Polynucleotide for enhancing polypeptide expression, and nucleic acid construct and use thereof

By designing nucleotide sequences that enhance peptide expression using the L7S5 sequence, the delivery and production cost issues of CAR-T cell therapy in solid tumor treatment were resolved, resulting in increased peptide expression and enhanced therapeutic efficacy.

WO2026139059A1PCT designated stage Publication Date: 2026-07-02MAXIRNA (SHANGHAI) PHARM CO LTD +3

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MAXIRNA (SHANGHAI) PHARM CO LTD
Filing Date
2025-12-26
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Existing CAR-T cell therapies face anatomical and physiological barriers in treating solid tumors, making it difficult for T cells to be delivered to the tumor site and limiting their function in the tumor microenvironment. Furthermore, large-scale protein production is costly, and existing strategies are unlikely to significantly increase protein production.

Method used

Using the L7S5 sequence designed based on the Exin21 motif, the expression of peptides, including the translation process of antibodies, chimeric antigen receptors, etc., was enhanced by redesigning the nucleotide sequence and constructing it into a vector with the peptide sequence. RNA folding structure analysis was used to screen nucleotide sequences that promote peptide expression.

Benefits of technology

It significantly improved peptide expression levels, reduced production costs, broadened the application scope of CAR-T cell therapy in the treatment of solid tumors, and enhanced the persistence and efficacy of engineered cells within the tumor microenvironment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025146142-FTAPPB-I100001
    Figure PCTCN2025146142-FTAPPB-I100001
  • Figure PCTCN2025146142-FTAPPB-I100002
    Figure PCTCN2025146142-FTAPPB-I100002
  • Figure PCTCN2025146142-FTAPPB-I100003
    Figure PCTCN2025146142-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a polynucleotide (L7S5 sequence) for enhancing the polypeptide expression, which polynucleotide has a nucleotide sequence as shown in any one of SEQ ID NOs: 2-7, or has at least 80%, 85%, 90% or 95% identity to the nucleotide sequence as shown in any one of SEQ ID NOs: 2-7. Further provided are the use of the polynucleotide for enhancing the polypeptide expression, and a nucleic acid construct in which the polynucleotide is operably linked to a gene encoding a polypeptide.
Need to check novelty before this filing date? Find Prior Art

Description

A polynucleotide and nucleic acid construct for enhancing peptide expression and its application Technical Field

[0001] This invention relates to the field of gene vectors, specifically to a polynucleotide and nucleic acid construct for enhancing polypeptide expression and its applications. Background Technology

[0002] CAR-T cell therapy, which uses engineered T cells to target specific tumor antigens, has shown high efficacy in some hematologic malignancies and has been approved by the US FDA. Despite its success, this therapy faces challenges in maintaining long-term remission in hematologic cancers and achieving significant efficacy against solid tumors. For solid tumors, the efficacy of CAR-T cell therapy is limited by anatomical and physiological barriers, such as the difficulty in delivering T cells to the tumor site and the complex and unfavorable tumor microenvironment (TME). The TME, characterized by hypoxia, acidity, and the presence of immunosuppressive cells and molecules, severely restricts the function of engineered cells and induces T cell exhaustion. Strategies have been developed to combine CAR-T cells with other existing therapies, such as antibodies, viruses, and small molecules. These combination therapies aim not only to improve the efficacy of engineered cells but also to reduce treatment-related toxicities, thereby broadening the therapeutic scope and improving safety profiles. Immune checkpoint inhibitors, such as antibodies targeting PD-1 and CTLA-4, can enhance the function of tumor-infiltrating lymphocytes (TILs), restoring their ability to attack cancer cells. Therefore, when used in combination with CAR-T cell therapy, these immune checkpoint inhibitors (ICIs) can improve the persistence and efficacy of engineered cells within the tumor microenvironment (TME). Numerous preclinical studies have confirmed the enhanced antitumor efficacy of this approach.

[0003] Large-scale antibody production is extremely challenging and costly. Currently, a series of technologies have been developed to increase protein yield, such as optimizing vector components like promoters, Kozak sequences, enhancer elements, polyA sequences, introns and cleavage sites, internal ribosome entry sites (IRES), and codon optimization. Despite these strategies, the expression levels of some proteins remain very low, preventing large-scale industrial production. Therefore, developing novel, simple, and universal methods to significantly improve protein production and reduce costs remains a pressing need.

