Engineered DNA molecule encoding mRNA

Abstract

Provided is an optimized poly(A) sequence, which exhibits high stability during in-vitro replication of a DNA molecule encoding a mRNA and can increase the expression level of the mRNA in cells. The present application further relates to the use of the poly(A) sequence.

Description

An engineered DNA molecule encoding mRNA

[0001] Cross-reference of related applications

[0002] This disclosure claims priority to Chinese Patent Application No. 2024119239573, filed on December 25, 2024, entitled "An Engineered DNA Molecule Encoding mRNA", the entire contents of which are incorporated herein by reference. Technical Field

[0003] This application relates to the field of biotechnology, specifically to a poly(A) sequence. Background Technology

[0004] Poly(A) nucleotides, also known as poly(A), refer to polymers consisting of 20 or more adenosine mononucleotides linked by 3',5'-phosphodiester bonds. In eukaryotes, almost every mRNA has a poly(A) nucleotide at its tail. Studies have shown that the poly(A) tail binds to polyadenylation-binding protein (PABPC) in the cytoplasm, promoting translation and preventing mRNA degradation (decay). In other words, the poly(A) tail significantly promotes mRNA stability and sustained expression.

[0005] On the other hand, polyadenylation is a post-transcriptional regulatory mechanism, and its purpose and mechanism vary in different cell types. Generally, polyadenylation can increase the lifespan of eukaryotic transcripts and promote the degradation of prokaryotic transcripts.

[0006] Regarding the length of polyadenylated nucleotides, current research indicates that:

[0007] 1. The average length of a poly(A) tail in mammals is about 200 nt, while the average length of a poly(A) tail in yeast is about 70 nt.

[0008] 2. The relationship between poly(A) tail length, translation efficiency, and mRNA stability is not a simple linear one;

[0009] For developers of mRNA drugs, one of the key steps in the in vitro preparation of mRNA drugs is the synthesis of mRNA through in vitro transcription (IVT) using a linearized plasmid containing the gene expression product as a template. The poly(A) tail is typically added downstream of the 3'UTR via co-transcription. To achieve co-transcription of the poly(A), the template plasmid needs to contain a corresponding poly(dA:dT) sequence. However, in many cases, the poly(dA:dT) repeat sequence in the amplified plasmid is unstable during replication in *E. coli*, frequently resulting in deletion mutations or replication errors due to homologous recombination, ultimately leading to a shortened poly(dA:dT). This poly(A) truncation significantly affects the in vivo stability and biological activity of mRNA. This phenomenon is detrimental to the preparation process of in vitro transcription template plasmids for large-scale fermentation production, and the aforementioned problems severely impact batch-to-batch consistency in subsequent CMC (Continuous Mixture Control) process scale-up stages.

[0010] In summary, the poly(A) tail protects the cap structure from degradation and works synergistically with poly(A)-binding proteins, the 5' cap (cap structure), and translation initiation factor proteins to initiate protein translation. Therefore, the sequence design and optimization of the poly(A) tail are crucial for the preparation and optimization of subsequent mRNA products. Currently, there is still significant room for improvement in the design of the poly(A) tail. Summary of the Invention

[0011] To improve replication stability during in vitro preparation and the efficiency and sustainability of in vitro / in vivo expression, the inventors conducted extensive research on the structure of poly(A) and provided a novel poly(A) tail.

[0012] In a first aspect, the present invention relates to a poly(A) tail element for constructing an mRNA transcription template, wherein the nucleotide sequence of the poly(A) tail element is as shown in SEQ ID NO:1-4 or has at least 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in SEQ ID NO:1-4.

[0013] In a specific implementation, the poly(A) tail element is able to maintain ≥90% integrity during cell expansion, and the translation level of the transcribed mRNA is at least 20% higher than that of the C-free control poly(A) tail.

[0014] In a specific embodiment, the nucleotide sequence of the poly(A) tail element is shown in SEQ ID NO:1-4.

[0015] Secondly, this application provides engineered nucleic acid molecules that can be replicated in cells.

