Polynucleotide for enhancing polypeptide expression, and nucleic acid construct and use thereof

By designing L7S5 polynucleotide sequences to enhance peptide expression, the problems of low antigen loading efficiency and immunosuppression in DC vaccines were solved, thus improving the efficacy of tumor immunotherapy.

WO2026139087A1PCT designated stage Publication Date: 2026-07-02MAXIRNA (SHANGHAI) PHARM CO LTD +3

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MAXIRNA (SHANGHAI) PHARM CO LTD
Filing Date
2025-12-30
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Existing DC vaccines suffer from problems such as lack of specific tumor antigens, low antigen loading efficiency, and immunosuppression caused by the activation of regulatory T cells after treatment, resulting in poor treatment efficacy in tumor immunotherapy.

Method used

A polynucleotide sequence L7S5 was designed to enhance peptide expression by influencing the mRNA stability and translation process of protein genes. It was also operatively linked to the peptide coding sequence to construct a nucleic acid construct for enhancing peptide expression, particularly the expression of PD-1/CTLA4 bispecific nanobodies.

Benefits of technology

It increased peptide expression, enhanced the anti-tumor immune response of DC vaccines, activated the killing function of T cells, overcame immunosuppression, and improved the therapeutic effect of tumor treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025147620-FTAPPB-I100001
    Figure PCTCN2025147620-FTAPPB-I100001
  • Figure PCTCN2025147620-FTAPPB-I100002
    Figure PCTCN2025147620-FTAPPB-I100002
Patent Text Reader

Abstract

Provided is a polynucleotide (L7S5 sequence) for enhancing the polypeptide expression, which polynucleotide has a nucleotide sequence as shown in any one of SEQ ID NOs: 2-7, or has at least 80%, 85%, 90% or 95% identity to the nucleotide sequence as shown in any one of SEQ ID NOs: 2-7. Further provided are the use of the polynucleotide for enhancing the polypeptide expression, and a nucleic acid construct in which the polynucleotide is operably linked to a gene encoding a polypeptide.
Need to check novelty before this filing date? Find Prior Art

Description

A polynucleotide and nucleic acid construct for enhancing peptide expression and its application Technical Field

[0001] This invention relates to the field of gene vectors, specifically to a polynucleotide and nucleic acid construct for enhancing polypeptide expression and its applications. Background Technology

[0002] Tumor immunotherapy, as a novel cancer treatment modality, primarily aims to eliminate tumor cells by activating the body's immune system to generate anti-tumor immunity. It not only induces sustained anti-tumor immunity but also plays a crucial role in preventing postoperative recurrence. Dendritic cells (DCs), as the primary link in generating a specific immune response, are an important target for tumor immunotherapy. DC vaccines involve introducing cultured DCs loaded with tumor antigens into the body. These DCs regulate the proliferation and activation of tumor antigen-specific Th1 cells through antigen presentation and cytokine secretion, further promoting NK cell and CTL activation and mediating tumor killing. Although clinical studies have shown that DC vaccines induced by the patient's own monocytes are well-tolerated and can generate an anti-tumor immune response, they are still not effective in treating tumors. This may be due to the lack of specific tumor antigens, low antigen loading efficiency, and the subsequent activation of regulatory T cells, leading to immunosuppression. The tumor immune microenvironment and tumor immunosuppressive mechanisms are key factors limiting the use of DC vaccines. CN118726264A discloses a DC vaccine with a self-secretory PD1 / CTLA4 bispecific antibody, which can relieve the inhibition of Tregs and the immunosuppression at the tumor site, enabling DCs to efficiently activate naive T cells and more efficiently stimulate the effector function of activated T cells against cancer. However, its antibody expression level still needs to be further improved.

[0003] In its research on SARS-CoV-2, CN117979994A unexpectedly discovered a 21-nucleotide motif (Exin21) that encodes a specific heptapeptide (QPRFAAA), named Qα. The study found that the addition of Exin21 / Qα increased the production of various types of proteins in cells, and that Exin21 affects the translation process of protein genes, rather than the transcription process. CN118562831A modified the sequence used in varicella-zoster mRNA vaccine formulations, inserting a Qα sequence fragment to enhance T cell responses. Summary of the Invention

[0004] Based on the principle that the Exin21 motif affects the stability of protein gene mRNA and the translation process, this invention designs multiple nucleotide sequences based on the analysis of RNA folding structure, and constructs the designed sequences and peptide sequences into the same vector. By detecting changes in peptide expression levels in different cells, nucleotide sequences that promote peptide expression are screened.

[0005] The present invention provides a polynucleotide (named L7S5 sequence) that enhances polypeptide expression, the nucleotide sequence of which is shown in any one of SEQ ID NO: 2-7, or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the nucleotide sequence shown in any one of SEQ ID NO: 2-7.

[0006] The present invention also provides the application of the polynucleotide for enhancing polypeptide expression, wherein the polynucleotide is operatively linked to the coding sequence of the polypeptide.

[0007] The present invention also provides a nucleic acid construct comprising the coding sequences of the polynucleotide and the polypeptide, wherein the coding sequences of the polynucleotide and the polypeptide are operatively linked.

