RNA-editing oligonucleotides and uses thereof
Novel oligonucleotides with chemical modifications enhance ADAR recruitment and editing efficiency, addressing the challenge of selective RNA editing in target RNAs for therapeutic applications.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KORRO BIO INC
- Filing Date
- 2025-12-16
- Publication Date
- 2026-06-25
AI Technical Summary
Existing synthetic oligonucleotides are not capable of selectively editing target RNAs in a therapeutically effective manner, as they do not efficiently recruit ADAR proteins to specific sites for adenosine deamination.
Development of novel oligonucleotides with chemical modifications, such as o-homo-DNA, and specific structural features that enhance ADAR recruitment and editing efficiency, including a Central Triplet and ADAR recruiting domain, to deaminate adenosine in target RNAs.
The modified oligonucleotides effectively recruit ADAR proteins to specific sites in target RNAs, increasing the efficiency of adenosine deamination and potential therapeutic outcomes.
Smart Images

Figure IMGF000020_0001 
Figure IMGF000021_0001 
Figure IMGF000021_0002
Abstract
Description
KB-049-WO Docket No. 33791 / 41049RNA-EDITING OLIGONUCLEOTIDES AND USES THEREOFINCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0001] This application contains, as a separate part of the disclosure, a Sequence Listing in computer-readable form which is incorporated by reference in its entirety and identified as follows: 41049_SeqListing.xml; Size: 562,521 bytes; Created: December 12, 2025.BACKGROUND
[0002] Adenosine deaminases acting on RNA (ADAR) are enzymes that bind to double-stranded RNA (dsRNA) and convert adenosine to inosine through deamination. In RNA, inosine functions similarly to guanosine for translation and replication. Thus, conversion of adenosine to inosine in an mRNA can result in a codon change that may lead to changes to the encoded protein and its functions. There are three known ADAR proteins expressed in humans, ADAR1, ADAR2, and ADAR3. ADAR1 and ADAR2 are expressed throughout the body whereas ADAR3 is expressed only in the brain. ADAR1 and ADAR2 are catalytically active, while ADAR3 is thought to be inactive.
[0003] Synthetic oligonucleotides have been shown capable of utilizing the ADAR proteins to edit target RNAs through deamination particular adenosines in the target RNA. The oligonucleotides are complementary to the target RNA with the exception of at least one mismatch opposite the adenosine to be deaminated. Improved oligonucleotides capable of utilizing the ADAR proteins to selectively edit target RNAs in a therapeutically effective manner are needed.SUMMARY
[0004] The disclosure provides oligonucleotides, compositions and methods to deaminate adenosine in target RNAs, e.g., an adenosine which may be deaminated to produce a therapeutic result, e.g., in a subject in need thereof. In some embodiments, the target RNA is a mRNA.
[0005] Adenosine deaminases that act on RNA (ADARs) are editing enzymes that recognize certain structural motifs of double-stranded RNA (dsRNA) and edit adenosine to inosine, resulting in recoding of amino acid codons that may lead to changes to the encoded protein and its function. The nucleobases surrounding the editing site, especially the one immediately 5' of the editing site and one immediately 3' to the editing site, which together with the editing site are termed the triplet, play an important role in the deamination of adenosine. A preference for U at the 5' position and G at the 3' position relative to the editing site, was revealed from the analysis of yeast RNAs efficiently edited by overexpressed human ADAR2 and ADAR1. See Wang et al., (2018) Biochemistry, 57: 1640-1651, Eifler et al., (2013) Biochemistry, 52: 7857-7869, and Eggington et al., (2011) Nat. Commun., 319: 1-9. Recruiting ADAR to specific sites of selected transcripts and deamination of adenosine regardless of neighboring bases holds great promise for the treatment of disease. Based on structural and modeling studies of the editing site of dsRNA / ADAR complexes, several structural features that could be incorporated into guide oligonucleotides have been identified, whose properties could increase the recruitment ofKB-049-WO Docket No. 33791 / 41049ADAR and increase the efficiency of editing of target RNA. Novel oligonucleotides with chemical modifications such as o-homo-DNA capable of recruiting ADAR proteins and deaminating adenosine with different surrounding base compositions in target RNA are shown. In addition, structure-activity relationship (SAR) studies revealed that a 2'-O-methyl (2’-OMe) modification of the ribose of some, but not all, nucleosides in the guide oligonucleotide, in addition to triplet modifications, are compatible with efficient ADAR engagement and editing.
[0006] Provided herein are oligonucleotides comprising the structure:[Am]-X1-X2-X3-[Bn]whereinm+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises an ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage and(1) the X1sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl (“nr”), Dh 2'-(R)-di methyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (" MK4”), 2’-O-acetamide ("na”), MCP (" M3”), Arabinose-OME, 2'5' 3' OME, or 2’-Amino ("2-NH2”); and / or(2) the X1nucleobase is selected from e4C, OH5U, m1PU, br5C, dW, mZb, ca5c, m3c, pU, prC, s2T, I5C, hm5U, m3C, n6U, m5c, Py, Oh5C, pdC, 5m-C, 5h-C, 5mh-C, 5ca-C, f5-C, 5br-C, 5I-C, fpy-C, N3m-C, N4e-C, 5a-56dh-C, 5f-U, 5hm-U, 5py-U, 4t-U, 2t-T, 4t-T, 6a-U, 6a-T, 5ey-U, I P-U, N1m-PU, Iso-C, Z, 5m-Zeb, W, P-IsoC, 8o-A, 7da-A, 7da-8a-A, IsoA, 8-oxo-a, IsoU, 8am-A, 8-br-A, 7da-G, I, 8o-G, N1m-G, Iso-G, 2f-l, X, N, 8a-N, N4-oxy-cyclic-der-C, Py-m-C, and G-clamp.Definitions:
[0007] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed technology, because the scope of the technology is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.KB-049-WO Docket No. 33791 / 41049
[0008] In this application, unless otherwise clear from context, (i) the term "a” may be understood to mean "at least one”; (II) the term "or” may be understood to mean "and / or”; and (ill) the terms "including” and "comprising” may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps.
[0009] The terms "about” and "approximately” refer to a value that is within 10% above or below the value being described. For example, the term "about 5 nM” indicates a range of from 4.5 to 5.5 nM.
[0010] The term "at least” prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21 -nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.
[0011] The phrase "no more than” or "less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, an oligonucleotide with "no more than 5 unmodified nucleotides” has 5, 4, 3, 2, 1, or 0 unmodified nucleotides. When "no more than” is present before a series of numbers or a range, it is understood that "no more than” can modify each of the numbers in the series or range.
[0012] The term "administration” refers to the administration of a composition (e.g., a compound or a preparation that includes a compound as described herein) to a subject or system. Administration to an animal subject (e.g., to a human) may be by any appropriate route, such as the one described herein.
[0013] The term "oligonucleotide” as used herein, is a molecule including two or more nucleotides. The term "nucleotide” refers to a nucleobase, a sugar moiety, and an internucleotide linkage. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides. The oligonucleotide described herein may be manmade, and is chemically synthesized, and is typically purified or isolated. Oligonucleotide is also intended to include (i) compounds that have one or more furanose moieties that are replaced by furanose derivatives or by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the nucleobase moiety, (ii) compounds that have one or more phosphodiester linkages that are either modified, as in the case of phosphoramidate or phosphorothioate linkages, or completely replaced by a suitable linking moiety as in the case of formacetal or riboacetal linkages, and / or (iii) compounds that have one or more linked furanosephosphodiester linkage moieties replaced by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the nucleobase moiety. The oligonucleotide described herein may include one or more alternative nucleotides (e.g., including those described herein). It is also understood that oligonucleotideKB-049-WO Docket No. 33791 / 41049includes compositions lacking a sugar moiety or nucleobase but is still capable of forming a pairing with or hybridizing to a target sequence. Oligonucleotides as used herein comprise 100 or fewer nucleotides.Nucleobases
[0014] Oligonucleotides described herein can also include one or more nucleobases (often referred to in the art simply as "bases"), including one or more standard nucleobases and / or alternative nucleobases (e.g., unnatural nucleobases, or natural nucleobases comprising modifications or substitutions). In some cases, at least one nucleotide in the oligonucleotides disclosed herein does not have a nucleobase - i.e., is an abasic oligonucleotide.
[0015] As disclosed herein, the nucleobase at the -1 position of the oligonucleotide can be 5m-C, 5h-C, 5mh-C, 5ca-C, f5-C, 5br-C, 5I-C, fpy-C, N3m-C, N4e-C, 5a-56dh-C, 5f-U, 5hm-U, 5py-U, 4t-U, 2t-T, 4t-T, 6a-U, 6a-T, 5ey-U, I P-U, N1m-PU, Iso-C, Z, 5m-Zeb, W, P-lsoC, 8o-A, 7da-A, 7da-8a-A, IsoA, 8-oxo-a, IsoU, 8am-A, 8-br-A, 7da-G, I, 8o-G, N1m-G, Iso-G, 2f-l, X, N, 8a-N, N4-oxy-cyclic-der-C, Py-m-C, or G-clamp. The nucleobase of the remaining nucleotides of the oligonucleotide can be any nucleobase, e.g., as disclosed herein.
[0016] Standard nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Alternative nucleobases include other unnatural / synthetic and natural nucleobases as described herein, including nucleobases comprising modifications or substitutions.
[0017] In some instances, the oligonucleotides comprise at least one unnatural nucleobase. In some instances, the oligonucleotides comprise at least one modified natural nucleobase. The terms "modified” or, as appropriate, "modification” refer to structural and / or chemical modifications with respect to A, G, U, T, or C nucleobases, nucleosides, and / or nucleotides. Nucleotides in the oligonucleotides of the present disclosure may comprise non-standard nucleotides, such as non-naturally occurring nucleotides ("unnatural nucleotides”) or chemically synthesized nucleotides. One or more atoms of a nucleobase may be replaced or substituted with optionally substituted amino, optionally substituted thiol, optionally substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro).
[0018] Nonlimiting examples of synthetic and natural nucleobases that can serve as alternative nucleobases include 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-carboxycytosine, pyrrolocytosine, dideoxycytosine, uracil, 5-methoxyuracil, 5-hydroxydeoxyuracil, dihydrouracil, 4-thiouracil, pseudouracil, 1-methyl-pseudouracil, deoxyuracil, 5-hydroxybutynl-2'-deoxyuracil, xanthine, hypoxanthine, 7-deaza-xanthine, thienoguanine, 8-aza-7-deazaguanine, 7-methylguanine, 7-deazaguanine, 6-aminomethyl-7-deazaguanine, 8-aminoguanine, 2,2,7-trimethylguanine, 8-methyladenine, 8-azidoadenine, 7-methyladenine, 7-deazaadenine, 3-deazaadenine, 2,6-diaminopurine, 2-aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5-nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 4-thiouracil, 8-halo, 8-KB-049-WO Docket No. 33791 / 41049amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 8-azaguanine and 8-azaadenine, and 3-deazaguanine. In a some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as an "alternative nucleobase” selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, pseudouracil, 1 -methylpseudouracil, 5-methoxyuracil, 2'-thio-thymine, hypoxanthine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine. Further nucleobases include those disclosed in U. S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., ORC Press, 1993, in Hirao et al (2012) Accounts of Chemical Research vol 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligonucleotides described herein. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions.
[0019] In other embodiments, the nucleobases in the oligonucleotides may be independently, for each position, selected from adenine, uridine, guanine, or cytidine or analogs of adenine, uridine, guanine, or cytidine, such as modified adenine, uridine, guanine, or cytidine. Non-limiting examples of adenine, uridine, guanine, and cytidine analogs and modified adenine, uridine, guanine, and cytidine include N6-methyladenine, N1-methylademine, N6-2'-O-dimehtyladenosine, pseudouridine, N1-methypseudouridine, 5-iodouridine, 4-thiouridine, 2-thiouridine, 5-methyluridine, pseudoisocytosine, 5-methoxycytosine, 2-thiocytosine, 5-hydroxycytosine, N4-methylcytosine, 5-hydroxymethylcytosine, hypoxanthine, N1-methylguanine, 06-methylguanine, 1-methyl-guanosine, N2-methyl-guanosine, N2, N2-dimethyl-guanonsine, 2-methyl-guanosine, N7-methyl-guanosine, 1-methyl-guanosine, N2, N7-dimethyl-guanosine, and isoguanine. For example, uridine (U) may be replaced with pseudouridine (ip), 2-thiouridine (s2U), dihydrouridine (D), 5-bromo-U, 5-iodo-U, etc. A purine may be replaced with a 2,6-diaminopurine.
[0020] Representative U. S. patents that teach the preparation of certain of the above noted nucleobases as well as other nucleobases include, but are not limited to, the above noted U. S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197;KB-049-WO Docket No. 33791 / 410496,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.
[0021] Additional nucleobases found in the oligonucleotides disclosed herein include, but are not limited to, the following: 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine; 2-methylthio-N6-methyladenosine; 2-methylthio-N6-threonyl carbamoyladenosine; N6-glycinylcarbamoyladenosine; N6-isopentenyladenosine; N6-methyladenosine; N6-threonylcarbamoyladenosine; 1,2'-O-dimethyladenosine; 1 -methyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); 2-methyladenosine; 2-methylthio-N6 isopentenyladenosine; 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine; 2'-O-methyladenosine; 21-0-ribosyladenosine (phosphate); Isopentenyladenosine; N6-(cis-hydroxyisopentenyl)adenosine; N6,2'-O-dimethyladenosine; N6,2'-O-dimethyladenosine; N6, N6,2'-O-trimethyladenosine; N6, N6-dimethyladenosine; N6-acetyladenosine; N6-hydroxynorvalylcarbamoyladenosine; N6-methyl-N6-threonylcarbamoyladenosine; 2-methyladenosine; 2-methylthio-N6-isopentenyladenosine; 7-deaza-adenosine; N1-methyl-adenosine; N6, N6 (dimethyl)adenine; N6-cis-hydroxy-isopentenyl-adenosine; o-thio-adenosine; 2 (amino)adenine; 2 (aminopropyl)adenine; 2 (methylthio) N6 (isopentenyl)adenine; 2-(alkyl)adenine; 2-(aminoalkyl)adenine; 2-(aminopropyl)adenine; 2-(halo)adenine; 2-(halo)adenine; 2-(propyl)adenine; 2'-Amino-2'-deoxy-ATP; 2'-Azido-2'-deoxy-ATP; 2'-Deoxy-2'-a-aminoadenosine TP; 2'-Deoxy-2'-a-azidoadenosine TP; 6 (alkyl)adenine; 6 (methyl)adenine; 6-(alkyl)adenine; 6-(methyl)adenine; 7 (deaza)adenine; 8 (alkenyl)adenine; 8 (alkynyl)adenine; 8 (amino)adenine; 8 (thioalkyl)adenine; 8-(alkenyl)adenine; 8-(alkyl)adenine; 8-(alkynyl)adenine; 8-(amino)adenine; 8-(halo)adenine; 8-(hydroxyl)adenine; 8-(thioalkyl)adenine; 8-(thiol)adenine; 8-azido-adenosine; aza adenine; deaza adenine; N6 (methyl)adenine; N6-(isopentyl)adenine; 7-deaza-8-aza-adenosine; 7-methyladenine; 1 -Deazaadenosine TP; 2'Fluoro-N6-Bz-deoxyadenosine TP; 2'-OMe-2-Amino-ATP; 2'0-methyl-N6-Bz-deoxyadenosine TP; 2'-a-Ethynyladenosine TP; 2-aminoadenine; 2-Aminoadenosine TP; 2-Amino-ATP; 2'-a-Trifluoromethyladenosine TP; 2-Azidoadenosine TP; 2'-b-Ethynyladenosine TP; 2-Bromoadenosine TP; 2'-b-Trifluoromethyladenosine TP; 2-Chloroadenosine TP; 2'-Deoxy-2',2'-difluoroadenosine TP; 2'-Deoxy-2'-a-mercaptoadenosine TP; 2'-Deoxy-2'-a-thiomethoxyadenosine TP; 2'-Deoxy-2'-b-aminoadenosine TP; 2'-Deoxy-2'-b-azidoadenosine TP; 2'-Deoxy-2'-b-bromoadenosine TP; 2'-Deoxy-2'-b-chloroadenosine TP; 2'-Deoxy-2'-b-fluoroadenosine TP; 2'-Deoxy-2'-b-iodoadenosine TP; 2'-Deoxy-2'-b-mercaptoadenosine TP; 2'-Deoxy-2'-b-thiomethoxyadenosine TP; 2-Fluoroadenosine TP; 2-lodoadenosine TP; 2-Mercaptoadenosine TP; 2-methoxy-adenine; 2-methylthio-adenine; 2-Trifluoromethyladenosine TP; 3-Deaza-3-bromoadenosine TP; 3-Deaza-3-chloroadenosine TP; 3-Deaza-3-fluoroadenosine TP; 3-Deaza-3-iodoadenosine TP; 3-Deazaadenosine TP; 4'-Azidoadenosine TP; 4'-Carbocyclic adenosine TP; 4'-Ethynyladenosine TP; 5'-Homo-adenosine TP; 8-Aza-ATP; 8-bromo-adenosine TP; 8-Trifluoromethyladenosine TP; 9-Deazaadenosine TP; 2-aminopurine; 7-deaza-2,6-diaminopurine; 7-deaza-8-aza-2,6-diaminopurine; 7-deaza-8-aza-2-aminopurine; 2,6-diaminopurine; 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine; 2-thiocytidine; 3-methylcytidine; 5-formylcytidine; 5-hydroxymethylcytidine; 5-methylcytidine; N4-acetylcytidine; 2'-O-methylcytidine; 2'-O-methylcytidine; 5,2'-O-dimethylcytidine; 5-formyl-2'-O-methylcytidine; Lysidine; N4,2'-O-dimethylcytidine; N4-acetyl-2'-O-methylcytidine; N4-methylcytidine; N4, N4-KB-049-WO Docket No. 33791 / 41049Dimethyl-2'-OMe-Cytidine TP; 4-methylcytidine; 5-aza-cytidine; Pseudo-iso-cytidine; pyrrolo-cytidine; a-thio-cytidine; 2-(thio)cytosine; 2'-Amino-2'-deoxy-CTP; 2'-Azido-2'-deoxy-CTP; 2'-Deoxy-2'-a-aminocytidine TP; 2'-Deoxy-2'-a-azidocytidine TP; 3 (deaza) 5 (aza)cytosine; 3 (methyl)cytosine; 3-(alkyl)cytosine; 3-(deaza) 5 (aza)cytosine; 3-(methyl)cytidine; 4,21 -O-dimethylcytidine; 5 (halo)cytosine; 5 (methyl)cytosine; 5 (propynyl)cytosine; 5 (trifluoromethyl)cytosine; 5-(alkyl)cytosine; 5-(alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine; 5-bromo-cytidine; 5-iodo-cytidine; 5-propynyl cytosine; 6-(azo)cytosine; 6-aza-cytidine; aza cytosine; deaza cytosine; N4 (acetyl)cytosine; 1-methyl-l-deaza-pseudoisocytidine; 1 -methyl-pseudoisocytidine; 2-methoxy-5-methyl-cytidine; 2-methoxy-cytidine; 2-thio-5-methyl-cytidine; 4-methoxy-l-methyl-pseudoisocytidine; 4-methoxy-pseudoisocytidine; 4-thio-l-methyl-1-deaza-pseudoisocytidine; 4-thio-l-methy l-pseudoisocytidine; 4-thio-pseudoisocytidine; 5 -aza-zebularine; 5 -methyl-zebularine; pyrrolo-pseudoisocytidine; Zebularine; (E)-5-(2-Bromo-vinyl)cytidine TP; 2,2'-anhydro-cytidine TP hydrochloride; 2'Fluor-N4-Bz-cytidine TP; 2'Fluoro-N4-Acetyl-cytidine TP; 2'-O-Methyl-N4-Acetyl-cytidine TP; 2'0-methyl-N4-Bz-cytidine TP; 2'-a-Ethynylcytidine TP; 2'-a-Trifluoromethylcytidine TP; 2'-b-Ethynylcytidine TP; 2'-b-Trifluoromethylcytidine TP; 2'-Deoxy-2',2'-difluorocytidine TP; 2'-Deoxy-2'-a-mercaptocytidine TP; 2'-Deoxy-2'-a-thiomethoxycytidine TP; 2'-Deoxy-2'-b-aminocytidine TP; 2'-Deoxy-2'-b-azidocytidine TP; 2'-Deoxy-2'-b-bromocytidine TP; 2'-Deoxy-2'-b-chlorocytidine TP; 2'-Deoxy-2'-b-fluorocytidine TP; 2'-Deoxy-2'-b-iodocytidine TP; 2'-Deoxy-2'-b-mercaptocytidine TP; 2'-Deoxy-2'-b-thiomethoxycytidine TP; 21 -O-Methyl-5-(1 -propynyl)cytidine TP; 3'-Ethynylcytidine TP; 4'-Azidocytidine TP; 4'-Carbocyclic cytidine TP; 4'-Ethynylcytidine TP; 5-(1 -Propynyl)ara-cytidine TP; 5-(2-Chloro-phenyl)-2-thiocytidine TP; 5-(4-Amino-phenyl)-2-thiocytidine TP; 5-Aminoallyl-CTP; 5-Cyanocytidine TP; 5-Ethynylara-cytidine TP; 5-Ethynylcytidine TP; 5'-Homo-cytidine TP; 5-Methoxycytidine TP; 5-Trifluoromethyl-Cytidine TP; N4-Amino-cytidine TP; N4-Benzoyl-cytidine TP;Pseudoisocytidine; 7-methylguanosine; N2,2'-O-dimethylguanosine; N2-methylguanosine; Wyosine; 1,2'-O-dimethylguanosine; 1 -methylguanosine; 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 7-aminomethyl-7-deazaguanosine; 7-cyano-7-deazaguanosine; Archaeosine; Methyl wyosine; N2,7-dimethylguanosine; N2, N2,2'-O-trimethylguanosine;N2, N2,7-trimethylguanosine; N2, N2-dimethylguanosine; N2,7,2'-O-trimethylguanosine; 6-thio-guanosine; 7-deaza-guanosine; 8-oxo-guanosine; N1-methyl-guanosine; a-thio-guanosine; 2 (propyl)guanine; 2-(alkyl)guanine; 2'-Amino-2'-deoxy-GTP; 2'-Azido-2'-deoxy-GTP; 2'-Deoxy-2'-a-aminoguanosine TP; 2'-Deoxy-2'-a-azidoguanosine TP; 6 (methyl)guanine; 6-(alkyl)guanine; 6-(methyl)guanine; 6-methyl-guanosine; 7 (alkyl)guanine; 7 (deaza)guanine; 7 (methyl)guanine; 7-(alkyl)guanine; 7-(deaza)guanine; 7-(methyl)guanine; 8 (alkyl)guanine; 8 (alkynyl)guanine; 8 (halo)guanine; 8 (thioalkyl)guanine; 8-(alkenyl)guanine; 8-(alkyl)guanine; 8-(alkynyl)guanine; 8-(amino)guanine; 8-(halo)guanine; 8-(hydroxyl)guanine; 8-(thioalkyl)guanine; 8-(thiol)guanine; aza guanine; deaza guanine; N (methyl)guanine; N-(methyl)guanine; 1-methyl-6-thio-guanosine; 6-methoxy-guanosine; 6-thio-7-deaza-8-aza-guanosine; 6-thio-7-deaza-guanosine; 6-thio-7-methyl-guanosine; 7-deaza-8-aza-guanosine; 