiGiGiOUiGrGrGrGrAiGrArArGrGrGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUr ArUrGtCrU / AltR2 /

[1022] 'AltRl / rGr. ArG / iUNA- SEQ ID NO: 437 PDCD1 8 UNA17 rC rArGrGiGrCrUrGrGrGrGrArGrArArGrGrGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU AltR2 /

[1023] / AltRl / rGrArGrC / iUNA- SEQ ID NO: 438 PDCD1 8 UNA16 rA'rGrGrGrCrUiGiGrGrGrAiGrArArGrGrGrUrUrUrUrAiGr crRNA with single UNA base ArGrCrUrArUrGrCrU / AltR2 /

[1024] 'AltRl / rGrArGrCrA'iUNA- SEQ ID NO: 439 PDCD1 8 UNA15 iG / rGrGtCrUiGiGrGrGrAiGrArArGrGrGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUiGrCrU / AltR2 /

[1025] A lRl rtirAr<iit rArt;il l\ \- SEQ ID NO: 440 PDCD1 8 UNA14 rG'rGrCrUrGrGrGrGrArGrArAiGrGrGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1026] - AltR 1 / rGrArGrCrArGrG / iUN A- SEQ ID NO: 441 PDCD1 8 UNA13 rG rCrUrGKM^ crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1027] / AltRl / rGrAiGiCrAiGiGiG / itiNA- SEQ ID NO: 442 PDCD1 8 UNA12 rC / rUrGrGrGrGrAi<3rArArGr^^ crRNA with single UNA base ArUrGrCrU / AltR2 /

[1028] / AltRl / iGrAiGrCrAiGrGrGrC'iUNA- SEQ ID NO: 443 PDCD1 8 UNA11 rU / rGrGrGrGrArGrAr. ArGrGrGrUrUrUrUrArGrArGrCrUrAr crRNA with single UNA base UrGrCrU / AltR2 /

[1029] 'AltRl / rGrArGrCrAiGrGrGrCrU / iUNA- SEQ ID NO: 444 PDCD1 8 UNA10 rG tGrGrGrArGrArAiGrGrGrUrUrUrUrArGrArGrCrUrArUr crRNA with single UNA base GrCrU / 'AltR2 /

[1030] / AltRl / rGrArGiCrAiGiGrGrCrUrG / iUNA- SEQ ID NO: 445 PDCD1 8 UNA9 rG / tGrGrArGrArArGiGrGrUrUrUrUrArGrArGrCrUrArUrGr crRNA with single UNA base CrU / AltR2 /

[1031] / AltRl / rGrAiGrCrAiGrGrGrCrUrGrG / iUNA- SEQ ID NO: 446 PDCD1 8 UNA8 rG / rGrAiGrArArGrGrGrUrUrUrUrAiGrArGrCrUrArUrGrCr crRNA with single UNA base U / A11R2 /

[1032] / AltRl / rGr.4rGrCrArGrGrGrCrlTrGrGrG / iUNA- SEQ ID NO: 447 PDCD1 8 UNA7 rG'rArGrArArGrGrGrUrUrUrUr. ArGr. ArGrCrUrArUrGrCrU / crRNA with single UNA base AltR2 /

[1033] / AltRl / rGrAiGiCrArGrGrGrCrUrGrGrGrG / iUNA- SEQ ID NO: 448 PDCD1 8 UNA6 rA4GrArArGrGrGrUrUrUrUrArGrArGtCrUrArUrGrCrU / Alt crRNA with single UNA base R2 /

[1034] / AltRl / iGrAiGiCrAiGiGiGrCrUrGrGiGrGrA / iUNA- SEQ ID NO: 449 PDCD1 8 UNA5 iG / rAiArGrGiGrUrUrUrUrArGrArGrCrUrArUrGrCrU / . AltR2 crRNA with single UNA base

[1035]

[1036] Attorney Docket No.: 6391-0012WO01

[1037] SEQ ID NO: 450 / AltRl / rGrArGrCrArGrGrGrCrU^

[1038] PDCD1 8 UNA4 crRNA with single UNA base rA'rArGrGtGrUrUrUrUrAiGrArGrCrUrArUrGiCrU / AltR2 /

[1039] SEQ ID NO: 451 / AltRl / rGrArGiCrArGrGrGrCrUrGrGrGrGrArGrA / iUNA- PDCD1 8 LJNA3 crRNA with single UNA base rA'rGrGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1040] SEQ ID NO: 452 PDCD1 8 UNA2 / AltRl / rGrAiGrCrAiGrGrGrCrUrGrGrGrGrArGrArA / iUNA- crRNA with single LINA base rG rGrGrUrUrUrUr AiGr. ArGrCrUrArUrGrCrU / AltR2 /

[1041] SEQ ID NO: 453 / AtRl / rGr. AGrCrArGrGrGrCrUrGrGrGrGr. ArGrArArG / iUN

[1042] PDCD1 8 UNA1 crRNA with single UNA base A-rG rtirl WrUrUr ArGr. AGrCrUrArL'rGrCrU AltR2 /

[1043] / AltRl / / 5UNA- SEQ ID NO: 454 LAG3s9_UNA_20 iG / rArAiGiGiCrUrGr. ArGrArUrCrCrUrGiGiArGrGrGrUrUr crRNA with single UNA base UrUr. ArGrArGrCrUrArUrGrCrU / AltR2 /

[1044] / AltRl / rG / iUNA- SEQ ID NO: 455 LAG3s9 UNA 19 rArArGrGrCrUrGrArGr. ArUrCrCrLJrGrGrAGrGrGrUrUrUr crRNA with single UNA base UrArGrArGrCrLJrArL¥GrCrU / AltR2 /

[1045] / AltRl / rGr. AiUNA- SEQ ID NO: 456 EAG3s9_UNA_18 rA / rGrGrCrt TrGrAiGrArt JrCrCrI JrGrGr ArGrGrGrl Jrt Jrt Jrt Jr crRNA with single UNA base ArGrArGrCrUrArUrGrCrU. AltR2 /

[1046] / AltRl / iGrArA / iUNA- SEQ ID NO: 457 LAG3s9_UNA_17 tG / rGrCrUiGrAiGrArUiCrCrUrGrGrArGrGrGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU / AltR2J

[1047] / AltRl / iGrArArG / iUNA- SEQ ID NO: 458 LAG3s9_UNA_16 iG / iCrUiGiArGrArUrCrCrUrGrGiAGiGiGiUrUrUrUr. ArGr crRNA with single UNA base ArGrCrUrArUrGrCrU AltR2 /

[1048] AltRl / rGrArArGrG / iUNA- SEQ ID NO: 459 LAG3s9_UNA_15 rC / 'rUrGrArGrArUrCrCrUrGrGrArGtGrGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[1049] / AltRl / rGrArArGrGrC / iUNA- SEQ ID NO: 460 LAG3s9_UNA_14 rU / rGrArGrArUrCiCrUrGrGrArGrGtGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArUrGrCrLJ / AltR2 /

[1050] / AltRl / rGrArArGrGrCrU / iUNA- SEQ ID NO: 461 LAG3s9_UNA_13 rG / rArGrArUrCi€rUiGrGrArGtGrGrUrUrUrUrArGrArGiCr crRNA with single UNA base UrArUrGrCrtJ / AltR2 /

[1051] / AltRl / iGrArAiGiGiCrUrG / iUNA- SEQ ID NO: 462 LAG3s9_UNA_12 rA 4GrArUrCrCrUiGrGrArGrGrGrUrUrUrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1052] / AltRl / rGrArArGrGrCrUrGrA'iUNA- SEQ ID NO: 463 LAG3s9_UNA_ll iG / rAUrCiCrtJrGrGrAiGrGrGrUrUrUrUrAGrArGrCrUrAr crRNA with single UNA base UrGrCrU / AltR2 /

[1053] - AltR 1 / rGrArArGrGrCrtJrGr ArG / iUNA- SEQ ID NO: 464 LAG3s9_UNA_10 rAWrCrCrUrGrGrArGrGrGrUrUrUrUrArGrAiGiCrUrArUr crRNA with single UNA base GrCrU / AltR2 /

[1054] JAtRl / rGrArArGrGrCrLhGrAGrA'iLNA- SEQ ID NO: 465 LAG3s9_UNA_9 rlJ'rCrCrllrGrGrArGrGrGrUrUrUrlTrArGrArGrCrUrArUrGr crRNA with single UNA base CrU / AltR2 /

[1055] / AltRl / rGrArAiGiGrCrUrGrArGrArUAUNA- SEQ ID NO: 466 LAG3s9_UNA_8 rC / rCrUTGrGr. ArGrGrGrUrUrUrUrArGrArGrCrUr. ArUrGrCr crRNA with single LINA base U / AltR2 /

[1056] / AltRl / iGrArAiGiGiCrUtGrArGrArUiC / iUNA- SEQ ID NO: 467 LAG3s9_UNA_7 rC / rUrGrGrAiGiGiGrUrUrUrUrAiGrAiGrCrUrArUrGiCrU / crRNA with single UNA base \I: R2

[1057] / AltRl / rGrArAiGiGiCrUrGrArGrArUrCrC / iUNA- SEQ ID NO: 468 LAG3s9_UNA_6 rU / rGrGrAiGiGrGrUrUrUrUrArGrArGrCrUrAiUrGrCrU / Alt crRNA with single UNA base R2 /