[0008] In some embodiments, the operative link is a direct link, a linker link, or a linker linking sequence that encodes a Furin recognition site. The linker sequence is (GGGGS)n or SGGGGS, where n is a positive integer greater than 0, such as 1, 2, or 3. The amino acid sequence of the Furin recognition site is RXXR, where X is any amino acid, such as RARR.

[0009] In some embodiments, the polypeptide comprises one or more of the following: antibody, chimeric antigen receptor, cytokine, vaccine, antigen, synthetic peptide, chimeric polypeptide, signal peptide, peptide tag, etc. In some embodiments, the antibody is a single-chain antibody, single-domain antibody, bispecific antibody, or multispecific antibody. In one specific embodiment, the antibody is a PD-1 / CTLA4 bispecific nanobody.

[0010] In some implementations, the nucleic acid construct further includes one or more of the following elements: 5'UTR, 3'UTR, poly(A), polyadenylation signal, promoter, chimeric promoter.

[0011] In some embodiments, the nucleic acid construct, from 5' to 3', sequentially includes a coding sequence for an operably linked polypeptide, a coding sequence for a linker, and a polynucleotide. In some embodiments, the nucleic acid construct, from 5' to 3', sequentially includes an operably linked chimeric promoter, a coding sequence for a polypeptide, a coding sequence for a linker, a polynucleotide, and a poly(A) or polyadenylation signal. In some embodiments, the nucleic acid construct, from 5' to 3', sequentially includes a coding sequence for an operably linked polypeptide, a coding sequence for a Furin recognition site, and a polynucleotide. In some embodiments, the nucleic acid construct, from 5' to 3', sequentially includes an operably linked chimeric promoter, a coding sequence for a polypeptide, a coding sequence for a Furin recognition site, a polynucleotide, and a poly(A) or polyadenylation signal.

[0012] In some implementations, the nucleic acid construct is a cloning vector, an expression vector, or an integration vector.

[0013] The present invention also provides a host cell comprising the nucleic acid construct.

[0014] In some embodiments, the host cell expresses and / or secretes the polypeptide.

[0015] In some implementations, the host cell is a eukaryotic or prokaryotic cell, such as human cells, mammalian cells, bacterial cells, yeast cells, etc.

[0016] The present invention also provides a method for producing polypeptides, the method comprising: culturing host cells under conditions suitable for polypeptide production, and optionally purifying the polypeptides from the culture.

[0017] Alternatively, the nucleic acid construct may be incubated under conditions suitable for the translation of DNA or RNA in a non-cellular system (e.g., solution).

[0018] The present invention also provides an engineered antigen-presenting cell containing the polynucleotide or the nucleic acid construct.

[0019] In some embodiments, the antigen-presenting cells are also loaded with tumor antigens or their coding sequences.

[0020] In some embodiments, the tumor-associated antigen includes P53, Survivin, and MUC1, wherein Survivin is in tandem with P53; preferably, the antigen also contains hTERT and KRAS.

[0021] In some embodiments, the Survivin and P53 are tandemly linked by a connector; preferably, the connector is GGGSGG; more preferably, the amino acid sequence of the tandemly linked Survivin and P53 is shown in SEQ ID NO:22, the amino acid sequence of MUC1 is shown in SEQ ID NO:23, the amino acid sequence of hTERT is shown in SEQ ID NO:24, and the amino acid sequence of KRAS is shown in SEQ ID NO:25.

[0022] In some embodiments, the antigen-presenting cells are selected from macrophages, B cells, or dendritic cells.

[0023] The present invention also provides a method for in vitro activation of immune-active cells derived from a patient with a tumor, comprising:

[0024] Immune cells are obtained from the patient; the immune cells are co-cultured with the engineered antigen-presenting cells for a sufficient time to activate the immune cells, thereby obtaining activated immune cells.

[0025] The present invention also provides activated immune cells obtained by the aforementioned method.

[0026] The present invention also provides a pharmaceutical composition comprising engineered antigen-presenting cells and pharmaceutically acceptable excipients. The present invention also provides the use of the engineered antigen-presenting cells in the preparation of a medicament; preferably, the medicament is used to prevent the occurrence or metastasis of tumors in a subject, or to inhibit the growth or metastasis of tumors in a subject expressing the tumor-associated antigen. Attached Figure Description

[0027] Figure 1 shows the plasmid map of pTini-CES-Z15-12Z1-Fc_0_2, which contains the Qα-linked bispecific antibody gene.

[0028] Figure 2 shows the amount of bispecific antibody secreted after the bispecific antibody plasmid was transfected into CHO-K1 cells;

[0029] Figure 3 shows the amount of bispecific antibody secreted after the bispecific antibody plasmid was transfected into PBMC cells;

[0030] Figure 4 shows the amount of bispecific antibody secreted after the bispecific antibody plasmid was transduced into dendritic cells;

[0031] Figure 5 is a schematic diagram of the structure of GM-CSF-mQα1 mRNA;

[0032] Figure 6 shows the introduction of GM-CSF mRNA into DC cells and the amount of GM-CSF secreted.