[0004] In its research on SARS-CoV-2, CN117979994A unexpectedly discovered a 21-nucleotide motif (Exin21) encoding a specific heptapeptide (QPRFAAA), named Qα. The study found that the addition of Exin21 / Qα increased the production of various types of proteins in cells, including SARS-CoV-2 proteins S, nucleocapsid (N), and membrane (M), as well as accessory proteins (NSP2, NSP16, and ORF3), endogenous proteins such as human interleukin-2 (IL-2), interferon-g (IFN-g), angiotensin-converting enzyme 2 (ACE2), mouse NIK and IKK2 binding proteins (NIBP), and anti-SARS-CoV monoclonal antibodies (mAbs). Furthermore, it was found that Exin21 affects the translation process of protein genes, rather than the transcription process. CN118562831A modified the sequence used in varicella-zoster mRNA vaccine formulations by inserting the Qα sequence fragment to enhance T cell responses. Summary of the Invention

[0005] Based on the principle that the Exin21 motif affects the stability of protein gene mRNA and the translation process, this invention redesigned multiple nucleotide sequences based on the analysis of RNA folding structure. Using molecular biology methods, the designed sequences and peptide sequences were constructed into the same vector. By detecting changes in peptide expression levels in different cells, nucleotide sequences that promote peptide expression were screened.

[0006] The present invention provides a polynucleotide (named L7S5 sequence) that enhances polypeptide expression, the nucleotide sequence of which is shown in any one of SEQ ID NO: 2-7, or has at least 80%, 85%, 90%, or 95% identity with the nucleotide sequence shown in any one of SEQ ID NO: 2-7.

[0007] The present invention also provides the application of the polynucleotide for enhancing polypeptide expression, wherein the polynucleotide is operatively linked to the coding sequence of the polypeptide.

[0008] The present invention also provides a nucleic acid construct comprising the coding sequences of the polynucleotide and the polypeptide, wherein the coding sequences of the polynucleotide and the polypeptide are operatively linked.

[0009] In some embodiments, the operative link is a direct link, a linker link, or a linker linking sequence that encodes a Furin recognition site. The linker sequence is (GGGGS)n or SGGGGS, where n is a positive integer greater than 0, such as 1, 2, or 3. The amino acid sequence of the Furin recognition site is RXXR, where X is any amino acid, such as RARR.

[0010] In some embodiments, the polypeptide comprises one or more of the following: antibody, chimeric antigen receptor, cytokine, vaccine, antigen, synthetic peptide, chimeric polypeptide, signal peptide, peptide tag, etc. In some embodiments, the antibody is a single-chain antibody, single-domain antibody, bispecific antibody, or multispecific antibody. In one specific embodiment, the antibody is a PD-1 / CTLA4 bispecific nanobody.

[0011] In some implementations, the nucleic acid construct further includes one or more of the following elements: 5′UTR, 3′UTR, poly(A), polyadenylation signal, promoter, chimeric promoter.

[0012] In some embodiments, the nucleic acid construct, from 5′ to 3′, sequentially includes a coding sequence for an operably linked polypeptide, a coding sequence for a linker, and a polynucleotide. In some embodiments, the nucleic acid construct, from 5′ to 3′, sequentially includes an operably linked chimeric promoter, a coding sequence for a polypeptide, a coding sequence for a linker, a polynucleotide, and a poly(A) or polyadenylation signal. In some embodiments, the nucleic acid construct, from 5′ to 3′, sequentially includes a coding sequence for an operably linked polypeptide, a coding sequence for a Furin recognition site, and a polynucleotide. In some embodiments, the nucleic acid construct, from 5′ to 3′, sequentially includes an operably linked chimeric promoter, a coding sequence for a polypeptide, a coding sequence for a Furin recognition site, a polynucleotide, and a poly(A) or polyadenylation signal.

[0013] In some implementations, the nucleic acid construct is a cloning vector, an expression vector, or an integration vector.

[0014] The present invention also provides a host cell comprising the nucleic acid construct.

[0015] In some embodiments, the host cell expresses and / or secretes the polypeptide.

[0016] In some implementations, the host cell is a eukaryotic or prokaryotic cell, such as human cells, mammalian cells, bacterial cells, yeast cells, etc.

[0017] The present invention also provides a method for producing polypeptides, the method comprising: culturing host cells under conditions suitable for polypeptide production, and optionally purifying the polypeptides from the culture.

[0018] Alternatively, the nucleic acid construct may be incubated under conditions suitable for the translation of DNA or RNA in a non-cellular system (e.g., solution). Attached Figure Description

[0019] Figure 1 shows the plasmid map of pTini-CES-Z15-12Z1-Fc_0_2, which contains the Qα-linked bispecific antibody gene.