7-ethyl-8-oxo-guanosine; N2, N2-dimethyl-6-thio-guanosine; N2-methyl-6-thio-guanosine; 1-Me-GTP; 2'Fluoro-N2-isobutyl-guanosine TP; 2'O-methyl-N2-isobutyl-guanosine TP; 2'-a-Ethynylguanosine TP; 2'-a-Trifluoromethylguanosine TP; 2'-b-Ethynylguanosine TP; 2'-b-Trifluoromethylguanosine TP; 2'-Deoxy-2',2'-KB-049-WO Docket No. 33791 / 41049difluoroguanosine TP; 2'-Deoxy-2'-a-mercaptoguanosine TP; 2'-Deoxy-2'-a-thiomethoxyguanosine TP; 2'-Deoxy-2'-b-aminoguanosine TP; 2'-Deoxy-2'-b-azidoguanosine TP; 2'-Deoxy-2'-b-bromoguanosine TP; 2'-Deoxy-2'-b-chloroguanosine TP; 2'-Deoxy-2'-b-fluoroguanosine TP; 2'-Deoxy-2'-b-iodoguanosine TP; 2'-Deoxy-2'-b-mercaptoguanosine TP; 2'-Deoxy-2'-b-thiomethoxyguanosine TP; 4'-Azidoguanosine TP; 4'-Carbocyclic guanosine TP; 4'-Ethynylguanosine TP; 5'-Homo-guanosine TP; 8-bromo-guanosine TP; 9-Deazaguanosine TP; N2-isobutyl-guanosine TP; 1 -methylinosine; Inosine; 1,2'-O-dimethylinosine; 2'-O-methylinosine; 7-methylinosine; 2'-O-methylinosine; Epoxyqueuosine; galactosyl-queuosine; Mannosylqueuosine; Queuosine; allyamino-thymidine; aza thymidine; deaza thymidine; deoxy-thymidine; 2'-O-methyluridine; 2-thiouridine; 3-methyluridine; 5-carboxymethyluridine; 5-hydroxyuridine; 5-methyluridine; 5-taurinomethyl-2-thiouridine; 5-taurinomethyluridine; Dihydrouridine; Pseudouridine; (3-(3-amino-3-carboxypropyl)uridine; 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1-methylpseudouridine; 1-ethyl-pseudouridine; 2'-O-methyluridine; 2'-O-methylpseudouridine; 2'-O-methyluridine; 2-thio-2'-O-methyluridine; 3-(3-amino-3-carboxypropyl)uridine; 3,2'-O-dimethyluridine; 3-Methyl-pseudo-Uridine TP; 4-thiouridine; 5-(carboxyhydroxymethyl)uridine; 5-(carboxyhydroxymethyl)uridine methyl ester; 5,2'-O-dimethyluridine; 5,6-dihydro-uridine; 5-aminomethyl-2-thiouridine; 5-carbamoylmethyl-2'-O-methyluridine; 5-carbamoylmethyluridine; 5-carboxyhydroxymethyluridine; 5-carboxyhydroxymethyluridine methyl ester; 5-carboxymethylaminomethyl-2'-O-methyluridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; 5-carboxymethylaminomethyluridine; 5-Carbamoylmethyluridine TP; 5-methoxycarbonylmethyl-2'-O-methyluridine; 5-methoxycarbonylmethyl-2-thiouridine; 5-methoxycarbonylmethyluridine; 5-methyluridine,), 5-methoxyuridine; 5-methyl-2-thiouridine; 5-methylaminomethyl-2-selenouridine; 5-methylaminomethyl-2-thiouridine; 5-methylaminomethyluridine; 5-Methyldihydrouridine; 5-Oxyacetic acid- Uridine TP; 5-Oxyacetic acid-methyl ester-Uridine TP; N1 -methyl-pseudo-uracil; N1 -ethyl-pseudo-uracil; uridine 5-oxyacetic acid; uridine 5-oxyacetic acid methyl ester;3-(3-Amino-3-carboxypropy 1 )-Uridine TP; 5-(iso-Pentenylaminomethyl)- 2-thiouridine TP; 5-(iso-Pentenylaminomethyl)-2'-O-methyluridine TP; 5-(iso-Pentenylaminomethyl)uridine TP; 5-propynyl uracil; a-thio-uridine; 1 (aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouracil; 1 (aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudouracil; 1 (aminoalkylaminocarbonylethylenyl)-4 (thio)pseudouracil; 1 (aminoalkylaminocarbonylethylenyl)-pseudouracil; 1 (aminocarbonylethylenyl)-2(thio)-pseudouracil; 1 (aminocarbonylethylenyl)-2,4-(dithio)pseudouracil; 1 (aminocarbonylethylenyl)-4 (thio)pseudouracil; 1 (aminocarbonylethylenyl)-pseudouracil; 1 substituted 2(thio)-pseudouracil; 1 substituted 2,4-(dithio)pseudouracil; 1 substituted 4 (thio)pseudouracil; 1 substituted pseudouracil; 1-(aminoalkylamino-carbonylethylenyl)-2-(thio)-pseudouracil; 1 -Methyl -3-(3-amino-3-carboxypropyl) pseudouridine TP; 1 -Methyl -3-(3-amino-3-carboxypropyl)pseudo-UTP; 1-Methyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 2 (thio)pseudouracil; 2' deoxy uridine; 2' fluorouridine; 2-(thio)uracil; 2,4-(dithio)psuedouracil; 2' methyl, 2'amino, 2'azido, 2'fluro-guanosine; 2'-Amino-2'-deoxy-UTP; 2'-Azido-2'-deoxy-UTP; 2'-Azido-deoxyuridine TP; 2'-O-methylpseudouridine; 2' deoxy uridine; 2' fluorouridine; 2'-Deoxy-2'-a-aminouridine TP; 2'-Deoxy-2'-a-azidouridine TP; 2-methylpseudouridine; 3 (3 amino-3 carboxypropyl)uracil; 4 (thio)pseudouracil; 4-(thio )pseudouracil; 4-(thio)uracil; 4-thiouracil; 5 (1,3-diazole-l-alkyl)uracil; 5 (2-aminopropyl)uracil; 5KB-049-WO Docket No. 33791 / 41049(aminoalkyl)uracil; 5 (dimethylaminoalkyl)uracil; 5 (guanidiniumalkyl)uracil; 5 (methoxycarbonylmethyl)-2-(thio)uracil; 5 (methoxycarbonyl-methyl)uracil; 5 (methyl) 2 (thio)uracil; 5 (methyl) 2,4 (dithio)uracil; 5 (methyl) 4 (thio)uracil; 5 (methylaminomethyl)-2 (thio)uracil; 5 (methylaminomethyl)-2,4 (dithio)uracil; 5 (methylaminomethyl)-4 (thio)uracil; 5 (propynyl)uracil; 5 (trifluoromethyl)uracil; 5-(2-aminopropyl)uracil; 5-(alkyl)-2-(thio)pseudouracil; 5-(alkyl)-2,4 (dithio)pseudouracil; 5-(alkyl)-4 (thio)pseudouracil; 5-(alkyl)pseudouracil; 5-(alkyl)uracil; 5-(alkynyl)uracil; 5-(allylamino)uracil; 5-(cyanoalkyl)uracil; 5-(dialkylaminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidiniumalkyl)uracil; 5-(halo)uracil; 5-(1,3-diazole-l-alkyl)uracil; 5-(methoxy)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5-(methoxycarbonyl-methyl)uracil; 5-(methyl) 2(thio)uracil; 5-(methyl) 2,4 (dithio )uracil; 5-(methyl) 4 (thio)uracil; 5-(methyl)-2-(thio)pseudouracil; 5-(methyl)-2,4 (dithio)pseudouracil; 5-(methyl)-4 (thio)pseudouracil; 5-(methyl)pseudouracil; 5-(methylaminomethyl)-2 (thio)uracil; 5-(methylaminomethyl)-2,4(dithio)uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5-(trifluoromethyl)uracil; 5-aminoallyl-uridine; 5-bromo-uridine; 5-iodo-uridine; 5-uracil; 6 (azo)uracil; 6-(azo)uracil; 6-aza-uridine; allyamino-uracil; aza uracil; deaza uracil; N3 (methyl)uracil; P seudo-UTP-1-2-ethanoic acid; Pseudouracil; 4-Thio-pseudo-UTP; 1-carboxymethyl-pseudouridine; 1 -methyl -1-deaza-pseudouri dine; 1 -propynyl-uridine; 1 -taurinomethyl-1 -methyl-uridine; 1-taurinomethyl-4-thio-uridine; 1-taurinomethyl-pseudouridine; 2-methoxy-4-thio-pseudouridine; 2-thio-l-methyl-1-deaza-pseudouridine; 2-thio-l-methyl-pseudouridine; 2-thio-5-aza-uridine; 2-thio-dihydropseudouridine; 2-thio-dihydrouridine; 2-thio-pseudouridine; 4-methoxy-2-thio-pseudouridine; 4-methoxy-pseudouridine; 4-thio-l-methyl-pseudouridine; 4-thio-pseudouridine; 5 -aza-uridine; Dihydropseudouri dine; (±)1 -(2-Hydroxy propyl)pseudouridine TP; (2R)- 1 -(2-Hydroxypropyl)pseudouridine TP; (2S)-1-(2-Hydroxypropyl)pseudouridine TP; (E)-5-(2-Bromo-vinyl)ara-uridine TP; (E)-5-(2-Bromo-vinyl)uridine TP; (Z)-5-(2-Bromo-vinyl)ara-uridine TP; (Z)-5-(2-Bromo-vinyl)uridine TP; 1-(2,2,2-Trifluoroethyl)-pseudo-UTP; 1-(2,2,3,3,3-Pentafluoropropyl)pseudouridine TP; 1 -(2,2-Diethoxyethyl)pseudouridine TP; 1-(2,4,6-Trimethylbenzyl)pseudouridine TP; 1 -(2,4,6-Trimethyl-benzyl)pseudo-UTP; 1 -(2,4,6-Trimethyl-phenyl)pseudo-UTP; 1-(2-Amino-2-carboxyethyl)pseudo-UTP; 1-(2-Amino-ethyl)pseudo-UTP; 1-(2-Hydroxyethyl)pseudouridine TP; 1-(2-Methoxyethyl)pseudouridine TP; 1 -(3,4-Bi s-trifluoromethoxybenzyl)pseudouridine TP; 1 -(3,4-Dimethoxybenzyl)pseudouri dine TP; 1 -(3 -Amino-3 -carboxypropyl)pseudo-UTP; 1 -(3 -Amino-propyl)pseudo-UTP; 1 -(3 -Cy cl opropyl-prop-2-ynyl)pseudouridine TP; 1 -(4-Amino-4-carboxy butyl)pseudo-UTP; 1 -(4-Amino-b enzyl)pseudo-UTP; 1 -(4-Amino-butyl)pseudo-UTP; 1 -(4-Amino-phenyl)pseudo-UTP; 1 -(4-Azidobenzyl)pseudouridine TP; 1 -(4-Bromobenzyl)pseudouridine TP; 1 -(4-Chlorobenzyl)pseudouridine TP; 1-(4-Fluorobenzyl)pseudouridine TP; 1-(4-lodobenzyl)pseudouridine TP; 1-(4-Methanesulfonylbenzyl)pseudouridine TP; 1-(4-Methoxy benzyl)pseudouridine TP; 1 -(4-Methoxy -benzyl)pseudo-UTP; 1 -(4-Methoxy-phenyl)pseudo-UTP; 1 -(4-Methylbenzyl)pseudouridine TP; 1 -(4-Methyl-benzyl)pseudo-UTP; 1 -(4-Nitrobenzyl)pseudouridine TP; 1-(4-Nitro-benzyl)pseudo-UTP; 1(4-Nitro-phenyl)pseudo-UTP; 1 -(4-Thiomethoxybenzyl)pseudouridine TP; 1 -(4-Trifluoromethoxy benzyl)pseudouridineTP; 1 -(4-Trifluoromethylbenzyl)pseudouridine TP; 1 -(5 -Amino-pentyl)pseudo-UTP; 1 -(6-Amino-hexyl)pseudo-UTP; 1,6-Dimethyl-pseudo-UTP; 1 - [3 -(2- {2- [2-(2-Aminoethoxy)-ethoxy] -ethoxy -ethoxy)-propionyl] pseudouridine TP; 1 -13- [2-(2-Amino ethoxy)-ethoxy] -propionyl } pseudouridine TP; 1-KB-049-WO Docket No. 33791 / 41049Acetylpseudouridine TP; 1 -Alkyl-6-(1 -propyny 1 )-pseudo-UTP; 1 -Alkyl-6-(2-propynyl)-pseudo-UTP; 1-Alkyl-6-allyl-pseudo-UTP; 1-Alkyl-6-ethynyl-pseudo-UTP; 1-Alkyl-6-homoallyl-pseudo-UTP; 1-Alkyl-6-vinyl-pseudo-UTP; 1-Allylpseudouridine TP; 1-Aminomethyl-pseudo-UTP; 1 -Benzoylpseudouridine TP; 1-Benzyloxymethylpseudouridine TP; 1-Benzyl-pseudo-UTP; 1-Biotinyl-PEG2-pseudouridine TP; 1-Biotinylpseudouridine TP; 1-Butyl-pseudo-UTP; 1 -Cyanomethylpseudouridine TP; 1-Cyclobutylmethyl-pseudo-UTP; 1-Cyclobutyl-pseudo-UTP; 1-Cycloheptylmethyl-pseudo-UTP; 1-Cycloheptyl-pseudo-UTP; 1-Cyclohexylmethyl-pseudo-UTP; 1 -Cyclohexyl-pseudo-UTP; 1 -Cyclooctylmethyl-pseudo-UTP; 1 -Cyclooctyl-pseudo-UTP; 1 -Cyclopentylmethyl-pseudo-UTP; 1 -Cyclopentyl-pseudo-UTP; 1 -Cyclopropylmethyl-pseudo-UTP; 1-Cyclopropyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 1-Hexyl-pseudo-UTP; 1 -Homoallylpseudouridine TP; 1-Hydroxymethylpseudouridine TP; 1-iso-propyl-pseudo-UTP; 1-Me-2-thio-pseudo-UTP; 1-Me-4-thio-pseudo-UTP; 1-Me-alpha-thio-pseudo-UTP; 1 -Methanesulfonylmethylpseudouridine TP; 1 -Methoxymethylpseudouridine TP; 1-Methyl-6-(2,2,2-Trifluoroethyl)pseudo-UTP; 1 -Methyl-6-(4-morpholino)-pseudo-UTP; 1-Methyl-6-(4-thiomorpholino)-pseudo-UTP; 1-Methyl-6-(substituted phenyl)pseudo-UTP; 1-Methyl-6-amino-pseudo-UTP; 1-Methyl-6-azido-pseudo-UTP; 1 -Methyl-6-bromo-pseudo-UTP; 1 -Methyl-6-butyl-pseudo-UTP; 1-Methyl-6-chloro-pseudo-UTP; 1 -Methyl-6-cyano-pseudo-UTP; 1 -Methyl-6-dimethylamino-pseudo-UTP; 1-Methyl-6-ethoxy-pseudo-UTP; 1 -Methyl-6-ethylcarboxylate-pseudo-UTP; 1 -Methyl-6-ethyl-pseudo-UTP; 1-Methyl-6-fluoro-pseudo-UTP; 1 -Methyl-6-formyl-pseudo-UTP; 1 -Methyl-6-hydroxyamino-pseudo-UTP; 1-Methyl-6-hydroxy-pseudo-UTP; 1 -Methyl-6-iodo-pseudo-UTP; 1 -Methyl-6-iso-propyl-pseudo-UTP; 1 -Methyl-6-methoxy-pseudo-UTP; 1-Methyl-6-methylamino-pseudo-UTP; 1-Methyl-6-phenyl-pseudo-UTP; 1-Methyl-6-propyl-pseudo-UTP; 1-Methyl-6-tert-butyl-pseudo-UTP; 1 -Methyl-6-trifluoromethoxy-pseudo-UTP; 1-Methyl-6-trifluoromethyl-pseudo-UTP; 1 -Morpholinomethylpseudouridine TP; 1-Pentyl-pseudo-UTP; 1-Phenyl-pseudo-UTP; 1-Pivaloylpseudouridine TP; 1 -Propargylpseudouridine TP; 1-Propyl-pseudo-UTP; 1-propynyl-pseudouridine; 1-p-tolyl-pseudo-UTP; 1-tert-Butyl-pseudo-UTP; 1 -Thiomethoxymethylpseudouridine TP; 1-Thiomorpholinomethylpseudouridine TP; 1-Trifluoroacetylpseudouridine TP; 1-Trifluoromethyl-pseudo-UTP; 1-Vinylpseudouridine TP; 2,2'-anhydro-uridine TP; 2'-bromo-deoxyuridine TP; 2'-F-5-Methyl-2'-deoxy-UTP; 2'-OMe- 5-Me-UTP; 2'-OMe-pseudo-UTP; 2'-a-Ethynyluridine TP; 2'-a-Trifluoromethyluridine TP; 2'-b-Ethynyluridine TP; 2'-b-Trifluoromethyluridine TP; 2'-Deoxy-2',2'-difluorouridine TP; 2'-Deoxy-2'-a-mercaptouridine TP; 2'-Deoxy-2'-a-thiomethoxyuridine TP; 2'-Deoxy-2'-b-aminouridine TP; 2'-Deoxy-2'-b-azidouridine TP; 2'-Deoxy-2'-b-bromouridine TP; 2'-Deoxy-2'-b-chlorouridine TP; 2'-Deoxy-2'-b-fluorouridine TP; 2'-Deoxy-2'-b-iodouridine TP; 2'-Deoxy-2'-b-mercaptouridine TP; 2'-Deoxy-2'-b-thiomethoxyuridine TP; 2-methoxy-4-thio-uridine; 2-methoxyuridine; 2'-O-Methyl-5-(1 -propynyl)uridine TP; 3-Alkyl-pseudo-UTP; 4'-Azidouridine TP; 4'-Carbocyclic uridine TP; 4'-Ethynyluridine TP; 5-(1 -Propynyl)ara-uridine TP; 5-(2-Furanyl)uridine TP; 5-Cyanouridine TP; 5-Dimethylaminouridine TP; 5'-Homo-uridine TP; 5-iodo-2'-fluoro-deoxyuridine TP; 5-Phenylethynyluridine TP; 5-Trideuteromethyl-6-deuterouridine TP; 5-Trifluoromethyl-Uridine TP; 5-Vinylarauridine TP; 6-(2,2,2- T rifluoroethy l)-pseudo- UTP; 6-(4-Morpholino)-pseudo-UTP; 6-(4-Thiomorpholino)-pseudo-UTP; 6-(Su bsti tuted-Phenyl)-pseudo-UTP; 6-Amino-pseudo-UTP; 6-Azido-pseudo-UTP; 6-Bromo-pseudo-UTP; 6-Butyl-pseudo-UTP; 6-Chloro-pseudo-UTP; 6-Cyano-pseudo-UTP; 6-Dimethylamino-pseudo-UTP; 6-Ethoxy-pseudo-UTP; 6-KB-049-WO Docket No. 33791 / 41049Ethylcarboxylate-pseudo-UTP; 6-Ethyl-pseudo-UTP; 6-Fluoro-pseudo-UTP; 6-Formyl-pseudo-UTP; 6-Hydroxyamino-pseudo-UTP; 6-Hydroxy-pseudo-UTP; 6-Iodo-pseudo-UTP; 6-iso-Propyl-pseudo-UTP; 6-Methoxy-pseudo-UTP; 6-Methylamino-pseudo-UTP; 6-Methyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Propyl-pseudo-UTP; 6-tert-Butyl-pseudo-UTP; 6-Trifluoromethoxy-pseudo-UTP; 6-Trifluoromethyl-pseudo-UTP; Alpha-thio-pseudo-UTP; Pseudouridine 1-(4-methylbenzenesulfonic acid) TP; Pseudouridine 1-(4-methylbenzoic acid) TP; Pseudouridine TP 1-[3-(2-ethoxy)]propionic acid; Pseudouridine TP 1 -[3-12-(2-[2-(2-ethoxy )-ethoxy]-ethoxy )-ethoxy 1 ]propionic acid; Pseudouridine TP 1 - [3 - {24242- 12(2-ethoxy )-ethoxy 1 -ethoxy]-ethoxy)-ethoxy1]propionic acid; Pseudouridine TP 1-[3-12-(2-[2-ethoxy ]-ethoxy)-ethoxyllpropionic acid; Pseudouridine TP 143-12-(2-ethoxy)-ethoxyll propionic acid; Pseudouridine TP 1-methylphosphonic acid; Pseudouridine TP 1-methylphosphonic acid diethyl ester; Pseudo-UTP-N1-3-propionic acid; Pseudo-UTP-N1-4-butanoic acid; Pseudo-UTP-N1-5-pentanoic acid; Pseudo-UTP-N1-6-hexanoic acid; Pseudo-UTP-N1-7-heptanoic acid; Pseudo-UTP-N1-methyl-p-benzoic acid; Pseudo-UTP-N1-p-benzoic acid; Wybutosine; Hydroxywybutosine; Isowyosine; Peroxywybutosine; undermodified hydroxywybutosine; 4-demethylwyosine; 2,6-(diamino)purine;1-(aza)-2-(thio)-3-(aza)-phenoxazin-l-yl: 1,3-( diaza)-2-( oxo )-phenthiazin- 1-y1;1,3-(diaza)-2-(oxo)-phenoxazin-l-y1;1,3,5-(triaza)-2,6-(dioxa)-naphthalene;2 (amino)purine;2,4,5-(trimethyl)pheny1;2' methyl, 2'amino, 2'azido, 2'fluro-cytidine;21 methyl, 2'amino, 2'azido, 2'fluro-adenine;2'methyl, 2'amino, 2'azido, 2'fluro-uridine;2'-amino-2'-deoxyribose; 2-amino-6-Chloro-purine; 2-aza-inosinyl; 2'-azido-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified bases; 2'-O-methyl-ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxo-pyridopyrimidine-3-yl; 2-pyridinone; 3 nitropyrrole; 3-(methyl)-7-(propynyl)isocarbostyrilyl; 3-(methyl)isocarbostyrilyl; 4-(fluoro)-6-(methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(methyl)indolyl; 4,6-(dimethyl)indolyl; 5 nitroindole; 5 substituted pyrimidines; 5-(methyl)isocarbostyrilyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloro-purine; 6-phenyl-pyrrolo-pyrimidin-2-on-3-y 1; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio )-3-(aza)-phenthiazin-l-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-( diaza)-2-( oxo )-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)- 2-(oxo)-phenoxazin-l-yl; 7-(aza)indolyl; 7-(guanidiniumalkylhydroxy)-1 -(aza)-2-(thio )-3-(aza)-phenoxazinl-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio )-3-(aza)-phenthiazin-l-y1; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-l-y 1; 7-(guanidiniumalkylhydroxy)-1,3 -(di aza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidiniumalkyl-hydroxy)-l,3-( diaza)-2-( oxo )-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo )-phenoxazin-1-yl; 7-(propynyl)isocarbostyrilyl; 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidizopyridinyl; Aminoindolyl; Anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-y 1; bis-ortho-substituted-6-pheny l-py rrolo-py ri midin-2-on-3-y I; Difluorotolyl; Hypoxanthine;Imidizopyridinyl; Inosinyl; Isocarbostyrilyl; Isoguanosine; N2-substituted purines; N6-methyl-2-amino-purine; N6-substituted purines; N-alkylated derivative; Napthalenyl; Nitrobenzimidazolyl; Nitroimidazolyl; Nitroindazolyl; Nitropyrazolyl; Nubularine; 06-substituted purines; O-alkylated derivative; ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Oxoformycin TP;para-KB-049-WO Docket No. 33791 / 41049(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-y1; para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-y1; Pentacenyl; Phenanthracenyl; Phenyl; propynyl-7-(aza)indolyl; Pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl; pyrrolo-pyrimidin-2-on-3-yl; Pyrrolopyrimidinyl; Pyrrolopyrizinyl; Stilbenzyl; substituted 1,2,4-triazoles; Tetracenyl; Tubercidine; Xanthine; Xanthosine-5'-TP; 2-thio-zebularine; 5-aza-2-thio-zebularine; 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-Amino-riboside-TP; Formycin ATP;Formycin B TP; Pyrrolosine TP; 2'-OH-ara-adenosine TP; 2'-OH-ara-cytidineTP; 2'-OH-ara-uridine TP; 2'-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP; and N6-(19-Amino-pentaoxanonadecyl)adenosine TP. In some embodiments, the alternative nucleobases are selected from the group consisting of pseudouridine (ip), 2-thiouridine (s2U), 4'-thiouridine, 5-methylcytosine, 2-thio-l-methy 1 -1 -deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine,5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, 21-O-methyl uridine, 1-methyl-pseudouridine (m1tp), 1-ethyl-pseudouridine (e1tp), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), a-thio-guanosine, a-thio-adenosine, 5-cyano uridine, 4'-thio uridine 7-deaza-adenine, 1-methyl-adenosine (ml A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), and 2,6-Diaminopurine, (I), 1-methyl-inosine (ml I), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQO), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (ml G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lysidine, 2-selenouridine, 3-(3-amino-3-carboxypropy1)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 3-methylpseudouridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-aminomethy1 -2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl -2-thiouridine, 5-carboxymethylaminomethy1 -2-geranylthiouridine, 5-carboxymethylaminomethy1-2-selenouridine, 5-cyanomethyluridine, 5-hydroxycytidine, 5-methylaminomethy1 -2-geranylthiouridine, 7-aminocarboxypropyl-demethylwyosine, 7-aminocarboxypropylwyosine, 7-aminocarboxypropylwyosine methyl ester, 8-methyladenosine, N4, N4-dimethylcytidine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, cyclic N6-threonylcarbamoyladenosine, glutamyl-queuosine, methylated undermodified hydroxywybutosine, N4, N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethy1 -2-thiouridine, geranylated 5-carboxymethylaminomethy1-2-thiouridine, Qbase, preQObase, preQIbase, and two or more combinations thereof. In some embodiments, the alternative nucleobase is selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, 1-ethyl-pseudouridine, 5-methylcytosine, 5-methoxyuridine, and a combination thereof.
[0022] In some embodiments, the nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having a modified uracil include pseudouridine (ip), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methylKB-049-WO Docket No. 33791 / 41049ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethy1-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethy1-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethy1-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (im5U), 1-taurinomethyl-pseudouridine, 5-taurinomethy1-2-thio-uridine(Tm5s2U), 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (ml ip), 1-ethyl-pseudouridine (e1tp), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4 ip), 4-thio-l-methyl-pseudouridine, 3-methyl-pseudouridine (m3 ip), 2-thio-1 -methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N 1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1 -methyl -3-(3-amino-3-carboxypropyl)pseudouridine (acp3 kv), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (tpm), 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethy1-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethy1-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethy1-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1 -thio-uridine, deoxythymidine, 2' -F-ara-uridine, 2'-F-uridine, 2' -OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and 5-[3-(1-E-propenylamino)]uridine.
[0023] In some embodiments, the nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having a modified cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio- 1 -methyl- 1 -deaza-ps eudoisocytidine, 1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l-methyl-pseudoisocytidine, lysidine (k2C), o-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m5Cm), N4-acetyl-2'-0-methyl-cytidine(ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formy 1 -2'-O-methyl-cytidine (f5Cm), N4, N4,2’-O-trimethyl-cytidine (m42Cm), 1 -thio-cytidine, 2' -F-ara-cytidine, 2' -F-cytidine, and 2' -OH-ara-cytidine.
[0024] In some embodiments, the nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having a modified adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-KB-049-WO Docket No. 33791 / 41049diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6-threonylcarbamoyl-adenosine (t6A), N6- methyl-N6-threonylcarbamoyl-adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms2g6A), N6, N6-dimethyl-adenosine (m62A), N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, o-thio-adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O-dimethyl-adenosine (m6Am), N6, N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (miAm), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine.