[0033] Figure 7 shows the effect of detecting the L7S5 sequence on bispecific antibody secretion on DC cells.

[0034] Figure 8 shows the effect of the L7S5 sequence on the tumor-killing function of T cells detected on DC cells. Detailed Implementation

[0035] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains (e.g., cellular, molecular genetics, and biochemistry).

[0036] The term "polynucleotide" refers to a molecule containing a sequence of nucleotides bound together. An example polymer of a polynucleotide is... Examples of nucleotides include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and their analogues (such as modified nucleotides like pseudouridine). Polynucleotides can be single-stranded sequences of nucleotides, such as RNA or single-stranded DNA; double-stranded sequences of nucleotides, such as double-stranded DNA; or mixtures of single-stranded and double-stranded sequences of nucleotides. Double-stranded DNA (dsDNA) contains genomic DNA, as well as PCR and amplification products. Single-stranded DNA (ssDNA) can be converted into dsDNA and vice versa.

[0037] The term "operably linked" refers to the connection of two parts (e.g., two polypeptides or two polynucleotides) in a functional relationship. For example, when polypeptides are linked in-frame (directly or indirectly via peptide linkers), the polypeptide is operably linked to another polypeptide such that both polypeptides are functional. Alternatively, if a transcriptionally regulatory polynucleotide, such as a promoter, enhancer, or other expression control element, affects the transcription of a protein-coding polynucleotide, it is operably linked to the protein-coding polynucleotide.

[0038] The term "peptide" refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also called peptide bonds). A peptide can refer to any chain having two or more amino acids, and does not refer to a product of a specific length; examples include peptides, dipeptides, tripeptides, oligopeptides, "proteins," "amino acid chains," etc. Peptides also include products modified after peptide expression, including but not limited to glycosylation, acetylation, phosphorylation, and acylation.

[0039] The term “nucleic acid construct” or “polynucleotide construct” refers to one or more single-stranded or double-stranded nucleic acid molecules that are isolated from naturally occurring genes or modified to contain nucleic acid fragments in a manner not found in nature.

[0040] The term "secretory protein" refers to a polypeptide or protein that is secreted from a cell into at least the extracellular space or extracellular space.

[0041] The term “enhancement” refers to an increase in a specified parameter (such as peptide expression level) relative to a baseline, such as an increase of 5%, 10%, 50%, 100%, or higher.

[0042] The term "heavy chain antibody" is derived from antibodies from camelids or cartilaginous fishes. Compared to the four-chain antibodies mentioned above, heavy chain antibodies lack the light chain and heavy chain constant region 1 (CH1), containing only two heavy chains consisting of a variable region (VHH) and other constant regions. The variable region is linked to the constant region via a hinge-like structure. Each heavy chain of camelid heavy chain antibodies contains one variable region (VHH) and two constant regions (CH2 and CH3), while each heavy chain of cartilaginous fish heavy chain antibodies contains one variable region and five constant regions (CH1-CH5). The antigen-binding fragment of heavy chain antibodies includes VHH or single-chain heavy chain antibodies. By fusing with the constant region of human IgG Fc, heavy chain antibodies can possess the CH2 and CH3 regions of human IgG Fc.

[0043] The terms "single-domain antibody," "heavy chain variable region domain of a heavy chain antibody," and "VHH" are used interchangeably, referring to the VHH that specifically recognizes and binds to the antigen. The VHH is the variable region of a heavy chain antibody. Typically, a VHH contains three CDRs and four FRs.

[0044] This invention provides a polynucleotide for enhancing peptide expression, the nucleotide sequence of which is shown in any one of SEQ ID NO: 2-7. The polynucleotide is operatively linked to a gene, primarily enhancing the gene translation process and increasing peptide expression. The polynucleotide can be DNA or RNA.

[0045] This invention also provides the application of the polynucleotide for enhancing polypeptide expression, wherein the polynucleotide is operatively linked to the coding sequence of the polypeptide. This invention also provides a nucleic acid construct comprising the polynucleotide and the coding sequence of the polypeptide, wherein the polynucleotide is operatively linked to a gene encoding the polypeptide. The operative link can be a direct link or a linker linking through the coding sequence of a linker. The sequence of the linker is (GGGGS)n or SGGGGS, where n is a positive integer greater than 0, such as 1, 2, or 3. Other sequences, such as UTR sequences or signal peptide sequences, may also be included between the polynucleotide and the coding sequence of the polypeptide; the polynucleotide may be upstream or downstream of the coding sequence of the polypeptide.

[0046] In some embodiments, the polypeptide includes antibodies, chimeric antigen receptors, transmembrane proteins, cytokines, vaccines, antigens, synthetic peptides, chimeric polypeptides, signal peptides, peptide tags, etc.