[0020] Figure 2 shows the amount of bispecific antibody secreted after the bispecific antibody plasmid was transfected into CHO-K1 cells;

[0021] Figure 3 shows the amount of bispecific antibody secreted after the bispecific antibody plasmid was transfected into PBMC cells;

[0022] Figure 4 shows the amount of bispecific antibody secreted after the bispecific antibody plasmid was transduced into dendritic cells;

[0023] Figure 5 is a schematic diagram of the structure of GM-CSF-mQα1 mRNA;

[0024] Figure 6 shows the introduction of GM-CSF mRNA into DC cells and the amount of GM-CSF secreted. Detailed Implementation

[0025] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains (e.g., cellular, molecular genetics, and biochemistry).

[0026] The term "polynucleotide" refers to a molecule containing a sequence of nucleotides bound together. An example polymer of a polynucleotide is... Examples of nucleotides include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and their analogues (such as modified nucleotides like pseudouridine). Polynucleotides can be single-stranded sequences of nucleotides, such as RNA or single-stranded DNA; double-stranded sequences of nucleotides, such as double-stranded DNA; or mixtures of single-stranded and double-stranded sequences of nucleotides. Double-stranded DNA (dsDNA) contains genomic DNA, as well as PCR and amplification products. Single-stranded DNA (ssDNA) can be converted into dsDNA and vice versa.

[0027] The term "operably linked" refers to the connection of two parts (e.g., two polypeptides or two polynucleotides) in a functional relationship. For example, when polypeptides are linked in-frame (directly or indirectly via peptide linkers), the polypeptide is operably linked to another polypeptide such that both polypeptides are functional. Alternatively, if a transcriptionally regulatory polynucleotide, such as a promoter, enhancer, or other expression control element, affects the transcription of a protein-coding polynucleotide, it is operably linked to the protein-coding polynucleotide.

[0028] The term "peptide" refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also called peptide bonds). A peptide can refer to any chain having two or more amino acids, and does not refer to a product of a specific length; examples include peptides, dipeptides, tripeptides, oligopeptides, "proteins," "amino acid chains," etc. Peptides also include products modified after peptide expression, including but not limited to glycosylation, acetylation, phosphorylation, and acylation.

[0029] The term “nucleic acid construct” or “polynucleotide construct” refers to one or more single-stranded or double-stranded nucleic acid molecules that are isolated from naturally occurring genes or modified to contain nucleic acid fragments in a manner not found in nature.

[0030] The term "secretory protein" refers to a polypeptide or protein that is secreted from a cell into at least the extracellular space or extracellular space.

[0031] The term “enhancement” refers to an increase in a specified parameter (such as peptide expression level) relative to a baseline, such as an increase of 5%, 10%, 50%, 100%, or higher.

[0032] This invention provides a polynucleotide for enhancing peptide expression, the nucleotide sequence of which is shown in any one of SEQ ID NO: 2-7. The polynucleotide is designed according to RNA folding, similar to Qα, and named the L7S5 sequence. It is operatively linked to a gene, primarily enhancing the gene translation process and increasing peptide expression. The polynucleotide can be DNA or RNA.

[0033] This invention also provides the application of the polynucleotide for enhancing polypeptide expression, wherein the polynucleotide is operatively linked to the coding sequence of the polypeptide. This invention also provides a nucleic acid construct comprising the polynucleotide and the coding sequence of the polypeptide, wherein the polynucleotide is operatively linked to a gene encoding the polypeptide. The operative link can be a direct link or a linker linking through the coding sequence of a linker. The sequence of the linker is (GGGGS)n or SGGGGS, where n is a positive integer greater than 0, such as 1, 2, or 3. Other sequences, such as UTR sequences or signal peptide sequences, may also be included between the polynucleotide and the coding sequence of the polypeptide; the polynucleotide may be upstream or downstream of the coding sequence of the polypeptide.

[0034] In some embodiments, the polypeptide includes antibodies, chimeric antigen receptors, transmembrane proteins, cytokines, vaccines, antigens, synthetic peptides, chimeric polypeptides, signal peptides, peptide tags, etc.

[0035] The antibody is a single-chain antibody, a single-domain antibody, a bispecific antibody, or a multispecific antibody. The antibody can be a secreted protein, such as an immunosuppressant antibody, a PD-1 antibody, a CTLA4 antibody, a PD-L1 antibody, or a PD-1 / CTLA4 bispecific nanobody. The sequence of the single-domain antibody targeting PD-1 is the single-domain antibody targeting PD-1 described in any embodiment of patent CN202011582908.X, the entire contents of which are incorporated herein by reference. The sequence of the single-domain antibody targeting CTLA-4 is the single-domain antibody targeting CTLA-4 described in any embodiment of patent CN202111152925.4, the entire contents of which are incorporated herein by reference. In some embodiments, the sequence of the PD-1 / CTLA4 bispecific antibody is as shown in any of SEQ ID NO: 8-11.