[0016] Its 5' to 3' direction includes the following parts:

[0017] (a) Promoter;

[0018] (b) A transcribed nucleic acid sequence or a nucleic acid sequence used to introduce a transcribed nucleic acid sequence;

[0019] (c) poly(A) tail element, which, when transcribed under the control of promoter (a), encodes a nucleotide sequence of 150-160 consecutive nucleotides in a transcript, wherein at least 150 nucleotides in the transcript are A, the consecutive nucleotides contain nucleotides other than A, and the nucleotides other than adenosine are C.

[0020] In some implementations, the length of the poly(A) tail element is 150nt-160nt, for example 150nt, 151nt, 152nt, 153nt, 154nt, 155nt, 156nt, 157nt, 158nt, 159nt, 160nt.

[0021] In a specific implementation, the nucleotide other than A can be a single nucleotide or multiple nucleotides.

[0022] In some embodiments, the nucleotides other than A are located in the region of positions 30 to 121, preferably positions 60 to 121, and more preferably positions 60 to 91 of the poly(A) tail element.

[0023] In some implementations, the position is measured from the 5' to 3' direction.

[0024] In some implementations, the number of nucleotides other than A is no more than four, preferably no more than three, and more preferably no more than two nucleotides other than A.

[0025] In some implementations, multiple nucleotides other than A are distributed sequentially.

[0026] In some implementations, multiple nucleotides other than A are spaced apart.

[0027] In some embodiments, the poly(A) tail element sequence is selected from: A120-C-A30, A90-C-A60, A75-C-A75, and A60-C-A60-C-A30. A "-" indicates that the two elements are directly connected, meaning there is no nucleotide between them; in AX, X represents the number of consecutive adenosine nucleotides. For example, A120-C-A30 represents 120 consecutive A's, 1 C', and 30 consecutive A's from the 5' to 3' direction.

[0028] In some embodiments, the poly(A) tail element is a nucleotide sequence as shown in SEQ ID NO:1-4 or a nucleotide sequence having more than 95%, more than 96%, more than 97%, more than 98%, or more than 99% sequence homology with the nucleotide sequence shown in SEQ ID NO:1-4, or a variant of said nucleotide sequence.

[0029] In some implementations, the nucleic acid molecule is a DNA molecule.

[0030] In one embodiment, the nucleic acid molecule is an expression vector or plasmid, such as an IVT vector, or a plasmid based on pUC, pTZ, pMB1, or pCoIE1.

[0031] In some implementations, the nucleic acid sequence (b) and poly(A) tail element (c) under the control of promoter (a) can be transcribed to produce a common transcript.

[0032] In some embodiments, the nucleic acid molecules of the present invention are closed circular molecules or linear molecules.

[0033] In some implementations, the transcribed nucleic acid sequence contains a nucleic acid sequence encoding a peptide or protein.

[0034] In a specific implementation, the nucleic acid sequence used to introduce the transcribed nucleic acid sequence is a multiple cloning site.

[0035] In some embodiments, the nucleic acid molecule of the present invention further comprises one or more members selected from the group consisting of: (i) a reporter gene; (ii) a selection marker; and (iii) a replication origin.

[0036] In some embodiments, the nucleic acid molecules of the present invention are used for the in vitro transcription of RNA (e.g., mRNA).

[0037] In some specific embodiments, the use further includes transient gene expression.

[0038] In some specific embodiments, the use further includes preparation of RNA vaccines (such as anti-tumor mRNA vaccines).

[0039] In some specific embodiments, the use further includes in vitro transfection into cells or direct in vivo administration.

[0040] In some specific embodiments, the use further includes transient in vivo expression of functional recombinant proteins.

[0041] In some more specific embodiments, the use further includes a therapeutic tool for enzyme replacement therapy (ERT) or protein replacement therapy (PRT), for example, as a medicine.

[0042] In some specific implementations, the nucleic acid molecule (e.g., mRNA) can replace, increase, or promote the expression of proteins or their bioactive fragments in vivo.

[0043] In some specific embodiments, the nucleic acid molecule (e.g., mRNA) can be specifically used to transfect antigen-presenting cells and as a tool for presenting antigens, the antigens to be presented corresponding to peptides or proteins expressed by the mRNA; the antigen-presenting cells can be used to stimulate T cells, particularly CD4, in vivo or in vitro. + and / or CD8 + T cells.