[0025] In some embodiments, the nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1 -methyl-inosine (mil), wyosine (ImG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQo), 7-aminomethyl-7-deaza-guanosine (preQi), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine N2-methyl-guanosine (m2G), N2, N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m2'7G), N2, N2,7-dimethyl-guanosine 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2, N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m2Gm), N2, N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (miGm), N2,7-dimethyl-2'-O-methyl-guanosine (m2'7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine 2'-O-ribosylguanosine (phosphate) (Gr(p)), 1 -thio-guanosine, O6-methyl-guanosine, 2'-F-ara-guanosine, and 2'-F-guanosine.
[0026] Non-limiting further examples of suitable alternative nucleobases, nucleosides, and nucleotides for use in the oligonucleotides disclosed herein include those disclosed in WO 2020 / 154342, WO 2020 / 154344, and WO 2020 / 154343, each of which is incorporated herein by reference in its entirety.
[0027] In some embodiments, the oligonucleotides are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, an oligonucleotide can be uniformly modified with 1 -methyl-pseudouridine, meaning that all uridine residues in the oligonucleotide sequence are replaced with 1 -methyl-pseudouridine. Similarly, an oligonucleotide can be uniformly modified for any type of nucleobase present in the sequence by replacement with an alternative nucleobase such as those set forth above.KB-049-WO Docket No. 33791 / 41049
[0028] The oligonucleotides of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleobase (e.g., purine or pyrimidine, or any one or more or all of A, G, U, T, or C) may be uniformly modified in an oligonucleotide of the disclosure, or in a given predetermined sequence region thereof (e.g., in an mRNA including or excluding the polyA tail). In some embodiments, all nucleotides X in an oligonucleotide of the present disclosure (or in a given sequence region thereof) are modified nucleotides, wherein X may any one of nucleotides A, G, U, T, C, or any one of the combinations A+G, A+U, A+C, G-HU, G-FC, U+C, A+G-HU, A+G-FC, G-HU+C or A+G+C.
[0029] In some embodiments, the oligonucleotide contains 1% to 100% modified nucleobases (either in relation to overall nucleobase content, or in relation to one or more types of nucleobase, i.e., any one or more of A, G, U, T, and / or C) or any intervening percentage (e.g., 1% to 5%, 1% to 10%, 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of standard nucleobases A, G, T, U, and / or C.
[0030] The oligonucleotides may contain at a minimum 0% and at maximum 100% modified nucleobases, or any intervening percentage, such as at least 1% modified nucleobases, at least 5% modified nucleobases, at least 10% modified nucleobases, at least 25% modified nucleobases, at least 50% modified nucleobases, at least 80% modified nucleobases, or at least 90% modified nucleobases. For example, the oligonucleotides may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the oligonucleotide is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the oligonucleotide is replaced with a modified cytosine (e.g., a 5-substituted cytosine). The modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
[0031] In some embodiments, the oligonucleotides described herein includes at least 1 modified nucleobase, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleobases. In other embodiments, the oligonucleotides include from 1 to 10 modified nucleobases, such as from 2 to 9 modified nucleobases, such as from 3 to 8 modified nucleobases, such as from 4 to 7 modified nucleobases, such as 6 or 7 modified nucleobases. In some embodiments, the oligonucleotides include a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.KB-049-WO Docket No. 33791 / 41049Sugar Moieties
[0032] Oligonucleotides described herein also include one or more sugar moieties (alternatively referred to herein as a sugar of the nucleotide), including one or more standard sugar moieties and / or alternative sugar moieties (e.g., unnatural sugar moieties, sugar analogs, or natural sugar moieties comprising modifications or substitutions).
[0033] As disclosed herein, the sugar of the nucleotide at position -1 can be a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl ("nr”), Dh 2'-(R)-dimethyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (" MK4”), 2’-O-acetamide ("na”), MCP (" M3”), Arabinose-OME, 2'5' 3' OME, or 2’-Amino ("2-NH2”). The sugars of the remaining nucleotides of the oligonucleotide can be one of these sugars or another sugar as disclosed herein.
[0034] Standard sugar moieties include ribose and deoxyribose. In some embodiments, the oligonucleotides disclosed herein comprise a ribose or modified ribose moiety. In some embodiments, the sugar moiety in the oligonucleotides may be a ribose optionally having a 2'-O-methyl, 2'-O-MOE, 2'-F, 2'-amino, 2'-O-propyl, 2'-aminopropyl, or 2’ -OH modification. In some embodiments, the oligonucleotides disclosed herein comprise a deoxyribose or modified deoxyribose moiety. Alternative sugar moieties include other unnatural and natural sugars and sugar analogs as described herein, including sugar moieties comprising modifications or substitutions.
[0035] Alternative sugar moieties also include substituted sugar moieties. The oligonucleotides disclosed herein can comprise substituted furanose sugar moieties having one or more of the following at the 2'-position of a furanosyl sugar (e.g., ribose or arabinose): OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to C alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include -O[(CH2)nO]mCH3, -O(CH2)nOCH3, -O(CH2)n-NH2, -O(CH2)nCH3, -O(CH2)n-ONH2, and -O(CH2)n-ON[(CH2)nCH3]2, where n and m are from 1 to about 10. In other embodiments, oligonucleotides disclosed herein can comprise substituted furanose sugar moieties having one or more of the following at the 2' position: Ci to Cw alkyl, substituted Ci to Cw alkyl (e.g., substituted with one or more of OH, halo, amino, alkoxy, or thiol, or combinations thereof), alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-O-MOE) i.e., an alkoxy-alkoxy group. 2'-O-MOE nucleosides confer several beneficial properties to oligonucleotides including, but not limited to, increased nuclease resistance,KB-049-WO Docket No. 33791 / 41049improved pharmacokinetics properties, reduced non-specific protein binding, reduced toxicity, reduced immunostimulatory properties, and enhanced target affinity as compared to unmodified oligonucleotides.
[0036] Another exemplary alternative sugar moiety comprises a 2'-dimethylaminooxyethoxy group, i.e., a -O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-(CH2)2-O-(CH2)2-N(CH3)2. Further exemplary alternative sugar moieties include: 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides, (both R and S isomers in these three families); 2'-alkoxyalkyl; and 2'-NMA (N-methylacetamide).
[0037] Other alternatives include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (Z-OCFhCFhCFhNFh) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the sugar moieties of an oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides can also have sugar analogs or mimetics such as cyclobutyl, cyclohexyl, cyclohexenyl, hexitol moieties in place of a pentofuranosyl sugar. Representative U. S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U. S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.
[0038] An oligonucleotide of the disclosure can include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by the bridging of two atoms. A "bicyclic nucleoside" (" BNA") is a nucleoside having a sugar moiety including a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some embodiments an oligonucleotide of the disclosure may include one or more locked nucleosides. A locked nucleoside is a nucleoside having a modified ribose moiety in which the ribose moiety includes an extra bridge connecting the 2' and 4' carbons. In other words, a locked nucleoside is a nucleoside including a bicyclic sugar moiety including a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleosides to oligonucleotides has been shown to increase oligonucleotide stability in serum, and to reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12):3185-3193). Examples of bicyclic nucleosides for use in the oligonucleotides of the disclosure include without limitation nucleosides including a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the oligonucleotides of the disclosure include one or more bicyclic nucleosides including a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CH2OCH3)-O-2' (and analogs thereof; see, e.g., U. S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)-O-2' (and analogs thereof; see e.g., U. S. Pat. No. 8,278,283); 4'-CH2-N(OCH3)-2' (and analogs thereof; see e.g., U. S. Pat. No. 8,278,425); 4'-CH2-O-N(CH3)2-2' (see, e.g., U. S. Patent Publication No. 2004 / 0171570); 4'-CH2-N(R)-O-2',KB-049-WO Docket No. 33791 / 41049wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U. S. Pat. No. 7,427,672); 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' (and analogs thereof; see, e.g., U. S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. In some embodiments, at least 1 of the alternative sugar moieties is a BNA (e.g., an LNA), such as at least 2, such as at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 of the alternative sugar moieties are BNAs. In a still further embodiment, all the alternative moieties are BNAs.
[0039] Additional representative U. S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U. S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference.
[0040] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example o-L-ribofuranose and p-D-ribofuranose (see WO 99 / 14226).
[0041] An oligonucleotide of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid including a bicyclic sugar moiety including a 4'-CH(CH3)-O-2' bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as " S-cEt".
[0042] An oligonucleotide of the disclosure may also include one or more "conformationally restricted nucleotides" (" CRN"). CRN are nucleotide analogs with a linker connecting the C2' and C4' carbons of ribose or the C3 and — C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.
[0043] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013 / 0190383; and PCT publication WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference.
[0044] In some embodiments, an oligonucleotide of the disclosure includes one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between CT-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the CT and C4' carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).KB-049-WO Docket No. 33791 / 41049
[0045] Representative U. S. publications that teach the preparation of UNA include, but are not limited to, U. S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference.
[0046] The sugar moiety may also be modified with a cyclopropane ring to produce a tricyclodeoxynucleic acid (tricyclo DNA). The sugar moiety may be e.g., 1,5,-anhydrohexitol, threose to produce a threose nucleoside (TNA), or arabinose to produce an arabino nucleoside.
[0047] The sugar moiety can also be a non-sugar such as cyclohexene to produce cyclohexene nucleic acid (CeNA) or glycol to produce glycol nucleic acids (GNA). Potentially stabilizing modifications to the ends of nucleotide molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.
[0048] Exemplary oligonucleotides of the disclosure include standard and / or alternative sugar moieties in any combination and at various positions, and may also include DNA or RNA oligonucleotides. Incorporation of modified sugar moieties into the oligonucleotide of the disclosure may enhance the affinity of the oligonucleotide for the target nucleic acid.
[0049] In some embodiments, the sugar moieties may be independently, for each position, selected from ribose and deoxyribose, and / or may comprise modifications such as but not limited to 2'-O-alkyl, 2'-O-methoxyethyl, 2'-O-allyl, 2'-O-alkalamine, 2'-fluororibse 2'-deoxyribase, and locked nucleic acid (LNA). In some embodiments, the oligonucleotides include one or more modified sugar moieties, e.g., 2'-modified modified sugar moieties. In some embodiments, the oligonucleotides described herein include one or more 2'-modified sugar moieties independently selected from the group consisting of 2'-O-alkyl-RNA (e.g., 2'-O-methyl-RNA), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, ANA, 2'-fluoro-ANA, and bridged nucleic acid (" BNA” e.g., locked nucleic acid " LNA”) moieties. In some embodiments, the one or more modified sugar moiety is a BNA. In some cases, at least one sugar moiety is a ribose or modified ribose sugar. In some cases, at least one sugar moiety is a ribose sugar. In some cases, at least one sugar moiety is a modified ribose sugar. In some cases, at least one sugar moiety is independently 2'-methoxy-ribose, 2'-MOE-ribose, 5'-methyl-2'deoxyribose, 2'-deoxy-2'-fluororibose, 2'-fluoro-arabinose, 2-methoxy-arabinose, 2'deoxyribose, a locked nucleic acid (LNA), or a deoxyhexose. In some cases, each sugar moiety is independently 2'-methoxy-ribose, 2'-MOE-ribose, 5'-methyl-2'deoxyribose, 2'-deoxy-2'-fluororibose, 2'-fluoro-arabinose, 2-methoxy-arabinose, 2'deoxyribose, a locked nucleic acid (LNA), or a deoxyhexose.
[0050] In some embodiments, the oligonucleotides described herein include phosphorodiamidate morpholino oligomers (PMO), in which a deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester inter-subunit linkage is replaced by an uncharged phophorodiamidate linkage, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev. 1997, 7:63-70. In some instances, the oligonucleotidesKB-049-WO Docket No. 33791 / 41049include modified sugar moieties comprising bicyclic sugar derivatives (LNA, ENA, CLNA, CENA, AENA etc.), acyclic sugar analogs (UNA, PNA, etc.) or analogs containing sugars other than ribose or deoxyribose (e.g., a pyranose ring (ANA, HNA)).
[0051] In some embodiments, the oligonucleotide includes at least 1 modified sugar moiety, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified sugar moieties. In other embodiments, the oligonucleotides include from 1 to 10 modified sugar moieties, such as from 2 to 9 modified sugar moieties, such as from 3 to 8 modified sugar moieties, such as from 4 to 7 modified sugar moieties, such as 6 or 7 modified sugar moieties. In some embodiments, the oligonucleotide contains 1% to 100% modified sugar moieties (either in relation to overall sugar moiety content, or in relation to one or more types of sugar moiety, e.g., any one or more of ribose, deoxyribose, or derivatives thereof) or any intervening percentage (e.g., 1% to 5%, 1% to 10%, 1 % to 20%, 1 % to 25%, 1 % to 50%, 1 % to 60%, 1 % to 70%, 1 % to 80%, 1 % to 90%, 1 % to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining sugar moieties in the oligonucleotides are standard sugar moieties, i.e., ribose or deoxyribose sugar moieties.
[0052] In some embodiments, the sugar moiety has the structure of any one of Formula IA-VA:^R1A| O^R4AR2AR3A RSAFormula IA Formula HA Formula IIIA Formula IVA Formula VA wherein N1is hydrogen or a nucleobase;R1Ais hydroxy, halogen, or Ci-Ce alkoxy;R2Ais hydrogen, hydroxy, halogen, or Ci-Ce alkoxy;R3Ais hydrogen, hydroxy, halogen, or Ci-Ce alkoxy;R4Ais hydrogen, hydroxy, halogen, or Ci-Ce alkoxy; andR5Ais hydrogen, hydroxy, halogen, or Ci-Ce alkoxy.KB-049-WO Docket No. 33791 / 41049
[0053] In some embodiments, the sugar moiety has the structure of any one of Formula IB-VIB:Formula IB Formula IIB Formula IIIB Formula IVBwherein N1is hydrogen or a nucleobase;R12is hydrogen, hydroxy, fluoro, halogen, Ci-Ce alkyl, Ci-Ce heteroalkyl, or Ci-Ce alkoxy; andR13is hydrogen or Ci-Ce alkyl.
[0054] In some embodiments, the sugar moiety has the structure of any one of Formula IC-IVC:Formula IC Formula IIC Formula IIIC Formula IVC wherein N1is hydrogen or a nucleobase;R6Cis hydrogen, hydroxy, or halogen;R7Cis hydrogen, hydroxy, halogen, or Ci-Ce alkoxy;R8Cis hydrogen or halogen;R9Cis hydrogen or hydroxy, halogen, or Ci-Ce alkoxy;R10Cis hydrogen or halogen; andR11Cis hydrogen or hydroxy, halogen, or C1-C6alkoxy.Sugar moieties of Formula IC are HNA sugars; sugar moieties of Formula IIC are beta-homo-DNA sugars; andKB-049-WO Docket No. 33791 / 41049sugar moieties of Formula NIC are CeNA sugars. In some cases, the HNA sugar is unsubstituted (i.e., R7Cand R6Care each H). In some cases, the beta-homo-DNA sugar is unsubstituted (i.e., R8Cand R9Care each H). In some cases, the CeNA sugar is unsubstituted (i.e., R10Cand R11Care each H).
[0055] Non-limiting further examples of suitable sugars for use in the oligonucleotides disclosed herein include those disclosed in WO 2020 / 154342, WO 2020 / 154344, and WO 2020 / 154343, each of which is incorporated herein by reference in its entirety.
[0056] In some cases, the sugar moiety of a nucleotide as disclosed herein is p-D-ribose, p-D-2'-deoxy ribose, methoxy-substituted sugars (e.g., p-D-2'methoxyribose), MOE-substituted sugars (e.g., p-D-2'methoxyethylribose), amide substituted sugars (e.g., a 2'MCE-ribose, where MCE is O-CH2CH2C(O)NHCH3 at the 2' position of the ribose, and can be either oriented as p-2' or a-2’), fluoro substituted sugars (e.g., 2'-deoxy-2-fluororibose, also referred to herein as 2-fluororibose, and p-D-2'-deoxy-2'-fluoroarabinofurose, also referred to herein as 2'-fluoroarabinose), substituted sugars (such as 2', 5' and bis substituted sugars), 4'-S-sugars (such as 4'-S-ribose, 4'-S-2'-deoxyribose and 4'-S-2'-substituted ribose), bicyclic alternative sugars (such as locked nucleic acid (LNA) having a 2'-O— CH2-4' or 2'-O— (CH2)2-4' bridged ribose derived bicyclic sugar) and sugar surrogates (such as when the ribose ring has been replaced with a morpholino, a pyran, a cyclohexyl, a cyclohexenyl, or a hexitol ring system, such as a p-D-homoDNA, CeNA, or HNA. A p-D-homoDNA sugar moiety includes optionally substituted versions (e.g., substituted at the 2' or 3' position with a halo, Ci-salkoxy, or Ci-salkyl - see, e.g., sugars of Formula HO). A HNA sugar moiety includes optionally substituted versions (e.g., substituted at the T or 3' position with a halo, Ci-salkoxy, or Ci-salkyl - see, e.g., sugars of Formula IO). A CeNA sugar moiety includes optionally substituted versions (e.g., substituted at the 3' position with a halo, Ci-salkoxy, or Ci-salkyl, see, e.g., sugars of Formula IIIC).Internucleotide Linkages
[0057] The oligonucleotides disclosed herein include one or more internucleotide linkages. The internucleotide linkage(s) of the disclosed oligonucleotides can be unmodified or natural internucleotide linkages and / or alternative nucleotide linkages. Unmodified or natural internucleotide linkages can be a phosphate linkage. Alternative internucleotide linkages include unnatural internucleotide linkages and / or modified natural internucleotide linkages. Examples of alternative internucleotide linkages are known in the art, including, but not limited to, phosphorothioate, boronophosphate, phosphotriester, phosphorothionate, or phosphoramidate linkages, and other variants of the phosphate backbone. In some embodiments, the oligonucleotides of the disclosure include at least one alternative internucleotide linkage.
[0058] In some instances, the phosphate group (PC) of a natural internucleotide linkage can be replaced with a phosphorothioate (PS) or boranophosphonate (PB) group, or the 3',5'-phosphodiester bond of a natural internucleotide linkage can be replaced with a 2',5'-bond, or the ester bond can be replaced with an amide bond, etc. Some embodiments include oligonucleotides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2-[known as a methylene (methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-KB-049-WO Docket No. 33791 / 41049N(CH3)-CH2- and -N(CH3)-CH2-CH2-[wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of the above-referenced U. S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U. S. Pat. No. 5,602,240. In some embodiments, the oligonucleotides featured herein have morpholino backbone structures of the above-referenced U. S. Pat. No. 5,034,506. In some embodiments, the internucleotide linkages within a contiguous nucleotide sequence are alternative internucleotide linkages. In some embodiments, the internucleotide linkages within a contiguous nucleotide sequence are phosphoroamidate linkages, e.g., a PAX internucleotide linkage that has a structure of Formula (IV) disclosed herein. In some embodiments the alternative internucleotide linkages are stereochemically pure alternative phosphoroamidate linkages. In some embodiments, the alternative internucleotide linkages are Sp phosphoroamidate linkages. In other embodiments, the alternative internucleotide linkages are Rp phosphoroamidate linkages. In all cases, the oligonucleotides disclosed herein comprise at least one PAX internucleotide linkage that has a structure of Formula (IV) disclosed herein.
[0059] In some cases, at least one internucleotide linkage of an oligonucleotide disclosed herein has a structure of Formula (IV):.R1-S11-N=P1-C)II I \ / JO O- Z (IV)whereinR1is isopropyl, isobutyl, sec-butyl, C1-6 haloalkyl, C2-6 hydroxyalkyl, C2-8 alkylene-N(RN)2, Co-2alkylene-C3-8 cycloalkyl, 4-10 membered heterocycloalkyl having 1-3 ring heteroatoms selected from O, N, and S, or 5-10-membered heteroaryl having 1-3 ring heteroatoms selected from O, N, and S, with the proviso that the heterocycloalkyl or heteroaryl is attached to the sulfur via a carbon ring atom, and the cycloalkyl, heterocycloalkyl, or heteroaryl is substituted with 0, 1, 2, or 3 R2groups;each R2is independently halo, CN, N(RN)2 Ci-salkyl, Ci-shaloalkyl, Ci-salkoxy, oxo, CO2RN, or C(O)Ci. salkyl; andeach RNis independently H or Ci-salkyl.
[0060] In some cases, R1is isopropyl. In some cases, R1is isobutyl. In some cases, R1is sec-butyl. In some cases, R1is C3-8 cycloalkyl, and in some cases is a spiro C7.8 cycloalkyl. In some cases, R1is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. In some cases, R1is cyclobutyl, cyclopentyl, or cyclohexyl. In some cases, R1is cyclopropyl. In some cases, R1is cyclobutyl. In some cases, R1is cyclopentyl. In some cases, R1is cyclohexyl. In some cases, R1is a spiro[3.3]heptyl. In some cases, R1is C1-6 haloalkyl or C1-6 hydroxyalkyl. In some cases, R1is C1-6 haloalkyl. In some cases, R1is Ci-efluoroalkyl. In some cases, R1is CH2F or CHF2. In some cases, R1is CH2F. In some cases, R1is CHF2. In some cases, R1C1-6 hydroxyalkyl. In some cases, R1is C2-8 alkylene-N(RN)2. In some cases, R1is 4-8-membered heterocylcoalkyl. In some cases, R1is azetidine, pyrrolidine, piperidine, oxetane, tetrahydrofuran, or tetrahydropyran. In some cases, R1is 5-10 heteroaryl. InKB-049-WO Docket No. 33791 / 41049some cases, R1is furan, thiophene, thiazole, isoxazole, imidazole, pyridine, or pyrazine. In some cases, R1is unsubstituted. In some cases, R1is substituted with 1, 2, or 3 R2. In some cases, R1is substituted with 1 R2. In some cases, R1is substituted with 2 R2. In some cases, R1is substituted with 3 R2.
[0061] In some cases, at least one R2is oxo, CO2RN, or halo. In some cases, at least one R2is oxo, CO2H, or halo. In some cases, at least one R2is oxo. In some cases, at least one R2is CO2H. In some cases, at least one R2is halo. In some cases, at least one R2is CN, N(RN)2 Ci-salkyl, Ci-shaloalkyl, Ci-salkoxy, or C(O)Ci-salkyl. In some cases, at least one RNis H. In some cases, at least one RNis C^alkyl. In some cases, each RNis H. In some cases, each RNis Ci-salkyl.
[0062] Other alternatives chemistries of the oligonucleotide internucleotide linkages described herein include a 5' phosphate or 5' phosphate mimic, e.g., a 5'-terminal phosphate or phosphate mimic of an oligonucleotide. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.
[0063] The term "cycloalkyl” refers to a non-aromatic monocyclic, fused, bridged or spiro ring system whose ring atoms are carbon and which can be saturated or have one or more units of unsaturation. The carbocycle can have three to eight ring carbon atoms. In some embodiments, the number of carbon atoms is 4 to 6. " Fused” bicyclic ring systems comprise two rings which share two adjoining ring atoms. Bridged bicyclic group comprise two rings which share three or four adjacent ring atoms. Spiro bicyclic ring systems share one ring atom.Cycloalkyl groups can include cycloalkenyl groups. Specific examples include, but are not limited to, cyclohexyl, cyclopentyl, cyclobutyl, and cyclopropyl. A carbocycle ring is unsubstituted or substituted as described herein.
[0064] The term “heterocycloalkyl” as used herein refers to a non-aromatic monocyclic, fused, spiro or bridged ring system which can be saturated or contain one or more units of unsaturation, having four to ten ring atoms in which one or more (e.g., one to three, or one, two, or three) ring atoms is a heteroatom selected from O, N, and S. Examples of heterocycloalkyls include, but are not limited to, quinuclidinyl, piperidinyl, piperizinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, azepanyl, diazepanyl, triazepanyl, azocanyl, diazocanyl, triazocanyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, oxazocanyl, oxazepanyl, thiazepanyl, thiazocanyl, benzimidazolonyl, tetrahydrofuranyl, tetrahydrothiophenyl, morpholino (including, for example, 3-morpholino, 4-morpholino), 2-thiomorpholino, 3-thiomorpholino, 4-thiomorpholino, 1 -pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 24mmune24dine-2-one, 1-tetrahydropiperazinyl, 2-tetrahydropiperazinyl, 3-tetrahydropiperazinyl, 1 -piperidinyl, 2-piperidinyl, 3-piperidinyl, 1 -pyrazolinyl, 3-pyrazolinyl, 4-pyrazolinyl, 5-pyrazolinyl, 1 -piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl, 2-thiazolidinyl, 3-thiazolidinyl, 4-thiazolidinyl, 1 -imidazolidinyl, 2-imidazolidinyl, 4-imidazolidinyl, 5-imidazolidinyl, indolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, benzothiolanyl, benzodithianyl, 3-(1-alkyl)-benzimidazol-2-onyl, and 1,3-dihydro-imidazol-2-onyl. A heterocycloalkyl ring is unsubstituted or substituted as described herein.