[0036] Chimeric antigen receptors contain an optional signal peptide sequence, an extracellular target recognition region (antigen-binding domain), a hinge region, a transmembrane region, an intracellular co-stimulatory domain, and an intracellular signaling domain. The extracellular recognition region contains an antibody targeting the antigen (e.g., a tumor antigen), such as a full-length antibody, an antigen-binding fragment, a single-domain antibody (nanobody), or a single-chain variable fragment (scFv). The transmembrane protein can be a native polypeptide or a chimeric polypeptide, such as a chimeric antigen receptor, a T-cell antigen receptor, or transmembrane IL-2. Cytokines can be IL-2, IL-5, IL-7, IL-10 / IL-12, IL-21, etc. The signal peptide can be the CD8 signal peptide, the IL-10 signal peptide, etc. Polypeptides can also be combinations of polypeptides, such as a combination of a chimeric antigen receptor and a secreted antibody, or a combination of a signal peptide and a secreted antibody. Different polypeptides can be operatively linked (e.g., via a linker) or functionally independent linked (e.g., via a 2A peptide link or a Furin recognition site link).

[0037] The "signal peptide" described herein is a short peptide chain (5-30 amino acids in length) that guides the transfer of newly synthesized polypeptides into the secretory pathway. The signal peptide is selected from CD8 signal peptide, CD28 signal peptide, CD4 signal peptide, light chain signal peptide, or IL-10 signal peptide.

[0038] In some embodiments, the nucleic acid construct further comprises: a 5′UTR (untranslated region) and / or a 3′UTR, a poly(A) or polyadenylation signal, a promoter, or a chimeric promoter. In some embodiments, the nucleic acid construct comprises, from 5′ to 3′, sequentially a coding sequence for an operably linked polypeptide, a coding sequence for a linker, and a polynucleotide. In some embodiments, the nucleic acid construct comprises, from 5′ to 3′, sequentially a chimeric promoter, a coding sequence for a polypeptide, a coding sequence for a linker, a polynucleotide that enhances polypeptide expression, and a poly(A) or polyadenylation signal. In some embodiments, the nucleic acid construct comprises, from 5′ to 3′, sequentially a chimeric promoter, a 5′UTR, a coding sequence for a polypeptide, a 3′UTR, a coding sequence for a linker, a polynucleotide that enhances polypeptide expression, and a poly(A) or polyadenylation signal.

[0039] In some embodiments, the nucleic acid construct comprises, from 5′ to 3′, an operably linked chimeric promoter, a coding sequence for a peptide, a coding sequence for a Furin recognition site, and a polynucleotide. In some embodiments, the nucleic acid construct comprises, from 5′ to 3′, an operably linked chimeric promoter, a coding sequence for a peptide, a coding sequence for a Furin recognition site, a polynucleotide that enhances peptide expression, and a poly(A) or polyadenylation signal. In some embodiments, the nucleic acid construct comprises, from 5′ to 3′, an operably linked chimeric promoter, a 5′ UTR, a coding sequence for a peptide, a 3′ UTR, a coding sequence for a Furin recognition site, a polynucleotide that enhances peptide expression, and a poly(A) or polyadenylation signal.

[0040] In some embodiments, the nucleic acid construct is a cloning vector, an expression vector, or an integration vector. Expression of the polynucleotide sequence of the present invention is typically achieved by operably ligating the polynucleotide sequence of the present invention to an expression vector. A typical cloning vector contains transcription and translation terminators, a start sequence, and a promoter that can be used to regulate the expression of the desired nucleic acid sequence. An integration vector contains components for integrating the target sequence into the cellular genome. These vectors can be used to transform appropriate host cells to enable them to express proteins. Vectors typically contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. These sequences (collectively referred to in some embodiments as "flanking sequences") typically include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splicing sites, a leader sequence encoding a polypeptide secretion, a ribosome binding site, a polyadenylated sequence, a multi-connector region for inserting a nucleic acid encoding the binding molecule to be expressed, and optional marker elements. Furthermore, the type of vector is not limited; for example, plasmids, phage particles, phage derivatives, animal viruses, and granules can be varied depending on the host cell to which they are introduced. Viral vector technology is well known in the art and has been described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. To assess the expression of peptides or their fractions, vectors introduced into cells may also contain one or both of optional marker genes or reporter genes to facilitate the identification and selection of expressing cells from cell populations seeking transfection or infection via viral vectors.