[1058] / AltRl / iGrArAiGiGiCrUrGrArGrArUrCiCrU / iUNA- SEQ ID NO: 469 LAG3s9 UNA 5 rG rGrArGrGiGrUrUrUrUr. ArGrArGrCrL¥ArUrGrCrU / AltR2 crRNA with single UNA base /

[1059] SEQ ID NO: 470 / AltRl / rGrArArGrGiCrUrGrArGrArUrCrCrUrG / iUNA- LAG3s9_UNA_4 crRNA with single UNA base iG / rAiGiGiGiUrUrUrUr. AiGrArGrCrUrAiUiGiCrU / AltR2 /

[1060] SEQ ID NO: 471 LAG3s9_UNA_3 / AltRl / rGrArArGrGrCrUrGrArt3rArUrCrCrUrGiG / iUNA- crRNA with single UNA base rA'rGrGrGrUrUrUrUrAiGrAiGrCrUrArUrGrCrU / AltR2 /

[1061] SEQ ID NO: 472 JAltRl / rGr. Ar. ArGrGrCrL^rGrArGrArUrCrCrUrGrGrA / iUNA- LAG3s9_UNA_2 crRNA with single UNA base rG / iGiGrUrUrUrUrAiGr. ArGrCrUrArUiGrCrU / Alt^

[1062]

[1063] Attorney Docket No.: 6391-0012WO01

[1064] SEQ ID NO: 473 / AltRl / iGrAr / XiGiGiCrUrGrArGrArUiCiCrUrGiGrrLrG / iLlN

[1065] LAG3s9_UNA_l crRNA with single UNA base A-iG / rGrUrUrUrUrArGrAiGiCrLJrArUrGrCrU / AltR2 /

[1066] / AltRl / / iUNA- SEQ ID NO: 474 FANCF_tgtl3_UNA20 rG'rCrLTrGrCrArGrAr. ArGrGrGrArLIrLTrCrCrArUrGrGrUrUr crRNA with single UNA base I Jrt JrArGrArGrCrt r Art TrGrCrt J / A11R2 /

[1067] / AltRl / rG / iUNA- SEQ ID NO: 475 FANCF_tgtl3_UNA19 rC / rtJrGrCrAiGrArArGrGrGrArtJrtJrCrCrArtJiGrGrUrLJrUr crRNA with single LINA base UrArGrArGrCrUrArUrGrCrU / AltR2 /

[1068] 'AltRl / rGrC / iUNA- SEQ ID NO: 476 FANCF_tgtl3_UNA18 rU / iGiCrArGrArArGrGrGrArUrLlrCiCrArUrGiGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUrArUrGrCrU / AltR2 /

[1069] AltRl / rGrCrU / iUNA- SEQ ID NO: 477 FANCF_tgtl3_UNA17 tG / rCrAiGiArArGrGrGrArUrUrCrCrAiUrGiGr Ur Ur UrUrAr crRNA with single UNA base Gr ArGrCrUrArUrGrCrU AltR2 /

[1070] 'AltRl / rGrCrUrG / iUNA- SEQ ID NO: 478 FANCF tgtl3 UNA16 rO'rArGrArArGrGrGrArUrUrCrCrArUrGrGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArUrGrCrU / AltR2 /

[1071] / AltRl / rGrCrUrGrC / iUNA- SEQ ID NO: 479 FANCF tgtl 3 1JNA15 rA / rGrArArGrGrGr Art Jrt JrCrCrArt TrGrGrI Jrt Jrt Jrt Tr ArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[1072] / AltRl / iGrCrUrGrCrA / iLJNA- SEQ ID NO: 480 FANCF_tgtl3_UNA14 rG r \r \rlir<irGrAr UrUrCrCrArUrGrGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1073] / AltRl / iGiCrUiGiCrArG / iUNA- SEQ ID NO: 481 FANCF_tgtl3_UNA13 rA'rArGrGrGrArUrUrCrCrArUrGrGrUrUrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1074] AltRl / rGrCrUrGrCrArGrA iUNA- SEQ ID NO: 482 FANCF_tgtl3_UNA12 rA'rGtGtGrArUrUrCrCrArUrGrGrUrUrUrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1075] 'AltRl / rGrCrUrGrCrArGrArA iL / NA- SEQ ID NO: 483 FANCF_tgtl3_UNAll rGrGrGrArUrUrCrCr. ArUrGrGrUrLIrLH / rArGrArGrCrUr. Ar crRNA with single UNA base UrGrCrU / AltR2 /

[1076] / AltRl / rGrCrLIrGrCrArGrArArG / iUNA- SEQ ID NO: 484 FANCF_tgtl3_UNA10 rG / rGrArUrUrCiCrArUrGrGrUrUrUrUrArGrArGiCrUrArUr crRNA with single UNA base GrCrU / \llR2

[1077] / AltRl / rGrCrUrGrCrArGrArAiGrG / iUNA- SEQ ID NO: 485 FANCF_tgtl3_UNA9 tG / rArUrUtCiCrArUrGiGrUrUrUrUrArGrArGrCrUrArUrGr crRNA with single UNA base CrU / AltR2 /

[1078] / AltRl / rGrCrUrGrCrArGrArArGrGrG / iUNA- SEQ ID NO: 486 FANCF_tgtl3_UNA8 rA'rUrUrCrCrArUrGrGrUrUrUrUrArGrArGrCrUrArUrGrCr crRNA with single UNA base U / AHR2 /

[1079] -AltRl / rGrCrUrGrCrArGrArAiGrGrGrA / iUNA- SEQ ID NO: 487 FANCF_tgtl3_UNA7 rU / rUrCrCrArUrGrGrUrUrUrUrArGrArGrCrUrArUrGrO-U / crRNA with single UNA base AltR2 /

[1080] / AltRl / rGrCrUrGrCrArGrArArGrGrGrArU / iUNA- SEQ ID NO: 488 FANCF_tgtl3_UNA6 rLI'rCrCrArUrGrGrUrUrUrUr. ArGrArGrCrLTrArUrGrCrU / . Alt crRNA with single UNA base R2 /

[1081] SEQ ID NO: 489 AltRl / rGrCrUrGrCrArGrArAiGrGrGrArUrU / iUNA- FANCF_tgtl3_UNA5 crRNA with single LINA base tC / rCr AiUiGrGrUrUrUrUrArGr ArGrCrUrArUrGrCrU / A11R2

[1082] SEQ ID NO: 490 / AltRl / rGrCrUrGrCrArGrArArGrGrGrArUrUrC / iUNA- FANCF_tgtl3_UNA4 crRNA with single UNA base rC rArLTrGrGrUrUrUrUr. ArGr. ArGrCrLTrArLTrGrCrU / AltR2 /

[1083] SEQ ID NO: 491 FANCF_tgtl3_UNA3 / AltRl / iGrCrUrGrCrArGrArArGrGrGrArUrUrCrC / iLTNA- crRNA with single UNA base rA'rUrGrGrUrUrUrUrAiGrArGrCrUrArUrGrCrU / AltR2 / / AltRl / rGrCrUrGrCrArGrArAiGrGrGrArUrUrCrCrA / iLJNA- SEQ ID NO: 492 FANCF tgtl3 UNA2 crRNA with single UNA base rU / rGiGrUrUrUrUrArGr. ArGrCrUrArUtGiCrU / AltR2 /

[1084] SEQ ID NO: 493 FANCF_tgtl3_UNAl / AltRl / rGrCrUrGrCrArGrArArGrGrGrArUrUrCrCrArU / iUN crRNA with single LINA base A-rG / rGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1085] / AltRl / / iUNA- SEQ ID NO: 494 EMX1 UNA20 rt i I'Art irUrCrCrt irArt h'CrAiGr Ar Art ir Ar ArGr Ar ArGrl ’rUr crRNA with single UNA base UrUrArGr ArGrCrUrArUrGrCrU / AltR2 /

[1086] A lRI iG il NA- SEQ ID NO: 495 EMX1 UNA19 rA'rGrUrCrCrGrArGrCrArGrArArGrArArGrArArGrUrUrUr crRNA with single UNA base

[1087]

[1088] UrArGrArGrCrUrArUrGrCrU / AltR2 / Attorney Docket No.: 6391-0012WO01

[1089] / AltRl / rGrA / iUNA- SEQ ID NO: 496 EMX1 LINA18 rG / rLWrCiGrArGrCr. AiGrArArGrArArGrArArGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUrArLrGrCrU / AltR2 /

[1090] JAltRl / rGr. ArG / iUNA- SEQ ID NO: 497 EMX1_UNA17 rU / tCrCrGrArGiCrAK^^^ crRNA with single UNA base GrArGrCrI JrArl JrGrCrt V AltR2 /

[1091] / AltRl / rGr. ArGrU / iUNA- SEQ ID NO: 498 EMX1 UNA16 rC / rCrGrArGrCrArGrArArGrArArGrArArGrUrUrUrUrArGr crRNA with single LINA base ArGrCrUrArUrGrCrU / AltR2 /