[0044] In some embodiments, the coding region of the gene is replaceable and may encode pathogen antigens or functional fragments thereof, tumor neoantigens, tumor-associated antigens, but is not limited thereto.

[0045] Thirdly, the present invention relates to an mRNA transcription template construct having the structure shown in Formula I:

[0046] E1-E2-E3-E4-E5-E6-E7(I)

[0047] In this context, E1 and E7 are either absent or restriction enzyme sites; E2 is either absent or a promoter element or an internal ribosome entry site sequence (IRES); E3 is a 5'UTR element; E4 is a replaceable coding region; E5 is a 3'UTR element; and E6 is the poly(A) tail element of this invention.

[0048] In some implementations, the construct further includes a 5' cap.

[0049] In some implementations, E1 and E7 are blunt-end restriction enzyme sites or sticky-end restriction enzyme sites.

[0050] In some embodiments, the 5'UTR includes: a kozak sequence (GCCACC), a human α-globin 5'UTR sequence, or a human β-globin 5'UTR sequence.

[0051] In other embodiments, the 3'UTR is a 3'UTR derived from the genes ACTG1, ATP6V0B, ATP6V0E1, CFL1, COX4I1, CTSB, FAM166A, or NDUFB9; and the 5'UTR is a 5'UTR derived from the genes ACTG1, ATP6V0B, ATP6V0E1, CFL1, COX4I1, CTSB, FAM166A, NDUFB9, CHCHD10, SLC38A2, NDUFA11, NDUFV3, PRDX5, GUK1, IAH1, ABHD16A, SLC25A39, ATPIF1, ANAPC11, CCDC12, MRPL14, or APOA1BP.

[0052] In some implementations, the 5' cap is selected from the group consisting of:

[0053] ARCA, 3'-O-Me-m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pU, m7Gppp(A2'O-MOE)pG, m7G(5')ppp(5')(2'OMe A) pG, m7G(5')ppp(5')(2'OMeG)pG, m7(3'OMeG)(5')ppp(5')(2'OMeG)pG or m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

[0054] In some implementations, the promoter includes: SP6 promoter, CAG promoter, UBC promoter, CMV promoter, U6 promoter, EF1a promoter, PGK1 promoter, TRE promoter, Ac5 promoter, UAS promoter, SV40 promoter, ADH1 promoter, CaMV35S promoter, Ubi promoter, Lac promoter, T3 or T7 polymerase promoter.

[0055] In some implementations, E4 is a protein-coding gene used for the prevention and / or treatment of infectious diseases, rare genetic diseases, neurodegenerative diseases, retinal diseases, cancer, or tumors.

[0056] In some implementations, E6 is selected from: A120-C-A30, A90-C-A60, A75-C-A75, A60-C-A60-C-A30.

[0057] Fourthly, the present invention relates to an mRNA having the structure shown in Formula II:

[0058] C1-C2-C3-C4-C5-C6(II)

[0059] in,

[0060] C1 is a 5' cap element;

[0061] C2 is either absent or an internal ribosome entry site sequence (IRES);

[0062] C3 is a 5'UTR element;

[0063] C4 is the replaceable encoding area;

[0064] C5 is a 3'UTR element;

[0065] C6 is the poly(A) tail element of this invention.

[0066] Fifthly, the present invention provides a vector containing the mRNA transcription template construct or poly(A) tail element of the present invention.

[0067] In some embodiments, the vector is selected from the group consisting of DNA, RNA, viral vectors, plasmids, transposons, or combinations thereof.

[0068] In a sixth aspect, the present invention provides a host cell containing the vector of the present invention.

[0069] In some implementations, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0070] In other implementations, the host cell is selected from the group consisting of Escherichia coli, yeast cells, and mammalian cells.

[0071] In a seventh aspect, the present invention provides a method for obtaining nucleic acid molecules, comprising:

[0072] (1) Providing the nucleic acid molecule (e.g., DNA or RNA) of the present invention; and

[0073] (2) Cultivate host cells containing the nucleic acid molecules.

[0074] Eighthly, the present invention relates to a method for obtaining RNA, comprising:

[0075] The method for obtaining nucleic acid molecules according to the present invention yields nucleic acid molecules; and

[0076] RNA is transcribed in vitro using nucleic acid molecules as templates.