[0041] In some embodiments, the vector includes, but is not limited to, conventional circular DNA plasmids, linear DNA plasmids, microcircular plasmids, nanoparticles, doggybone, and other DNA forms that do not contain antibiotic or / and replicon DNA sequences. In some embodiments, the DNA vector is a DNA microcarrier whose DNA backbone sequence does not contain an antibiotic expression cassette and is preferably limited to a length of less than 600 bp, and / or does not contain a CpG DNA motif. In some embodiments, the DNA vector is an antibiotic-free microplasmid, i.e., a microplasmid without an antibiotic resistance gene (antibiotic-free expression cassette microplasmid), also called a tiny or tiniplasmid. Antibiotic-free microplasmids suitable for use in this invention can be found in the antibiotic-free microplasmids described in any embodiment of PCT / CN2024 / 072052 or the antibiotic-free microplasmids produced by the strain CN202410952401.0. The entire contents of this application are incorporated herein by reference. In some embodiments, the antibiotic-free microplasmid contains a nucleotide sequence encoding an antitoxin protein and a replicon.

[0042] This invention also provides a host cell comprising the nucleic acid construct described herein. Suitable host cells for introducing the nucleic acid construct described herein can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: *Escherichia coli*, *Streptomyces* spp.; bacterial cells of *Salmonella typhimurium*; fungal cells such as yeast; insect cells of *Drosophila* S2 or Sf9; animal cells of CHO, COS7, 293 cells, etc. Examples of mammalian cells include immune cells, preferably immune effector cells. "Immune effector cells" are immune cells capable of performing immune effector functions, including: T cells, NK cells, peripheral blood mononuclear cells (PBMCs), neutrophils, eosinophils, and hematopoietic stem cells. T cells suitable for this invention can be of various types from various sources. Methods for introducing nucleic acids or vectors into mammalian cells are known in the art, and the vectors can be transferred into cells by physical, chemical, or biological methods. Examples of mammalian cells also include tumor cells, such as hybridoma cells.

[0043] In some embodiments, the host cells express and / or secrete the polypeptide. The polypeptide may be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant protein can be isolated and purified using various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations thereof. The host cells may also be used as cell therapy products, reinfused into the human body to express and secrete polypeptides; for example, secreting PD-1 antibodies, CTLA4 antibodies, TCEs, cytokines, etc., to treat diseases.

[0044] The present invention also provides a method for producing polypeptides, the method comprising: culturing host cells under conditions suitable for polypeptide production, and optionally purifying the polypeptides from the culture.

[0045] Alternatively, the nucleic acid construct may be incubated under conditions suitable for the translation of DNA or RNA in a non-cellular system (e.g., solution).

[0046] The present invention is described in further detail with reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, the invention should not be construed as limited to the following examples, but should be interpreted as including any and all variations that become apparent from the teachings provided herein. The methods and reagents used in the examples, unless otherwise stated, are conventional methods and reagents in the art.

[0047] Example

[0048] Example 1: Construction of a plasmid to enhance PD-1 / CTLA bispecific antibody expression using the L7S5 sequence

[0049] First, the plasmid pTini-CES-Z15-12Z1-Fc_0_2, which links the Qα gene to the bispecific antibody gene, was constructed, and its map is shown in Figure 1. The plasmid backbone uses the empty vector plasmid 0637 from CN118374547A. The chimeric promoter for the bispecific antibody expression cassette is the mCIS-CACA promoter shown in SEQ ID NO: 33 from CN202411432640.X. The amino acid sequence of PD-1 / CTLA4 is shown in SEQ ID NO: 10. The bispecific antibody is linked to both ends by the IL-10 signal peptide and Qα, and the expression cassette (ORF) sequence is shown in SEQ ID NO: 12.

[0050] Based on pTini-CES-Z15-12Z1-Fc_0_2, primer design was used to replace the linker with the coding sequence of RARR (Furin recognition site), resulting in the pTini-CES-Z15-12Z1-Fc_0_F plasmid. Then, Qα was replaced with newly designed polynucleotides mQα1, mQα2, mQα3, mQα4, mQα5, and mQα6 (i.e., the newly designed L7S5 sequence), as shown in SEQ ID NO: 2-7, to obtain the corresponding plasmid.