[0047] The antibodies are single-chain antibodies, single-domain antibodies, bispecific antibodies, and multispecific antibodies. Antibodies can be secreted proteins, such as immunosuppressant antibodies, PD-1 antibodies, CTLA4 antibodies, PD-L1 antibodies, PD-1 / CTLA4 bispecific nanobodies, etc. The sequence of the single-domain antibody targeting PD-1 is the single-domain antibody targeting PD-1 described in any embodiment of patent CN202011582908.X, the entire contents of which are incorporated herein by reference. The sequence of the single-domain antibody targeting CTLA-4 is the single-domain antibody targeting CTLA-4 described in any embodiment of patent CN202111152925.4, the entire contents of which are incorporated herein by reference. In some embodiments, the PD-1 / CTLA4 bispecific nanobodies are the PD-1 / CTLA4 bispecific nanobodies described in any embodiment of patent PCT / CN2024 / 084767, the entire contents of which are incorporated herein by reference. In some embodiments, the sequence of the PD-1 / CTLA4 bispecific antibody is shown in any of SEQ ID NO:8-11.

[0048] Chimeric antigen receptors contain an optional signal peptide sequence, an extracellular target recognition region (antigen-binding domain), a hinge region, a transmembrane region, an intracellular co-stimulatory domain, and an intracellular signaling domain. The extracellular recognition region contains an antibody targeting the antigen (e.g., a tumor antigen), such as a full-length antibody, an antigen-binding fragment, a single-domain antibody (nanobody), or a single-chain variable fragment (scFv). The transmembrane protein can be a native polypeptide or a chimeric polypeptide, such as a chimeric antigen receptor, a T-cell antigen receptor, or transmembrane IL-2. Cytokines can be IL-2, IL-5, IL-7, IL-10 / IL-12, IL-21, etc. The signal peptide can be the CD8 signal peptide, the IL-10 signal peptide, etc. Polypeptides can also be combinations of polypeptides, such as a combination of a chimeric antigen receptor and a secreted antibody, or a combination of a signal peptide and a secreted antibody. Different polypeptides can be operatively linked (e.g., via a linker) or functionally independent linked (e.g., via a 2A peptide link or a Furin recognition site link).

[0049] The "signal peptide" described herein is a short peptide chain (5-30 amino acids in length) that guides the transfer of newly synthesized polypeptides into the secretory pathway. The signal peptide is selected from CD8 signal peptide, CD28 signal peptide, CD4 signal peptide, light chain signal peptide, or IL-10 signal peptide.

[0050] In some embodiments, the nucleic acid construct further comprises: a 5' UTR (untranslated region) and / or a 3' UTR, a poly(A) or polyadenylation signal, a promoter, or a chimeric promoter. In some embodiments, the nucleic acid construct comprises, from 5' to 3', sequentially a coding sequence for an operably linked polypeptide, a coding sequence for a linker, and a polynucleotide. In some embodiments, the nucleic acid construct comprises, from 5' to 3', sequentially a chimeric promoter, a coding sequence for a polypeptide, a coding sequence for a linker, a polynucleotide enhancing polypeptide expression, and a poly(A) or polyadenylation signal. In some embodiments, the nucleic acid construct comprises, from 5' to 3', sequentially a chimeric promoter, a 5' UTR, a coding sequence for a polypeptide, a 3' UTR, a coding sequence for a linker, a polynucleotide enhancing polypeptide expression, and a poly(A) or polyadenylation signal.

[0051] In some embodiments, the nucleic acid construct, from 5' to 3', sequentially includes a coding sequence for an operably linked polypeptide, a coding sequence for a Furin recognition site, and a polynucleotide. In some embodiments, the nucleic acid construct, from 5' to 3', sequentially includes an operably linked chimeric promoter, a coding sequence for a polypeptide, a coding sequence for a Furin recognition site, a polynucleotide that enhances polypeptide expression, and a poly(A) or polyadenylation signal. In some embodiments, the nucleic acid construct, from 5' to 3', sequentially includes an operably linked chimeric promoter, a 5' UTR, a coding sequence for a polypeptide, a 3' UTR, a coding sequence for a Furin recognition site, a polynucleotide that enhances polypeptide expression, and a poly(A) or polyadenylation signal.

[0052] In some embodiments, the nucleic acid construct is a cloning vector, an expression vector, or an integration vector. Expression of the polynucleotide sequence of the present invention is typically achieved by operably ligating the polynucleotide sequence of the present invention to an expression vector. A typical cloning vector contains transcription and translation terminators, a start sequence, and a promoter that can be used to regulate the expression of the desired nucleic acid sequence. An integration vector contains components for integrating the target sequence into the cellular genome. These vectors can be used to transform appropriate host cells to enable them to express proteins. Vectors typically contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. These sequences (collectively referred to in some embodiments as "flanking sequences") typically include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splicing sites, a leader sequence encoding a polypeptide secretion, a ribosome binding site, a polyadenylated sequence, a multi-connector region for inserting a nucleic acid encoding the binding molecule to be expressed, and optional marker elements. Furthermore, the type of vector is not limited; for example, plasmids, phage particles, phage derivatives, animal viruses, and granules can be varied depending on the host cell to which they are introduced. Viral vector technology is well known in the art and has been described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. To assess the expression of peptides or their fractions, vectors introduced into cells may also contain one or both of optional marker genes or reporter genes to facilitate the identification and selection of expressing cells from cell populations seeking transfection or infection via viral vectors.