[1092] 'AltRl / rGrArGrUrC / iUNA- SEQ ID NO: 499 I \L\1 UNA15 rC / rGrArGrCrAiGrArAiGrArArGrArArGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[1093] SEQ ID NO: 500 EMX1 UNA14 iG / rArGtCrArGrArArGrArArGrArArGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1094] / AltRl / rGr. AiGrUrCrCrG / iUNA- SEQ ID NO: 501 EMX1 UNA13 rA rGrCrArGr Ar ArGr Ar. ArGrArArGrL'rLWrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1095] / AltRl / rGr. ArGrUrCiCiGrA'iLiNA- SEQ ID NO: 502 EMX1JINA12 rG / rCr ArGr Ar AiGrAr ArGr ArArGrI Jrl rl H TrArGrAiGrCrl Jr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1096] / AltRl / rGrArGrLTrCrCrGrArG / iUNA- SEQ ID NO: 503 EMX1 UNA11 tC / rArGrArAiGrArArGrArArGrLTrLTrUrUrAiGrAiGiCrUrAr crRNA with single UNA base UrGrCrU7AltR2 /

[1097] / AltRl / rGrAiGrUrCrCrGrArGrC / iUNA- SEQ ID NO: 504 EMX1 UNA10 rA'rGrArArGrArArGrArArGrUrUrUrUrArGrArGrCrUrArUr crRNA with single UNA base GrCrU / AltR2 /

[1098] / AltRl / rGrAiGrUiCiCrGrArGrCrA / iUNA- SEQ ID NO: 505 EMX1 UNA9 rG / rArAiGrArArGrArAiGrUrUrUrUrAiGrAiGrCrUrArUrGr crRNA with single UNA base CrU / AltR2 /

[1099] 'AltRl / rGr. ArGrUrCrCrGrArGrCrArG / iUNA- SEQ ID NO: 506 EMX1 UNA8 rA'rArGrArArGrArArGrUrUrUrUrArGrArGrCrUrArUrGrCr crRNA with single UNA base U / A11R2 /

[1100] / AltRl / rGrArGrLTrCrCrGrArGrCrAiGrA / iLTNA- SEQ ID NO: 507 EMX1 UNA7 rA'rGrAr ArGr Ar ArGrLTrLTrLTrLTr ArGr ArGrCrUrArUiGrCrLT / crRNA with single UNA base AltR2 /

[1101] / AltRl / rGrAiGrUrCrCrGrArGiCrAiGrArA / iUNA- SEQ ID NO: 508 EMX1 UNA6 rG / rAr ArGr Ar. ArGrUrUrUrUrArGrArGrCrUrArUrGrCrU / Alt crRNA with single UNA base R2 /

[1102] / AltRl / rGrArGrUrCrCrGrArGrCrArGrArArG / iUNA- SEQ ID NO: 509 EMX1 UNA5 rA'rArGrArArGrUrUrUrUrArGrArGrCrUrArUrGtCrU / AHR2 crRNA with single UNA base SEQ ID NO: 510 EMX1 UNA4 / AltRl / iGrArGrUrCrCrGrArGiCrAiGrArArGr / ViUNA- crRNA with single UNA base rA'rGrArAiGrUrUrUrUrAiGrArGrCrUrArUrGiCrU / AltR2 /

[1103] SEQ ID NO: 511 EMX1 UNA3 / AltRl / iGrArGrUrCiCiGrAiGrCrAiGrArArGrArA / iUNA- crRNA with single UNA base rG / rArArGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1104] SEQ ID NO: 512 EMX1 UNA2 / AltRl / rGrAiGrUiCiCiGrArGrCrArGrArArGrArArG / iUNA- crRNA with single LINA base rA'rArGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1105] SEQ ID NO: 513 / AltRl / rGr. ArGrUrCrCrGrArGrCr ArGr Ar. ArGr Ar ArGr A / iUN

[1106] EMX1 UNA1 crRNA with single UNA base A-rA / tGrUrUrUrUr ArGr. ArGrCrUrArL'rGrCrLl AltR2 /

[1107] A lRI il XA- SEQ ID NO: 514 HBB UNA20 rC / rUrUrGiCrCrCrCrArCrArGrGrGrCrArGrUrArArGrUrUrLJ crRNA with single UNA base rUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1108] / AltRl / rC / iUNA- SEQ ID NO: 515 HBB UNA19 rU / rUrGrCrCtCrCrAiCrAiGrGrGiCrArGrUrArArGrUrUrUr crRNA with single UNA base UrArGrArGrCrLJrArL¥GrCrU / AltR2 /

[1109] / AltRl / rCrU / iUNA- SEQ ID NO: 516 HBB UNA18rU / rGrCrCrCiCrArCr. ArGrGrGrCrArGrUrArArGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUrArUrGrCrU. AltR2 /

[1110] / AltRl / iCrUrU / iLJNA- SEQ ID NO: 517 HBB UNA17 tG / rCrCiCiCrArCrArGrGrGrCrArGrUrArArGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU / AltR2 /

[1111] 'AltRl / rCrUrUrG / iUNA- SEQ ID NO: 518 HBB UNA16 rO'rCrCrCrArCrArGrGrGrCrArGrUrArArGrUrUrUrUrArGr crRNA with single UNA base

[1112]

[1113] ArGrCrUrArUrGrCrU AltR2 / Attorney Docket No.: 6391-0012WO01

[1114] -AltRl / rCrUrUrGrC / iUNA- SEQIDNO: 519 HBB UNA15 rC / rCrCrArCrArGrGrGrCrArGrLWAiGiUrUrUrUr. LrGrAr crRNA with single UNA base GrCrUrArUrGrCrLVAltR2 /

[1115] TAltRl / rCrUrUrGrCrC / iLTNA- SEQIDNO: 520 HBB_UNA14 rC / iCrAiCrAiGrGrGrCrArGrUrArArGrUrUrUrUrArGrArGr crRNA with single UNA base CrI JrArt JrGrCrt T / AltR2 /

[1116] / AltRl / rCrUrUrGrCrCrC / iUNA- SEQIDNO: 521 HBB UNA13 rC / rArCrArGrGrGrCrArGrLTrArArGrUrUrUrUrArGrArGrCr crRNA with single LINA base UrArUrGrCrLVAltR2 /

[1117] / AltRl / rCrUrUiGrCrCtCiC / iUNA- SEQ ID NO: 522 HBB UNA12 rA'iCrArGiGiGiCrAiGrUrArAiGrUrUrUrUrArGrArGiCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1118] / AltRl / rCrUrUrGrCrCrCrCrA / iUNA- SEQ ID NO: 523 HBB UNAll iC / rAiGiGiGrCrArGrUrArArGrLTrLTrUrUrAiGiArGrCrUrAr crRNA with single UNA base UrGrCrU / AltR2 /

[1119] / AltRl / rCrUrUrGrCrCrCrCrAiC / iUNA- SEQIDNO: 524 HBB UNA10 rA'rGrGtGrCrAiGrUrArAiGrUrUrUrLrAiGrAiGiCrUrArUr crRNA with single UNA base GrCrU / AltR2 /

[1120] / AltRl / rCrUrUrGrCrCrCrCrArCrA / iUNA- SEQIDNO: 525 HBB I NJA9 rG'rGrGrCrArGrl JrArArGrl Jrt Jrt Jrt TrArGrArGrCrt TrArl JrGr crRNA with single UNA base CrU / AltR2 /

[1121] / AltRl / iCrUrUrGrCrCrCrCrAiCrAiG / iUNA- SEQIDNO: 526 HBB UNA8 tG / rGrCrAiGrUrArArCkUrUrUrUrArGrArGtCrUrArUiGrCr crRNA with single UNA base U / AltR2'

[1122] / AltRl / iCrUrUiGiCiCrCiCrAiCrAiGiG / iUNA- SEQ ID NO: 527 HBB UNA7 rG / rCrArGrUrArArGrUrUrUrUrAiGrArGrCrUrArUrGrCrU / crRNA with single UNA base AltR2 /

[1123] / AltRl / rCrUrUiGiCrCrCrCrArCrArGiGrG / iUNA- SEQIDNO: 528 HBB UNA6 rC / 'rAiGrUrArAiGrtJrUrUrUrAiGrAiGrCrUrArUiGiCrU / Alt crRNA with single UNA base R2 /

[1124] 'AltRl / rCrUrUrGrCrCrCrCrArCrArGrGrGrC / iUNA- SEQIDNO: 529 HBB_L'NA5 rArtjrLTrArArGrtJrUrUrUrAr<frArGtCrL¥ArLTrtjiCrU / AltR2 crRNA with single UNA base /

[1125] SEQ ID NO: 530 HBB UNA4 / AltRl / rCrUrUiGiCrCrCrCrArCrArGrGrGrCrA / iUNA- crRNA with single UNA base iG / rUrAiAiGiUrUrUrUr. ArtjrArGrCrUrArUiGiCrU / AltR2 /

[1126] SEQIDNO: 531 'AltRl / rCrUrUrGrCrCrCrCrArCrArGrGrGrCrArG / iLTNA- HBB UNA3 crRNA with single UNA base rU / rArArGrUrUrUrUrArGrAiGrCrUrArUiGrCrU / AltR2 /

[1127] SEQ ID NO: 532 / AltR 1 / rCrt Tri JrGrCrCrCrCr ArCr ArGrGrGrCr ArGrI Vil INA- HBB UNA2rcrRNA with single UNA base A'rArGrUrUrUrUrAi<k. ArGrCrUr. ArUrGrOU / AltR2 /

[1128] SEQIDNO: 533 HBB L'NAl / AltRl / rCrLTrLTiGrCrCrCiCrAiCrArtjrtjrGrCnLrGrtJrA'iUN crRNA with single UNA base A-rA / rGrUrUrUrUrArGr. AiGrCrUrArUrGrCrU / AltR2 /