[0051] Primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., as shown below (SEQ ID NO: 13-20):

[0052] Z15-f: CTGACAGGGGTCTCCGCCACCATGCATTCCTCAG

[0053] Furin-r: CTCATCAATGTATCTTAGGATCCTCATTAAGCGGCC

[0054] Qa1-r: CTCATCAATGTATCTTAGGATCCTCATTAACGCCACG

[0055] Qa2-r: CTCATCAATGTATCTTAGGATCCTCATTACAACCGCG

[0056] Qa3-r: CTCATCAATGTATCTTAGGATCCTCATTAAGGGCCCG

[0057] Qa4-r: CTCATCAATGTATCTTAGGATCCTCATTAAGGGCCGG

[0058] Qa5-r: CTCATCAATGTATCTTAGGATCCTCATTAGCGGCC

[0059] Qa6-r: CTCATCAATGTATCTTAGGATCCTCATTAGGCGGC

[0060] Taking the construction of plasmid pTini-CES-Z15-12Z1-Fc-0-F as an example, pTini-CES-Z15-12Z1-Fc-0-2 was used as a template, and Z15-f and Furin-r were used as front and back primers respectively, ligated seamlessly. The subsequent plasmid mutation construction method is the same as above, the difference being the back primers used, as shown in Table 1. The corresponding template is amplified using the corresponding primers, and then seamlessly cloned into the corresponding template to obtain the corresponding mutant plasmid.

[0061] Table 1

[0062] Example 2: Effect of CHO-K1 cell detection on bispecific antibody secretion

[0063] 1) CHO-K1 electroporation (or electrodialysis)

[0064] Culture medium preparation: Mix DMEM medium and RPMI 1640 medium in a 1:1 ratio, and then add 10% fetal bovine serum, 1% glutamine, 1% hypoxanthine and thymidine mixture.

[0065] Preparation of electroporation mixture: Follow the instructions of the Human T Cell Nucleofector transfection kit. Add 5 μg of plasmid to 100 pL of electroporation buffer. Experimental groups are shown in Table 2. pTini-CES-Z15-12Z1-Fc-0 has no Qα or L7S5 sequence.

[0066] Table 2

[0067] Prepare 1E6 CHO-K1 cells in the logarithmic growth phase. Mix the electroporation mixture from the above steps with the cell pellet and add it to the electroporation cuvette. Place the cuvette in a Lonza-Nucleofector2b electroporator and select the CHO cell high-activity program (H-014) for electroporation. After electroporation, use the micropipette in the kit to aspirate the preheated culture medium and mix it with the electroporation suspension. Quickly transfer the mixture to a 6-well plate containing 3 mL of preheated culture medium, mix well, and incubate at 37°C in a 5% CO2 incubator.

[0068] On day 2 after electroporation, 500 μL of supernatant was collected from each group for antibody secretion detection.

[0069] 2) Antibody secretion level detection

[0070] Antigen coating: Prepare human PD-1 antigen (for first use, dissolve the antigen in sterile water, dilute the antigen to 1ug / ml with coating buffer, coat 100ul per well with the ELISA plate, and incubate overnight at 4°C). The next day, wash 3 times with PBST, 300ul per well each time, and pat dry with absorbent paper.

[0071] Blocking: Add 300 μL of blocking solution (3% BSA + PBST) to each well, then incubate the microplate in a 37°C biochemical incubator for 2 hours. After blocking, wash the wells three times with PBST, 300 μL per well each time, and pat dry with absorbent paper.

[0072] Sample addition: Dilute the sample with blocking buffer to a suitable gradient, generally two gradients. At the same time, prepare the standard. Dilute the standard with blocking buffer to the highest concentration of 6.25 ng / ml, and then add a gradient of 7 by step dilution of 2-fold. Use the blocking buffer as a negative control. Add the sample and standard to the plate, 100 μl per well. Each group of samples should be set up in duplicate. Then place the plate in a 37°C biochemical incubator for 2 hours. After that, wash 3 times with PBST, 300 μl per well each time, and pat dry with absorbent paper.

[0073] Add secondary antibody: Dilute the secondary antibody at a ratio of 1:10000 with blocking buffer, 100 μL per well, and then incubate the microplate in a 37°C biochemical incubator for 1 hour. After incubation, wash the plate 3 times with PBST, 300 μL per well each time, and pat dry with absorbent paper.

[0074] Color development: Add 100 μL of color development solution to each well and develop at room temperature in the dark for 5-10 minutes.

[0075] Termination: Add 50 μL of stop solution to each well to terminate the reaction.

[0076] Reading the data: Adjust the absorbance value in the ELISA template to OD450nm, then place the microplate into the instrument and run it. The instrument will automatically detect the absorbance. After the detection is completed, analyze the ELISA data results.

[0077] The test results are shown in Figure 2. On CHO-K1 cells, the bispecific antibody secretion levels of the pTini-CES-Z15-12Z1-Fc-0-F and pTini-CES-Z15-12Z1-Fc-0-mQα1 groups were better than those of the pTini-CES-Z15-12Z1-Fc-0-mQα6 groups.