[0077] Ninthly, the present invention also relates to a method for obtaining peptides or proteins, comprising:

[0078] The method for obtaining RNA according to the present invention obtains mRNA encoding peptides or proteins;

[0079] And the translation of mRNA.

[0080] In a tenth aspect, the present invention also relates to a pharmaceutical composition comprising the poly(A) tail element of the present invention, a nucleic acid molecule or mRNA transcription template construct of the present invention, and optionally a pharmaceutically acceptable vector.

[0081] In some embodiments, the pharmaceutical composition is typically provided in a uniform dosage form and can be prepared in a manner known in the art; the pharmaceutical composition may be, for example, in the form of a solution or suspension.

[0082] In some embodiments, the pharmaceutical composition may contain salts, buffers, preservatives, diluents, and / or excipients, all of which are preferably pharmaceutically acceptable.

[0083] The term "pharmaceutical acceptable" refers to the non-toxicity of materials that do not interfere with the action of the active ingredient in a pharmaceutical composition.

[0084] In some embodiments, the pharmaceutically acceptable salt includes, but is not limited to, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc.

[0085] Eleventhly, the invention provides the use of engineered nucleic acid molecules or poly(A) tail elements or mRNA transcription template constructs or vectors that can be replicated in cells, host cells containing said vectors, or pharmaceutical compositions of the invention for increasing the transcription and expression of recombinant proteins in cells.

[0086] In some implementations, when producing recombinant proteins, the vectors of the present invention can be used to transcribe recombinant nucleic acids and express recombinant proteins in a cell-based system, including, for example, recombinant antibodies, hormones, cytokines, enzymes, etc.

[0087] In some embodiments, the nucleic acid molecule or mRNA transcription template construct of the present invention is used for gene therapy. Therefore, the nucleic acid molecule or mRNA transcription template construct of the present invention can be a gene therapy vector and used for transgenic expression; based on this, any nucleic acid-based vector system (e.g., DNA, RNA) can be used (e.g., plasmids, adenoviruses, poxvirus vectors, influenza virus vectors, alphavirus vectors, etc.). Cells can be transfected in vitro with these vectors, for example in lymphocytes or dendritic cells, or by direct administration in vivo transfection.

[0088] In some more specific embodiments, the nucleic acid molecule (e.g., RNA) or mRNA transcription template construct of the present invention can be used, for example, for transient expression of exogenous genes, and a possible application area is RNA-based vaccines.

[0089] In some more specific embodiments, the nucleic acid molecule or mRNA transcription template construct of the present invention is transfected into cells in vitro or administered to directly express functional recombinant proteins in vivo or in vitro, for example, to initiate cell differentiation processes or to study protein function, and to transiently express functional recombinant proteins such as erythropoietin, hormones, coagulation inhibitors, etc.

[0090] In some more specific embodiments, the nucleic acid molecules (such as RNA) of the present invention can be specifically used for transfecting antigen-presenting cells. Thus, they serve as tools for delivering antigens to be presented and loading antigen-presenting cells, the antigens corresponding to or derived from peptides or proteins expressed from said antigens, particularly through intracellular processing such as cleavage, i.e., the antigens to be presented are, for example, fragments of peptides or proteins expressed from RNA. Such antigen-presenting cells can be used to stimulate T cells, particularly CD4 cells. + and / or CD8 + T cells.

[0091] In some more specific embodiments, the nucleic acid molecule (e.g., RNA) or mRNA transcription template construct of the present invention is used to transfect host cells.

[0092] In some embodiments, the host cell is an antigen-presenting cell, preferably a dendritic cell, a monocyte-macrophage, a B cell, or a Langerhans cell, and more preferably a dendritic cell.

[0093] In some embodiments, the nucleic acid molecule or mRNA transcription template construct of the present invention is used for vaccination.

[0094] In some implementations, the vaccine includes: a DNA vaccine, a recombinant protein vaccine, an RNA vaccine, preferably an RNA vaccine, more preferably an mRNA vaccine, and most preferably an mRNA DC vaccine.

[0095] In a twelfth aspect, the use of the engineered nucleic acid molecule or poly(A) tail element or mRNA transcription template construct or vector that can be replicated in cells, a host cell containing said vector, or a pharmaceutical composition of the present invention in improving the amplification stability of poly(A) structures is provided.