[0053] In some embodiments, the vector includes, but is not limited to, conventional circular DNA plasmids, linear DNA plasmids, microcircular plasmids, nanoparticles, doggybone, and other DNA forms that do not contain antibiotic or / and replicon DNA sequences. In some embodiments, the DNA vector is a DNA microcarrier whose DNA backbone sequence does not contain an antibiotic expression cassette and is preferably limited to a length of less than 600 bp, and / or does not contain a CpG DNA motif. In some embodiments, the DNA vector is an antibiotic-free microplasmid, i.e., a microplasmid without an antibiotic resistance gene (antibiotic-free expression cassette microplasmid), also called a tiny or tiniplasmid. Antibiotic-free microplasmids suitable for use in this invention can be found in the antibiotic-free microplasmids described in any embodiment of PCT / CN2024 / 072052 or the antibiotic-free microplasmids produced by the strain CN202410952401.0. The entire contents of this application are incorporated herein by reference. In some embodiments, the antibiotic-free microplasmid contains a nucleotide sequence encoding an antitoxin protein and a replicon.

[0054] This invention also provides a host cell comprising the nucleic acid construct described herein. Suitable host cells for introducing the nucleic acid construct described herein can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: *Escherichia coli*, *Streptomyces* spp.; bacterial cells of *Salmonella typhimurium*; fungal cells such as yeast; insect cells of *Drosophila* S2 or Sf9; animal cells of CHO, COS7, 293, etc. Examples of mammalian cells include immune cells, including: T cells, NK cells, peripheral blood mononuclear cells (PBMCs), neutrophils, eosinophils, hematopoietic stem cells, and antigen-presenting cells. Methods for introducing nucleic acids or vectors into mammalian cells are known in the art, and the vectors can be transferred into cells by physical, chemical, or biological methods. Examples of mammalian cells also include tumor cells, such as hybridoma cells.

[0055] In some embodiments, the host cells express and / or secrete the polypeptide. The polypeptide may be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant protein can be isolated and purified using various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations thereof. The host cells can also be used as cell therapy products, reinfused into the human body to express and secrete polypeptides; for example, secreting PD-1 antibodies, CTLA4 antibodies, PD-1 / CTLA4 bispecific antibodies, TCEs, cytokines, etc., to treat diseases.

[0056] The present invention also provides a method for producing a polypeptide, the method comprising: culturing host cells under conditions suitable for polypeptide production, and optionally purifying the polypeptide from the culture, or incubating a construct encoding the nucleic acid under conditions suitable for the translation of DNA or RNA in a non-cellular system (e.g., solution).

[0057] The present invention also provides an engineered antigen-presenting cell, wherein the antigen-presenting cell is loaded with the polynucleotide or the nucleic acid construct.

[0058] Antigen-presenting cells are cells that can transmit antigen information to lymphocytes (such as T cells) to trigger an immune response, including macrophages, B cells, and dendritic cells (DC cells or DCs).

[0059] The term "antigen" has its conventional meaning and refers to a molecule capable of inducing an immune response. In the context of this invention, an antigen can be a protein or a fragment thereof, such as a (poly)peptide that presents an epitope of said protein. However, the antigen used may also be an artificial peptide or a peptide mimic. The antigens used in this invention are preferably proteins or portions thereof obtained from or derived from tumor cells.

[0060] In this article, tumor antigens can be tumor-associated antigens, tumor-specific antigens, or neotumor antigens.

[0061] In some implementations, the antigen-presenting cells are also loaded with tumor antigens.

[0062] In some embodiments, the tumor antigen is selected from one or more of the following: hTERT, p53, Her2, Survivin, KRAS, CEA, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-C1, MAGE-C2, MUC1, Wilms tumor 1 (WT1), Her2-neu, NY-ESO-1, Mammaglobin-A, Folate Receptorα (FR-α), HPV16 / 18-E6, HPV16 / 18-E7, Alpha Fetoprotein (AFP), Glypican3 (GPC3), Prostate-Specific Antigen (PSA), Prostatic Acid Phosphatase (PAP), Prostate-Specific Membrane Antigen (PSMA), Prostate Stem Cell Antigen (PSCA), Six-transmembrane epithelial antigen of prostate 1 (STEAP1), B-cell maturation antigen (BCMA), CMV pp65, gp100, PRAME.

[0063] In some embodiments, the tumor antigen includes P53, Survivin, and MUC1. Survivin is tandem with P53.

[0064] In some implementations, the antigen also contains hTERT and KRAS.

[0065] In some implementations, the Survivin and P53 are connected in series via a connector; preferably, the connector is GGGSGG.

[0066] In some specific embodiments, the amino acid sequence of the tandem Survivin and P53 is shown in SEQ ID NO:22, the amino acid sequence of MUC1 is shown in SEQ ID NO:23, the amino acid sequence of hTERT is shown in SEQ ID NO:24, and the amino acid sequence of KRAS is shown in SEQ ID NO:25.