[0065] The terms "heteroaryl” refers to a heterocycle that is aromatic, having five to ten members (e.g., 5 to 6 members), including monocyclic heteroaromatic rings and polycyclic aromatic rings in which a monocyclicKB-049-WO Docket No. 33791 / 41049aromatic ring is fused to one or more other aromatic ring. Heteroaryl groups have one or more ring (e.g., 1 to 3, 1, 2, or 3) heteroatoms selected from 0, N, and S. Also included within the scope of the term "heteroaryl”, as it is used herein, is a group in which an aromatic ring is "fused” to one or more non-aromatic rings (carbocyclic or heterocyclic), where the radical or point of attachment is on the aromatic ring.. Examples of heteroaryl groups include pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, imidazolyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl or thiadiazolyl including, for example, 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxadiazolyl, 5-oxadiazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 3-pyrazolyl, 4-pyrazolyl, 1 -pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 3-pyridazinyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-triazolyl, 5-triazolyl, tetrazolyl, 2 -thienyl, 3-thienyl,, isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,3-triazolyl, 1,2,3-thiadiazolyl, 1,3,4-thiadiazolyl 1, ob Q- ——- 1,2,5-thiadiazolyl, pyrazinyl, and 1,3,5-triazinyl. A heteroaryl ring is uns | 1 z OO o00. Q- ——- ——- II 1ubstituted or substituted as described herein.OO I Q- 1 ——- II IIO o Q. 1 t!- ——I1 1 z ii 1 OOOT== Z zI I
[0066] In some instances, the phosphoramidate in oo OO 1wOT==== zternucleotide linkage (" PAX”) of Formula (IV) has a structure oow== OOW== 1shown in Table 1:Z CJX oT I A ITable 1PAX Linkage StructureL1L2L3L4L5KB-049-WO Docket No. 33791 / 41049PAX Linkage StructureL6Z\ ii IC) \ / > - S II-N=P 1-OV\ / „0 O~ SL7b^ L8 1 | O00— ——b o II i o b Z ^'^’'^^ | | II O0 ob 0. i o 10 o0 o 0—! 0— b —— ——^^o— ——- ——1 ob II Q- l oow ——== II 1z II | z 1 o 6D— z —— z II i- i oow oow== 1 1== z II i 11OO OO 1OTOT==== zoow== oow==L9A A 0M C oo 6T I IL10L11L12L13 / _ \ ° II 1O ) — S— N=P~0, \ / II T i \z ' —f0 0" <L14KB-049-WO Docket No. 33791 / 41049
[0067] As used herein, the term " ADAR-recruiting domain” refers nucleotide a sequence that acts as recruitment and binding region for an ADAR enzyme. Oligonucleotides including such ADAR-recruiting domains may be referred to as ‘axiomer AONs' or ‘self-looping AONs.' In some embodiments, stem loop structures can act as a recruitment domain for the ADAR enzyme (e.g., an ADAR-recruiting domain), yet the oligonucleotides as disclosed herein can affect ADAR recruitment and activity against a target adenosine in a target RNA without such a stem loop structure. Thus, in some embodiments, the oligonucleotides disclosed herein do not include a stem-loop structure. Alternatively, in some embodiments, the oligonucleotides disclosed herein do include a stem-loop structure. The ADAR-recruiting domain portion may act to recruit an endogenous ADAR enzyme present in the cell. Such ADAR-recruiting domains do not require conjugated entities or presence of modified recombinant ADAR enzymes. Alternatively, the ADAR-recruiting portion may act to recruit a recombinant ADAR fusion protein that has been delivered to a cell or to a subject via an expression vector construct including a polynucleotide encoding an ADAR fusion protein. Such ADAR-fusion proteins may include the deaminase domain of ADAR1 or ADAR2 enzymes fused to another protein, e.g., to the MS2 bacteriophage coat protein. An ADAR-recruiting domain may be a nucleotide sequence based on a natural substrate (e.g., the GluR2 receptor pre-mRNA; such as a GluR2 ADAR-recruiting domain), a Z-DNA structure, or a domain known to recruit another protein which is part of an ADAR fusion protein, e.g., an MS2 ADAR-recruiting domain known to be recognized by the dsRNA binding regions of ADAR. A stem-loop structure of an ADAR-recruiting domain can be an intermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand.
[0068] In various cases, the oligonucleotide described herein comprises an ADAR-recruiting portion and a targeting portion that is complementary to a target RNA having a target adenosine, where "position 0” of the oligonucleotide of the present disclosure is the nucleotide directly opposite the target adenosine, and the "centralKB-049-WO Docket No. 33791 / 41049triplet” of the oligonucleotide is position -1, position 0, and position +1 of the oligonucleotide (i.e., at X1, X2and X3of the oligonucleotide). In some cases, the internucleotide linkage between position -1 and 0 and between position 0 and +1 are not a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position +1 and +2 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position +4 and +5 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position +5 and +6 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position +9 and +10 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -31 and -30 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -27 and -26 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -25 and -24 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -23 and -22 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -19 and -18 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -13 and -12 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -11 and -10 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -10 and -9 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position -9 and -8 is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide between position -x and -(x-1) and between position -(x-1) and -(x-2) are each a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17), where x is the terminal position at the 5' end of the oligonucleotide. In some cases, the internucleotide linkage between position +(y-1) and +y is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17), where +y is the terminal position at the 3' end of the oligonucleotide. In some cases, the internucleotide linkage between position +(y-2) and +(y-1) is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17). In some cases, the internucleotide linkage between position +(y-3) and +(y-2) is a phosphoramidate (e.g., a moiety of Formula (IV), such as any of L1-L17).
[0069] The term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C, or 70 °C, for 12-16 hours followed by washing (see, e.g., " Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions,KB-049-WO Docket No. 33791 / 41049such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
[0070] " Complementary” sequences can also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and alternative nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G: U Wobble or Hoogstein base pairing. Complementary sequences between an oligonucleotide and a target sequence as described herein, include base-pairing of the oligonucleotide or polynucleotide including a first nucleotide sequence to an oligonucleotide or polynucleotide including a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally no more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., deamination of an adenosine. " Substantially complementary” can also refer to an oligonucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA having a target adenosine). For example, an oligonucleotide is complementary to at least a part of the mRNA of interest if the sequence is substantially complementary to a non-interrupted portion of the mRNA of interest.
[0071] The term "region of complementarity" refers to the region on the oligonucleotide that is substantially complementary to all or a portion of a gene, primary transcript, a sequence (e.g., a target sequence; e.g., a target sequence having a target nucleobase, e.g., adenosine), or processed mRNA, so as to interfere with expression of the endogenous gene. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5'- and / or 3'-terminus of the oligonucleotide.
[0072] The phrase "contacting a cell with an oligonucleotide," such as an oligonucleotide as described herein, includes contacting a cell by any possible means. Contacting a cell with an oligonucleotide includes contacting a cell in vitro with the oligonucleotide or contacting a cell in vivo with the oligonucleotide. The contacting may be done directly or indirectly. Thus, for example, the oligonucleotide may be put into physical contact with the cell by the individual performing the method, or alternatively, the oligonucleotide agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
[0073] Contacting a cell in vitro may be done, for example, by incubating the cell with the oligonucleotide. Contacting a cell in vivo may be done, for example, by injecting the oligonucleotide into or near the tissue where the cell is located, or by injecting the oligonucleotide agent into another area, e.g., the bloodstream or theKB-049-WO Docket No. 33791 / 41049subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the oligonucleotide may contain and / or be coupled to a ligand, e.g., GalNAc3, that directs the oligonucleotide to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an oligonucleotide and subsequently transplanted into a subject.
[0074] In one embodiment, contacting a cell with an oligonucleotide includes "introducing" or "delivering the oligonucleotide into the cell" by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an oligonucleotide can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an oligonucleotide into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, oligonucleotide s can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art.
[0075] The terms "lipid nanoparticle" or " LNP" is a vesicle including a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an oligonucleotide. LNP refers to a stable nucleic acid-lipid particle. LNPs typically contain a cationic, ionizable lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are described in, for example, U. S. Pat. Nos. 6,858,225; 6,815,432; 8,158,601; and 8,058,069, the entire contents of which are hereby incorporated herein by reference.
[0076] The term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multil amellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the oligonucleotide composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the oligonucleotide composition, although in some examples, it may. Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes including one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
[0077] " Micelles" are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.
[0078] The terms "effective amount,” "therapeutically effective amount,” and "a "sufficient amount” of an agent that results in a therapeutic effect (e.g., in a cell or a subject) described herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an "effective amount” or synonym thereto depends on the context in which it is being applied. For example, in the context of treating a disorder, it is an amount of the agent that is sufficient to achieve a treatmentKB-049-WO Docket No. 33791 / 41049response as compared to the response obtained without administration. The amount of a given agent will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and / or weight) or host being treated, and the like, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount” of an agent is an amount that results in a beneficial or desired result in a subject as compared to a control. As defined herein, a therapeutically effective amount of an agent may be readily determined by one of ordinary skill by routine methods known in the art. Dosage regimen may be adjusted to provide the optimum therapeutic response.
[0079] A "therapeutically-effective amount” includes an amount (either administered in a single or in multiple doses) of an oligonucleotide that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. Oligonucleotides employed in the methods as disclosed herein may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment.
[0080] By "determining the level of a protein” is meant the detection of a protein, or an mRNA encoding the protein, by methods known in the art either directly or indirectly. " Directly determining” means performing a process (e.g., performing an assay or test on a sample or "analyzing a sample” as that term is defined herein) to obtain the physical entity or value. " Indirectly determining” refers to receiving the physical entity or value from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Methods to measure protein level generally include, but are not limited to, western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, liquid chromatography (LC)-mass spectrometry, microcytometry, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry, as well as assays based on a property of a protein including, but not limited to, enzymatic activity or interaction with other protein partners. Methods to measure mRNA levels are known in the art.
[0081] " Percent (%) sequence identity” with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleotides or amino acids in a candidate sequence that are identical to the nucleotides or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given sequence, A, to, with, or against aKB-049-WO Docket No. 33791 / 41049given sequence, B, (which can alternatively be phrased as a given sequence, A that has a certain percent sequence identity to, with, or against a given sequence, B) is calculated as follows:100 multiplied by (the fraction X / Y)where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program's alignment of A and B, and where Y is the total number of nucleotides or amino acids in B. It will be appreciated that where the length of sequence A is not equal to the length of sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.
[0082] By "level” is meant a level or activity of a protein, or mRNA encoding the protein, as compared to a reference. The reference can be any useful reference. By a "decreased level” or an "increased level” of a protein is meant a decrease or increase in protein level, as compared to a reference (e.g., a decrease or an increase by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500%, or more; a decrease or an increase of more than about 10%, about 15%, about 20%, about 50%, about 75%, about 100%, or about 200%, as compared to a reference; a decrease or an increase by less than about 0.01 -fold, about 0.02-fold, about 0.1-fold, about 0.3-fold, about 0.5-fold, about 0.8-fold, or less; or an increase by more than about 1.2-fold, about 1.4-fold, about 1.5-fold, about 1.8-fold, about 2.0-fold, about 3.0-fold, about 3.5-fold, about 4.5-fold, about 5.0-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 1000-fold, or more). A level of a protein may be expressed in mass / vol (e.g., g / dL, mg / mL, pg / mL, ng / mL) or percentage relative to total protein or mRNA in a sample.
[0083] The term "pharmaceutical composition,” represents a composition containing an oligonucleotide formulated with a pharmaceutically acceptable excipient, and preferably manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal. Pharmaceutical compositions can be formulated, for example, for oral administration in unit dosage form (e.g., a tablet, capsule, caplet, gelcap, or syrup); for topical administration (e.g., as a cream, gel, lotion, or ointment); for intravenous administration (e.g., as a sterile solution free of particulate emboli and in a solvent system suitable for intravenous use); for intrathecal injection; for intracerebroventricular injections; for intraparenchymal injection; or in any other pharmaceutically acceptable formulation.
[0084] A "pharmaceutically acceptable excipient,” refers any ingredient other than the oligonucleotides described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calciumKB-049-WO Docket No. 33791 / 41049carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.
[0085] The term "pharmaceutically acceptable salt” means any pharmaceutically acceptable salt of an oligonucleotide as described herein. For example, pharmaceutically acceptable salts include those that are within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in: Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977 and in Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P. H. Stahl and C. G. Wermuth), Wiley-VCH, 2008. The salts can be prepared in situ during the final isolation and purification of the compounds described herein or separately by reacting a free base group with a suitable organic acid.
[0086] Pharmaceutically acceptable salts may be acid addition salts involving inorganic or organic acids or the salts maybe prepared from inorganic or organic bases. Frequently, pharmaceutically acceptable salts are prepared as addition products of pharmaceutically acceptable acids or bases. Suitable pharmaceutically acceptable acids and bases and methods for preparation of the appropriate salts are well-known in the art. Salts may be prepared from pharmaceutically acceptable non-toxic acids and bases including inorganic and organic acids and bases. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine.
[0087] By a "reference” is meant any useful reference used to compare protein or mRNA levels or activity. The reference can be any sample, standard, standard curve, or level that is used for comparison purposes. The reference can be a normal reference sample or a reference standard or level. A "reference sample” can be, for example, a control, e.g., a predetermined negative control value such as a "normal control” or a prior sample taken from the same subject; a sample from a normal healthy subject, such as a normal cell or normal tissue; aKB-049-WO Docket No. 33791 / 41049sample (e.g., a cell or tissue) from a subject not having a disease; a sample from a subject that is diagnosed with a disease, but not yet treated with a compound described herein; a sample from a subject that has been treated by a compound described herein; or a sample of a purified protein (e.g., any described herein) at a known normal concentration. By "reference standard or level” is meant a value or number derived from a reference sample. A "normal control value” is a pre-determined value indicative of non-disease state, e.g., a value expected in a healthy control subject. Typically, a normal control value is expressed as a range ("between X and Y”), a high threshold ("no higher than X”), or a low threshold ("no lower than X”). A subject having a measured value within the normal control value for a particular biomarker is typically referred to as "within normal limits” for that biomarker. A normal reference standard or level can be a value or number derived from a normal subject not having a disease or disorder; a subject that has been treated with a compound described herein. In preferred embodiments, the reference sample, standard, or level is matched to the sample subject sample by at least one of the following criteria: age, weight, sex, disease stage, and overall health. A standard curve of levels of a purified protein, e.g., any described herein, within the normal reference range can also be used as a reference.
[0088] The term "subject” refers to any organism to which oligonucleotides or compositions described herein may be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject may seek or be in need of treatment, require treatment, be receiving treatment, be receiving treatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.
[0089] The terms "treat," "treated," or "treating" mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
[0090] The terms "variant” and "derivative” are used interchangeably and refer to naturally-occurring, synthetic, and semi-synthetic analogues of a compound, peptide, protein, or other substance described herein. A variant or derivative of a compound, peptide, protein, or other substance described herein may retain or improve upon the biological activity of the original material.KB-049-WO Docket No. 33791 / 41049DETAILED DESCRIPTION
[0091] Provided herein are oligonucleotides that can be used to modify a nucleobase on a target RNA.Accordingly, the disclosure provides oligonucleotides, compositions containing the same, and methods to modify a target nucleobase (e.g., deaminate a target adenosine) on RNA, where the modification produces a therapeutic result, e.g., in a subject in need thereof. In some embodiments, the target RNA is a mRNA.
[0092] Oligonucleotides
[0093] The oligonucleotides described herein are complementary to target RNA and are capable of recruiting ADAR enzymes used to edit a target nucleobase on the target RNA, e.g., to deaminate a target adenosine on the target RNA. In some embodiments, only one nucleobase (e.g., one adenosine) is edited (e.g., deaminated). In some embodiments, 1, 2, or 3 nucleobases are edited. In some embodiments, the oligonucleotide includes at least one mismatch, wobble, insertion or deletion. In some cases, the oligonucleotide includes a mismatch opposite the target nucleobase, e.g., at X2(see structure below). The oligonucleotides described herein may further include modifications (e.g., alternative nucleotides) to increase stability and / or increase deamination efficiency. In some embodiments, the oligonucleotides described herein comprises 1, 2, 3, 4, or 5 mismatches or wobbles or insertions or deletions (or any combination thereof).
[0094] In some embodiments, one or more of the nucleobases of an oligonucleotide described herein is chemically modified to enhance stability or other beneficial characteristics. Without being bound by theory, it is believed that certain modification can increase nuclease resistance and / or serum stability or decrease immunogenicity. For example, oligonucleotides described herein may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides that have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or internucleotide linkage).
[0095] The oligonucleotides described herein comprise the structure:[Am]-X1-X2-X3-[Bn]whereinm+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises an ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage; andKB-049-WO Docket No. 33791 / 41049(1) the X1sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl (“nr”), Dh 2'-(R)-di methyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”). MCE-morpholino (" MK4”), 2’-O-acetamide ("na”), MCP (" M3”), Arabinose-OME, 2'5' 3' OME or 2’-Amino ("2-NH2”); and / or(2) the X1nucleobase is selected from 5m-C, 5h-C, 5mh-C, 5ca-C, f5-C, 5br-C, 5I-C, fpy-C, N3m-C, N4e-C, 5a-56dh-C, 5f-U, 5hm-U, 5py-U, 4t-U, 2t-T, 4t-T, 6a-U, 6a-T, 5ey-U, I P-U, N1m-PU, Iso-C, Z, 5m-Zeb, W, P-lsoC, 8o-A, 7da-A, 7da-8a-A, IsoA, 8-oxo-a, IsoU, 8am-A, 8-br-A, 7da-G, I, 8o-G, N1m-G, Iso-G, 2f-l, X, N, 8a-N, N4-oxy-cyclic-der-C, Py-m-C, and G-clamp.
[0096] The A / B sugars and the X3sugar of the oligonucleotides disclosed herein can be any sugar known or disclosed herein. In some cases, the A / B sugars and the X3sugar are each individually 2'-methoxy riboseO OMe, a 2'-deoxy-2' -fluororibose (sometimes referred to as 2'-fluororibose), or a locked nucleic acid (LNA).
[0097] The X2sugar of the oligonucleotides disclosed herein can be any sugar known or disclosed herein. Insome cases, the X2sugar is 2'-methoxy ribosea 2'-deoxy-2'-fluororiboseKB-049-WO Docket No. 33791 / 41049homoDNA sugar (a structure of Formula II C), or a locked nucleic acid (LNA).
[0098] In various embodiments, the X1sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl (“nr”), Dh 2'-(R)-dimethyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (" MK4”), 2’-O-acetamide ("na”), or MCP (" M3”), Arabinose-OME, 2'5' 3' OME, or 2'-Amino (“2-NH2”). In some embodiments, the X1sugar is a CeNA, a HNA, or a 2'MCE. In some embodiments, the X1sugar is a CeNa. In some embodiments, the X1sugar
[0099] In some embodiments, the X1sugar is a HNA. In some embodiments, the X1sugar is, and N is the X1nucleobase.
[0100] In some embodiments, the X1sugar is a 2'MCE. In some embodiments, the X1sugar isand N is the X1nucleobase.
[0101] In some embodiments, the X1sugar is 2'-0 (N-Me Propionamide) having the structure:KB-049-WO Docket No. 33791 / 41049and nucleobase is the X1nucleobase,
[0102] In some embodiments, the X1sugar is 2'-aminopropyl ("nr”) having the structure:to 5‘ endto nodeobsseO Mbto 3' end2’-ainmopropyl ribosenrand nucleobase is the X1nucleobase.
[0103] In some embodiments, the X1sugar is Dh 2'-(R)-dimethyl NMA ("rDhNdMA”) having the following structure:and nucleobase is the X1nucleobase.KB-049-WO Docket No. 33791 / 41049
[0104] In some embodiments, the X1sugar is Dh 2'-(R)-NMA ("rDhNMA”) having the following structure:and nucleobase is the X1nucleobase.
[0105] In some embodiments, the X1sugar is Dh 2'-(R)-Nme propionamide ("rDhNMP”) having the following structure:and nucleobase is the X1nucleobase.
[0106] In some embodiments, the X1sugar is 2-O-NMA (“NMA”) having the following structure:><:■ 5 ' Kand nucleobase is the X1nucleobase.KB-049-WO Docket No. 33791 / 41049
[0107] In some embodiments, the X1sugar is 2’-(R)-F-deoxyhexose (“Fr2”) having the following structure:to § s sdJite T and nucleobase is the X1nucleobase.
[0108] In some embodiments, the X1sugar is 3'-6’-Deoxyhexose )”36d”) having the following structure:5><-yand nucleobase is the X1nucleobase.
[0109] In some embodiments, the X1sugar is Dh-2’-(R)-OMe ("rDHOMe”) having the following structure:and nucleobase is the X1nucleobase.KB-049-WO Docket No. 33791 / 41049
[0110] In some embodiments, the X1sugar is MCE-morpholino (“MK-4”) having the following structure:and nucleobase is the X1nucleobase
[0111] In some embodiments, the X1sugar is MCP (“MK-3”) having the following structure:and nucleobase is the X1nucleobase.KB-049-WO Docket No. 33791 / 41049
[0112] In some embodiments, the X1sugar is 2’-O-acetamide (“na”) having the following structure:2’-O-acetamidesymbol naand nucleobase is the X1nucleobase.
[0113] In some embodiments, the X1sugar is arabinose having the following structure:9if As'atasese?3,,and nucleobase is the X1nucleobase.KB-049-WO Docket No. 33791 / 41049
[0114] In some embodiments, the X1sugar is 2’ -5’ ribose OME having the following structure:to end2'5' linked ribose3 QMe ribose (5 ’»2?- linked)m3and nucleobase is the X1nucleobase.
[0115] In some embodiments, the X1sugar is 2'-amino having the following structure:to 5'(122'-amino- and nucleobase is the X1nucleobase.
[0116] In some embodiments, the X1nucleobase is a naturally occurring nucleobase. In some embodiments, the X1nucleobase is selected from e4C, OH5U, m1PU, br5C, dW, mZb, ca5c, m3c, pU, prC, s2T, i5C, hm5U, m3C, n6U, m5c, Py, Oh5C, pdC, 5m-C, 5h-C, 5mh-C, 5ca-C, f5-C, 5br-C, 5I-C, fpy-C, N3m-C, N4e-C, 5a-56dh-C, 5f-U, 5hm-U, 5py-U, 4t-U, 2t-T, 4t-T, 6a-U, 6a-T, 5ey-U, I P-U, N1m-PU, Iso-C, Z, 5m-Zeb, W, P-lsoC, 8o-A, 7da-A, 7da-8a-A, IsoA, 8-oxo-a, IsoU, 8am-A, 8-br-A, 7da-G, I, 8o-G, N1m-G, Iso-G, 2f-l, X, N, 8a-N, N4-oxy-cyclic-der-C, Py-m-C, and G-clamp. In some embodiments, the X1nucleobase is N1m-PU, 5br-C, 5m-Zeb, 5ca-C, or P-U.KB-049-WO Docket No. 33791 / 41049
[0117] In some embodiments, the X1nucleobase is N4-ethylcytosine (“e4C”) having the following structure:
[0118] In some embodiments, the X1nucleobase is 5-Hydroxy-Uracil (" OF5U”) having the following structure:O
[0119] In some embodiments, the X1nucleobase is N1-methyl-pseudo-U (“m1pll”) having the followingstructure:KB-049-WO Docket No. 33791 / 41049
[0120] In some embodiments, the X1nucleobase is 5-Bromocytosine ("br5C”) having the following structure:
[0121] In some embodiments, the X1nucleobase is Xanthine (" X”) having the following structure:
[0122] In some embodiments, the X1nucleobase is 5-methyl-6-ethynyl PseudoU (“dW”) having the following
[0123] In some embodiments, the X1nucleobase is 5-methyl-Zubularine (“mZb”) having the followingstructure:KB-049-WO Docket No. 33791 / 41049
[0124] In some embodiments, the X1nucleobase is Cytosine-5-Carboxylic Acid ("ca5C”) having the followingfo -sugarstructure:
[0125] In some embodiments, the X1nucleobase is N3-Methylcytosine (“m3C”) having the following structure:NHto sugar
[0126] In some embodiments, the X1nucleobase is Pseudouracil (“pll”) having the following structure:0to sugar
[0127] In some embodiments, the X1nucleobase is Isouracil (“isoll”) having the following structure:HNG OtoKB-049-WO Docket No. 33791 / 41049
[0128] In some embodiments, the X1nucleobase is 6-methylpyrrolo C (“prC”) having the following structure:to sugar
[0129] In some embodiments, the X1nucleobase is 2-Thiothymine (“s2T”) having the following structure:
[0130] In some embodiments, the X1nucleobase is 5-lodocytosine (“i5C”) having the following structure:to stsgarKB-049-WO Docket No. 33791 / 41049
[0131] In some embodiments, the X1nucleobase is 5-(Hydroxymethyl)cytosine ("hm5U”) having the followingstructure:
[0132] In some embodiments, the X1nucleobase is 6-aza-U (“n6U”) having the following structure:
[0133] In some embodiments, the X1nucleobase is 5-Methylcytosine (“m5C”) having the following structure:to sugarKB-049-WO Docket No. 33791 / 41049
[0134] In some embodiments, the X1nucleobase is DegenP (“Py”) having the following structure:to sugar
[0135] In some embodiments, the X1nucleobase is 8-Oxo-Adenine (“08A”) having the following structure:
[0136] In some embodiments, the X1nucleobase is 5-hydroxycystonine ("oh5C”) having the followingto sugarstructure:KB-049-WO Docket No. 33791 / 41049
[0137] In some embodiments, the X1nucleobase is 4-Amino-5-propynyl-pyrimidinone (“pdC”) having theto sugarfollowing structure:
[0138] In some embodiments, the disclosure provides an oligonucleotide comprising the structure:[Am]-X1-X2-X3-[Bn]whereinm+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises an ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage; and(1) the X2sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl (“nr”), Dh 2'-(R)-di methyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (" MK4”), 2’-O-acetamide ("na”), MCP (" M3”), Arabinose-OME, 2'5' 3' OME, or 2'-Amino (“2-NH2”). In some embodiments, the X2sugar is CeNA. In some embodiments, the X2sugar is HNA. In some embodiments, the X2sugar is 2'MCE. In some embodiments, the X2sugar is Dh. In some embodiments, the X2sugar is dp. In some embodiments, the X2sugar is nr. In some embodiments, the X2sugar is rDhNdMA. In some embodiments, the X2sugar is rDhNMA. In some embodiments, the X2sugar is rDhNMP. In some embodiments, the X2sugar is MK4. In some embodiments, the X2sugar is na. In some embodiments, the X2sugar is M3.