[0096] The polyA functional element involved in this application has the following advantages:

[0097] 1. This poly(A) structure can be used for large-scale formulation production, solving the technical problems of plasmid instability and tail mutation in mRNA vaccine production.

[0098] 2. In clinical applications, it can provide stronger and longer antigen expression, making it particularly suitable for personalized tumor neoantigen vaccines.

[0099] 3. Insertion of only a small number of C molecules can significantly improve the half-life and translation efficiency of the mRNA containing poly(A). Attached Figure Description

[0100] Figure 1: MFI results of EGFP average fluorescence intensity.

[0101] Figure 2: Comparison of experimental results on the amplification stability of different poly(A) structures. Detailed Implementation

[0102] definition:

[0103] Unless otherwise stated, all technical terms used herein are as defined herein; where not defined herein, terms shall have the same meaning as understood by one of ordinary skill in the art. For an explanation of the meanings understood in the art, please refer to Current Protocols in Molecular Biology (Ausubel).

[0104] For numerical values, this invention indicates numerical ranges and approximate parameter values ​​in a broad sense, or, in specific embodiments, describes them with the most accurate values ​​possible. However, any numerical value inherently contains a certain degree of error due to the standard deviation present in their respective measurements. Furthermore, all ranges disclosed herein should be understood to encompass any and all subranges contained therein. For example, the stated range “1 to 10” should be considered to include any and all subranges between the minimum value 1 and the maximum value 10 (inclusive); that is, all subranges starting with a minimum value of 1 or greater, such as 1 to 6.1, and subranges ending with a maximum value of 10 or less, such as 5.5 to 10. Additionally, any references referred to as “incorporated herein” should be understood to be incorporated herein in their entirety.

[0105] The term "nucleic acid" refers to deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), or the term "nucleic acid molecule" includes genomic DNA, cDNA, and RNA (such as mRNA). Nucleic acid molecules can be recombinant or chemically synthesized molecules. According to the present invention, nucleic acid molecules can be in the form of single-stranded or double-stranded linear or covalently closed circular molecules. The term "nucleic acid molecule" according to the present invention also includes the chemical derivatization of nucleic acids at nucleotide bases, sugars, or phosphate groups, as well as nucleic acid molecules containing non-natural nucleotides and nucleotide analogs.

[0106] The term "mRNA" refers to "messenger RNA" and relates to transcripts that encode peptides or proteins, produced using a DNA template. Typically, mRNA contains a 5' UTR, a protein-coding region, a 3' UTR, and a poly(A) tail. mRNA can be produced from a DNA template via in vitro transcription. In vitro transcription methods are known to those skilled in the art. For example, various in vitro transcription kits are commercially available. According to the invention, in addition to the modifications according to the invention, mRNA can also be modified by further stabilizing modifications and capping.

[0107] The term "variant" includes any variant, particularly mutants, splice variants, conformations, isomers, allele variants, species variants, and species homologs. Allele variants involve alterations to the normal sequence of a gene; complete gene sequencing often identifies numerous allele variants of a given gene. Species homologs are nucleic acid or amino acid sequences that have a different species origin than a given nucleic acid or amino acid sequence. According to the invention, nucleic acid variants comprise single or multiple nucleotide deletions, additions, mutations, and / or insertions compared to a reference nucleic acid. Deletions include the removal of one or more nucleotides from the reference nucleic acid. Addition variants comprise 5' and / or 3' fusions of one or more nucleotides (e.g., 1, 2, 3, 5, 10, 20, 30, 50, or more nucleotides). Mutations may include, but are not limited to, substitutions, where at least one nucleotide in the sequence is removed and another nucleotide is inserted at its position (e.g., transversion and transition); base-free sites; cross-linking sites; and chemically altered or modified bases. Insertions include the addition of at least one nucleotide to the reference nucleic acid. For nucleic acid molecules, the term "variant" further includes degenerate nucleic acid sequences, wherein the degenerate nucleic acid sequences according to the invention are nucleic acids that differ from the reference nucleic acid in the codon sequence due to the degeneracy of the genetic code.