[1129] / AltRl / / iUNA- SEQIDNO: 534 AR UNA20 rG'rLHkGrGrArGrCrArUrCrUrGrArGrLYCrCrArGrGrUrUr crRNA with single UNA base I Tri TrArGrArGrCrt r Ari TrGrCrt T / AHR2 /

[1130] / AltRl / rG / iUNA- SEQ ID NO: 535 AR UNA19 rU / rUrGrGr. ArGrCr. ArUrCrUrGrArGrUrCrCr. ArGrGrUrUrUr crRNA with single LINA base UrAr&2\rGrCrUnArUrGiCrU / AltR2 /

[1131] 'AltRl / rGrU / iUNA- SEQ ID NO: 536 AR UNA18 rU / rGrGrArGrCnArUrCrUrGrArGrUrCrCrArGrGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUrArUrGrCrU / AltR2 /

[1132] 'AltRl / rGrUrU / iUNA- SEQ ID NO: 537 AR UNA17 iG / rGrAiGiCrArUrCrUrGrArGrLTrCrCrAiGrGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU / AltR2 /

[1133] 'AltRl / rGrUrUrG / iUNA- SEQIDNO: 538 AR UNA16 rGrArGrCrArUrCrUrGr. ArGrUrCrCrArGrGrUrUrUrUr. ArGr crRNA with single UNA base ArGrCrUrArUrGrCrlVAltR2 /

[1134] TAltRl / rGrUrUrGrG / iUNA- SEQ ID NO: 539 AR UNA15 rA'rGrCrArUrCrUKk. ArGrUrCrCrArGrGrUrUrUrUrArGr. Ar crRNA with single LINA base GrCrUrArUrGrCrU / AltR2 /

[1135] / AltRl / iGrUrUrGrGrA / iLlNA- SEQ ID NO: 540 AR UNA14 rt3 / rCrArUiCrUi<3rAiGrUrCrCrArGrGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1136] 'AltRl / KkUrUiGrGrAiG / iLTNA- SEQ ID NO: 541 AR UNA13 rO'rArUrCrUrGrAiGrUrCrCrAiGrGrUrUrUrUrArGrArGiCr crRNA with single UNA base

[1137]

[1138] UrArUrGrCrU / AltR2 / Attorney Docket No.: 6391-0012WO01

[1139] / AltRl / rGrUrUrGrGrArGrC / iLiNA- SEQIDNO: 542 AR UNA12rAWrCrUi<kAiGrUrCrCrAiGrGrUrUrUrUrArGrArGiCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1140] / AltRl / rGrUrUrGrGrArGrCrA'iLMA- SEQIDNO: 543 AR UNAll rLT / tCrLlrGrArGrUrCrCrArGrGrUrLTrLWrArGrArGrCrUrAr crRNA with single UNA base UrGrCrU / A1tR2 /

[1141] / AltRl / rGrUrUrGrGr. ArGrCrArU / iUNA- SEQ ID NO: 544 AR UNA10 rC / rUrGrAiGrUiCiCrAiGrGrUrUrUrUrArGrArGiCrUrArUr crRNA with single LINA base GrCrU / AltR2,

[1142] 'AltRl / rGrUrUrGrGrArGrCrArUrC / iUNA- SEQ ID NO: 545 AR UNA9 rU / iGrAiGrtJrCiCrAiGrGrUrUrLTrUrArGrArGrCrUrArUrGr crRNA with single UNA base CrU / AltR2 /

[1143] / AltRl / rGrUrUiGiGrArGrCrArUrCrU / iUNA- SEQ ID NO: 546 AR UNA8 I'G / rArGrUi'CrCrArGrtjrUrUrUrLTrArGiAiGiCrUrArUrGiCr crRNA with single UNA base U / A1IR2

[1144] / AltRl / iGrUrUiGiGrArGrCrArUrCrUrG / iUNA- SEQIDNO: 547 AR UNA7 rA'rGrUrCrCrArGrGrUrUrUrUrAKkArtJrCrUrArUrGr& U / crRNA with single UNA base AltR2 /

[1145] / AltRl / rGrUrUrGrGrArGrCrArlTrCrUrGr. A / iUNA- SEQ ID NO: 548 AR_UNA6 rG'rl TrCrCrAiOiOrl Tri Tri Tri JrArGrArGrCrI W TrGrCrI T / A11 crRNA with single UNA base R2 /

[1146] SEQ ID NO: 549 / AltRl / rGrUrUiGrGrArGrCrArUrCrUrGrAiG / iUNA- AR UNA5 crRNA with single UNA base rU / rCrCrAiGrGrUrUrUrUrArGrArGrCrUrArUrGiCrU / . AltR2' TAltRl / rGrUrUrGrGrArGrCrArLTrCrUrGrArGrU / iUNA- SEQIDNO: 550 AR UNA4 crRNA with single UNA base rC rCrAi<jrGrUrUrUrUr. ArGr. ArGrCrL¥ArLTrGrCrU / .'XltR2 /

[1147] SEQIDNO: 551 / AltRl / KkUrUrGrGrArGtCrArUiCrUi& AKkUrC / iLlNA- AR_UNA3 crRNA with single UNA base rC / rArGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1148] SEQIDNO: 552 / AltRl / rGrUrUrGrGrArGrCrArUrCrUrGrArGrUrCrC / iLTNA- AR UNA2 crRNA with single UNA base rA / rGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1149] SEQIDNO: 553 AR UNAl / AltRl / rGrUrUiGiGrArGrCrArUrCrUrGrArGrUrCiCrA / iUN crRNA with single UNA base A-rG / rGrUrUrUrUrArGr. AiGrCrUrArUrGrCrU / AltR2 /

[1150] / AltRl / / iUNA- SEQIDNO: 554 IIEKS3 i x\20 iG / rGrCtCiCrArGrArCrLTrGrArGrCrArCiGrUrGrArGrUrLTr crRNA with single UNA base UrUrArGrArGrCrUrArUrGiCrU / AltR2 /

[1151] / AltRl / rG / iUNA- SEQIDNO: 555 HEKs3_UNA19 lO / rCiCiCrArGr. ArCrUrGrArGrCrAiCrGrUrGr. ArGrUrUrUr crRNA with single UNA base UrArGrArGrCrUrArUrGrCrU / AltR2 /

[1152] / AltRl / rGrG / iUNA- SEQIDNO: 556 HEKs3_UNA18 rC / rCrCrArGrAiCrUrGrArGrCrArCrGiUrGrAiGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUrArLrGrCrU / AltR2 /

[1153] TAltRl / rGrGrC / iUNA- SEQIDNO: 557 HEKs3_UNA17 rC / tCrAiGrArCrUrGrArGrCrArCtGrLlrGrArGrUrUrUrUrAr crRNA with single UNA base GrArGrCrI TrArl TrGrCrI V A1tR2 /

[1154] / AltRl / rGrGrCrC / iUNA- SEQIDNO: 558 HEKs3_UNA16 rC / rArGrArCrUiGrAiGrCrArCrGrUrGrArGrUrUrUrUrArGr crRNA with single LINA base ArGrCrUr / \rUrGrCrU / AltR2 /

[1155] 'AltRl / rGrGrCrCrC / iUNA- SEQIDNO: 559 HEKs3_UNA15 rAtGrArCrUrGrAiGrCrArCKfrLTrGrArCfrUrUrUrUrArCirAr crRNA with single UNA base GrCrUrArUiGrCrU / AltR2 /

[1156] A lRI rtirtirt it it rA il XA- SEQ ID NO: 560 HEKs3_UNA14 rG'rArCrUrGrArGrCrArCrGrUrGrArGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1157] / AltRl / rGiGiCiCiCrAiG / iL’NA- SEQIDNO: 561 HEKs3 UNA13 rA rCrUrGr ArGrCrArCrGrUrGr ArGrUrUrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1158] / AltRl / rGrGrCrCrCrArGrA'iLiNA- SEQ ID NO: 562 HEKs3_UNA12 rC / rUrGrAiGrCrAiCrGrUrGr. ArGrUrUrUrUrArGrArGrCrUr crRNA with single LINA base ArUrGrCrU / AltR2 /

[1159] / AltRl / rGrGrCrCrCrArGrArC / iUNA- SEQ ID NO: 563 HEKs3_UNAl 1 rU / rGrArGtCrAiCKkUrGrArGrUrUrUrUrArGrArGiCrUrAr crRNA with single UNA base UrGrCrU / AltR2,

[1160] / AltRl / rGrGrCiCrCrArGrArCrU / iUNA- SEQ ID NO: 564 HEKs3_UNA10 rG / rArGrCrArCrGrUrGrArGrUrUrUrUrArGrArGrCrUrArUr crRNA with single UNA base

[1161]

[1162] GrCrU / AltR2 / Attorney Docket No.: 6391-0012WO01

[1163] / AltRl / rGiGiCiCiCrArGrArCrUiG / iUNA- SEQIDNO: 565 HEKs3_UNA9 rArGrCrAiCrGrUrGr^ crRNA with single UNA base CrU / AltR2

[1164] / AltRl / rGrGrCrCrCrArGrArCrUrGrA / iUNA- SEQIDNO: 566 HEKs3_UNA8 rG'rCrArCrGrUrGrArGrUrUrUrUrArGrArGrCrUrArUrGrCr crRNA with single UNA base U / AHR2 /