[0139] In some embodiments, the disclosure provides an oligonucleotide comprising the structure:[Am]-X1-X2-X3-[Bn]whereinKB-049-WO Docket No. 33791 / 41049m+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises an ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage; and(1) the X3sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl (“nr”), Dh 2'-(R)-di methyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (" MK4”), 2’-O-acetamide ("na”), or MCP (" M3”) Arabinose-OME, 2'5' 3' OME, or 2'-Amino (“2-NH2”). In some embodiments, the X3sugar is CeNA. In some embodiments, the X3sugar is HNA. In some embodiments, the X3sugar is 2'MCE. In some embodiments, the X3sugar is Dh. In some embodiments, the X3sugar is dp. In some embodiments, the X3sugar is nr. In some embodiments, the X3sugar is rDhNdMA. In some embodiments, the X3sugar is rDhNMA. In some embodiments, the X3sugar is rDhNMP. In some embodiments, the X3sugar is MK4. In some embodiments, the X3sugar is na. In some embodiments, the X3sugar is M3.
[0140] In some embodiments, 10-70% (e.g., 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62% 63% 64%, 65%, 66%, 67%, 68%, 69%, or 70%) of the A / B sugars and the X sugars, collectively, are 2'-deoxy-2'-fluororibose. In some embodiments, 20-50% (e.g., 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%) of the A / B sugars and the X sugars, collectively, are 2'-deoxy-2'-fluororibose.
[0141] In some embodiments, no more than four sequential A / B sugars are 2'-deoxy-2'-fluororibose. In some embodiments, the A / B sugars are selected from 2'-methoxy-ribose, 2'-MOE-ribose, 2'-deoxy-2'-fluororibose, and 2'deoxyribose.
[0142] In some embodiments, the A / B sugar at position +3 is a 2'-deoxy-2' -fluororibose. In some embodiments, the A / B sugar at position -5 is a 2'-deoxy-2'-fluororibose. In some embodiments, the A / B sugar at position -16 is a 2'-deoxy-2'-fluororibose. In some embodiments, the A / B sugar at position -20 is a 2'-deoxy-2'-fluororibose. In some embodiments, the A / B sugar at each of positions -5, -16, and -20 is a 2'-deoxy-2'-fluororibose. In some embodiments, the A / B sugar at each of positions +3, -5, -16, and -20 is a 2'-deoxy-2'-fluororibose.KB-049-WO Docket No. 33791 / 41049
[0143] In some embodiments, the X2nucleobase is a naturally occurring nucleobase. In some embodiments, the X2nucleobase is a cytosine, 8-oxoA, or IsoU. In some embodiments, the X2sugar is a beta-homo-DNA-sugar or a 2’-deoxyribose. In some embodiments, the X2sugar is a beta-homo-DNA-sugar, and the beta-homo-DNA sugar is optionally substituted (e.g. the structure of Formula IIC where R8Cand / or R9Cis not H). In some embodiments, the X2sugar is a 2’-deoxyribose.
[0144] In some embodiments, the X3nucleobase is a naturally occurring nucleobase. In some embodiments, the X3nucleobase is guanosine, hypoxanthine, or 7-deazaguinine.
[0145] In some embodiments, the X3sugar is selected from a 2’-(R)-F-deoxyhexose (“Fr2”), 3’-6’-Deoxyhexose (“36d), Dh-2’-(R)-OMe ("rDhOMe”), CeNA (“cena”), Hexitol Nucleic Acid (“HNA”), 2'-0 (N-Me Propionamide) ("dp”), 2'-methoxy-ribose, 2'-MOE-ribose, 2'-fluororibose, 2'-fluoro-arabinose, 2'-OH-arabinose, 2-methoxy-arabinose, 2'deoxyribose, and a locked nucleic acid (LNA).
[0146] In some embodiments, the internucleotide linkage is a phosphoroamidate, phosphorothioate, phosphorodithioate, methylphosphonate, thiophosphate, 3' -thiophosphate, or 5' -thiophosphate.0R-N=P-OHiCk /
[0147] Phosphoramidate linkages (e.g.,, where R is a suitable substituent on the nitrogen,Me- S-N=P-OHII iembodiments, the phosphoramidite linkage is a mesyl phosphoramidate. In some embodiments, each phosphoroamidate linkage in the oligonucleotide is a mesyl phosphoramidate. In some cases, the phosphoramidate is a PAX linkage as disclosed in Table 1, above.
[0148] In some embodiments, the oligonucleotide comprises at least one phosphoramidate linkage having astructure of O O', R1is isopropyl, isobutyl, sec-butyl, C1-6 haloalkyl, C2-6 hydroxyalkyl, C2-8 alkylene-N(RN)2, Co-2alkylene-C3-8 cycloalkyl, 4-10 membered heterocycloalkyl having 1-3 ring heteroatoms selected from 0, N, and S, or 5-10-membered heteroaryl having 1-3 ring heteroatoms selected from O, N, and S, with the proviso that the heterocycloalkyl or heteroaryl is attached to the sulfur via a carbon ring atom, and the cycloalkyl, heterocycloalkyl, or heteroaryl is substituted with 0, 1, 2, or 3 R2groups; each R2is independently halo, CN, N(RN)2, Ci-salkyl, Ci-shaloalkyl, Ci-salkoxy, oxo, CO2RN, or C(O)Ci-3alkyl; and each RNis independently H or Ci-salkyl.KB-049-WO Docket No. 33791 / 41049
[0149] In some embodiments, the internucleotide linkages of the oligonucleotides described herein comprise at least 30% (e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) phosphoramidate and / or phosphorothioate linkages. In some embodiments, the oligonucleotides described herein have 30-70% (e.g., 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%) phosphorothioate and phosphoroamidate linkages. In some embodiments, the oligonucleotides described herein have 40-60% (e.g., 40%, 45%, 50%, 55%, 60%) phosphorothioate and phosphoroamidate linkages.
[0150] In some embodiments, the phosphorothioate linkages are Sp phosphorothioate linkages. In other embodiments, the phosphorothioate linkages are Rp phosphorothioate linkages. In some cases, the phosphorothioate linkages are a mixture of Sp and Rp.
[0151] In some embodiments, at least 3 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) of the internucleotide linkages of the oligonucleotides described herein are phosphoramidate linkages. In some embodiments, no more than 7 (e.g., 1, 2, 3, 4, 5, 6, or 7) of the internucleotide linkages of the oligonucleotides described herein are phosphoramidate linkages.
[0152] In some embodiments, the internucleotide linkage (i) between the nucleotide at position -(m+1) and the nucleotide at position -(m) (the 5'end), (ii) between the nucleotide at position +(n) and the nucleotide at position +(n+1) (the 3'-end), or (iii) at each the 5'-end and 3'-end of the oligonucleotide is a phosphoramidate linkage.
[0153] In some embodiments, the internucleotide linkage between the nucleotide at position -(m) and the nucleotide at position -(m-1) and the internucleotide linkage between the nucleotide at position +(n-1) and the nucleotide at position +(n) are independently a phosphorothioate or a phosphoramidate linkage.
[0154] In some embodiments, the internucleotide linkage between X1and X2is a phosphorothioate or a phosphodiester linkage. In some embodiments, the internucleotide linkage between X1and X2is a phosphorothioate linkage.
[0155] In some embodiments, the internucleotide linkage between X2and X3is a phosphorothioate or a phosphodiester linkage. In some embodiments, the internucleotide linkage between X2and X3is a phosphorothioate linkage.
[0156] In some embodiments, the internucleotide linkage between the nucleoside at position -2 and X1is a phosphorothioate or a phosphodiester linkage. In some embodiments, the internucleotide linkage between the nucleoside at position -2 and X1is a phosphorothioate linkage.
[0157] In some embodiments, the internucleotide linkage between the nucleotide at position -9 and the nucleotide at position -8 is a phosphoramidate linkage.
[0158] In some embodiments, the internucleotide linkage between the nucleotide at position -11 and the nucleotide at position -10 is a phosphoramidate linkage.
[0159] In some embodiments, the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2 is a phosphoramidate linkage.KB-049-WO Docket No. 33791 / 41049
[0160] In some embodiments, the internucleotide linkage between the nucleotide at position +4 and the nucleotide at position +5 is a phosphoramidate linkage. In some embodiments, the internucleotide linkage between the nucleotide at position +5 and the nucleotide at position +6 is a phosphoramidate linkage. In some embodiments, the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 is a phosphoramidate linkage. In some embodiments, the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2 and the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 are a phosphoramidate linkage. In some embodiments, the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2, the internucleotide linkage between the nucleotide at position +5 and the nucleotide at position +6, and the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 are a phosphoramidate linkage.
[0161] For the oligonucleotides disclosed herein, n and m (collectively) is an integer ranging from 24 to 100, and in some cases 24 to 50. In some embodiments, n and m (collectively) is an integer ranging from 24-40 (e.g., 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40). In some embodiments, n and m (collectively) is 27. In some embodiments, n and m (collectively) is 39.
[0162] In some embodiments, m is at least 20 (e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29. 30, 31, 32, 33, 34 or 35). In some embodiments, n is at least 4 (e.g., 4, 5, 6, 7, 8, 9 or 10). In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10.
[0163] In some embodiments, the oligonucleotides described herein have a GalNAc moiety at the 5' end. In some embodiments, the oligonucleotides described herein have a GalNAc moiety at the 3' end.
[0164] Exemplary oligonucleotides described herein are shown in Table 2, below (in Hierarchical Editing Language for Macromolecules (HELM) syntax) (Zhang et al., J. Chem. Inf. Model. 2012, 52, 10, 2796-2806, where each nucleotide is noted by terms between periods (.); the first term indicates the sugar moiety, the next is the nucleobase, and last term is the internucleotide linkage. For clarity, the terms can be separated by punctuation, e.g., brackets and parentheses. Thus, a nucleotide designation of “,f(A)P.” means a 2'-deoxy-2'-fluororibose sugar moiety and an adenosine nucleobase that is then linked via a phosphodiester linkage. Sugar moiety designations are "f "for 2’ -fl uorori bose, “m” for 2'-methoxyribose, "fana” for 2'-fluroarabi nose, “d” is deoxyribose, "dH” is beta-homoDNA, "moe”: is 2'-MOEribose, " Fr2” is 2'-(R)-F-deoxyhexose, "36d” is 3' -6'-Deoxyhexose, "rDhOMe” is Dh-2'-(R)-OMe, "cena” is CeNA, " HNA” is hexitol nucleic acid, and "dp” is 2'-0 (N-Me Propionamide). Modified bases are as follows: e4C, OH5U, m1PU, br5C, dW, mZb, ca5c, m3c, pU, prC, s2T, i5C, hm5U, m3C, n6U, m5c, Py, Oh5C, pdC, 5m-C, 5h-C, 5mh-C, 5ca-C, f5-C, 5br-C, 5I-C, fpy-C, N3m-C, N4e-C, 5a-56dh-C, 5f-U, 5hm-U, 5py-U, 4t-U, 2t-T, 4t-T, 6a-U, 6a-T, 5ey-U, I P-U, N1m-PU, Iso-C, Z, 5m-Zeb, W, P-IsoC, 8o-A, 7da-A, 7da-8a-A, IsoA, 8-oxo-a, IsoU, 8am-A, 8-br-A, 7da-G, I, 8o-G, N1m-G, Iso-G, 2f-l, X, N, 8a-N, N4-oxy-cyclic-der-C, Py-m-C, and G-clamp. For linkages, "msPA” indicates a mesyl phosphroamidate internucleotide linkage, "sP” indicates a phosphorothioate linkage; and “P” indicates a phosphate linkage.KB-049-WO Docket No. 33791 / 41049Additional chemical modifications are noted by CHEM 1 {TriGalNAc2}|CHEM2{P}, which indicates a tri-GalNAc conjugated to the 5' end of the oligonucleotide, and CHEM3{P}|CHEM4{TriGal NAc1 }, which indicates a tri-GalNAc conjugated to the 3' end.
[0165] Table 2. Exemplary OligonucleotidesOligo No. HELM Base sequenceA1. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C CAUAAUUUACACAGAAGCAAU )[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 1) GCCIUCACC (SEQ ID NO: 2) A2. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].[rDhOMe](C)[sP].d(l)[msPA].m(U)[s CAUAAUUUACACAGAAGCAAU P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 3) GCCIUCACC (SEQ ID NO: 2) A3. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C)[s CAUAAUUUACACAGAAGCAAU P].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 4) GCCIUCACC (SEQ ID NO: 2) A4. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].d(C)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 5) GCCCUCACC (SEQ ID NO: 6) A5. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].d(G)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 7) GCCGUCACC (SEQ ID NO: 6) A6. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].d(C)[msPA].m(U)[sP].f(C)[ CAUAAUUUACACAGAAGCAAU sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 8) GCCCUCACC (SEQ ID NO: 9) A7. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].d(G)[msPA].m(U)[sP].f(C)[ CAUAAUUUACACAGAAGCAAU sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 10) GCCGUCACC (SEQ ID NO: 6) A8. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. CAUAAUUUACACAGAAGCAAU m(U)[sP].f(G)[sP].[rDhOMe](C)[sP].[Dh](C)[sP].d(l)[msPA].m( GCCIUCACC U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 11) (SEQ ID NO: 2)A9. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].[rDhOMe](C)[msPA].m( CAUAAUUUACACAGAAGCAAU U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 12) GCCCUCACC (SEQ ID NO: 9) A10. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sPj. m(U)[sP].f(G)[sP].[rDhOMe](C)[sP].d(C)[sP].d(l)[msPA].m(U)[s CAUAAUUUACACAGAAGCAAUP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 13) GCCIUCACC (SEQ ID NO: 2)KB-049-WO Docket No. 33791 / 41049A11. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].[rDhOMe](C)[msPA].m(U)[ CAUAAUUUACACAGAAGCAAU sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 14) GCCCUCACC (SEQ ID NO: 9) A12. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[fR2](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP] CAUAAUUUACACAGAAGCAAU.f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 15) GCCIUCACC (SEQ ID NO: 2) A13. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[fR2](C)[sP].d(l)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 16) GCCIUCACC (SEQ ID NO: 2) A14. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].[fR2](C)[msPA].m(U)[s CAUAAUUUACACAGAAGCAAU P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 17) GCCCUCACC (SEQ ID NO: 9) A15. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[fR2](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 18) GCCIUCACC (SEQ ID NO: 2) A16. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].[fR2](C)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 19) GCCCUCACC (SEQ ID NO: 9) A17. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[36D](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP CAUAAUUUACACAGAAGCAAU ].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 20) GCCIUCACC (SEQ ID NO: 2) A18. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[36D](C)[sP].d(l)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 21) GCCIUCACC (SEQ ID NO: 2) A19. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].[36D](C)[msPA].m(U)[s CAUAAUUUACACAGAAGCAAU P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 22) GCCCUCACC (SEQ ID NO: 9) A20. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[36D](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 23) GCCIUCACC (SEQ ID NO: 2) A21. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].[36D](C)[msPA].m(U)[sP].f CAUAAUUUACACAGAAGCAAU (C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 24) GCCCUCACC (SEQ ID NO: 9) A22. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[cena](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s CAUAAUUUACACAGAAGCAAUP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 25) GCCIUCACC (SEQ ID NO: 2)KB-049-WO Docket No. 33791 / 41049A23. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[cena](C)[sP].d(l)[msPA].m(U)[sP].f CAUAAUUUACACAGAAGCAAU (C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 26) GCCIUCACC (SEQ ID NO: 2) A24. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].[cena](C)[msPA].m(U)[s CAUAAUUUACACAGAAGCAAU P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 27) GCCCUCACC (SEQ ID NO: 9) A25. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[cena](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f CAUAAUUUACACAGAAGCAAU (C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 28) GCCIUCACC (SEQ ID NO: 2) A26. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].[cena](C)[msPA].m(U)[sP]. CAUAAUUUACACAGAAGCAAU f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 29) GCCCUCACC (SEQ ID NO: 9) A27. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[dp](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f CAUAAUUUACACAGAAGCAAU (C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 30) GCCIUCACC (SEQ ID NO: 2) A28. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[dp](C)[sP].d(l)[msPA].m(U)[sP].f(C CAUAAUUUACACAGAAGCAAU )[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 31) GCCIUCACC (SEQ ID NO: 2) A29. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].[dp](C)[msPA].m(U)[sP] CAUAAUUUACACAGAAGCAAU.f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 32) GCCCUCACC (SEQ ID NO: 9) A30. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[dp](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C CAUAAUUUACACAGAAGCAAU )[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 33) GCCIUCACC (SEQ ID NO: 2) A31. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].[dp](C)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 34) GCCCUCACC (SEQ ID NO: 9) A32. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[hna](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP] CAUAAUUUACACAGAAGCAAU.f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 35) GCCIUCACC (SEQ ID NO: 2) A33. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[hna](C)[sP].d(l)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 36) GCCIUCACC (SEQ ID NO: 2) A34. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].[hna](C)[msPA].m(U)[s CAUAAUUUACACAGAAGCAAUP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 37) GCCCUCACC (SEQ ID NO: 9)KB-049-WO Docket No. 33791 / 41049A35. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[hna](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f( CAUAAUUUACACAGAAGCAAU C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 38) GCCIUCACC (SEQ ID NO: 2) A36. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].[hna](C)[msPA].m(U)[sP].f CAUAAUUUACACAGAAGCAAU (C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 39) GCCCUCACC (SEQ ID NO: 9) A37. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C)[s CAUAAUUUACACAGAAGCAAU P].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 40) GCUGUCACC (SEQ ID NO: 41) A38. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[rDhNMA](C)[sP].d(C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 42)A39. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[rDhNMP](C)[sP].d(C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 43)A40. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[NMA]([m5C])[sP].d(C)[sP].d(l)[msPA].m(U)[ sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 44)A41. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C )[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 45)A42. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[Dh](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C )[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 46)A43. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[cena](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f (C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 47)A44. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[hna](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f( C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 48)A45. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[dp](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C )[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 49)A46. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP].m(U)[sP].f(G)[sP].[nr](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 50)KB-049-WO Docket No. 33791 / 41049A47. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[rDhNdMA](C)[sP].d(C)[sP].d(l)[msPA].m(U)[ sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 51)A48. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[Dh](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP]. f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 52)A49. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[cena](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 53)A50. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[hna](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 54)A51. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[dp](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f (C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 55)A52. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. - Left off here at SEQ 56 m(U)[sP].f(G)[sP].[nr](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f (C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 56)A53. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[rDhNdMA](C)[sP].[Dh](C)[sP].d(l)[msPA].m( U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 57)A54. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[rDhNMA](C)[sP].[Dh](C)[sP].d(l)[msPA].m( U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 58)A55. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[rDhNMP](C)[sP].[Dh](C)[sP].d(l)[msPA].m( U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 59)A56. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCUGUCACC (SEQ ID NO: 41) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[NMA]([m5C])[sP].[Dh](C)[sP].d(l)[msPA].m( U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 60)A57. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([e4C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 61)A58. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP].m(U)[sP].f(G)[sP].d([OH5U])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)}| (SEQ ID NO: 63)KB-049-WO Docket No. 33791 / 41049A59. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([m1pU])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)}| (SEQ ID NO: 64)A60. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([br5C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 65)A61. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(X)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C )[sP].m(A)[sP].m(C)[msPA].m(C)}| (SEQ ID NO: 66)A62. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([dW])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP]. f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 67)A63. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([mZb])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP ].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)}| (SEQ ID NO: 68)A64. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([ca5C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 69)A65. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].d([m3C])[sP].d(l)[msPA].m(U)[sP].f( C)[sP].m(A)[sP].m(C)[msPA].m(C)}| (SEQ ID NO: 70)A66. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([pU])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f (C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 71)A67. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[Dh]([isoU])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[ sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 72)A68. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([prC])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 73)A69. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([s2T])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 74)A70. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP].m(U)[sP].f(G)[sP].d([i5C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 75)KB-049-WO Docket No. 33791 / 41049A71. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([hm5U])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA] (SEQ ID NO: 76)A72. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([m3C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP ].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 77)A73. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([n6U])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 78)A74. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([m5C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP ].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 79)A75. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([Py])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f (C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 80)A76. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 61) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[Dh]([o8A])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[ sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 81)A77. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([oh5C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 82)A78. m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U)[ CAUAAUUUACACAGAAGCAAU sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 62) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d([pdC])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 83)A79. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U) CAUAAUUUACACAGAAGCAAU [sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 85) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].d(C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C )[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 84)A80. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U) CAUAAUUUACACAGAAGCAAU [sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 85) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[M3](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP]. f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 86)A81. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U) CAUAAUUUACACAGAAGCAAU [sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 85) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP]. m(U)[sP].f(G)[sP].[MK4](C)[sP].[Dh](C)[sP].d(l)[msPA].m(U)[s P].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 87)A82. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U) CAUAAUUUACACAGAAGCAAU [sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 85) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP].m(U)[sP].f(G)[sP].[na]([m5C])[sP].[Dh](C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C) (SEQ ID NO: 88)KB-049-WO Docket No. 33791 / 41049A83. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U) CAUAAUUUACACAGAAGCAAU [sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 85) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP], m(U)[sP].f(G)[sP].[M3](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 89)A84. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U) CAUAAUUUACACAGAAGCAAU [sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 85) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP], m(U)[sP].f(G)[sP].[MK4](C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 90)A85. {m(C)[msPA].f(A)[sP].m(U)[sP].f(A)[sP].f(A)[sP].m(U)[sP].m(U) CAUAAUUUACACAGAAGCAAU [sP].m(U)[sP].f(A)[sP].m(C)[sP].f(A)[msPA].m(C)[sP].f(A)[sP].f( GCCIUCACC (SEQ ID NO: 85) G)[msPA].f(A)[sP].f(A)[sP].f(G)[sP].m(C)[sP].f(A)[sP].f(A)[sP], m(U)[sP].f(G)[sP].d(C)[sP].d(C)[sP].d(l)[msPA].m(U)[sP].f(C)[sP].m(A)[sP].m(C)[msPA].m(C)} (SEQ ID NO: 91)A86. CHEM1{GD}|CHEM2{P}|RNA1{[moe]([m5C])[msPA].[moe]([m CCCAGCAGCUUCAGUCCCUUT 5C])[sP].[moe]([m5C])[msPA].f(A)[sP].f(G)[sP].m(C)P.m(A)P.f( CTCIUCGAU (SEQ ID NO: 93) G)[msPA].f(C)[sP].m(U)P.m(U)P.m(C)P.m(A)P.m(G)P.f(U)[ms PA].[moe]([m5C])P.f(C)[sP].[moe]([m5C])P.f(U)[sP].m(U)P.[mo e](T)P.f(C)[sP].d(T)[sP].d(C)[sP].d(l)[msPA].m(U)P.f(C)[sP].m(G)[sP].f(A)[msPA].m(U)} (SEQ ID NO: 92)A87. CHEM1{GD}|CHEM2{P}|RNA1{[moe]([m5C])[msPA].[moe]([m CCCAGCAGCUUCAGUCCCUUT 5C])[sP].[moe]([m5C])[msPA].f(A)[sP].f(G)[sP].m(C)P.m(A)P.f( CTCIUCGAU (SEQ ID NO: 93) G)[msPA].f(C)[sP].m(U)P.m(U)P.m(C)P.m(A)P.m(G)P.f(U)[ms PA].[moe]([m5C])P.f(C)[sP].[moe]([m5C])P.f(U)[sP].m(U)P.[moe](T)P.f(C)[sP].d(T)[sP].[Dh](C)[sP].d(l)[msPA].m(U)P.f(C)[sP],m(G)[sP].f(A)[msPA].m(U)} (SEQ ID NO: 94)
[0166] Pharmaceutical Uses
[0167] The oligonucleotides described herein may be used to treat any disorder which may be treated through editing of a target nucleobase of a target RNA, e.g., deamination of an adenosine in a target RNA. For example, any disorder which is caused by a guanosine to adenosine mutation, the introduction of a premature stop codon, or expression of an undesired protein. In some embodiments, the oligonucleotides described herein, when administered to a subject, can result in correction of a guanosine to adenosine mutation. In some embodiments, the oligonucleotides described herein can result in turning off of a premature stop codon so that a desired protein is expressed. In some embodiments, the oligonucleotides described herein can result in inhibition of expression of an undesired protein.
[0168] Particularly interesting target adenosines for editing using oligonucleotides described herein are those that are part of codons for amino acid residues that define key functions, or characteristics, such as catalytic sites, binding sites for other proteins, binding by substrates, localization domains, for co- or post-translational modification, such as glycosylation, hydroxylation, myristoylation, and protein cleavage by proteases (to mature the protein and / or as part of the intracellular routing).
[0169] A host of genetic diseases are caused by G-to-A mutations, and these are possible diseases to be treated by oligonucleotides described herein because adenosine deamination at the mutated target adenosine will reverse the mutation to wild-type. However, reversal to wild-type may not always be necessary to obtain a beneficial effect. Modification of an A to a G in a target may also be beneficial if the wild-type nucleotide is otherKB-049-WO Docket No. 33791 / 41049than a G. In certain circumstances this may be predicted to be the case, in others this may require some testing. In certain circumstances, the modification from an A in a target RNA to a G where the wild-type is not a G may be silent (not translated into a different amino acid), or otherwise non-consequential (for example an amino acid is substituted but it constitutes a conservative substitution that does not disrupt protein structure and function), or the amino acid is part of a functional domain that has a certain robustness for change. If the A-to-G transition brought about by editing is in a non-coding RNA, or a non-coding part of an RNA, the consequence may also be inconsequential or less severe than the original mutation. Those of ordinary skill in the art will understand that the applicability of the methods described herein is very wide and is not even limited to preventing or treating disease. The methods described herein may also be used to modify transcripts to study the effect thereof, even if, or particularly when, such modification induces a diseased state, for example in a cell or a non-human animal model.