[0108] The terms “homology,” “identity,” or other similar expressions are used interchangeably herein to refer specifically to the percentage of identical nucleotides in an optimal alignment between two sequences to be compared, where the differences between the two sequences can be randomly distributed throughout the entire length of the sequence, and the sequence to be compared may contain additions or deletions to achieve an optimal alignment compared to a reference sequence. The comparison of two sequences is typically performed by comparing the sequences against segments or “comparison windows” after optimal alignment to identify local regions of the corresponding sequences. Optimal alignment for comparison can be performed manually or by means of computer programs using the algorithm described herein (GAP, BESTFIT, FASTA, BLASTP, BLASTN, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 ScienceDrive, Madison, Wis.).

[0109] The term "3'-untranslated region" refers to the region located at the 3' end of a gene, downstream of the stop codon in a protein-coding region, that is transcribed but not translated into an amino acid sequence, or the corresponding region in an RNA molecule.

[0110] The terms “poly(A)”, “poly(A)”, “poly(A) tail”, or “poly(A) tail” are used interchangeably and refer to a sequence of adenosine residues typically located at the 3' end of an RNA molecule. This invention allows such sequences to be attached to the RNA during transcription via a DNA template based on repeating thymidine residues in a strand complementary to the coding strand; however, these sequences are not normally encoded in DNA but are attached to the free 3' end of RNA post-transcriptionally in the cell nucleus by template-independent RNA polymerase. In this document, “poly(A)” may contain one or more non-A nucleotide residues. “A” refers to an adenosine residue. Non-A nucleotide residues include, for example, G, C, and U.

[0111] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0112] Example 1: Candidate poly(A) sequence design and mRNA preparation

[0113] 1.1 poly(A) sequence design

[0114] The following sequences to be detected were obtained by design:

[0115] Table 1: polyA sequences involved in this application

[0116] 1.2 mRNA preparation

[0117] (1) Plasmid modification: Different poly(A) tails corresponding to A107, A108, A109, A110, and A057 were ligated into the EGFP reporter gene expression vector using the restriction endonucleases PacI and EcoRI via T4 ligase. The reporter gene expression vector contains the T7 promoter-5'UTR-d2EGFP-3'UTR-poly(A) element.

[0118] (2) Plasmid transformation: The constructed plasmid was transformed into competent Escherichia coli cells and cultured overnight on solid LB medium supplemented with Kana. Single clones were picked and cultured on Kana-resistant LB medium for 6-14 hours.

[0119] (3) Plasmid extraction: Plasmids were extracted using a plasmid extraction kit.

[0120] (4) Plasmid linearization: Plasmids are linearized by BspQI digestion. The purified linearized plasmids will be used as templates for in vitro transcription of mRNA.

[0121] (5) mRNA preparation: Linearized plasmid, nucleotide raw materials, T7 RNA polymerase and cap analogue were added to the reaction buffer system in a certain proportion, mixed well and incubated at 37°C for 2 h. After the reaction was completed, the mixture was incubated with DNase I at 37°C for 15 min to obtain crude mRNA product.

[0122] (6) The purified mRNA was obtained by purification with magnetic beads and washing with 70% ethanol. The prepared mRNA was tested for multiple quality standards, including concentration, purity, capping rate, dsRNA ratio, and poly(A) ratio. The quality-controlled mRNA was frozen at -80℃ and subsequently used for electroporation of cells.

[0123] Table 2: Structure of Important Components

[0124] Example 2: Comparative Study of Exogenous Protein Expression with Different Poly(A) Structures

[0125] 2.1 293T cell culture

[0126] (1) Cell resuscitation: Remove 293T cells from the liquid nitrogen storage tank and gently shake the cryovial in a 37°C water bath until a small piece of ice remains in the tube. Wipe the cryovial with a 75% alcohol cloth and place it in a biosafety cabinet. Transfer a certain volume of DMEM (Gibco) medium to a 50mL centrifuge tube, transfer the 293T cells from the cryovial to the centrifuge tube, invert several times to mix, and centrifuge at 1000rpm for 5min at room temperature.