[0067] In some embodiments, the tumor antigen includes P53 or a mutant antigen thereof, KRAS or a mutant antigen thereof, Survivin, and hTERT. For example, P53 or a mutant antigen thereof is tandemly linked with KRAS or a mutant antigen thereof, and Survivin is tandemly linked with hTERT.

[0068] In some implementations, a self-adjuvant is fused to the tumor antigen.

[0069] Preparation method of engineered antigen-presenting cells

[0070] In this study, DCs can be derived from DC precursor cells isolated from the subject's own blood, such as CD34+ hematopoietic precursor cells derived from umbilical cord blood, or differentiated from CD14+ monocytes derived from peripheral blood. DCs were obtained after isolation, culture, expansion, and differentiation from the subject.

[0071] The method for culturing DC precursor cells to differentiate into DCs can be any method known in the art or any other method capable of differentiating DC precursor cells into DCs, such as adding cytokines GM-CSF and IL-4 to the culture medium for differentiation culture. In other embodiments, the DCs can be cells obtained by in vitro expansion and culture followed by differentiation culture of an immortalized DC precursor cell line. The immortalized DC precursor cell line can be a cell line known in the art or publicly reported, such as the MUTZ3 cell line, or an immortalized DC precursor cell line prepared by the method described in CN201810368646.3. The immortalized DC precursor cell line can be expanded in large quantities in vitro and then differentiated into DCs by the aforementioned method.

[0072] The term "load" as used herein refers to enabling antigen-presenting cells to contain (capture) tumor antigens in a certain way, thereby processing the antigens and presenting them to other immune cells. Taking dendritic cells (DCs) as an example, loading can be achieved through various methods of contacting the antigen or its coding sequence, such as incubation with recombinant, synthetic, or purified tumor antigen peptides or proteins, incubation with tumor cell lysates, incubation with apoptotic or necrotic tumor cells, or enabling the cells to express the antigen. Enabling cells to express antigens can be achieved by contacting the cells with nucleic acids (DNA or RNA) encoding the tumor antigen (e.g., co-incubation) or by introducing the nucleic acid into the cells (e.g., by electroporation) (e.g., via electroporation of RNA). Introducing a DNA-coding sequence into cells typically involves a nucleic acid (DNA) construct containing that DNA sequence along with a suitable promoter or control sequence, such as expression vectors and integration vectors. These vectors can be used to transform appropriate host cells to enable them to express proteins. Alternatively, the RNA-coding sequence of the antigen (e.g., mRNA) can be directly introduced into the cells to express the antigen. Depending on the tumor to be targeted, the antigen can be contacted with and loaded with the corresponding tumor antigen or its encoding nucleic acid (e.g., mRNA). Methods of loading antigens are known in the art, such as incubation, cell transformation (e.g., electroporation of DNA or mRNA), etc. In this document, the antigen or its coding sequence is in a soluble form or the antigen or its coding sequence is attached to a solid support. The solid support may include polystyrene beads. The solid support is biodegradable.

[0073] Antigen-presenting cells (e.g., dendritic cells) are induced to mature by contact with a maturation composition (maturation cocktails). The maturation compositions used exemplary herein comprise one or more selected from IFN-γ, PolyI:C, R848, and PGE2. The dendritic cells are contacted with the maturation composition for at least 10 hours, at least 20 hours, at least 30 hours, or at least 40 hours.

[0074] There are generally no particular restrictions on the order of engineering and maturation of antigen-presenting cells; that is, cells can be loaded with antigens before being exposed to the cytokine composition, or antigens can be exposed to the cytokine composition before being loaded with antigens. This is within the knowledge of those skilled in the art.

[0075] Furthermore, in embodiments expressing tumor antigens and the polynucleotides or nucleic acid constructs, the coding sequences of the tumor antigens and the polynucleotides or nucleic acid constructs can be introduced into cells separately or simultaneously. Similarly, the coding sequences of tumor antigens and multispecific nanobodies can be located on separate nucleic acid constructs or combined in a suitable manner on the same nucleic acid construct.

[0076] In some implementations, antigen-presenting cells (APCs) such as dendritic cells (DCs) are obtained from subjects, such as those with cancer or at risk of developing cancer, using apheresis. Purified dendritic cells are cultured in the presence of a maturation composition to obtain mature DCs. The mature DCs are loaded with antigens, for example, by electroporation encoding the antigen's mRNA, to obtain mature DCs containing the antigen and a DC vaccine. Before, during, or after antigen loading, the DCs may be introduced with the nucleic acid constructs described herein (e.g., antimicrobial-free plasmids). The introduction may be via electroporation. The resulting DCs are then given to the patient. An exemplary treatment procedure involves administering DCs three times over a 4-week period.

[0077] The DC cells used in this invention can be freshly prepared or obtained by cryopreservation followed by thawing, such as DC cells obtained by thawing and culturing after one month of cryopreservation. The reagents, conditions, etc. required for cryopreservation and thawing can be obtained using conventional methods in the art.