[0170] Examples of genetic diseases that can be prevented and / or treated with oligonucleotides described herein are any disease where the modification of one or more adenosines in a target RNA will bring about a (potentially) beneficial change. The oligonucleotides described herein particularly suitable for treating genetic diseases, such as cystic fibrosis, albinism, alpha-1 -antitrypsin (A1AT) deficiency, Alzheimer disease, amyotrophic lateral sclerosis, asthma, 11 -thalassemia, Cadasil syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermylosis bullosa, Fabry disease, Factor V Leiden associated disorders, familial adenomatous, polyposis, galactosemia, Gaucher's disease, glucose-6-phosphate dehydrogenase deficiency, haemophilia, hereditary hematochromatosis, Hunter syndrome, Huntington's disease, Hurler syndrome, inflammatory bowel disease (IBD), inherited polyagglutination syndrome, Leber congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy types I and II, neurofibromatosis, Niemann-Pick disease type A, B and C, NY-ESO-1 related cancer, Parkinson's disease, Peutz-Jeghers syndrome, phenylketonuria, Pompe's disease, primary ciliary disease, prothrombin mutation related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, retinitis pigmentosa, Sandhoff disease, severe combined immune deficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt's disease, Tay-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturge-Weber syndrome, Rett syndrome, and various forms of cancer (e.g. BRCA1 and 2 linked breast cancer and ovarian cancer).
[0171] The present disclosure is not limited to correcting mutations, as it may instead be useful to change a wildtype sequence into a mutated sequence by applying oligonucleotides described herein. One example where it may be advantageous to modify a wild-type adenosine is to bring about skipping of an exon, for example by modifying an adenosine that happens to be a branch site required for splicing of said exon. Another example is where the adenosine defines or is part of a recognition sequence for protein binding, or is involved in secondary structure defining the stability of the RNA. As noted above, therefore, the oligonucleotides and methods described herein can be used to provide research tools for diseases, to introduce new mutations which are lessKB-049-WO Docket No. 33791 / 41049deleterious than an existing mutation. Deamination of an adenosine using the oligonucleotides disclosed herein includes any level of adenosine deamination, e.g., at least 1 deaminated adenosine within a target sequence (e.g., at least, 1, 2, 3, or more deaminated adenosines in a target sequence).
[0172] Adenosine deamination may be assessed by a decrease in an absolute or relative level of adenosines within a target sequence compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
[0173] Because the enzymatic activity of ADAR converts adenosines to inosines, adenosine deamination can alternatively be assessed by an increase in an absolute or relative level of inosines within a target sequence compared with a control level. Similarly, the control level may be any type of control level that is utilized in the art, e.g., pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
[0174] The levels of adenosines and / or inosines within a target sequence can be assessed using any of the methods known in the art for determining the nucleotide composition of a polynucleotide sequence. For example, the relative or absolute levels of adenosines or inosines within a target sequence can be assessed using nucleic acid sequencing technologies including but not limited to Sanger sequencing methods, Next Generation Sequencing (NGS; e.g., pyrosequencing, sequencing by reversible terminator chemistry, sequencing by ligation, and real-time sequencing) such as those offered on commercially available platforms (e.g., Illumina, Qiagen, Pacific Biosciences, Thermo Fisher, Roche, and Oxford Nanopore Technologies). Clonal amplification of target sequences for NGS may be performed using real-time polymerase chain reaction (also known as qPCR) on commercially available platforms from Applied Biosystems, Roche, Stratagene, Cepheid, Eppendorf, or Bio-Rad Laboratories. Additionally or alternatively, emulsion PCR methods can be used for amplification of target sequences using commercially available platforms such as Droplet Digital PCR by Bio-Rad Laboratories.
[0175] In certain embodiments, surrogate markers can be used to detect adenosine deamination within a target sequence. For example, effective treatment of a subject having a genetic disorder involving G-to-A mutations with an oligonucleotide of the present disclosure, as demonstrated by an acceptable diagnostic and monitoring criteria can be understood to demonstrate a clinically relevant adenosine deamination. In certain embodiments, the methods include a clinically relevant adenosine deamination, e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an oligonucleotide of the present disclosure.
[0176] Adenosine deamination in a gene of interest may be manifested by an increase or decrease in the levels of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a gene of interest is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an oligonucleotide of the present disclosure, or by administering an oligonucleotide described herein to a subject in which the cells are or were present) such that the expression of the gene of interest is increased or decreased, as compared to a second cell or group of cells substantiallyKB-049-WO Docket No. 33791 / 41049identical to the first cell or group of cells but which has not or have not been so treated (control cell (s) not treated with an oligonucleotide or not treated with an oligonucleotide targeted to the gene of interest). The degree of increase or decrease in the levels of mRNA of a gene of interest (e.g., SERPINA1) may be expressed in terms of:(mRNA in control cells) — (mRNA in treated cells)(mRNA in control cells)
[0177] In other embodiments, change in the levels of a gene may be assessed in terms of a reduction of a parameter that is functionally linked to the expression of a gene of interest, e.g., protein expression of the gene of interest or signaling downstream of the protein. A change in the levels of the gene of interest may be determined in any cell expressing the gene of interest, either endogenous or heterologous from an expression construct, and by any assay known in the art.
[0178] A change in the level of expression of a gene of interest may be manifested by an increase or decrease in the level of the protein produced by the gene of interest that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of mRNA suppression, the change in the level of protein expression in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.
[0179] A control cell or group of cells that may be used to assess the change in the expression of a 3 gene of interest includes a cell or group of cells that has not yet been contacted with an oligonucleotide of the present disclosure. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an oligonucleotide.
[0180] The level of mRNA of a gene of interest that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of a gene of interest in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the gene of interest. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY™ RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating mRNA of the gene of interest may be detected using methods the described in PCT Publication WO2012 / 177906, the entire contents of which are hereby incorporated herein by reference. In some embodiments, the level of expression of the gene of interest is determined using a nucleic acid probe. The term "probe," as used herein, refers to any molecule that is capable of selectively binding to a specific sequence, e.g. to an mRNA or polypeptide. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.KB-049-WO Docket No. 33791 / 41049
[0181] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses, and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA of a gene of interest. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of mRNA of a gene of interest.
[0182] An alternative method for determining the level of expression of a gene of interest in a sample involves the process of nucleic acid amplification and / or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U. S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology 6:1197), rolling circle replication (Lizardi et al., U. S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In some embodiments, the level of expression of a gene of interest is determined by quantitative fluorogenic RT-PCR (i.e., the TAQMAN™ System) or the DUAL-GLO® Luciferase assay.
[0183] The expression levels of mRNA of a gene of interest may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support including bound nucleic acids). See U. S. Pat. Nos. 5,770,722;5,874,219; 5,744,305; 5,677,195; and 5,445,934, which are incorporated herein by reference. The determination of gene expression level may also include using nucleic acid probes in solution.
[0184] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of nucleic acids of the gene of interest.
[0185] The level of protein produced by the expression of a gene of interest may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assaysKB-049-WO Docket No. 33791 / 41049(ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of proteins produced by the gene of interest. Additionally, the above assays may be used to report a change in the mRNA sequence of interest that results in the recovery or change in protein function thereby providing a therapeutic effect and benefit to the subject, treating a disorder in a subject, and / or reducing of symptoms of a disorder in the subject.
[0186] In some embodiments, the oligonucleotides described herein are administered to a subject such that the oligonucleotide is delivered to a specific site within the subject. The change in the expression of the gene of interest may be assessed using measurements of the level or change in the level of mRNA or protein produced by the gene of interest in a sample derived from a specific site within the subject.
[0187] In other embodiments, the oligonucleotide is administered in an amount and for a time effective to result in one of (or more, e.g., two or more, three or more, four or more of): (a) decrease the number of adenosines within a target sequence of the gene of interest, (b) delayed onset of the disorder, (c) increased survival of subject, (d) increased progression free survival of a subject, (e) recovery or change in protein function, and (f) reduction in symptoms.
[0188] Treating disorders associated with G-to-A mutations can also result in a decrease in the mortality rate of a population of treated subjects in comparison to an untreated population. For example, the mortality rate is decreased by more than 2% (e.g., more than 5%, 10%, or 25%). A decrease in the mortality rate of a population of treated subjects may be measured by any reproducible means, for example, by calculating for a population the average number of disease-related deaths per unit time following initiation of treatment with a compound or pharmaceutically acceptable salt of a compound described herein. A decrease in the mortality rate of a population may also be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following completion of a first round of treatment with a compound or pharmaceutically acceptable salt of a compound described herein.
[0189] In various embodiments, the guide oligonucleotides provided herein are complementary to a target RNA (e.g., target mRNA) sequence comprising the SNP associated with a disease. Nonlimiting exemplary targets, along with the SNP associated with a disease, and target amino acid to be edited, are shown in Table 3.
[0190] Table 3.Target Protein Target amino Reference SNP Accession No. foracid mRNALRRK2 G2019S rs34637584 NM_198578.4LRRK2 R1441H rs34995376 NM_198578.4ASS1 G390R rs121908641 NM_000050.4ASS1 E191K rs777828000 NM_000050.4OTOF R1939Q rs201326023 NM_194248.3OTOF Q829X rs80356593 NM_194248.3OTOF R794H rs80356592 NM_194248.3ASL V178M rs28941473 NM_001024943.2ASL R193Q rs373697663 NM_001024943.2KB-049-WO Docket No. 33791 / 41049ASL Splice variant rs142637046 NM_001024943.2ASL E59K rs869312985 NM_001024943.2ASL R12Q rs145138923 NM_001024943.2GJB2 V37I rs72474224 NM_004004.6GJB2 W24X rs104894396 NM_004004.6MECP2 R255X rs61749721 NM_004992 MECP2 R168X rs61748421 NM_004992 MECP2 R294X rs61751362 NM_004992 MECP2 R270X rs61750240 NM_004992TNNI3 D572N rs121908072 NM_138691.3 TNNI3 R389X rs151001642 NM_138691.3RS1 E72K rs104894928 NM_000330.3RS1 R102Q rs61752068 NM_000330.3ABCA4 G1961E rs1800553 NM_000350.3SERPINA1 E342K rs28929474 NM_000295.5UGP2 I252M NM_006759.4Nav1.7 K1614R NM_002977.3NRF2 E129G NM_006164.5TDP43 K95E NM_007375.4UGP2 Mouse I241M NM_001290634.1
[0191] Oligonucleotides described herein may deaminate the adenosine mutation resulting in an increase in protein activity.
[0192] In certain embodiments, treatment is performed on a subject who has been diagnosed with a mutation in a gene, but does not yet have disease symptoms (e.g., an infant such as a subject that is 1 month to 12 months old or subject under the age of 2). In other embodiments, treatment is performed on an individual who has at least one symptom.
[0193] Treatment may be performed in a subject of any age, starting from infancy to adulthood. Subjects may begin treatment, for example, at birth, six months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, or 18 years of age.
[0194] In certain embodiments, the oligonucleotide increases (e.g., an increase by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 600%. 700%, 800%, 900%, 1000% or more, or an increase by more than 1.2-fold, 1.4-fold, 1.5-fold, 1.8-fold, 2.0-fold, 3.0-fold, 3.5-fold, 4.5-fold, 5.0-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 1000-fold, or more) protein activity in vitro and / or in vivo.
[0195] In some embodiments, the oligonucleotide increases (e.g., an increase by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more, or an increase by more than 1.2-fold, 1.4-fold, 1.5-fold, 1.8-fold, 2.0-fold, 3.0-fold, 3.5-fold, 4.5-fold, 5.0-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 1000-fold, or more) protein activity in the brain.
[0196] Methods of treating or preventing a disease or disorder are also contemplated. For example, the methods described herein may be used to treat or prevent any diseases or disorders which may be caused by aKB-049-WO Docket No. 33791 / 41049guanosine to adenosine mutation, the introduction of a premature stop codon, or expression of an undesired protein. In some embodiments, the oligonucleotides for use in the methods described herein, when introduced to a cell or a subject, can result in correction of a guanosine to adenosine mutation. In some embodiments, the oligonucleotides for use in the methods described herein can result in turning off of a premature stop codon so that a desired protein is expressed. In some embodiments, the oligonucleotides for use in the methods described herein can result in inhibition of expression of an undesired protein or result in expression of a mutant protein that has a therapeutic effect.
[0197] In some embodiments, the subject is a human subject.
[0198] The methods disclosed herein also include contacting the target polynucleotides with a single nucleotide polymorphism (SNP) associated with a disease or disorder in a cell or a subject (including a subject identified as being in need of such treatment, or a subject suspected of being at risk of disease and in need of such treatment) with a oligonucleotide capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration of the SNP associated with the disease or disorder, as described herein.
[0199] The oligonucleotides for use in the methods described herein are designed to specifically target the mRNA of a subject (e.g., a human patient) in need thereof, and are capable of effecting an ADAR-mediated adenosine to inosine alteration in the SNPs associated with a disease or disorder. In some embodiments, the oligonucleotides are capable of recruiting the ADAR to the target mRNA, which then catalyze deamination of target adenosines in the target mRNA. Such treatment will be suitably introduced to a subject, particularly a human subject, suffering from, having, susceptible to, or at risk for developing the disease or disorder.
[0200] In some embodiments, provided herein are methods of monitoring treatment progress. The methods can include the step of determining a level of diagnostic marker (Marker) (e.g., SNP associated with the disease or disorder) or diagnostic measurement (e.g., screen, assay) in a subject suffering from or susceptible to developing the disease or disorder, or symptoms associated with the disease or disorder in which the subject has been administered a therapeutic amount of a composition disclosed herein sufficient to treat the disease or symptoms thereof. The level of Marker determined in the method can be compared to known levels of Marker in either healthy normal controls or in other afflicted patients to establish the subject's disease status. In preferred embodiments, a second level of Marker in the subject is determined at a time point later than the determination of the first level, and the two levels are compared to monitor the course of disease or the efficacy of the therapy. In certain preferred embodiments, a pre-treatment level of Marker in the subject is determined prior to beginning treatment according to this invention; this pre-treatment level of Marker can then be compared to the level of Marker in the subject after the treatment commences, to determine the efficacy of the treatment.
[0201] In some embodiments, cells are obtained from the subject and contacted with an oligonucleotide composition described herein as provided herein. In some embodiments, the cell is autologous, allogenic, or xenogenic to the subject. In some embodiments, cells removed from a subject and contacted ex vivo with anKB-049-WO Docket No. 33791 / 41049oligonucleotide composition described herein are re-introduced into the subject, optionally after the desired genomic modification has been effected or detected in the cells.
[0202] In some embodiments, the oligonucleotide for use in the methods of the present disclosure is introduced to a subject such that the oligonucleotide is delivered to a specific site within the subject. For example, in some embodiments the oligonucleotide may be intravitreally injected. The change in the expression of the gene of interest may be assessed using measurements of the level or change in the level of mRNA or protein produced by the gene of interest in a sample derived from a specific site within the subject.
[0203] In other embodiments, the oligonucleotide is introduced into the cell or the subject in an amount and for a time effective to result in one of (or more, e.g., two or more, three or more, four or more of: (a) decrease the number of adenosines within a target sequence of the gene of interest, (b) decrease the number of pathogenic mutations in the target protein, (c) delayed onset of a disease or disorder, (d) recovery or change in protein function, and (e) reduction in one or more of symptoms related to the disease or disorder.
[0204] Treating disorders associated with G-to-A mutations can also result in a decrease in the mortality rate of a population of treated subjects in comparison to an untreated population. For example, the mortality rate is decreased by more than 2% {e.g., more than 5%, 10%, or 25%). A decrease in the mortality rate of a population of treated subjects may be measured by any reproducible means, for example, by calculating for a population the average number of disease-related deaths per unit time following initiation of treatment with a compound or pharmaceutically acceptable salt of a compound described herein. A decrease in the mortality rate of a population may also be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following completion of a first round of treatment with a oligonucleotide described herein.A. Methods of Administration
[0205] The delivery of a oligonucleotide to a cell e.g., a cell within a subject, such as a human subject {e.g., a subject in need thereof) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an oligonucleotide described herein either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition including an oligonucleotide to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the oligonucleotide. Combinations of in vitro and in vivo methods of contacting a cell are also possible.Contacting a cell may be direct or indirect. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAcs ligand, or any other ligand that directs the oligonucleotide to a site of interest.
[0206] Contacting of a cell with an oligonucleotide may be done in vitro or in vivo. Known methods can be adapted for use with an oligonucleotide described herein (see e.g., Akhtar S. and Julian R L, (1992) Trends Cell. Biol. 2(5): 139-144 and WO94 / 02595, which are incorporated herein by reference in their entireties). For in vivoKB-049-WO Docket No. 33791 / 41049delivery, factors to consider in order to deliver an oligonucleotide molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an oligonucleotide can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the oligonucleotide molecule to be administered.
[0207] For administering an oligonucleotide systemically for the treatment of a disease, the oligonucleotide can include alternative nucleobases, alternative sugar moieties, and / or alternative internucleotide linkages, or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the oligonucleotide by endo- and exo-nucleases in vivo. Modification of the oligonucleotide or the pharmaceutical carrier can also permit targeting of the oligonucleotide composition to the target tissue and avoid undesirable off-target effects. Oligonucleotide molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the oligonucleotide can be delivered using drug delivery systems such as a nanoparticle, a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an oligonucleotide molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an oligonucleotide by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an oligonucleotide, or induced to form a vesicle or micelle that encases an oligonucleotide. The formation of vesicles or micelles further prevents degradation of the oligonucleotide when administered systemically. In general, any methods of delivery of nucleic acids known in the art may be adaptable to the delivery of the oligonucleotides described herein. Methods for making and administering cationic oligonucleotide complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., etal. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP (Sorensen, D R., etal (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, "solid nucleic acid lipid particles” (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res.16:1799-1804). In some embodiments, an oligonucleotide forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of oligonucleotides and cyclodextrins can be found in U. S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety. In some embodiments the oligonucleotides described herein are delivered by polyplex or lipoplexKB-049-WO Docket No. 33791 / 41049nanoparticles. Methods for administration and pharmaceutical compositions of oligonucleotides and polyplex nanoparticles and lipoplex nanoparticles can be found in U. S. Patent Application Nos. 2017 / 0121454;2016 / 0369269; 2016 / 0279256; 2016 / 0251478; 2016 / 0230189; 2015 / 0335764; 2015 / 0307554; 2015 / 0174549; 2014 / 0342003; 2014 / 0135376; and 2013 / 0317086, which are herein incorporated by reference in their entirety.
[0208] i. Membranous Molecular Assembly Delivery Methods
[0209] Oligonucleotides for use in the methods described herein can also be delivered using a variety of membranous molecular assembly delivery methods including polymeric, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, a colloidal dispersion system may be used for targeted delivery an oligonucleotide agent described herein. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 m can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the oligonucleotide are delivered into the cell where the oligonucleotide can specifically bind to a target RNA and can mediate ADAR-mediated RNA editing. In some cases, the liposomes are also specifically targeted, e.g., to direct the oligonucleotide to particular cell types. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.
[0210] A liposome containing an oligonucleotide can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The oligonucleotide preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the oligonucleotide and condense around the oligonucleotide to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of oligonucleotide.
[0211] If necessary, a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid {e.g., spermine or spermidine). The pH can also be adjusted to favor condensation.
[0212] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide / cationic lipid complex as a structural component of the delivery vehicle, are further described in,KB-049-WO Docket No. 33791 / 41049e.g., WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U. S. Pat. No. 4,897,355; U. S. Pat. No. 5,171,678; Bangham etal., (1965) M. Mol. Biol. 23:238; Olson etal., (1979) Biochim. Biophys. Acta 557:9; Szoka etal., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169. These methods are readily adapted to packaging oligonucleotide preparations into liposomes.
[0213] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid / liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang etal. (1987) Biochem. Biophys. Res. Commun., 147:980-985).
[0214] Liposomes, which are pH-sensitive or negatively charged, entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).
[0215] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and / or phosphatidylcholine and / or cholesterol.
[0216] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U. S. Pat. No.5,283,185; U. S. Pat. No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Feigner, (1994) J. Biol. Chem.269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.
[0217] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including NOVASOME™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and NOVASOME™ IIKB-049-WO Docket No. 33791 / 41049(glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S. T. P. Pharma. Sci., 4(6):466).
[0218] Liposomes may also be sterically stabilized liposomes, including one or more specialized lipids that result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) includes one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).
[0219] Various liposomes including one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N. Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglio side GM1, galactocerebroside sulfate, and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U. S. A., (1988), 85:6949). U. S. Pat. No. 4,837,028 and WO 88 / 04924, both to Allen et al., disclose liposomes including (1) sphingomyelin and (2) the ganglioside GMI or a galactocerebroside sulfate ester. U. S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes including sphingomyelin. Liposomes including 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97 / 13499 (Lim et al).
[0220] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver oligonucleotides to macrophages.
[0221] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated oligonucleotides in their internal compartments from metabolism and degradation (Rosoff, in " Pharmaceutical Dosage Forms,” Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
[0222] A positively charged synthetic cationic lipid, N-[1 -(2,3-dioleyloxy)propyl]-N, N, N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of oligonucleotides (see, e.g., Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U. S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).KB-049-WO Docket No. 33791 / 41049
[0223] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. LI POFECTI N™ Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that include positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane (" DOTAP”) (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.
[0224] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (" DOGS”) (TRANSFECTAM™, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (" DPPES”) (see, e.g., U. S. Pat. No. 5,171,678).
[0225] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol (“DC-Chol”) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L, (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.
[0226] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer oligonucleotides into the skin. In some implementations, liposomes are used for delivering oligonucleotides to epidermal cells and also to enhance the penetration of oligonucleotides into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol.2,405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. etal. (1987) Meth.Enzymol. 149:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L, (1987) Proc. Natl. Acad. Sci. USA 84:7851 -7855).KB-049-WO Docket No. 33791 / 41049
[0227] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with oligonucleotide are useful for treating a dermatological disorder.
[0228] The targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Additional methods are known in the art and are described, for example in U. S. Patent Application Publication No. 20060058255, the linking groups of which are herein incorporated by reference.
[0229] Liposomes that include oligonucleotides can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet.Transfersomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include oligonucleotides can be delivered, for example, subcutaneously by infection in order to deliver oligonucleotides to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transfersomes can be selfoptimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
[0230] Other formulations amenable to the present disclosure are described in U. S. provisional application Ser. No. 61 / 018,616, filed Jan. 2, 2008; 61 / 018,611, filed Jan. 2, 2008; 61 / 039,748, filed Mar. 26, 2008;61 / 047,087, filed Apr. 22, 2008 and 61 / 051,528, filed May 8, 2008. PCT application No. PCT / US2007 / 080331, filed Oct. 3, 2007 also describes formulations that are amenable to the present invention.
[0231] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile / lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head”) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N. Y., 1988, p. 285).KB-049-WO Docket No. 33791 / 41049
[0232] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
[0233] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
[0234] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
[0235] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.
[0236] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N. Y., 1988, p. 285).
[0237] The oligonucleotide for use in the methods described herein can also be provided as micellar formulations. Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.ii. Lipid Nanoparticle-Based Delivery Methods
[0238] Oligonucleotides for use in the methods described herein may be fully encapsulated in a lipid formulation, e.g., a lipid nanoparticle (LNP), or other nucleic acid-lipid particles. LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites {e.g., sites physically separated from the administration site). LNPs include "pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00 / 03683. The particles of the present disclosure typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present disclosure are resistant in aqueous solution to degradation with aKB-049-WO Docket No. 33791 / 41049nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g, U. S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U. S. Publication No. 2010 / 0324120 and PCT Publication No. WO 96 / 40964.
[0239] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to oligonucleotide ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4: 1 to about 10:1, from about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1. Ranges intermediate to the above recited ranges are also contemplated to be part described herein.
[0240] Non-limiting examples of cationic lipid include N, N-dioleyl-N, N-dimethylammonium chloride (DODAC), N, N-distearyl-N, N-dimethylammonium bromide (DDAB), N— (l-(2,3-dioleoyloxy)propyl)-N, N, N-trimethylammonium chloride (DOTAP), N- (l-(2,3-dioleyloxy)propyl)-N, N, N-trimethylammonium chloride (DOTMA), N, N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N, N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N, N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1.2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA. CI), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP. CI), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N, N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N, N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N, N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N, N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N, N-dimethyl- 2.2-di((9Z, 12Z)-octadeca-9,12-dienyetetrahydro- 3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu- tanoate (MC3), 1, T-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami- no)ethyl)piperazin-1-yeethylazanediyedidodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can include, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.
[0241] The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPO), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1 -carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1 -stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.KB-049-WO Docket No. 33791 / 41049
[0242] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Ger), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (Ci?), a PEG-dimyristyloxypropyl (Ci4), a PEG-dipalmityloxypropyl (Cie), or a PEG-disteary loxy propyl (C]s). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.
[0243] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g, about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.Kits
[0244] In certain aspects, the instant disclosure provides kits that include a pharmaceutical formulation including an oligonucleotide agent capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine alteration, and a package insert with instructions to perform any of the methods described herein.
[0245] In some embodiments, the kits include instructions for using the kit to edit a polynucleotide, e.g., a polynucleotide comprising a SNP associated with a disease or disorder. The instructions will generally include information about the use of the kit for editing nucleic acid molecules. In other embodiments, the instructions include at least one of the following: precautions; warnings; clinical studies; and / or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. In a further embodiment, a kit can comprise instructions in the form of a label or separate insert (package insert) for suitable operational parameters.
[0246] In some embodiments, the kit includes a pharmaceutical formulation including an oligonucleotide agent capable of effecting an ADAR-mediated adenosine to inosine alteration, an additional therapeutic agent, and a package insert with instructions to perform any of the methods described herein.
[0247] The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition.
[0248] In some embodiments, the kit can comprise one or more containers with appropriate positive and negative controls or control samples, to be used as standard(s) for detection, calibration, or normalization.