[1165] / AltRl / rGrGiCrCrCrArGrArCrUiGrArG / iUNA- SEQ ID NO: 567 HEKs3_UNA7 rC / rAiCrGrUiGrAKkUrUrUrUrAiGrArGrCrUrArUrGrCrU / crRNA with single LINA base AltR2 /

[1166] / AltRl / rGrGrCiCiCrAiGrAiCrUiGrAiGrC / iUNA- SEQ ID NO: 568 HEKs3_UNA6 rA'iCrGrUiGrAiGrUrUrUrUrAiGrArGiCrUrArUiGiCrU / Alt crRNA with single UNA base R2 /

[1167] / AltRl / rGrGrCrCrCrAK^^

[1168] SEQ ID NO: 569 HEKs3_UNA5 rO'rGrUrGrAiGrUrUrUrUrAiGrAiGrCrUrArUrGiCrU / AltR2 crRNA with single UNA base SEQIDNO: 570 HEKs3 UNA4 / AltRl / rGiGiCrCrCrArGrAiCrUiGrAiGrCrArC / iLlNA- crRNA with single UNA base rG / rUrGrAi<3rUrUrUrUr. AiGrArGrCrUrArUr<3rCrU / AltR2 /

[1169] SEQ ID NO: 571 HEKs3_UNA3 AltRl / rChCrCrCra^ crRNA with single UNA base rU / rGrArGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1170] SEQ ID NO: 572 / AltRl / rGiGiCiCiCrArGrArCrUiGrAiGrCrAiCiGrLViUNA- HEKs3_UNA2 crRNA with single UNA base rGrArGrUrUrUrUrArGr. ArGrCrUrArl'rGrCrU / AltR2 / / AltRl / rGrGrCrCrCrArGrArCrUrGrArGrCr. ArCrGrlTO / ilTN

[1171] SEQ ID NO: 573 HEKs3_UNAl crRNA with single UNA base A-rA / rGrLHHlrUrArGrArGrCrUrArLKhCrLT / Al^

[1172] / AltRl / / iUNA- SEQIDNO: 574 HPRT38087 UNA20 rA-'rArUrUrArUrGrGrGrGrArUrUrAiCrUrArGrGrAtGrUrUr crRNA with single UNA base UrUr. ArGrArGiCrUrArUrt3rCrU / AltR2 /

[1173] 'AltRl / rA / iUNA- SEQIDNO: 575 HPRT38087 UNA19 rA'rLH’rArUrGrGrGrGr. ArUrUrArCrLrArGrGrArGrUrUrUr crRNA with single UNA base UrArGr. ArGrCrUrArUrGrCrU / AltR2 /

[1174] / AltRl / rArA / iUNA- SEQ ID NO: 576 HPRT38087 UNA18 rU / rUrArUrGrGrGrGrArUrUrArCrUrArGrGrArGrUrUrUrUr crRNA with single UNA base ArGrArGrCrUrArUrGrCrU / AltR2 /

[1175] / AltRl / rArArU / iUNA- SEQ ID NO: 577 HPRT38087 UNA17 rU / rArUtGtGrGrGrArUrUrAiCrLTrArGrGrAiGrUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU / AltR2'

[1176] 'AltRl / r. ArArUrU / iUNA- SEQIDNO: 578 HPRT38087 UNA16 rAWrGrGrGrGrArUrUrArCrUrArGrGrArGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArUrGrCrU AltR2 /

[1177] / AltRl / rArArUrUrA / iUNA- SEQIDNO: 579 HPRT38087 UNA15 rU / rGrGtGrGrArUrUrAiCrUrAiGiGrAiGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrLVAltR2 /

[1178] / AltRl / r. Ar. ArUrUrArU / iUNA- SEQIDNO: 580 HPRT38087 UNA14 rG'rGrGrGrArLTrUrArCrUr. ArGrGrArGrlHHTrlTrArGrArGr crRNA with single UNA base Crl JrArl JrGrCrI T / AltR2 /

[1179] / AltRl / rArArUrUrArUrG / iUNA- SEQIDNO: 581 HPRT38087 UNA13 rG / rGrGrArUrUrArCrUrArGrGrArGrUrUrUrUrArGrArGrCr crRNA with single LINA base UrArUrGrCrLVAltR2 /

[1180] / AltRl / rArArUrUrArUrGrG / iLlNA- SEQIDNO: 582 HPRT38087 UNA12 r( 'iGrArUrUrArCrUrArGiLkAiGrtJrUrUrUrAiGrAiGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1181] A lRl r \rArl rl rArl r(;rtirti il \A- SEQIDNO: 583 HPRT38087 UNA11 rG'rArUrUrArCrUrArGrGrAiGrUrUrUrUrArGrArGrCrUrAr crRNA with single UNA base UrGrCrU / AltR2 /

[1182] / AltRl / rArArUrUrArUrGrGrGrG / iL'NA- SEQIDNO: 584 HPRT38087 UNA10 rA / 'rLWrAiCrUrArGrGrAiGrUrUrUrLrAiGrAiGiCrUrArUr crRNA with single UNA base GrCrU / AltR2 /

[1183] / AltRl / rArArUrUrArUrGrGrGrGrA / 'iL'NA- SEQIDNO: 585 HPRT38087 UNA9rU / rUrArOUrAi<3i<kArGrUrUrUrUrArGrArGiCrUrArUrGr crRNA with single UNA base CrU / AltR2 /

[1184] / . AltRl / r. ArArUrUrArUrGrGrGrGr. ArU / iUNA- SEQIDNO: 586 HPRT38087 UNA8 rU / rArCrUrAiGiGrArGrUrLTrLWrArGrArGtCrUrArUrGrCr crRNA with single UNA base U / AltR2 /

[1185] / AltRl / rArArUrUrArUrGrGrGrGrArUrU / iUNA- SEQIDNO: 587 HPRT38087 UNA7 rA'rCrUrArGiGrArGrUrUrUrUrAiGrArGrCrUrArUrGrCrU / crRNA with single UNA base

[1186]

[1187] AltR2 / Attorney Docket No.: 6391-0012WO01

[1188] / AltRl / rArArUrUrArUrGrGrGrGrArUrUrA / iUNA- SEQIDNO: 588 HPRT38087 EINA6 rO'rUrArGrGrAiGrUrUrUrUrArGrAiGrCrUrArUrGrCrU / Alt crRNA with single UNA base R2 /

[1189] / AltRl / rArArUrUrArUrGrGrGrGrArUrUrArC / iEJNA- SEQIDNO: 589 HPRT38087 EJNA5 rlT / rArGrGrArGrUrUrUrUr. ArGr. ArGrCrl¥ArlTrGiCrU / . AltR2 crRNA with single UNA base /

[1190] SEQ ID NO: 590 HPRT38087 UNA4 / AltRl / rArArUrUrArUrGrGrGrGrArUrUrArCrU / iUNA- crRNA with single ETNA base rA'iGrGrArGrUrUrUrUrAiGrArGrGU’rArUrGrCrU / AltR2 /

[1191] SEQ ID NO: 591 HPRT38087 UNA3 / AltRl / rArArUrUrArUrGrGrGrGrArUrUrArCrUrA / iUNA- crRNA with single UNA base rG / iGrArGrUrUrUrUrArGr. AiGrCrUrArUiGrCrU / AltR2 /

[1192] SEQ ID NO: 592 / AltRl / rArArETrETrArUrGrGrGrGrArUTrUrArCrETrArG / iElNA- HPRT38087 UNA2 crRNA with single UNA base rG / rArGrUrUrUrUrArGrArGrCrETrArUrGrCrU / AltR2 / 4\ltRl / r^ArUrUrArUrGrGrGrGr.\rUrUr. ArCrUrArGrG / iLIN

[1193] SEQIDNO: 593 HPRT38087 UNA1 crRNA with single UNA base A-rA / rGrUrUrUrUrArGrArGrCrETrArUrGrCrU / AltR2 /

[1194] / AltRl / / iUNA- SEQ ID NO: 594 B2MJ1NA20 rC / rt Tri TrArCrCrCrCrArCrI Tri WArCrt Tr Art TrCrl JrGrI Tri Tri I crRNA with single UNA base rUrArGrAiGrCrUrArUrGrCrU / AltR2 /

[1195] / AltRl / iC / iUNA- SEQ ID NO: 595 B2M UNA19 rU / rUrArCiCiCiCrArCrUrUrArArCrUrArUrCrUrGrUrUrUrU crRNA with single UNA baserAiGrAiGiCrUrArUrGrCrU / AltR2 /

[1196] 'AltRl / rCrU / iUNA- SEQ ID NO: 596 B2M UNA18 rU / rArCrCrCrCrArCrUrUrArArCrUrArUrCrUrGrUrUrUrUrA crRNA with single UNA base rGrAiGrCrUr. ArUrGrCrU / AltR2 /

[1197] 'AltRl / rOrUrU / iUNA- SEQIDNO: 597 B2M_UNA17 rA'rCrCrCrCrArCrUrUrArArCrUrArUrCrUrGrUrUrUrUrArG crRNA with single UNA base rAiGrCrUrArUrGrCrU / AltR2 /