[0078] In this article, the culture medium and culture conditions required for preparing DC cells can be the same as those for conventional DC cell culture. Exemplary culture media and culture conditions are shown in the examples.

[0079] The present invention also provides a method for in vitro activation of immune-active cells derived from a patient with a tumor, comprising:

[0080] Immune cells are obtained from the patient; the immune cells are co-cultured with the engineered antigen-presenting cells for a sufficient time to activate the immune cells, thereby obtaining activated immune cells.

[0081] The present invention also provides activated immune cells obtained by the aforementioned method.

[0082] The present invention also provides a pharmaceutical composition comprising engineered antigen-presenting cells and pharmaceutically acceptable excipients.

[0083] The antigen-presenting cells (e.g., dendritic cells) described herein can be used to prepare pharmaceutical compositions for the prevention or treatment of the various conditions and diseases described herein, such as DC vaccines. The conditions and diseases primarily refer to the occurrence, growth, and / or metastasis of tumors (cancers), including but not limited to: lung cancer, non-small cell lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer, lymphoma, hematologic malignancies, head and neck cancer, glioma, mesothelioma, colorectal cancer, gastric cancer, nasopharyngeal carcinoma, laryngeal cancer, cervical cancer, endometrial tumors and osteosarcoma, bone cancer, pancreatic cancer, renal cell carcinoma, skin cancer, prostate cancer, malignant melanoma of the skin or eye, uterine cancer, anal cancer, testicular cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestinal cancer, endocrine system cancers, bile duct cancer, and thyroid cancer. Cancer, parathyroid carcinoma, adrenal carcinoma, soft tissue sarcoma, urethral carcinoma, urothelial carcinoma, penile cancer, chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia), childhood solid tumors, lymphocytic lymphoma, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal tumors, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, Hodgkin's lymphoma, epidermal carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, including asbestos-induced cancers, and various types of leukemia and lymphoma, as well as various precancerous lesions.

[0084] The pharmaceutical compositions of the present invention can be different antigen-presenting cells loaded with different antigens, or a single antigen-presenting cell loaded with multiple antigens. In an exemplary embodiment, the pharmaceutical composition comprises antigen-presenting cells (e.g., dendritic cells) expressing the multispecific nanobodies described herein, loaded with Survivin-P53, MUC1, or Survivin-P53, MUC1, hTERT, and KRAS, respectively. The concentration and proportion of the various antigen-presenting cells in the pharmaceutical composition can be adjusted by those skilled in the art as needed. Exemplarily, the above three or four antigen-presenting cells are included in the pharmaceutical composition in equal proportions.

[0085] In addition to the DC cells described herein, the pharmaceutical compositions herein also contain pharmaceutically acceptable excipients, including but not limited to diluents, carriers, solubilizers, emulsifiers, and / or preservatives and adjuvants. These excipients are preferably non-toxic to the recipient at the doses and concentrations used. Such excipients include, but are not limited to, saline, buffers, glucose, water, glycerol, ethanol, and combinations thereof. In some embodiments, the pharmaceutical composition may contain substances for improving, maintaining, or retaining, for example, the composition's pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption, or permeation. These substances are known in the art. The optimal pharmaceutical composition can be determined based on the intended route of administration, delivery method, and required dosage.

[0086] The excipients in the pharmaceutical composition also include vaccine adjuvants. The adjuvants can be small molecules, biomolecules, compositions, complexes, or extracts of compounds known in the art that can enhance immune responses. In one or more embodiments, the adjuvants include those selected from aluminum adjuvants (e.g., aluminum hydroxide), Freund's adjuvants (e.g., complete and incomplete Freund's adjuvants), prostaglandin E2, alpha-interferon, Corynebacterium breviculae, lipopolysaccharides, cytokines, oil-in-water emulsions, water-in-oil emulsions, nanoemulsions, microparticle delivery systems, liposomes, microspheres, biodegradable microspheres, plaque virions, protein liposomes, proteasomes, immunostimulatory complexes (ISCOMs, ISCOMATRIX), microparticles, nanoparticles, biodegradable nanoparticles, silicon nanoparticles, polymeric micro / nanoparticles, polymeric sheet substrate particles (PLSP), microparticle resins, nanoliposome polymeric gels, synthetic / biodegradable and biocompatible semi-synthetic or natural polymers or dendritic polymers (e.g., PLG, PL...). GA, PLA, polycaprolactone, silicone polymers, polyesters, polydimethylsiloxane, sodium polystyrene sulfonate, polystyrene benzyltrimethylammonium chloride, polystyrene divinylbenzene resin, polyphosphazene, poly-[di-(carboxyacetylphenoxy)phosphazene (PCPP), poly-(methyl methacrylate), dextran, polyvinylpyrrolidone, hyaluronic acid and its derivatives, chitosan and its derivatives, polysaccharides, δ-inulin polysaccharide, glycolipids (synthetic or natural), lipopolysaccharides, one or more polycationic compounds (such as polyamino acids, poly-(γ-glutamic acid), poly-arginine-HCl, poly-L-lysine, polypeptides, biopolymers), cationic dimethyl di(octadecyl)ammonium (DDA), α-galactoside ceramide and its derivatives, archaeal lipids and their derivatives, lactams, gallons, glycerides, phospholipids, and spirochetes.