[0249] The kit can further comprise a second container comprising a pharmaceutically-acceptable buffer, such as (sterile) phosphate-buffered saline, Ringer's solution, or dextrose solution; and other suitable additives such as penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients, as described herein. It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, and package inserts with instructions for use. The kit can also include aKB-049-WO Docket No. 33791 / 41049drug delivery system such as liposomes, micelles, nanoparticles, and microspheres, as described herein. The kit can further include a delivery device such as needles, syringes, pumps, and package inserts with instructions for use.EXAMPLESExample 1 - mRNA editing
[0250] For transfection in 384-wel I format using Hep3B cell line, 5,000 cells were reverse transfected with oligos at final concentrations of 1 nm, 10 nm, or 100 nm using Lipofectamine 3000. Hep3B culture media is MEM with 10% FBS supplement. If human interferon alpha (Millipore, USA IF007) was used, the final concentration used was 1 U / uL at during the reverse transfection. After 48 hours of incubation, to determine editing efficiency based on the mRNA correction, mRNA was extracted from the transfected cells using the Dynabeads® Oligo (dT)25 (Life Technologies, 61005) using the BioTek EL406 with a magnetic stage. The isolated mRNA was treated with DNase and used to generate cDNA using SuperScript IV Vilo RT Master Mix (Life Technologies, CA) according to manufacturer's protocol. The cDNA was then used with site specific primer pairs to amplify DNA amplicon. This final DNA amplicon was directly used in Sanger sequencing and the percentage edited is quantified as a percentage of the conversion to G from A using the ratios of the peak of each nucleotide signal. Results are provided below in Table 4. Sufar modifications at position -1, position 0, or position +1, if present are 2'-(R)-F-deoxyhexose (" Fr2”), 3’-6’-Deoxyhexose ("36d), Dh-2’-(R)-OMe ("rDhOMe”), CeNA ("cena”), Hexitol Nucleic Acid (“HNA”), 2'-0 (N-Me Propionamide) ("dp”).
[0251] Table 4. mRNA editing efficiencyOligo Modification Modification Modification Editing Editing system Editing (%) ID at position -1 at position 0 at position +1 TargetingmutationA1 N / A N / A N / A ACTB HEP3B, 1 nM oligo 20.01% HEP3B, 10 nM oligo 40.85% HEP3B, 100 nM oligo 63.10% A2 N / A rDhOMe N / A ACTB HEP3B, 1 nM oligo 12.79% HEP3B, 10 nM oligo 25.60% HEP3B, 100 nM oligo 49.88% A3 N / A N / A N / A ACTB HEP3B, 1 nM oligo 26.93% HEP3B, 10 nM oligo 42.28% HEP3B, 100 nM oligo 76.26% A4 N / A N / A N / A ACTB HEP3B, 1 nM oligo 0.45% HEP3B, 10 nM oligo 1.17% HEP3B, 100 nM oligo 2.22% A5 N / A N / A N / A ACTB HEP3B, 1 nM oligo 10.71%KB-049-WO Docket No. 33791 / 41049Oligo Modification Modification Modification Editing Editing system Editing (%) ID at position -1 at position 0 at position +1 TargetingmutationHEP3B, 10 nM oligo 23.36% HEP3B, 100 nM oligo 51.78% A6 N / A N / A N / A ACTB HEP3B, 1 nM oligo 0.45% HEP3B, 10 nM oligo 1.05% HEP3B, 100 nM oligo 2.86% A7 N / A N / A N / A ACTB HEP3B, 1 nM oligo 11.30% HEP3B, 10 nM oligo 23.01% HEP3B, 100 nM oligo 41.36% A8 rDhOMe N / A N / A ACTB HEP3B, 1 nM oligo 3.61% HEP3B, 10 nM oligo 10.30% HEP3B, 100 nM oligo 19.79% A9 N / A N / A rDhOMe ACTB HEP3B, 1 nM oligo 0.10% HEP3B, 10 nM oligo 0.21% HEP3B, 100 nM oligo 0.29% A10 rDHOMe N / A N / A ACTB HEP3B, 1 nM oligo 5.16% HEP3B, 10 nM oligo 10.36% HEP3B, 100 nM oligo 21.32% A11 N / A N / A rDhOMe ACTB HEP3B, 1 nM oligo 0.07% HEP3B, 10 nM oligo 0.39% HEP3B, 100 nM oligo 0.88% A12 Fr2 N / A N / A ACTB HEP3B, 1 nM oligo 3.08% HEP3B, 10 nM oligo 8.09% HEP3B, 100 nM oligo 20.87% A13 N / A Fr2 N / A ACTB HEP3B, 1 nM oligo 15.47% HEP3B, 10 nM oligo 34.08% HEP3B, 100 nM oligo 61.32% A14 N / A N / A Fr2 ACTB HEP3B, 1 nM oligo 0.12% HEP3B, 10 nM oligo 0.22% HEP3B, 100 nM oligo 0.22% A15 Fr2 N / A N / A ACTB HEP3B, 1 nM oligo 3.38% HEP3B, 10 nM oligo 9.02% HEP3B, 100 nM oligo 21.85% A16 N / A N / A 36d ACTB HEP3B, 1 nM oligo 0.06%KB-049-WO Docket No. 33791 / 41049Oligo Modification Modification Modification Editing Editing system Editing (%) ID at position -1 at position 0 at position +1 TargetingmutationHEP3B, 10 nM oligo 0.16% HEP3B, 100 nM oligo 0.40% A17 36d N / A N / A ACTB HEP3B, 1 nM oligo 12.60% HEP3B, 10 nM oligo 34.35% HEP3B, 100 nM oligo 49.58% A18 N / A 36d N / A ACTB HEP3B, 1 nM oligo 6.85% HEP3B, 10 nM oligo 14.76% HEP3B, 100 nM oligo 28.18% A19 N / A N / A 36d ACTB HEP3B, 1 nM oligo 0.31% HEP3B, 10 nM oligo 0.93% HEP3B, 100 nM oligo 1.93% A20 36d N / A N / A ACTB HEP3B, 1 nM oligo 14.52% HEP3B, 10 nM oligo 36.58% HEP3B, 100 nM oligo 59.94% A21 N / A N / A 36d ACTB HEP3B, 1 nM oligo 0.39% HEP3B, 10 nM oligo 0.97% HEP3B, 100 nM oligo 2.21% A22 CeNA N / A N / A ACTB HEP3B, 1 nM oligo 19.73% HEP3B, 10 nM oligo 44.77% HEP3B, 100 nM oligo 65.76% A23 N / A CeNA N / A ACTB HEP3B, 1 nM oligo 12.48% HEP3B, 10 nM oligo 30.69% HEP3B, 100 nM oligo 45.76% A24 N / A N / A CeNA ACTB HEP3B, 1 nM oligo 0.10% HEP3B, 10 nM oligo 0.13% HEP3B, 100 nM oligo 0.20% A25 CeNA N / A N / A ACTB HEP3B, 1 nM oligo 17.02% HEP3B, 10 nM oligo 38.51% HEP3B, 100 nM oligo 55.99% A26 N / A N / A CeNA ACTB HEP3B, 1 nM oligo 0.05% HEP3B, 10 nM oligo 0.27% HEP3B, 100 nM oligo 0.23% A27 dp N / A N / A ACTB HEP3B, 1 nM oligo 14.31%KB-049-WO Docket No. 33791 / 41049Oligo Modification Modification Modification Editing Editing system Editing (%) ID at position -1 at position 0 at position +1 TargetingmutationHEP3B, 10 nM oligo 38.89% HEP3B, 100 nM oligo 64.26% A28 N / A dp N / A ACTB HEP3B, 1 nM oligo 8.61% HEP3B, 10 nM oligo 26.21% HEP3B, 100 nM oligo 41.13% A29 N / A N / A dp ACTB HEP3B, 1 nM oligo 0.17% HEP3B, 10 nM oligo 0.29% HEP3B, 100 nM oligo 0.34% A30 dp N / A N / A ACTB HEP3B, 1 nM oligo 24.38% HEP3B, 10 nM oligo 53.20% HEP3B, 100 nM oligo 64.10% A31 N / A N / A dp ACTB HEP3B, 1 nM oligo 0.46% HEP3B, 10 nM oligo 0.93% HEP3B, 100 nM oligo 2.06% A32 HNA N / A N / A ACTB HEP3B, 1 nM oligo 18.04% HEP3B, 10 nM oligo 43.75% HEP3B, 100 nM oligo 63.55% A33 N / A HNA N / A ACTB HEP3B, 1 nM oligo 19.77% HEP3B, 10 nM oligo 37.77% HEP3B, 100 nM oligo 54.95% A34 N / A N / A HNA ACTB HEP3B, 1 nM oligo 0.12% HEP3B, 10 nM oligo 0.08% HEP3B, 100 nM oligo 0.05% A35 HNA N / A N / A ACTB HEP3B, 1 nM oligo 23.81% HEP3B, 10 nM oligo 55.44% HEP3B, 100 nM oligo 65.23% A36 N / A N / A HNA ACTB HEP3B, 1 nM oligo 0.04% HEP3B, 10 nM oligo 0.07% HEP3B, 100 nM oligo 0.47%
[0252] Results showed that oligo designs with modifications at the -1 position having the best editing efficiencies were: HNAC-dC-l (Oligo A35) > 2'OMCE-dC-l (Oligo A30) > CenaC- K- 1 (Oligo A22).
[0253] Example 2 - mRNA editingKB-049-WO Docket No. 33791 / 41049
[0254] Primary Mouse Hepatocytes were thawed in a 37°C water bath in a 50 ml tube of Cryopreserved Hepatocyte Recovery Medium (CHRM- Life Technologies). After centrifugation at 80 x g for 6 minutes, supernatant was aspirated and the cell pellet is resuspended in Hepatocyte Plating Media (MB Bioscience). Cells were plated on to either 96-well collagen-coated tissue culture plates at 20000 cells / well or 384-wel I collagen-coated tissue culture plates at 5000 cells / well. Cells were transferred to incubator (37°C), 4 to 6 hours later media was changed to Hepatocyte Maintenance Media (MB Bioscience) and cells were transfected with ASOs specific to mouse ActB (i.e., A37-A78) at desired concentrations together with RNAIMax (Life Technologies, CA) according to manufacturer's protocol and placed back into the incubator. After 48 hours, cells were harvested, RNA isolated and analyzed for editing.
[0255] The experiment was run with first set of oligos (A37-A40), each oligo containing a ribose at position 0 and a sugar modification at position -1 of the oligonucleotide as noted below in Table 5. Sugar modifications at the -1 position include Deoxyhexose (“Dh”), CeNA (“cena”), Hexitol Nucleic Acid (“HNA”), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl (“nr”), Dh 2'-(R)-dimethyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), and 2'-NMA (" NMA”).
[0256] Table 5Oligo ID Modification at position -1 Editing Target Editing System Editing (%) A37 N / A ActB PMH, 1 nM oligo 39.96%PMH, 10 nM oligo 36.67%A38 Dh 2'-(R)-dimethyl NMA ActB PMH, 1nM oligo 12.62%PMH, 10 nM oligo 23.72%A39 Dh 2'-(R)-NMA ActB PMH, 1 nM oligo 14.87%PMH, 10 nM oligo 26.15%A40 2'-NMA-m5C ActB PMH, 1 nM oligo 44.55%38PMH 10 nM oligo.73%
[0257] Additional experiments were run with another set of oligos (A41-A56), each oligo containing a deoxyhexose (Dh) at position 0 and a modification at position -1 of the oligonucleotide as noted below in Table 6. Modifications at the -1 position include Deoxyhexose (" Dh”), CeNA ("cena”), Hexitol Nucleic Acid (" HNA”), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl ("nr”), Dh 2'-(R)-dimethyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), and 2'-NMA (" NMA”).
[0258] Table 6Oligo ID Modification at Editing Target Editing system Editing (%)position -1A41 N / A ActB PMH, 1 nM oligo 33.33%PMH, 10 nM oligo 43.02%A42 N / A ActB PMH, 1 nM oligo 17.09%PMH, 10 nM oligo 27.04%A43 CeNA ActB PMH, 1 nM oligo 36.81%KB-049-WO Docket No. 33791 / 41049Oligo ID Modification at Editing Target Editing system Editing (%)position -1PMH, 10 nM oligo 41.15%A44 HNA ActB PMH, 1 nM oligo 37.63%PMH, 10 nM oligo 41.94%A45 dp ActB PMH, 1 nM oligo 43.97%PMH, 10 nM oligo 38.88%A46 2'-NMA-m5C ActB PMH, 1 nM oligo 38.62%PMH, 10 nM oligo 45.04%A47 nr ActB PMH, 1 nM oligo 20.25%PMH, 10 nM oligo 25.71%A48 Deoxyhexose ActB PMH, 1 nM oligo 13.87%(Dh) PMH, 10 nM oligo 24.41% A49 CeNA ActB PMH, 1 nM oligo 42.95%PMH, 10 nM oligo 40.42%A50 HNA ActB PMH, 1 nM oligo 40.01%PMH, 10 nM oligo 50.49%A51 dp ActB PMH, 1 nM oligo 44.32%PMH, 10 nM oligo 48.40%A52 nr ActB PMH, 1 nM oligo 34.95%PMH, 10 nM oligo 54.63%A53 Dh 2'-(R)- ActB PMH, 1 nM oligo 9.79%dimethyl NMA PMH, 10 nM oligo 22.02% A54 Dh 2'-(R)-NMA ActB PMH, 1 nM oligo 12.29%PMH, 10 nM oligo 22.58%A55 Dh 2'-(R)-Nme ActB PMH, 1 nM oligo 18.17%propionamide PMH, 10 nM oligo 22.50% A56 2'-NMA-m5C ActB PMH, 1 nM oligo 51.34%PMH, 10 nM oligo 55.05%
[0259] Additional experiments were run with another set of oligos (A57-A78), each oligo containing a base modification at position -1 of the oligonucleotide as noted below in Table 6. Base modifications at the -1 position include e4C, OH5U, m1pU, br5C, X, dW, mZb, ca5C, m3C, pU, IsoU, prC, s2T, I5C, hm5U, m3C, n6U, m5C, Py, o8A, oh5C, and pdC,
[0260] Table 6Oligo ID Modification at Editing Target Editing system Editing (%)position -1A57 e4c ActB PMH, 1 nM oligo 36.74%PMH, 10 nM oligo 49.64%A58 OH5U ActB PMH, 1 nM oligo 55.28%PMH, 10 nM oligo 35.71%A59 m1pU ActB PMH, 1 nM oligo 66.17%PMH, 10 nM oligo 57.34%A60 br5c ActB PMH, 1 nM oligo 79.05%PMH, 10 nM oligo 68.57%KB-049-WO Docket No. 33791 / 41049Oligo ID Modification at Editing Target Editing system Editing (%)position -1A61 X ActB PMH, 1 nM oligo 41.45%PMH, 10 nM oligo 54.84%A62 dW ActB PMH, 1 nM oligo 10.56%PMH, 10 nM oligo 24.26%A63 mZb ActB PMH, 1 nM oligo 58.78%PMH, 10 nM oligo 45.86%A64 ca5c ActB PMH, 1 nM oligo 64.51%PMH, 10 nM oligo 71.54%A65 m3c ActB PMH, 1 nM oligo 53.96%PMH, 10 nM oligo 37.56%A66 pU ActB PMH, 1 nM oligo 54.76%PMH, 10 nM oligo 70.43%A67 IsoU ActB PMH, 1 nM oligo 17.17%PMH, 10 nM oligo 8.46%A68 prC ActB PMH, 1 nM oligo 59.88%PMH, 10 nM oligo 67.19%A69 s2T ActB PMH, 1 nM oligo 46.72%PMH, 10 nM oligo 57.62%A70 I5c ActB PMH, 1 nM oligo 66.67%PMH, 10 nM oligo 58.28%A71 hm5U ActB PMH, 1 nM oligo 56.99%PMH, 10 nM oligo 70.97%A72 m3c ActB PMH, 1 nM oligo 23.61%PMH, 10 nM oligo 32.32%A73 n6U ActB PMH, 1 nM oligo 57.48%PMH, 10 nM oligo 34.35%A74 m5C ActB PMH, 1 nM oligo 74.39%PMH, 10 nM oligo 64.73%A75 Py ActB PMH, 1 nM oligo 47.18%PMH, 10 nM oligo 64.41%A76 o8A ActB PMH, 1 nM oligo 12.10%PMH, 10 nM oligo 7.04%A77 oh5C ActB PMH, 1 nM oligo 59.62%PMH, 10 nM oligo 70.66%A78 pdC ActB PMH, 1 nM oligo 75.60%PMH, 10 nM oligo 63.60%
[0261] Additional experiments were run with another set of oligos (A79-85), each oligo containing a base modification at position -1 of the oligonucleotide as noted below in Table 7 (at doses of 0.1 nM, 1 nM, 10 nM, andKB-049-WO Docket No. 33791 / 41049100 nM of the oligos via transfection) and Table 8 (at doses of 10 nM, 50 nM, 100 nM, and 500 nM of the oligos via free uptake). Sugar modifications at the -1 position include MCE-morpholino (“MK4”), 2'-O-acetamide (“na”), and MCP (" M3”).
[0262] Table 7Oligo ID Modification at Editing Target Editing system Editing (%)position -1A79 N / A ActB PMH, 0.1 nM oligo 13.94%PMH, 1 nM oligo 34.76%PMH, 10 nM oligo 60.11%PMH, 100 nM oligo 81.86%A80 M3 ActB PMH, 0.1 nM oligo 12.80%PMH, 1 nM oligo 39.12%PMH, 10 nM oligo 35.35%PMH, 100 nM oligo 66.51%A81 MK4 ActB PMH, 0.1 nM oligo 13.98%PMH, 1 nM oligo 42.95%PMH, 10 nM oligo 44.39%PMH, 100 nM oligo 67.38%A82 na ActB PMH, 0.1 nM oligo 17.02%PMH, 1 nM oligo 37.68%PMH, 10 nM oligo 57.91%PMH, 100 nM oligo 77.16%A83 M3 ActB PMH, 0.1 nM oligo 20.63%PMH, 1 nM oligo 54.31%PMH, 10 nM oligo 61.94%PMH, 100 nM oligo 88.05%A84 MK4 ActB PMH, 0.1 nM oligo 20.14%PMH, 1 nM oligo 45.33%PMH, 10 nM oligo 65.49%PMH, 100 nM oligo 86.12%A85 N / A ActB PMH, 0.1 nM oligo 9.15%PMH, 1 nM oligo 35.84%PMH, 10 nM oligo 57.78%PMH, 100 nM oligo 78.78%
[0263] Table 8.Oligo ID Modification at Editing Target Editing system Editing (%)position -1A79 N / A ActB PMH, 1 nM oligo 14.76%PMH, 10 nM oligo 51.25%PMH, 100 nM oligo 64.50%PMH, 500 nM oligo 73.31%A80 M3 ActB PMH, 1 nM oligo 25.13%PMH, 10 nM oligo 45.34%PMH, 100 nM oligo 67.02%PMH, 500 nM oligo 66.96%KB-049-WO Docket No. 33791 / 41049Oligo ID Modification at Editing Target Editing system Editing (%)position -1A81 MK4 ActB PMH, 1 nM oligo 21.84%PMH, 10 nM oligo 52.51%PMH, 100 nM oligo 64.89%PMH, 500 nM oligo 74.53%A82 na ActB PMH, 1 nM oligo 26.07%PMH, 10 nM oligo 66.00%PMH, 100 nM oligo 80.84%PMH, 500 nM oligo 85.46%A83 M3 ActB PMH, 1 nM oligo 29.57%PMH, 10 nM oligo 64.66%PMH, 100 nM oligo 74.20%PMH, 500 nM oligo 84.45%A84 MK4 ActB PMH, 1 nM oligo 27.96%PMH, 10 nM oligo 61.99%PMH, 100 nM oligo 79.21%PMH, 500 nM oligo 84.43%A85 N / A ActB PMH, 1 nM oligo 17.84%PMH, 10 nM oligo 46.61%PMH, 100 nM oligo 66.34%PMH, 500 nM oligo 74.42%
[0264] Example 3 - mRNA editing using oligos with sugar variations at the X1 position
[0265] In this example, parent oligonucleotides directed to SERPINA1 with a D NA at positions X1and X2(Oligo A86) and a parent oligo with DNA at position X1and a Deoxyhexose at position X2(Oligo A87) were used as the basis for varying the sugar at position X1and evaluated for editing in hepatocytes. The sugar variants at position X1were HNA, MCE, NMA, Aminopropyl, Arabinose-OME, 2'5' 3' OME, and 2' -Amino (“2-NH2”).
[0266] " PiZZ cells” as used herein refer to cells carrying two copies of SERPINA1 Z-allele (homozygous for the Z-allele). " MZ cells” refer to cells carrying one copy of M-allele and one copy of Z-allele (heterozygous PIMZ genotype). Z-allele refers to a SERPINA1 gene carrying a mutation that produces a E342K mutation in AAT protein. M-allele refers to a control human SERPINA1 gene having glutamic acid (E) at residue 342.
[0267] PiZZ primary mouse hepatocytes (PMH) (obtained from PIZ transgenic mice that carries the human SERPINA1 Z-allele) and MZ primary human hepatocytes (PHH) were used in the study. Thawing and plating of the cells were performed according to Discovery Life Sciences' media and protocol. PiZZ PMH cells were seeded at 5,000 cells per well, and MZ PHH cells were seeded at 10,000 cells per well in 384 well collagen coated plates. Oligonucleotides A86 and A87 were administered at concentration of 10 nM to the hepatocytes and evaluated using a free uptake assay. Cells were incubated with oligonucleotides for 48 hours at 37°C with 5% C02. RNA isolation and cDNA synthesis were performed using standard protocols with primers detailed in Table 9. Adenosine to inosine editing efficiency was quantified by digital PGR (dPCR). Table 10 shows SERPINA1 Z-allele mRNA editing efficiency in two separate experiments, expressed as mean % M-allele present in the sample, of each tested oligonucleotide in the MZ PHH and PiZZ PMH. MZ PHH. Note, in MZ PHHKB-049-WO Docket No. 33791 / 41049cells, one M-allele copy had already been present (M-allele present at 50%) before introducing the oligonucleotides.
[0268] Table 9: PrimersName Sequence 5’-3’SERPINAfwd CTCCAAGGCCGTGCATAAG SEQ ID NO: 95SERPINA rvs GATAGACATGGGTATGGCCTCT SEQ ID NO: 96
[0269] Table 10MZ PiZOligo ID X1 position X2 position 0.5 nM 2nM 10nM 0.5nM 2nM 10nM A86DNA DNA C 52.2 59.1 68.7 8.0 22.1 36.8 DNA C parentHNA DNA C 53.7 60.6 72.2 10.0 28.3 44.5 MCE DNA C 52.7 58.2 68.4 10.1 24.8 41.6 NMA DNA C 52.9 60.2 73.3 8.6 19.1 38.9 AminoP DNA C 52.1 55.3 63.0 7.1 13.4 34.0 AraOMe DNA C 50.8 51.5 58.5 5.3 10.1 32.4 2'5' 3' OME DNA C 50.7 52.0 54.5 10.2 20.5 41.2 2-NH2 DNA C 52.9 54.5 61.4 9.5 20.4 39.7 A87DNA Dh C 55.2 60.5 75.6 13.8 28.7 47.6 DhC parentHNA Dh C 54.8 61.1 72.1 9.4 16.6 40.3 MCE Dh C 53.0 60.2 75.9 13.6 31.9 52.8 NMA Dh C 55.2 62.2 74.7 10.7 27.8 48.5 AminoP Dh C 52.4 57.7 67.3 7.2 14.0 36.6 AraOMe Dh C 52.6 56.4 66.7 10.1 23.6 45.5 2'5' 3' OME Dh C 51.9 54.8 66.6 8.3 18.8 37.62-NH2 Dh C 52.4 56.1 66.9 9.0 21.9 37.9
[0270] As illustrated in Table 10, variation of the X1sugar in both cell types and at all concentrations demonstrated strong editing and are well tolerated in the triplet at the X1position.
[0271] Exemplary embodiments:
[0272] 1. An oligonucleotide comprising the structure:[Am]-X1-X2-X3-[Bn]whereinm+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises anKB-049-WO Docket No. 33791 / 41049ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage;the X1sugar is a CeNA, a HNA, or a 2'MCE.
[0273] 2. The oligonucleotide of embodiment 1, wherein the X1sugar is a CeNa.
[0274] 3. The oligonucleotide of embodiment 2, wherein the X1sugar is CeNA of structure, and N is the X1nucleobase.
[0275] The oligonucleotide of embodiment 1, wherein the X1sugar is a HNA.
[0276] The oligonucleotide of embodiment 4, wherein the X1sugar is a HNA of structureO, and N is the X1nucleobase.
[0277] 6. The oligonucleotide of embodiment 1, wherein the X1sugar is a 2'MCE.
[0278] 7. The oligonucleotide of embodiment 6, wherein the X1sugar is a 2'MCE of structure, and N is the X1nucleobase.
[0279] 8. The oligonucleotide of any one of embodiments 1 to 7, wherein the X2nucleobase is a naturally occurring nucleobase.
[0280] 9. The oligonucleotide of any one of embodiments 1 to 7, wherein the X2nucleobase is cytosine, 8-oxoA, or IsoU.
[0281] 10. The oligonucleotide of any one of embodimentl to 9, wherein the X3nucleobase is a naturally occurring nucleobase.KB-049-WO Docket No. 33791 / 41049
[0282] 11. The oligonucleotide of any one of embodiments 1 to 9, wherein the X3nucleobase is guanosine, hypoxanthine, or 7-deazaguinine.
[0283] 12. The oligonucleotide of any one of embodiments 1 to 10, wherein the X2sugar is selected from 2’-methoxy-ribose, 2’-MOE-ribose, 2’ -fluororibose, 2’-fluoro-arabinose, 2’-OH-arabinose, 2-methoxy-arabinose, 2’deoxyribose, a locked nucleic acid (LNA), and a beta-homo-DNA sugar.