[0078] Example 3: Detection of the effect of L7S5 sequence on bispecific antibody secretion in PBMC cells

[0079] 1) PBMC recovery and revitalization

[0080] Preparation of activation medium: Take AIM-V medium, add 2% fetal bovine serum and 500 IU / ml IL-2. Take a 15ml centrifuge tube, add 9ml of medium to the tube, remove the cryovial from the -80℃ freezer, and thaw it in a 37℃ constant temperature water bath as soon as possible. When a small piece of ice remains, transfer the cell suspension to a centrifuge tube containing medium on a clean bench, centrifuge at 300g for 5 minutes, discard the supernatant, resuspend the cells with an appropriate amount of medium, take 10μL of the cell suspension, and then dilute it with 0.4% trypan blue at a 1:1 ratio. After thorough mixing, perform cell counting. Based on the counting results, for every 1E7 cells, use 30μL of Miltenyi T Cell TransAct.TM To activate the culture, add 3 ml of culture medium to each well, mix well, and incubate at 37°C in a 5% CO2 incubator.

[0081] 2) PBMC electro-rotation

[0082] Preparation of culture medium after electroporation: Take AIM-V culture medium and add 2% fetal bovine serum and 100 IU / ml IL-2.

[0083] Preparation of electroporation mixture: Follow the instructions of the Human T Cell Nucleofector transfection kit. Mix Nucleofector Solution:Supplement at a ratio of 82:18 and add 5 μg of plasmid to 100 μL of electroporation buffer. Experimental groups are shown in Table 1 above.

[0084] Prepare 7E6 activated human T cells. Mix the electroporation mixture from the above steps with the cell pellet and add it to the electroporation cuvette. Place the cuvette in a Lonza-4D electroporator and select the program human T cell stim (EO115) for electroporation. After electroporation, use the micropipette in the kit to aspirate the preheated culture medium and mix it with the electroporation suspension. Quickly transfer the mixture to a 6-well plate containing 3 ml of preheated culture medium, mix well, and incubate at 37°C in a 5% CO2 incubator.

[0085] On day 2 after electroporation, 500 μL of supernatant was collected from each group for antibody secretion detection.

[0086] 3) Antibody secretion level detection is as described in Example 1.

[0087] The test results are shown in Figure 3. On PBMC cells, pTini-CES-Z15-12Z1-Fc-0-F and pTini-CES-Z15-12Z1-Fc-0-mQα1 and pTini-CES-Z15-12Z1-Fc-0-mQα6 showed better secretion of dual antibodies compared to pTini-CES-Z15-12Z1-Fc-0-mQα6.

[0088] Example 4: Detection of the effect of L7S5 sequence on bispecific antibody secretion in DC cells

[0089] 1) DC cell generation

[0090] Monocyte-derived dendritic cells (DCs) were generated from peripheral blood mononuclear cells (PBMCs) via standard Ficoll density centrifugation to isolate PBMCs from patient leukocyte removal samples. PBMCs were seeded in serum-free AIM-V medium and allowed to adhere to culture flasks with 0.22 μm filter caps. After 2 hours, non-adherent cells were removed, and adherent monocytes were subsequently cultured for 6 days in AIM-V medium containing 50 ng / ml rhIL-4 and 100 ng / ml rhGM-CSF. On day 3, half of the medium was replaced with fresh medium containing GM-CSF and IL-4. A maturation mixture consisting of 100 IU / ml IFN-γ, 10 μg / ml poly(I:C), 5 μg / ml R848, and 1 μg / ml PGE2 was used to induce DC maturation for 24 hours.

[0091] 2) DC cell transformation

[0092] Observe cell morphology under a microscope, collect DCs into centrifuge tubes, and centrifuge at 300g for 10 min at room temperature; discard the supernatant, add an appropriate amount of DPBS to resuspend, and count the cells; take the number of cells for electroporation, and centrifuge at 300g for 10 min at room temperature. Take the electroporation kit (from Lonza), add 100 μl of electroporation reagent according to the 4D electroporation kit instructions, and then electroporate 3 μg of plasmid per 2E6 cells to prepare the electroporation mixture; resuspend the centrifuged cell pellet, gently mix, transfer the mixture to an electroporation cuvette, and select the DC human DNA program for electroporation; use the micropipettes in the kit to transfer the electroporated cell suspension to 6-well or 12-well plates (containing DC induction medium), mix well, and incubate at 37℃ in a 5% CO2 incubator.

[0093] On day 1 after electroporation, 200 μL of supernatant was collected from each group for antibody secretion detection.

[0094] 3) Antibody secretion level detection is as described in Example 1.

[0095] The test results are shown in Figure 4. On DC cells, compared with pTini-CES-Z15-12Z1-Fc-0-F, the three groups of bispecific antibodies, pTini-CES-Z15-12Z1-Fc-0-mQα1, pTini-CES-Z15-12Z1-Fc-0-mQα4 and pTini-CES-Z15-12Z1-Fc-0-mQα6, have better secretion levels of bispecific antibodies.