[1198] / AHRl / rCrUrUrA / iUNA- SEQIDNO: 598 B2M EJNA16 rC / iCrCrCrArCrUrUr. ArArCrUrArUrC-UrGrUrUrUrUrAiGrA crRNA with single UNA base rGrCrUrArUrGrCrU / AltR2 /

[1199] / AltRl / rCrUrUrArC / iUNA- SEQ ID NO: 599 B2M UNA15 rC / rCrCrAi€rUrUrArArCrUrArUrCrUrGrUrUrLTrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[1200] / AltRl / rCrUrUrArCrC / iUNA- SEQ ID NO: 600 B2M UNA14 tC / rCrAiCrUrUrAr. AiCrUrArUrCrUtGrUrUrUrUrAiGrAiGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1201] / AltRl / rCrUrUrArCrCrC / iUNA- SEQ ID NO: 601 B2M UNA13 rO'rArCrUrUrArArCrUrArUrCrUrGrUrUrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1202] / AltRl / rCrUrUrArCrCrCrC / iUNA- SEQ ID NO: 602 B2M EJNA12 rA'rCrUrUrArAiCrUrArUrCrUrGrUrUrUrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1203] TAltRl / rCrUrUrArCrCrCrCrA / iUNA- SEQ ID NO: 603 B2MJJNA11 rC / rLWrArArCrUrArUrCrUrGrUrUrLWrArGrArGrCrUr. Ar crRNA with single UNA base UrGrCrU / A1tR2 /

[1204] / AltRl / iCrUrUrArCrCrCrCrAiC / iUNA- SEQ ID NO: 604 B2M UNA10 rU / rUrArArCrUrArUrCrUrGrUrUrUrUrArGrArGiCrUrArUr crRNA with single ETNA base GrCrU / AltR2 /

[1205] / AltRl / rCrUrUrArCrCtCiCrAiCrU / iUNA- SEQ ID NO: 605 B2M UNA9 rU / rArArCrUrArUrCrUiGrUrUrUrUrArGrArGrCrUrArUrGr crRNA with single UNA base CrU / AltR2 /

[1206] / AltRl / rCrUrUrArCrCrCrCrArCrUrU / iUNA- SEQ ID NO: 606 B2M UNA8 rA'rArCrUrArUrCrUrGrUrUrUrUrArGrArGrCrUrArUrGrCr crRNA with single UNA base U / A1IR2

[1207] / AltRl / rCrUrUrArCrCrCrCrAiCrUrUrA / iUNA- SEQ ID NO: 607 B2M UNA7 rA'rCrUrArUrCrUrGrUrUrUrUrAiGrArGrCrUrArUrGrO-U / crRNA with single UNA base AltR2 /

[1208] / AltRl / rCrUrUr. ArCiCrCrCrAiCrUrUr. Ar. A / iUNA- SEQ ID NO: 608 B2M ENJA6 rC / rUrArUrCrUiGrUrUrUrUr. ArGrArGrCrUrArUiGrCrU / . Alt crRNA with single ETNA base R2 /

[1209] / AltRl / iCrUrUrArCrCrCrCrAiCrUrUrArArC / iLlNA- SEQ ID NO: 609 B2M UNA5 rU / rArUrCrUiGrUrUrUrUrArGrArGrCrUrArUrGiCrU / AltR2 crRNA with single UNA base /

[1210] SEQ ID NO: 610 B2M UNA4 / AltRl / rCrUrUrArCiCrCrCrAiCrUrUr. Ar. ArCrU / iUNA- crRNA with single UNA base rA'rUiCrUrGrUrUrUrUr. ArGr. AiGiCrUrArUrGrCrU / AltR2 /

[1211]

[1212] Attorney Docket No.: 6391-0012WO01

[1213] SEQ ID NO: 611 / AltRl / rCrLTrLTr / LrCrCrCiCrAiCrUrUr / Xr / LrCrUrA / iLJNA- B2M_UNA3 crRNA with single UNA base rU / rCrUtGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1214] SEQ ID NO: 612 / AltRl / rCrUrUrAiCrCrCrCrArCrUrUrArArCrUrArU / iUNA- B2M LNJA2 crRNA with single UNA base rO'rUrGrUrUrUrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1215] SEQ ID NO: 613 B2M UNA1 / AltRl / rCrUrUrAiCrCrCrCrArCrUrUrArArCrUrArUrC'iUN crRNA with single LINA base A-rU / rGrUrUrUrUrArGrAiGrCrUrArUrGrCrU / AltR^

[1216] / AltRl / / iUNA- SEQ ID NO: 614 APOBEC3A UNA20 rC / rGiGrUiCrArAiGrArUrG^ crRNA with single UNA base UrUrArGrArGrCrUrArUrGrCrU / AltR2 /

[1217] AltRl / rC / iUNA- SEQ ID NO: 615 APOBEC3A UNA19 iG / rGrUt'CrArArGrAr UrGrGrArCrCrAiGrCrArCrGrUrUrUr crRNA with single UNA base UrArGrArGiCrUrArUrGrCrU / AltR2 /

[1218] / AltRl / rCrG / iUNA- SEQ ID NO: 616 APOBEC3A UNA18 rG / rUrCrArAiGrArUrGrGrAiCrCrArGrCrAiCrGrUrUrUrUr crRNA with single UNA base ArGr. ArGrCrUrArLrGrCrU'AltR2 /

[1219] / AltRl / rCrGrG / iUNA- SEQ ID NO: 617 APOBEC3AJJNA17 rt T'rCrArArGrArt IrGrGrArCrCrArGrCrArCrGrl Jrt Jrl Jrt Jr Ar crRNA with single UNA base GrArGrCrUrArUrGrCrU / AltR2 /

[1220] / AltRl / iCrGrGrU / itlNA- SEQ ID NO: 618 APOBEC3A UNA16 tC / rArAiGrArUiGiGrAiCrCrArGrCrAiCiGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArUrGrCrU / AltR2'

[1221] / AltRl / iCiGiGrUiC / iUNA- SEQ ID NO: 619 APOBEC3A UNA15 rA'rArGrArUrGrGrArCrCrArGrCrArCrGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[1222] / AltRl / rCKJrOrUrCrA / iUNA- SEQ ID NO: 620 APOBEC3A UNA14 rA'rGrArUrGitkAiCrCrArGrCrArCrGrUrUrUrUrArGr. ArGr crRNA with single UNA base CrUrArUiGiCrU / AltR2 /

[1223] / AltRl / rCrGrGrUrCrArA / iUNA- SEQ ID NO: 621 APOBEC3A UNA13 rG'rArL’rGrGrArCrCr. ArGrCrArCrGrLWrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1224] / AltRl / rCrGrGrLTrCrArArG / iUNA- SEQ ID NO: 622 APOBEC3A UNA12 rAWrGrGrArCrCrArGrCr. ArCrGrUrUrUrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1225] / AltRl / rCiGrGrUrCrArArGrA / 'iUNA- SEQ ID NO: 623 APOBEC3A UNA11 rU / rGrGrAiCiCrAiGrCrAiCrGrUrUrUrUrArGrArGrCrUrAr crRNA with single UNA base UrGrCrU / AltR2 /

[1226] / 'AltRl / ZiUNA- SEQ ID NO: 624 APBB2 UNA20 rU / rUrGrGrGrArCrArArCrGrUrUrGrUrCrCrArGrCrGrUrUr crRNA with single UNA base UrUrArGrArGiCrUrArUrt3rCrU / AltR2 /

[1227] / AltRl / rU / iUNA- SEQ ID NO: 625 APBB2 UNA19 rU / rGrGtGrArCrArArCKkUrUiGrUrCrCrAiGiCrGrUrUrUr crRNA with single UNA base UrArGr. ArGrCrUrArUrGrCrU / AltR2 /

[1228] / AltRl / rUrU / iUNA- SEQ ID NO: 626 APBB2 UNA18 rG'rGrGrArCrArArCrGrUrUrGrUrCrCrArGrCrGrUrUrUrUr crRNA with single UNA base ArGrArGrCrI Jr Ari rGrCrt I AHR 2

[1229] / AltRl / rUrUrG / iUNA- SEQ ID NO: 627 APBB2 UNA17 rG / rGrArCrArAiCKkUrUrGrUrCrCrArGrCi<3rUrUrUrUrAr crRNA with single LINA base GrArGrCrUr / VUrGrCrUZAltR2Z

[1230] 'AltRl / rUrUrGrG / iUNA- SEQ ID NO: 628 APBB2 UNA16 rG / rArCrArArCrGrUrUrGrUrCrCrArCirCrGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArUrGrCrUZAltR2Z

[1231] ZAltRl / rUrUrGiGiG / iUNA- SEQ ID NO: 629 APBB2 UNA15 rA'iCrArArCiGrUrUrGrUrCiCrAiGrOGrUrUrUrUrArGrAr crRNA with single UNA base GrCrUrArUrGrCrU / AltR2 /

[1232] 'AltRl / rUrUrGrGrGrA / iUNA- SEQ ID NO: 630 APBB2 UNA14 rC'rArAiCrGrUrUrGrUrCrCrArGrCrGrUrUrUrUrArGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1233] / AltRl / rUrUrGrGrGrArC / iUNA- SEQ ID NO: 631 APBB2 UNA13 rA'rArCrGrUrUrGrUrCrCr. ArGrCrGrUrUrUrUrArGrArGrCr crRNA with single UNA base UrArUrGrCrU / AltR2 /