[0284] 13. The oligonucleotide of embodiment 12, wherein the X2sugar is a beta-homo-DNA sugar, and the beta-homo DNA sugar is optionally substituted.
[0285] 14. The oligonucleotides of any one of embodiments 1 to 13, the A / B sugars and the X3sugar are each independently selected from 2’-methoxy-ribose, 2’-MOE-ribose, 2’-fluororibose, 2’-fluoro-arabinose, 2’-OH-arabinose, 2’-methoxy-arabinose, 2’deoxyribose and a locked nucleic acid (LNA).
[0286] 15. The oligonucleotide of any one of embodiments 1 to 14, wherein the A / B sugars, collectively, are 10-70% 2’-fluororibose.
[0287] 16. The oligonucleotide of any one of embodiments 1 to 15, wherein the internucleotide linkages of the oligonucleotide are 30-100% phosphorothioate and phosphoramidate linkages, and 3 to 20 internucleotide linkages are phosphoramidate linkages.
[0288] 17. The oligonucleotide of any one of embodiments 1 to 16, wherein at least one internucleotide linkage is a phosphoramidate.
[0289] 18. The oligonucleotide of embodiment 16 or 17, wherein at least one phosphoramidate linkage is a mesyl phosphoramidate.
[0290] 19. The oligonucleotide of embodiment 16, 17, or 18, wherein at least one phosphoramidatelinkage has a structure of O O', R1is isopropyl, isobutyl, sec-butyl, C1-6 haloalkyl, C2-6 hydroxyalkyl, C2-8 alkylene-N(RN)2, Co-2alkylene-C3-8 cycloalkyl, 4-10 membered heterocycloalkyl having 1-3 ring heteroatoms selected from 0, N, and S, or 5-10-membered heteroaryl having 1-3 ring heteroatoms selected from 0, N, and S, with the proviso that the heterocycloalkyl or heteroaryl is attached to the sulfur via a carbon ring atom, and the cycloalkyl, heterocycloalkyl, or heteroaryl is substituted with 0, 1, 2, or 3 R2groups; each R2is independently halo, CN, N(RN)2, Ci-salkyl, Ci-shaloalkyl, Ci-salkoxy, oxo, C02RN, or C(O)Ci-3alkyl; and each RNis independently H or Ci-salkyl.
[0291] 20. The oligonucleotide of embodiment 19, wherein at least one internucleotide linkage is a phosphoramidate as shown in Table 1.
[0292] 21. The oligonucleotide of any one of embodiments 1 to 20, wherein the internucleotide linkage (i) between the nucleotide at position -(m+1) and the nucleotide at position -(m) (the 5’end), (ii) between theKB-049-WO Docket No. 33791 / 41049nucleotide at position +(n) and the nucleotide at position +(n+1) (the 3' -end), or (iii) at each the 5'-end and 3'-end of the oligonucleotide is a phosphoramidate linkage.
[0293] 22. The oligonucleotide of any one of embodiments 1 to 21, wherein the internucleotide linkage between the nucleotide at position -(m) and the nucleotide at position -(m-1) and the internucleotide linkage between the nucleotide at position +(n-1) and the nucleotide at position +(n) are independently a phosphorothioate or a phosphoramidate linkage.
[0294] 23. The oligonucleotide of any one of embodiments 1 to 22, wherein the internucleotide linkage between X1and X2is a phosphorothioate or a phosphodiester linkage.
[0295] 24. The oligonucleotide of embodiment 24, wherein the internucleotide linkage between X1and X2is a phosphorothioate.
[0296] 25. The oligonucleotide of any one of embodiments 1 to 24, wherein the internucleotide linkage between X2and X3is a phosphorothioate or a phosphodiester linkage.
[0297] 26. The oligonucleotide of embodiment 25, wherein the internucleotide linkage between X2and X3is a phosphorothioate.
[0298] 27. The oligonucleotide of any one of embodiments 1 to 26, wherein the internucleotide linkage between the nucleotide at position -2 and X1is a phosphorothioate or a phosphodiester linkage.
[0299] 28. The oligonucleotide of embodiment 27, wherein the internucleotide linkage between the nucleotide at position -2 and X1is a phosphorothioate.
[0300] 29. The oligonucleotide of any one of embodiments 1 to 28, wherein the internucleotide linkage between the nucleotide at position -9 and the nucleotide at position -8 is a phosphoramidate.
[0301] 30. The oligonucleotide of any one of embodiments 1 to 29, wherein the internucleotide linkage between the nucleotide at position -11 and the nucleotide at position -10 is a phosphoramidate.
[0302] 31. The oligonucleotide of any one of embodiments 1 to 30, wherein the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2 is a phosphoramidate.
[0303] 32. The oligonucleotide of any one of embodiments 1 to 31, wherein the internucleotide linkage between the nucleotide at position +4 and the nucleotide at position +5 is a phosphoramidate.
[0304] 33. The oligonucleotide of any one of embodiments 1 to 32, wherein the internucleotide linkage between the nucleotide at position +5 and the nucleotide at position +6 is a phosphoramidate.
[0305] 34. The oligonucleotide of any one of embodiments 1 to 33, wherein the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 is a phosphoramidate.KB-049-WO Docket No. 33791 / 41049
[0306] 35. The oligonucleotide of embodiment 34, wherein the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2 and the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 are a phosphoramidate.
[0307] 36. The oligonucleotide of embodiment 34 or 35, wherein the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2, the internucleotide linkage between the nucleotide at position +5 and the nucleotide at position +6, and the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 are a phosphoramidate.
[0308] 37. The oligonucleotide of any one of embodiments 21, 22 and 29-36, wherein the phosphoramidate is mesyl phosphoramidate.
[0309] 38. The oligonucleotide of any one of embodiments 21, 22 and 29-36, wherein the phosphoramidate is a phosphoramidate as shown in Table 1.
[0310] 39. The oligonucleotide of any one of embodiments 1 to 38, wherein n+m is 27.
[0311] 40. The oligonucleotide of any one of embodiments 1 to 38, wherein n+m is 39.
[0312] 41. The oligonucleotide of any one of embodiments 1 to 40, wherein n is 4, 5, 6, 7, 8, or 9.
[0313] 42. The oligonucleotide of embodiment 41, wherein n is 4.
[0314] 43. The oligonucleotide of embodiment 41, wherein n is 5.
[0315] 44. The oligonucleotide of embodiment 41, wherein n is 9.
[0316] 45. The oligonucleotide of any one of embodiments 1 to 44, wherein the A / B sugar at position +3 is a 2'-fluororibose.
[0317] 46. The oligonucleotide of any one of embodiments 1 to 45, wherein the A / B sugar at position -5 is a 2'- fluororibose.
[0318] 47. The oligonucleotide of any one of embodiments 1 to 46, wherein the A / B sugar at position -16 is a 2'- fluororibose.
[0319] 48. The oligonucleotide of any one of embodiments 1 to 47, wherein the A / B sugar at position -20 is a 2' -fluororibose.
[0320] 49. The oligonucleotide of any one of embodiments 1 to 48, wherein the A / B sugar at each of positions -5, -16, and -20 is a 2' -fluororibose.
[0321] 50. The oligonucleotide of any one of embodiments 1 to 49, wherein the A / B sugar at each of positions +3, -5, -16, and -20 is a 2'-fluororibose.
[0322] 51. The oligonucleotide of any one of embodiments 1 to 50, having a GalNAc moiety at the 5' end.
[0323] 52. The oligonucleotide of any one of embodiments 1 to 51, having a GalNAc moiety at the 3' end.KB-049-WO Docket No. 33791 / 41049
[0324] 53. The oligonucleotide of any one of embodiments 1 to 52, wherein at least one phosphoramidate is a mesyl phosphoramidate.
[0325] 54. The oligonucleotide of embodiment 53, wherein each phosphoramidate is a mesyl phosphoramidate.
[0326] 55. The oligonucleotide of any one of embodiments 1 to 54, sufficiently complementary to part of a target RNA having a target adenosine and capable of forming a complex with the target RNA.
[0327] 56. The oligonucleotide of embodiment 55, wherein, upon formation of the complex with the target RNA, the nucleotide of the oligonucleotide opposite the target adenosine is X2.
[0328] 57. The oligonucleotide of embodiment 55 or 56, capable of binding and recruiting an ADAR enzyme to perform editing on the target adenosine of the target RNA.
[0329] 58. The oligonucleotide of any one of embodiments 1 to 57, wherein the oligonucleotide does not comprise a portion that is capable of forming an intramolecular stem-loop structure.
[0330] 59. The oligonucleotide of any one of embodiments 1 to 57, comprising a portion that is capable of forming an intramolecular stem-loop structure.
[0331] 60. A complex comprising the oligonucleotide of any one of embodiments 1 to 59 and a target RNA, the complex formed by hybridization between the oligonucleotide and the target RNA.
[0332] 61. The complex of embodiment 60, comprising 1, 2, 3, 4, or 5 mismatches, wobbles, insertions or deletions.
[0333] 62. A method of editing a target adenosine in a target RNA in a cell comprising contacting the cell with the oligonucleotide of any one of embodiments 1 to 59 to (i) form a complex between the oligonucleotide and the target RNA such that X2of the oligonucleotide is opposite the target adenosine; and (ii) recruit an ADAR in the cell to the complex such that the ADAR edits the target adenosine.
[0334] 63. A pharmaceutical composition comprising the oligonucleotide of any one of embodiments 1 to 59 and a pharmaceutically acceptable excipient.
[0335] 64. The pharmaceutical composition of embodiment 63, wherein the oligonucleotide is encapsulated in a lipid nanoparticle (LNP).
Claims
KB-049-WO Docket No. 33791 / 41049What is claimed is:
1. An oligonucleotide comprising the structure:[Am]-X1-X2-X3-[Bn]whereinm+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises an ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage; and(1) the X1sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl (“nr”), Dh 2'-(R)-di methyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (" MK4”), 2’-O-acetamide ("na”), MCP (" M3”), Arabinose-OME, 2’-5’ Arabi nose-0 ME, 2'5' 3' OME or 2’-Amino ("2-NH2”.; and / or(2) the X1nucleobase is selected from e4C, OH5U, m1PU, br5C, dW, mZb, ca5c, m3c, pU, prC, s2T, I5C, hm5U, m3C, n6U, m5c, Py, Oh5C, pdC, 5m-C, 5h-C, 5mh-C, 5ca-C, f5-C, 5br-C, 5I-C, fpy-C, N3m-C, N4e-C, 5a-56dh-C, 5f-U, 5hm-U, 5py-U, 4t-U, 2t-T, 4t-T, 6a-U, 6a-T, 5ey-U, I P-U, N1m-PU, Iso-C, Z, 5m-Zeb, W, P-IsoC, 8o-A, 7da-A, 7da-8a-A, IsoA, 8-oxo-a, IsoU, 8am-A, 8-br-A, 7da-G, I, 8o-G, N1m-G, Iso-G, 2f-l, X, N, 8a-N, N4-oxy-cyclic-der-C, Py-m-C, and G-clamp.
2. The oligonucleotide of claim 1, wherein the X1sugar is a CeNA, a HNA, or a 2'MCE.
3. The oligonucleotide of claim 2, wherein the X1sugar is a CeNa.The oligonucleotide of claim 3, wherein the X1sugar is CeNA of structureand N is the X1nucleobase.
5. The oligonucleotide of claim 2, wherein the X1sugar is a HNA.KB-049-WO Docket No. 33791 / 410496. The oligonucleotide of claim 5, wherein the X1sugar is a HNA of structureand N is the X1nucleobase.
7. The oligonucleotide of claim 2, wherein the X1sugar is a 2'MCE.
8. The oligonucleotide of claim 7, wherein the X1sugar is a 2'MCE of structureand N is the X1nucleobase.
9. The oligonucleotide of claim 1, wherein the X1sugar is 2'-0 (N-Me Propionamide) having the:and nucleobase is the X1nucleobase,10. The oligonucleotide of claim 1, wherein the X1sugar is 2'-aminopropyl ("nr”) having the structure2’-amiiiopropyl ribosenrand nucleobase is the X1nucleobaseKB-049-WO Docket No. 33791 / 4104911. The oligonucleotide of claim 1, wherein the X1sugar is Dh 2'-(R)-dimethyl NMA ("rDhNdMA”) having the following structure:and nucleobase is the X1nucleobase.
12. The oligonucleotide of claim 1, wherein the X1sugar is Dh 2'-(R)-NMA ("rDhNMA”) having the following structure:and nucleobase is the X1nucleobase.
13. The oligonucleotide of claim 1, wherein the X1sugar is Dh 2'-(R)-Nme propionamide ("rDhNMP”) having the following structure:and nucleobase is the X1nucleobase.
14. The oligonucleotide of claim 1, wherein the X1sugar is 2'-O-NMA (“NMA”) having the following structure:KB-049-WO Docket No. 33791 / 41049tS %and nucleobase is the X1nucleobase.
15. The oligonucleotide of any one of claims 1 to 8, wherein the X1nucleobase is a naturally occurring nucleobase.
16. The oligonucleotide of any one of claims 1 to 9, wherein the X1nucleobase is selected from e4C, OH5U, m1PU, br5C, dW, mZb, ca5c, m3c, pU, prC, s2T, I5C, hm5U, m3C, n6U, m5c, Py, Oh5C, pdC, 5m-C, 5h-C, 5mh-C, 5ca-C, f5-C, 5br-C, 5I-C, fpy-C, N3m-C, N4e-C, 5a-56dh-C, 5f-U, 5hm-U, 5py-U, 4t-U, 2t-T, 4t-T, 6a-U, 6a-T, 5ey-U, I P-U, N1m-PU, Iso-C, Z, 5m-Zeb, W, P-lsoC, 8o-A, 7da-A, 7da-8a-A, IsoA, 8-oxo-a, IsoU, 8am-A, 8-br-A, 7da-G, I, 8o-G, N1m-G, Iso-G, 2f-l, X, N, 8a-N, N4-oxy-cyclic-der-C, Py-m-C, and G-clamp.
17. The oligonucleotide of any one of claims 1 to 16, wherein the X2nucleobase is a naturally occurring nucleobase.
18. The oligonucleotide of any one of claims 1 to 16, wherein the X2nucleobase is cytosine, 8-oxoA, or isoU.
19. The oligonucleotide of any one of claims 1 to 18, wherein the X3nucleobase is a naturally occurring nucleobase.
20. The oligonucleotide of any one of claims 1 to 18, wherein the X3nucleobase is guanosine, hypoxanthine, or 7-deazaguinine.
21. The oligonucleotide of any one of claims 1 to 20, wherein the X2sugar is selected from a 2'-(R)-F-deoxyhexose (" Fr2”), 3’-6’-Deoxyhexose ("36d”), Dh-2’-(R)-OMe (“rDhOMe”), CeNA (“cena”), Hexitol Nucleic Acid (“HNA”), 2'-0 (N-Me Propionamide) ("dp”), 2'-methoxy-ribose, 2'-MOE-ribose, 2'-fluororibose, 2'-fluoro-arabinose, 2'-OH-arabinose, 2-methoxy-arabinose, 2'deoxyribose, a locked nucleic acid (LNA), and a beta-homo-DNA sugar.
22. The oligonucleotide of claim 21, wherein the X2sugar is a beta-homo-DNA sugar, and the beta-homo DNA sugar is optionally substituted.
23. The oligonucleotide of any one of claims 1 -22, wherein the X3sugar is selected from a 2'-(R)-F-deoxyhexose (“Fr2"), 3'-6'-Deoxyhexose (“36d), Dh-2’-(R)-OMe ("rDhOMe”), CeNA ("cena”), Hexitol Nucleic Acid (" HNA”), 2'-0 (N-Me Propionamide) ("dp”), 2'-methoxy-ribose, 2'-MOE-ribose, 2'-fluororibose, 2’ -fluoro-arabinose, 2'-OH-arabinose, 2-methoxy-arabinose, 2'deoxyribose, and a locked nucleic acid (LNA).KB-049-WO Docket No. 33791 / 4104924. The oligonucleotides of any one of claims 1 to 23, the A / B sugars are each independently selected from 2'-methoxy-ribose, 2'-MOE-ribose, 2'-fluororibose, 2'-fluoro-arabinose, 2'-OH-arabinose, 2'-methoxy-arabinose, 2'deoxyribose and a locked nucleic acid (LNA).
25. The oligonucleotide of any one of claims 1 to 24, wherein the A / B sugars, collectively, are 10-70% 2'-fluororibose.
26. The oligonucleotide of any one of claims 1 to 56, wherein the internucleotide linkages of the oligonucleotide are 30-100% phosphorothioate and phosphoramidate linkages, and 3 to 20 internucleotide linkages are phosphoramidate linkages.
27. The oligonucleotide of any one of claims 1 to 26, wherein at least one internucleotide linkage is a phosphoramidate.
28. The oligonucleotide of claim 26 or 27, wherein at least one phosphoramidate linkage is a mesyl phosphoramidate.
29. The oligonucleotide of claim 26, 27, or 28, wherein at least one phosphoramidate linkage has aR11-S "-N=P I-Ostructure of O O', R1is isopropyl, isobutyl, sec-butyl, C1-6 haloalkyl, C2-6 hydroxyalkyl, C2-8 alkylene-N(RN)2, Co-2alkylene-C3-8 cycloalkyl, 4-10 membered heterocycloalkyl having 1-3 ring heteroatoms selected from 0, N, and S, or 5-10-membered heteroaryl having 1-3 ring heteroatoms selected from 0, N, and S, with the proviso that the heterocycloalkyl or heteroaryl is attached to the sulfur via a carbon ring atom, and the cycloalkyl, heterocycloalkyl, or heteroaryl is substituted with 0, 1, 2, or 3 R2groups; each R2is independently halo, CN, N(RN)2, Ci-salkyl, Ci-shaloalkyl, Ci-salkoxy, oxo, C02RN, or C(O)Ci-3alkyl; and each RNis independently H or Ci-salkyl.
30. The oligonucleotide of claim 29, wherein at least one internucleotide linkage is a phosphoramidate as shown in Table 1.
31. The oligonucleotide of any one of claims 1 to 30, wherein the internucleotide linkage (i) between the nucleotide at position -(m+1) and the nucleotide at position -(m) (the 5'end), (ii) between the nucleotide at position +(n) and the nucleotide at position +(n+1) (the 3' -end), or (ill) at each the 5'-end and 3'-end of the oligonucleotide is a phosphoramidate linkage.
32. The oligonucleotide of any one of claims 1 to 31, wherein the internucleotide linkage between the nucleotide at position -(m) and the nucleotide at position -(m-1) and the internucleotide linkage between the nucleotide at position +(n-1) and the nucleotide at position +(n) are independently a phosphorothioate or a phosphoramidate linkage.
33. The oligonucleotide of any one of claims 1 to 32, wherein the internucleotide linkage between X1and X2is a phosphorothioate or a phosphodiester linkage.
34. The oligonucleotide of claim 33, wherein the internucleotide linkage between X1and X2is a phosphorothioate.KB-049-WO Docket No. 33791 / 4104935. The oligonucleotide of any one of claims 1 to 34, wherein the internucleotide linkage between X2and X3is a phosphorothioate or a phosphodiester linkage.
36. The oligonucleotide of claim 35, wherein the internucleotide linkage between X2and X3is a phosphorothioate.
37. The oligonucleotide of any one of claims 1 to 36, wherein the internucleotide linkage between the nucleotide at position -2 and X1is a phosphorothioate or a phosphodiester linkage.
38. The oligonucleotide of claim 37, wherein the internucleotide linkage between the nucleotide at position -2 and X1is a phosphorothioate.
39. The oligonucleotide of any one of claims 1 to 38, wherein the internucleotide linkage between the nucleotide at position -9 and the nucleotide at position -8 is a phosphoramidate.
40. The oligonucleotide of any one of claims 1 to 39, wherein the internucleotide linkage between the nucleotide at position -11 and the nucleotide at position -10 is a phosphoramidate.
41. The oligonucleotide of any one of claims 1 to 40, wherein the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2 is a phosphoramidate.
42. The oligonucleotide of any one of claims 1 to 41, wherein the internucleotide linkage between the nucleotide at position +4 and the nucleotide at position +5 is a phosphoramidate.
43. The oligonucleotide of any one of claims 1 to 42, wherein the internucleotide linkage between the nucleotide at position +5 and the nucleotide at position +6 is a phosphoramidate.
44. The oligonucleotide of any one of claims 1 to 43, wherein the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 is a phosphoramidate.
45. The oligonucleotide of claim 44, wherein the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2 and the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 are a phosphoramidate.
46. The oligonucleotide of claim 44 or 45, wherein the internucleotide linkage between the nucleotide at position +1 and the nucleotide at position +2, the internucleotide linkage between the nucleotide at position +5 and the nucleotide at position +6, and the internucleotide linkage between the nucleotide at position +9 and the nucleotide at position +10 are a phosphoramidate.
47. The oligonucleotide of any one of claims 1 to 46, wherein n+m is 27.
48. The oligonucleotide of any one of claims 1 to 47, wherein n+m is 39.
49. The oligonucleotide of any one of claims 1 to 48, wherein n is 4, 5, 6, 7, 8, or 9.
50. The oligonucleotide of claim 49, wherein n is 4.
51. The oligonucleotide of claim 49, wherein n is 5.
52. The oligonucleotide of claim 49, wherein n is 9.
53. The oligonucleotide of any one of claims 1 to 52, wherein the A / B sugar at position +3 is a 2'-fluororibose.
54. The oligonucleotide of any one of claims 1 to 53, wherein the A / B sugar at position -5 is a 2'-fluororibose.KB-049-WO Docket No. 33791 / 4104955. The oligonucleotide of any one of claims 1 to 54, wherein the A / B sugar at position -16 is a 2'-fluororibose.
56. The oligonucleotide of any one of claims 1 to 55, wherein the A / B sugar at position -20 is a 2'-fluororibose.
57. The oligonucleotide of any one of claims 1 to 56, wherein the A / B sugar at each of positions -5, -16, and -20 is a 2'-fluororibose.
58. The oligonucleotide of any one of claims 1 to 57, wherein the A / B sugar at each of positions +3, -5, -16, and -20 is a 2'-fluororibose.
59. The oligonucleotide of any one of claims 1 to 58, having a GalNAc moiety at the 5' end.
60. The oligonucleotide of any one of claims 1 to 59, having a GalNAc moiety at the 3' end.
61. The oligonucleotide of any one of claims 1 to 60, wherein at least one phosphoramidate is a mesyl phosphoramidate.
62. The oligonucleotide of claim 61, wherein each phosphoramidate is a mesyl phosphoramidate.
63. The oligonucleotide of any one of claims 1 to 62, sufficiently complementary to part of a target RNA having a target adenosine and capable of forming a complex with the target RNA.
64. The oligonucleotide of claim 63, wherein, upon formation of the complex with the target RNA, the nucleotide of the oligonucleotide opposite the target adenosine is X2.
65. The oligonucleotide of claim 63 or 64, capable of binding and recruiting an ADAR enzyme to perform editing on the target adenosine of the target RNA.
66. The oligonucleotide of any one of claims 1 to 65, wherein the oligonucleotide does not comprise a portion that is capable of forming an intramolecular stem-loop structure.
67. The oligonucleotide of any one of claims 1 to 65, comprising a portion that is capable of forming an intramolecular stem-loop structure.
68. An oligonucleotide comprising the structure:[Am]-X1-X2-X3-[Bn]whereinm+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises an ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage; and(1) the X2sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-KB-049-WO Docket No. 33791 / 41049aminopropyl ("nr”), Dh 2'-(R)-di methyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (“MK4”), 2’-O-acetamide (“na”), or MCP (" M3”).
69. An oligonucleotide comprising the structure:[Am]-X1-X2-X3-[Bn]whereinm+n is 24 to 100, n is at least 4, and m is at least 20;-X1-X2-X3- is a Central Triplet of the oligonucleotide;X1is position -1 of the oligonucleotide, X2is position 0 of the oligonucleotide, and X3is position +1 of the oligonucleotide;[A]mis a first domain at positions -(m+1) to -2 of the oligonucleotide, and the first domain comprises an ADAR recruiting domain;[B]nis a second domain at positions +2 to +(n+1) of the oligonucleotide;each A and B is a nucleotide comprising a nucleobase, a sugar ("an A / B sugar”), and an internucleotide linkage;each of X1, X2, and X3comprises a nucleobase, a sugar, and an internucleotide linkage; and(1) the X3sugar is a CeNA, a HNA, a 2'MCE, deoxyhexose (Dh), 2'-0 (N-Me Propionamide) ("dp”), 2'-aminopropyl ("nr”), Dh 2'-(R)-di methyl NMA ("rDhNdMA”), Dh 2'-(R)-NMA ("rDhNMA”), Dh 2'-(R)-Nme propionamide ("rDhNMP”), 2'-O-NMA (" NMA”), MCE-morpholino (“MK4”), 2’-O-acetamide ("na”), or MCP (" M3”).
70. A complex comprising the oligonucleotide of any one of claims 1 to 69 and a target RNA, the complex formed by hybridization between the oligonucleotide and the target RNA.
71. The complex of claim 70, comprising 1, 2, 3, 4, or 5 mismatches, wobbles, insertions or deletions.
72. A method of editing a target adenosine in a target RNA in a cell comprising contacting the cell with the oligonucleotide of any one of claims 1 to 70 to (i) form a complex between the oligonucleotide and the target RNA such that X2of the oligonucleotide is opposite the target adenosine; and (ii) recruit an ADAR in the cell to the complex such that the ADAR edits the target adenosine.
73. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1 to 70 and a pharmaceutically acceptable excipient.
74. The pharmaceutical composition of claim 73, wherein the oligonucleotide is encapsulated in a lipid nanoparticle (LNP).