[0127] (2) Counting culture: Discard the supernatant, resuspend the cell pellet in DMEM complete medium (DMEM medium supplemented with 10% FBS and 1% antibiotics), mix well, and count. Add 15 mL of DMEM complete medium to a culture dish (100*20 mm) using a pipette, and take 6E+06 cells into the culture dish according to the counting results. Shake the culture dish until the cells are evenly distributed, label the cell batch number, and incubate at 37.0℃ in a 5.0% CO2 incubator for 20-24 h.

[0128] (3) Cell passage: Remove the culture dish from the incubator and place it in a biosafety cabinet. Carefully aspirate the culture medium with a pipette. Slowly add 10 mL of PBS (Vivacell) along the side of the culture dish, gently shake the dish to wash away the culture medium, and aspirate the PBS. Slowly add 1.5 mL of trypsin (Gibco) along the side of the culture dish and digest at room temperature for 2 min. After digestion, add 10 mL of DMEM complete culture medium to stop the digestion. After aspirating the cells in the culture dish a few times, transfer them to a centrifuge tube and centrifuge at 1000 rpm for 5 min at room temperature. Discard the supernatant, resuspend the cell pellet in DMEM complete culture medium, and mix 20 μL of the cell suspension with 20 μL of AO / PI by pipetting and counting. Seed several culture dishes according to the cell volume required for electroporation. Using a pipette, add 24 mL of DMEM complete culture medium to each culture dish (150*20 mm). Based on the counting results, take 1.2E+07 cells into the culture dish, shake the culture dish until the cells are evenly distributed, and then place it in a 37.0℃, 5.0% CO2 incubator for 20-24 h before harvesting the cells.

[0129] 2.2 Cell electroporation

[0130] (1) Five groups of mRNAs were used for electroporation, namely A057m, A107m, A108m, A109m and A110m. The electroporation dose of each group of mRNAs was 8 μg and the total electroporation volume was 200 μL. The prepared electroporation system was transferred to an electroporation cuvette and electroporated using a cell electroporator.

[0131] (2) After electroporation, the cells in the electroporation cup were resuspended three times with 1 mL of DMEM complete medium. The cells were counted and seeded into culture plates according to the counting results. The culture plates were shaken until the cells were evenly distributed. The cells were cultured in a 37.0℃, 5.0% CO2 incubator for 24 h before protein detection.

[0132] 2.3 Protein Expression Detection

[0133] (1) Collect cell samples from each electroporation group and centrifuge at 1000 rpm for 5 min at room temperature;

[0134] (2) Discard the supernatant, add 1 mL of FACS buffer (PBS containing 2% FBS) to each group to resuspend the cell pellet, centrifuge at 1000 rpm for 5 min at room temperature; discard the supernatant, resuspend the cell pellet with 200 μL of FACS buffer and detect EGFP expression by flow cytometry.

[0135] The results showed that the protein expression at different time points after electroporation of different mRNAs into mDCs was similar (see Figure 1 and Table 3). The difference in GFP positivity rate among the electroporation groups was not significant, indicating that most cells in each electroporation group could express GFP protein. However, the mRNAs with a poly(A) length of about 150 nt (A107m, A108m, A109m, A110m) showed significantly better protein expression than the poly(A) length of about 120 nt (A057m). This means that the expression vector containing the poly(A) of this invention can express exogenous proteins more effectively.

[0136] Table 3 Protein expression results

[0137] Example 3: Comparative Study on the Amplification Stability of Different Poly(A) Structures

[0138] This experiment investigated the proportion of expression units with different poly(A) structures that maintained intact poly(A) structures during expression in different competent cells (TOP10 or Stable). Taking TOP10 competent cells as an example, the specific steps are as follows:

[0139] 3.1 Plasmid transformation of competent cells and detection of poly(A) expression levels.

[0140] 1. Dilute the plasmid to 5 ng / μl;

[0141] 2. Add 2 μl of diluted plasmid to each competent cell, mix well by pipetting, incubate on ice for 30 min, and then heat shock in a water bath at 42°C for 90 s.

[0142] 3. After the heat shock, place the competent cells back on ice and let them stand for 3 minutes.

[0143] 4. Add 900 μl of antibiotic-free LB medium to each competent cell, mix by inversion, and incubate in a shaking incubator at 30℃ and 220 rpm for 1 h.