[0096] Example 5: Detection of the effect of L7S5 sequence on GM-CSF secretion in DC cells

[0097] 1) Generation and transformation of DC cells

[0098] DC cells were generated according to the method in Example 4, and GM-CSF mRNA without the mQα1 sequence and GM-CSF-mQα1 mRNA were electroporated into DC cells at a rate of 10 pmol / 2E6 cells. On day 1 after electroporation, 200 μL of supernatant was collected from each group for GM-CSF factor secretion detection.

[0099] The structure of GM-CSF-mQα1 mRNA is shown in Figure 5, and its sequence is shown in SEQ ID NO: 21. Compared with GM-CSF-mQα1 mRNA, GM-CSF mRNA lacks the mQα1 sequence.

[0100] 2) GM-CSF factor secretion level detection

[0101] Sample addition: Prepare a suitable gradient of samples using sample diluents, generally two dilutions. At the same time, prepare standards. Dilute the standards with blocking buffer to the highest concentration of 1000 pg / ml, and then add the standards in a 2-fold serial dilution gradient of 7. Use the blocking buffer as a negative control. Add the samples and standards to the standard plate, 50 μL per well. Each sample group should have replicates.

[0102] Add antibodies: Dilute 10x capture antibody and 10x detector antibody to 1x with blocking buffer, 50ul per well, then place the microplate in a 37°C biochemical incubator for 1 hour. After the incubation, wash 3 times with PBST, 300ul per well each time, and pat dry with absorbent paper.

[0103] Color development: Add 100 μL of color development solution to each well and develop at room temperature in the dark for 5-10 minutes.

[0104] Termination: Add 100 μL of stop solution to each well to terminate the reaction.

[0105] Reading the data: Adjust the absorbance value in the ELISA template to OD450nm, then place the microplate into the instrument and run it. The instrument will automatically detect the absorbance. After the detection is completed, analyze the ELISA data results.

[0106] The test results are shown in Figure 6. When the GM-CSF secretion level was detected on the DC, the GM-CSF-mQα1 mRNA electroporation group had a higher secretion level than the GM-CSF mRNA without mQα1.

[0107] Part of the sequence in this article

Claims

1. A polynucleotide that enhances expression of a polypeptide, comprising, the nucleotide sequence of any one of SEQ ID NOs: 2-7, or a nucleotide sequence having at least 80%, 85%, 90%, 95% identity to the nucleotide sequence of any one of SEQ ID NOs: 2-7.

2. Use of a polynucleotide according to claim 1 for enhancing the expression of a polypeptide, characterized in that the polynucleotide is operably linked to a coding sequence of a polypeptide.

3. Use according to claim 2, wherein the compound is ###0002### the polypeptide comprises one or more of an antibody, a chimeric antigen receptor, a cytokine, a vaccine, an antigen, a synthetic peptide, a chimeric polypeptide, a signal peptide, a peptide tag.

4. A nucleic acid construct, characterized in that, the polynucleotide is operably linked to a coding sequence of a polypeptide. Preferably, the operable linkage is direct linkage, linkage via a linker, or linkage via a Furin recognition site coding sequence. More preferably, the sequence of the linker is (GGGGS)n or SGGGGS, n is a positive integer greater than 0.

5. The nucleic acid construct of claim 4, wherein, the polypeptide comprises one or more of an antibody, a chimeric antigen receptor, a cytokine, a vaccine, an antigen, a synthetic peptide, a chimeric polypeptide, a signal peptide, a peptide tag. Preferably, the polypeptide comprises a PD-1 / CTLA4 bispecific antibody and a signal peptide. More preferably, the sequence of the antibody is any one of SEQ ID NOs: 8-11.

6. The nucleic acid construct of claim 4 or 5, wherein, The nucleic acid construct further comprises one or more of the following elements: a 5' UTR, a 3' UTR, a poly(A), a polyadenylation signal, a promoter, a chimeric promoter.

7. The nucleic acid construct of any one of claims 4-6, wherein, The nucleic acid construct is a cloning vector, an expression vector, or an integration vector.

8. A host cell, characterized in that, The polynucleotide of claim 1 or the nucleic acid construct of any one of claims 4-7.

9. The host cell of claim 8, wherein The host cell expresses and / or secretes the polypeptide.

10. A method of producing a polypeptide, comprising, The method comprises culturing the host cell of claim 8 or 9 under conditions suitable for production of the polypeptide, and optionally purifying the polypeptide from the culture, or, incubating the nucleic acid construct of any one of claims 4-7 under conditions suitable for translation of DNA or RNA in a non-cellular system.