[1234] ZAltRl / rUrUiGiGrGrArCrAZiUNA- SEQ ID NO: 632 APBB2 UNA12rA'rCrGrUrUi<3rUiCrCrArGrCrGrUrUrUrUrArGrArC3iCrUr crRNA with single UNA base \r. JrGrC rl AllR2

[1235] 'AllRl / rUrUrGiOrGrAiCrAiA'iUNA- SEQ ID NO: 633 APBB2 UNA11 rO'rGrUrUrGrUrCrCrArGrCrGrUrUrUrUrArGrArGiCrUrAr crRNA with single UNA base

[1236]

[1237] UrGrCrUZAltR2Z Attorney Docket No.: 6391-0012WO01

[1238] >'AltRl / / iUNA- SEQ ID NO: 634 ADI1 UNA20 rC / rUrArCiGrArGrGr. ArGrCrArllrl'rUrGi'CrArCrUrGrUrUr crRNA with single UNA base UrUr. ArGrArGrCrUrArUrGiCrU / AltR2 /

[1239] / AltRl / rC / iUNA- SEQ ID NO: 635 ADI1_UNA19 rU'rArCrGrArGrGrArGrCr. ArUrUrUrGrCrArCrUrGrUrUrUr crRNA with single UNA base

[1240] I JrArGrArGrCrl Jr Art YGrCrt T / A1tR2 /

[1241] / AltRl / rCrU / iUNA- SEQ ID NO: 636 ADI1 UNA18 rA'rCrGr. ArGrGr. ArGrCrArUrUrUrGtCr. ArCrUrGrUrUrUrUr crRNA with single LINA base ArGrArGrCrUrArUrGrCrU / AltR2 /

[1242] 'AltRl / rCrUrA'iUNA- SEQ ID NO: 637 ADI1 UNA17 rC / r<3rAi<3r<3rAi<3iCrArUrUrLTi<3rCrArCrUi<3rUrUrUrUrAr crRNA with single UNA base GrArGrCrUrArUrGrCrU / AltR2 /

[1243] AltRl / rCrUrArC / iUNA- SEQ ID NO: 638 ADI1 UNA16 rG / rArGrGrArGrCrArUrUrUrGrCrArCrUrGrUrUrUrUrArGr crRNA with single UNA base ArGrCrUrArUrGrCrU A11R2 /

[1244] / AltRl / rCrUrArCrG / iUNA- SEQ ID NO: 639 ADI1 UNA15 rA rtirt riArt hCr ArUrUrUrGrCrArCrUrGrUrUrUrUrArGr. Ar crRNA with single UNA base GrCrUr. ArUrGrCrU / AltR2 /

[1245] / AltRl / rCrUr. ArCiGrA / iUNA- SEQ ID NO: 640 ADI1J1NA14 rG'rGrArGrCrArl Jrl Jrt JrGrCrArCrt TrGrt H Trt Trt Tr ArGrArGr crRNA with single UNA base CrUrArUrGrCrU / AltR2 /

[1246] / AltRl / iCrUrArCrGrArG / iUNA- SEQ ID NO: 641 ADI1 UNA13 rG / rAiGtCr. ArUrUrUrGrCrArCrUrGrUrUrUrUr. ArGr. ArGrCr crRNA with single UNA base UrArUrGrCrU / A11R2 /

[1247] / AltRl / iCrUrAiCiGrAiGrG / iUNA- SEQ ID NO: 642 ADI1 UNA12 rA,'rGrCrArUrUrUrGrCrArCrUrGrUrUrUrUrArGrArGrCrUr crRNA with single UNA base ArUrGrCrU / AltR2 /

[1248] / AltRl / rCrUrArCrGrArGrGrA / 'iUNA- SEQ ID NO: 643 ADI1 UNA11 tOrCrAiUrUrUrGrCr. ArCrUrGrUrUrUrUrAiGrAr<3iCrUrAr crRNA with single UNA base

[1249]

[1250] UrGrCrU / AltR2 /

[1251] Example 8. Assessment of UNA modifications in sgRNAs

[1252] To ensure that UNA modifications showed similar attributes as was seen with 2-part gRNA systems, UNA modified sgRNAs were compared to IDT’s standard AUT-R sgRNAs for on / off-target editing in cells (SEQ_ID_644, SEQ_ID_645, SEQ ID 646, SEQ ID 647). Cas9 editing was assessed with WT-Cas9 RNP delivery in U2OS cells. In brief, cells were nucleofected with

[1253] 4 pM RNP, WT-Cas9 V3 (IDT), with 3 pM electroporation enhancer (IDT). All samples were incubated for 72 hrs., gDNA collected with QUICKEXTRACT, the on-target editing site was amplified and prepped for NGS using RHAMPSEQ and analyzed using CRISP ALTRATIONS.

[1254] As was seen previously with 2-part systems, sgRNAs with UNAs placed at previously optimized positions (UNA position 18 for both EMX1 and AAVS1 target sites) showed on-target editing retention and stark decreases in off-target editing (Figure 14A-14B). This highlights the importance of the UNA modification placed in the gRNA spacer region for modulation of editing, regardless of the gRNA format being a 2-part or single guide system.

[1255] Table 11. Oligos

[1256] Sequence II) Name Sequence Description

[1257]

[1258] Attorney Docket No.: 6391-0012WO01

[1259] 644 mG*mA*mG*rUrCrCrGrArGrCrArGrArArGrArArGrArArGrUrUrUrUrArGrArGrCrUrArG AltR™

[1260] EMX1 AltR™ sgRNA rArArArUrArGrCrArArGrUrUrArArAr. ArUr. ArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrAr sgRNA. ArCrUrUrGr. ArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGi<frUrGrCmU*mU*rnU*rU mG*mG*mG*rGrCrCrArCrUrArGrGrGrArCrArGrGrArUrGrUrUrUrUrArGrArGrCrUrArG

[1261] 645 AAVS1 AltR™ sgRNA AltR™ rArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrAr sgRNA. ArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU mG*mA* / iUNA- 646 UNA EMX1 UNA18 sgRNA!< J / *rUrCrCrGr. ArGiCrArGrArArGrArArGrArArGrUrUrUrUrArGrArGrCrUrArGrArArArU Modified rArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUr sgRNA GrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU

[1262] mG*inG* / iUNA- UNA 647 rG / *rGrCrCrArCrUrArGrGrGrArCrArGrGrArUrGrUrUrUrUrArGrArGrCrUrArGrArArArU AAVS1 UNA 18 sgRNA Modified rArGrCrAiAiGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrAiUrCrArArCrUrUr sgRNA

[1263]

[1264] GrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU

[1265] While the invention has been described in detail and with reference to specific examples thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.

[1266] References:

[1267] 1. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012).

[1268] A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science, 357(6096), 816-821.

[1269] 2. Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., Cradick, T. J., Marraffmi, L. A., Bao, G., & Zhang, F. (2013). DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnology, 31(9), 827-832.

[1270] 3. Fu, Y., Foden, J. A., Khayter, C., Maeder, M. L., Reyon, D., Joung, J. K., & Sander, J. D.

[1271] (2013). High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology, 37(9), 822-826.

[1272] 4. Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W., Donovan, K. F., Smith, I., Tothova, Z., Wilen, C., Orchard, R., Virgin, H. W., Listgarten, J., & Root, D. E.

[1273] (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature Biotechnology, 34(2), 184-191.

[1274] 5. Hendel, A., Bak, R. O., Clark, J. T., Kennedy, A. B., Ryan, D. E., Roy, S., Steinfeld, I., Lunstad, B. D., Kaiser, R. J., Wilkens, A. B., Bacchetta, R., Tsalenko, A., Dellinger, D., Bruhn, L, & Porteus, M. H. (2015). Chemically modified guide RNAs enhance CRISPR- Cas genome editing in human primary cells. Nature Biotechnology, 33(9), 985-989. Attorney Docket No.: 6391-0012WO01

[1275] 6. Fu, Y., Sander, J. D., Reyon, D., Cascio, V. M., & Joung, J. K. (2014). Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology, 32(3), 279-284.

[1276] 7. Vakulskas, C. A., Dever, D. P., Rettig, G. R., Turk, R., Jacobi, A. M., Collingwood, M.

[1277] A., Bode, N. M., McNeill, M. S., Yan, S., Camarena, J., Lee, C. M., Hyun Park, S., Wiebking, V., Bak, R. O., Gomez-Ospina, N., Pavel-Dinu, M„ Sun, W., Bao, G., Porteus, M. H., & Behlke, M. A. (2018). A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine.

[1278] 8. Donohoue, P. D., Pacesa, M., Lau, E., Vidal, B., Irby, M. J., Nyer, D. B., Rotstein, T., Banh, L., Toh, M. S., Gibson, J., Kohrs, B., Baek, K., Owen, A. L. G., Slorach, E. M., van Overbeek, M., Fuller, C. K., May, A. P., Jinek, M., & Cameron, P. (2021). Conformational control of Cas9 by CRISPR hybrid RNA-DNA guides mitigates off-target activity in T cells. Molecular Cell, 81(VT), 3637-3649. e5.

[1279] 9. Pasternak, A., Hernandez, F. J., Rasmussen, L. M., Vester, B., & Wengel, J. (2011).

[1280] Improved thrombin binding aptamer by incorporation of a single unlocked nucleic acid monomer. Nucleic Acids Research, 39(3), 1155-1164. doi.org / 10.1093 / nar / gkq823 10. Braasch, D. A., & Corey, D. R. (2001). Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chemistry & Biology, 3(1), 1-7.