[0144] 5. Take 50 μl of antibiotic-free LB medium into a 1.5 ml EP tube, and add 150 μl of bacterial culture to 50 μl of antibiotic-free LB medium and mix well;

[0145] 6. Take 100 μl of bacterial culture from a 1.5 ml EP tube and add it to a preheated LB (Kana resistant) solid medium plate. Spread the medium evenly with a spreader until the surface is dry. Invert the plate and place it in an electric incubator for 20-23 hours.

[0146] 7. Pick 10 single clones from the plate and add them to a final concentration of 50 μg / mL of Kanamycin. +In LB medium, incubate at 30°C and 220 rpm for 8 hours;

[0147] 8. Collect the bacterial culture, extract the plasmid according to the kit instructions, and perform poly(A) detection using PCR. The PCR procedure is as follows:

[0148] Table 4: PCR Procedure

[0149] The relevant primer sequences are:

[0150] Primer1:CCCCACTCACCACCTCTGCT(SEQ ID NO:6)

[0151] Primer2:GCGCCGAATTCAAACAAACA(SEQ ID NO:7)

[0152] The experimental results are shown in Figure 2. Based on the experimental results, for different competent cells (TOP10 or Stable), the 150A proportion of the poly(A) structure obtained in this application after overnight amplification is very high, and the proportion of 150poly(A) is still ≥90% in the vast majority of cases, which can meet the requirements of subsequent scaling-up processes.

[0153] Based on the above experimental data, it can be concluded that the poly(A) tail with a length of approximately 150 Å obtained in this application can significantly improve the stability of exogenous protein expression and effectively solve the problem of poly(dA:dT) shortening during the replication of DNA plasmids containing related elements. This improves the batch-to-batch consistency and product homogeneity of large-scale in vitro mRNA preparation, achieving unexpected technical effects. Related experiments demonstrate that inserting non-A ribonucleotides into the poly(A) tail can slow down deadenylation and delay mRNA degradation in a transcriptome-specific manner, while simultaneously increasing the expression intensity of synthesized mRNA.

[0154] The above description is merely a preferred embodiment of the present invention, used to more clearly illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Those skilled in the art can make various equivalent substitutions or modifications to the above embodiments without departing from the core idea of ​​the present invention, and these should all be considered to fall within the scope of protection of the present invention. The scope of protection of the present invention is defined by the appended claims.

Claims

1. A poly(A) tail element, characterized in that, The nucleotide sequence of the poly(A) tail element is as shown in SEQ ID NO:1-4 or has at least 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence shown in SEQ ID NO:1-4.

2. The poly(A) tail element of claim 1, wherein the nucleotide sequence of the poly(A) tail element is as shown in SEQ ID NO:1-4.

3. An mRNA transcription template construct having the structure shown in formula (I): E1-E2-E3-E4-E5-E6-E7(I) in, E1 and E7 are absent or restriction enzyme sites; E2 is absent or a promoter element or internal ribosome entry site sequence (IRES); E3 is a 5' UTR element; E4 is a replaceable coding region; E5 is a 3' UTR element; E6 is a poly(A) tail element as described in claim 1 or 2.

4. The mRNA transcription template construct according to claim 3, wherein, The nucleotide sequence of the poly(A) tail element is shown in SEQ ID NO:1-4.

5. A vector containing a poly(A) tail element as described in claim 1 or 2, or an mRNA transcription template construct as described in claim 3 or 4.

6. A host cell containing the vector as described in claim 5.

7. A pharmaceutical composition comprising a poly(A) tail element as described in claim 1 or 2 or an mRNA transcription template construct as described in claim 3 or 4, and optionally a pharmaceutically acceptable vector.

8. Use of the poly(A) tail element of claim 1 or 2, or the mRNA transcription template construct of claim 3 or 4, or the vector of claim 5, or the host cell of claim 6, or the pharmaceutical composition of claim 7, in the in vitro transcription of RNA.

9. The use as described in claim 8, further comprising: Used for transient gene expression; and / or Used for the preparation of RNA vaccines; and / or For use in vitro transfection into cells or direct in vivo administration; and / or For transient in vivo expression of functional recombinant proteins.

10. The use as described in claim 9, wherein, The RNA vaccine is an mRNA vaccine, preferably an mRNA DC vaccine, and more preferably an mRNA anti-tumor DC vaccine.

Images