[1281] 11. Manoharan, M., Akinc, A., Pandey, R. K., Qin, J., Hadwiger, P., John, M., Mills, K., Charisse, K., Maier, M. A., Nechev, L., Greene, E. M., Pallan, P. S., Rozners, E., Rajeev, K. G., & Egli, M. (2011). Unique Gene-Silencing and Structural Properties of 2'-Fluoro- Modified siRNAs. Angewandte Chemie International Edition, 50(10), 2284-2288.

[1282] 12. Fontenete, S., Guimaraes, N., Leite, M., Figueiredo, C., Wengel, J., & Filipe Azevedo, N.

[1283] (2013). Hybridization-Based Detection of Helicobacter pylori at Human Body Temperature Using Advanced Locked Nucleic Acid (LNA) Probes. PLOS ONE, 8(11), e81230-.

[1284] 13. Jun, W. J., Park, S.-J., Cha, S. & Kim, K. Factors affecting the cleavage efficiency of the CRISPR-Cas9 system. Anim. Cells Syst. 28, 75-83 (2024).

[1285] 14. Rieenberg, S., Helmbrecht, N., Kanis, P., Maricic, T. & Paabo, S. Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage. Nat. Commun. 13, 489 (2022). Attorney Docket No.: 6391-0012WO01

[1286] 15. Kuran, G. et al. CRISPAltRations: A validated cloud-based approach for interrogation of double-strand break repair mediated by CRISPR genome editing. Mol. Ther. - Methods Clin. Dev. 21, 478-491 (2021).

[1287] 16. Kinney, K. J. et al. UNCOVERseq Enables Sensitive and Controlled Gene Editing Off- Target Nomination Across CRISPR-Cas Modalities and Systems. bioRxiv 2025.05.09.653165 (2025) doi: 10.1101 / 2025.05.09.653165.

Claims

Attorney Docket No.: 6391-0012WO01CLAIMS WHAT IS CLAIMED IS:

1. A synthetic guide RNA comprising:(i) a first nucleotide sequence comprising at least one modified nucleotide, wherein the first nucleotide is partially or completely complementary to a target nucleic acid; and (ii) a second nucleic acid sequence which interacts with a CRISPR-associated protein (Cas) polypeptide,wherein the synthetic guide RNA guides the Cas polypeptide to the target nucleic acid, and wherein the synthetic guide RNA exhibits a reduced off-target effect and / or enhanced on-target editing activity, relative to an unmodified gRNA.

2. The synthetic guide RNA of claim 1, wherein the at least one modified nucleotide is selected from the group consisting of unlocked nucleic acid (UNA), locked nucleic acid (LNA), 2'fluoro, C3 spacer, dSpacer, and combinations thereof.

3. The synthetic guide RNA of any one of claims 1 - 2, wherein the first nucleotide sequence and second nucleotide sequence are a single nucleic acid strand.

4. The synthetic guide RNA of any one of claims 1 - 3, wherein the first nucleotide sequence and second nucleotide sequence are two separate nucleic acid strands.

5. The synthetic guide RNA of any one of claims 1 - 4, wherein the first nucleotide sequence is about 14-25 nucleotides in length.

6. The synthetic guide RNA of any one of claims 1 - 5, wherein the at least one modified nucleotide is present at a position selected from the group consisting of nucleotide 1, nucleotide 2, nucleotide 3, nucleotide4, nucleotide 5, nucleotide 6, nucleotide 7, nucleotide 8, nucleotide 9, nucleotide 10, nucleotide 11, nucleotide 12, nucleotide 13, nucleotide 14, nucleotide 15, nucleotide 16, nucleotide 17, nucleotide 18, nucleotide 19, nucleotide 20, and combinations thereof, wherein each position is labeled in the first nucleic acid sequence starting at nucleotide 1 from the PAM adjacent base.

7. The synthetic guide RNA of any one of claims 1 - 6, wherein off-target editing relative to an unmodified gRNA is reduced by at least an amount selected from the group consisting of 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 99%.Attorney Docket No.: 6391-0012WO018. The synthetic guide RNA of any one of claims 1 - 7, wherein the first nucleotide sequence comprises a 3’ modification.

9. The synthetic guide RNA of any one of claims 1 - 8, wherein the first nucleotide sequence comprises a 5’ modification.

10. The synthetic guide RNA of any one of claims 1 - 9, wherein the at least one modified nucleotide alters base-pairing thermostability.

11. The synthetic guide RNA of any one of claims 1 - 10, wherein said at least one modified nucleotide enhances base-pairing thermostability.

12. The synthetic guide RNA of any one of claims 1 - 11, wherein said at least one modified nucleotide decreases base-pairing thermostability.

13. The synthetic guide RNA of any one of claims 1 - 12, wherein the at least one modified nucleotide is a specificity-altering modification.

14. The synthetic guide RNA of any one of claims 1 - 13, wherein the specificity-altering at least one modified nucleotide is located in the guide sequence.

15. The synthetic guide RNA of any one of claims 1 - 14, wherein at least two nucleotides in the first nucleotide sequence are modified nucleotides.

16. The synthetic guide RNA of any one of claims 1 - 15, wherein one or more modified nucleotides are located within five nucleotides from the 5 '-end of the first nucleotide sequence.

17. The synthetic guide RNA of any one of claims 1 - 16, wherein from about 10% to about 30% of the nucleotides in the first nucleotide sequence are modified nucleotides.

18. The synthetic guide RNA of any one of claims 1 - 17, wherein the at least one modified nucleotide is located within five nucleotides from the 3 '-end of the second nucleotide sequence.

19. The synthetic guide RNA of any one of claims 1 - 18, wherein the modified sgRNA comprises one, two, or three consecutive or non-consecutive modified nucleotides at or near the 5 '-end of the first nucleotide sequence and one, two, or three consecutive or non-consecutive modified nucleotides at or near the 3 '-end of the second nucleotide sequence.

20. The synthetic guide RNA of any one of claims 1 - 19, wherein the modified sgRNA comprises three consecutive modified nucleotides at the 5 '-end of the first nucleotide sequence and three consecutive modified nucleotides at the 3 '-end of the second nucleotide sequence.

21. The synthetic guide RNA of any one of claims 1 - 20, wherein the modified sgRNA is chemically synthesized.Attorney Docket No.: 6391-0012WO0122. A synthetic guide RNA, comprising a targeting sequence that is partially or completely complementary to a target nucleic acid, wherein the targeting sequence comprises at least one UNA at positions 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, and / or 4 within the targeting sequence, wherein each position is labeled in the targeting sequence starting at position 1 from the PAM adjacent base.

23. The synthetic guide RNA of claim 22, wherein the targeting sequence comprises at least one UNA at positions 20, 19, 18, 17, 14, 13, 12, and / or 10.

24. The synthetic guide RNA of any one of claims 22-23, wherein the targeting sequence is truncated.

25. The synthetic guide RNA of any one of claims 22-23, wherein the targeting sequence comprises at least 17, 18, 19, 20 nucleotides.

26. The synthetic guide RNA of any one of claims 22-23, wherein the synthetic guide RNA is a single guide RNA.

27. A set or library of RNA molecules comprising two or more synthetic guide RNAs of any one of claims 1 - 26.

28. A kit comprising the synthetic guide RNA of any one of claims 1 - 26.

29. An array of RNA molecules comprising two or more synthetic guide RNAs of any one of claims 1 - 26.

30. A method for reducing off-target effect in a cell, the method comprising:introducing into the cell:(a) one or more synthetic guide RNA of any one of claims 1 - 26;:and(b) a Cas polypeptide, an mRNA encoding a Cas polypeptide, or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide,wherein the synthetic guide RNA guides the Cas polypeptide to the target nucleic acid and induces a gene regulation of the target nucleic acid.

31. The method of -claim 30, wherein the target nucleic acid comprises a target DNA or a target RNAAttorney Docket No.: 6391-0012WO0132. The method of any one of claims 30 - 31, wherein the method exhibits an enhanced on -target activity.

33. The method of any one of claims 30 - 32, wherein the genome editing comprises homologous-directed repair (HDR) or nonhomologous end joining (NHEJ) of the target DNA.

34. The method of any one of claims 30 - 33, further comprising introducing a recombinant donor repair template into the cell.

35. The method of any one of claims 30 - 34,wherein the modified sgRNA in (a) and the Cas polypeptide in (b) are introduced into the cell in a ribonucleoprotein (RNP) complex.

36. The method of any one of claims 30 - 35, wherein the gene regulation induced by the introduction of (a) and (b) is stable in the cell for at least 24 hours.

37. The method of any one of claims 30 - 36,wherein the modified synthetic guide RNA in (a) and the Cas polypeptide in (b) are introduced into the cell in a lipofection reagent.

38. The method of any one of claims 30 - 37,wherein the modified synthetic guide RNA in (a) and the Cas polypeptide in (b) are introduced into the cell via exosomes.

39. The method of any one of claims 30 - 38,wherein the modified synthetic guide RNA in (a) and the Cas polypeptide in (b) are introduced into the cell via lipid nanoparticles.

40. The method of any one of claims 30 - 39,wherein the modified synthetic guide RNA in (a) and the Cas polypeptide in (b) are introduced into the cell via viral vector.

Images