[0087] This invention also provides a method for treating a patient by applying engineered antigen-presenting cells or pharmaceutical compositions thereof as described in any embodiment of the invention. In this document, the terms “patient,” “subject,” “individual,” and “object” are used interchangeably and include any living organism, preferably an animal, more preferably a mammal (e.g., rat, mouse, dog, cat, rabbit, etc.), and most preferably a human. “Treatment” refers to a subject receiving the treatment regimen described herein to achieve at least one positive therapeutic effect (e.g., a reduction in the number of cancer cells, a reduction in tumor volume, a decrease in the rate of cancer cell invasion into surrounding organs, or a decrease in the rate of tumor metastasis or tumor growth). “Prevention” refers to a subject at risk receiving the treatment regimen described herein to achieve at least one effect of preventing the occurrence of disease or symptoms. Effective treatment or prevention regimens for patients can vary depending on various factors (e.g., the patient's disease state, age, weight, and the ability of the therapy to elicit an anti-cancer response in the subject).

[0088] The therapeutically effective amount of the pharmaceutical composition containing the engineered antigen-presenting cells of this invention will depend, for example, on the degree of treatment and the target. Those skilled in the art will understand that the appropriate dose level for treatment will vary in part depending on the delivered molecules, indication, route of administration, and the patient's size (weight, body surface or organ size) and / or condition (age and general health status). In some embodiments, clinicians may titrate the dose and vary the route of administration to obtain optimal therapeutic effect. For example, approximately 10 micrograms / kg body weight to approximately 50 milligrams / kg body weight per day.

[0089] The frequency of administration will depend on the pharmacokinetic parameters of the bound molecules in the formulation used. Clinicians typically administer the composition until a dose is reached to achieve the desired effect. The composition can therefore be administered as a single dose, or over time as two or more doses (with or without the same amount of the desired molecule), or via implanted device or catheter as a continuous infusion.

[0090] The drug composition can be administered via known methods, such as oral, intravenous, intraperitoneal, intracerebral (within brain parenchyma), intraventricular, intramuscular, intraocular, intraarterial, portal vein, or intralesional injection; via a sustained-release system; or via an implantable device. In one or more embodiments, the drug composition as a vaccine can be administered to the inguinal region via intrasegmental injection. Optionally, depending on the target of the vaccine, the vaccine can be administered subcutaneously or intradermally to the hands and feet of a cancer patient receiving treatment. Other routes of administration, such as intramuscular or blood injection, may also be used.

[0091] The present invention also provides methods for treating and / or preventing cancer, the methods comprising administering an effective dose of one or more of the aforementioned cell and pharmaceutical compositions to a subject. The methods include effects of at least one of treatment and prevention. In one or more embodiments, the methods of the present invention are for preventative purposes, wherein one or more of the cell and pharmaceutical compositions of the present invention are administered to the subject before the occurrence of cancer or precancerous lesions. In some cases, the pharmaceutical compositions are administered to the subject after the onset of one or more of the aforementioned cancers, with the aim of preventing the occurrence of further symptoms or further deterioration of existing symptoms. Prophylactic administration of one or more of the cell and pharmaceutical compositions of the present invention is intended to prevent or alleviate any subsequent symptoms. In one or more embodiments, the methods of the present invention are for therapeutic purposes, wherein one or more of the cell and pharmaceutical compositions of the present invention are administered to the subject at the onset of cancer or after the onset of cancer, with the aim of alleviating symptoms of existing cancer.

[0092] The present invention is described in further detail with reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, the invention should not be construed as limited to the following examples, but should be interpreted as including any and all variations that become apparent from the teachings provided herein. The methods and reagents used in the examples, unless otherwise stated, are conventional methods and reagents in the art.

[0093] Example

[0094] Example 1: Construction of a plasmid to enhance PD-1 / CTLA bispecific antibody expression using the L7S5 sequence

[0095] First, the plasmid pTini-CES-Z15-12Z1-Fc_0_2, which links the Qα gene to the bispecific antibody gene, was constructed, and its map is shown in Figure 1. The plasmid backbone uses the empty vector plasmid 0637 from CN118374547A. The chimeric promoter for the bispecific antibody expression cassette is the mCIS-CACA promoter shown in SEQ ID NO:33 from CN202411432640.X. The amino acid sequence of the PD-1 / CTLA4 bispecific antibody is shown in SEQ ID NO:10. The bispecific antibody is coupled to both ends with an IL-10 signal peptide and Qα, and the expression cassette (ORF) sequence is shown in SEQ ID NO:12.

[0096] Based on pTini-CES-Z15-12Z1-Fc_0_2, primer design was used to replace the linker with the coding sequence of RARR (Furin recognition site), resulting in the pTini-CES-Z15-12Z1-Fc_0_F plasmid. Then, Qα was replaced with newly designed polynucleotides mQα1, mQα2, mQα3, mQα4, mQα5, and mQα6 (i.e., the newly designed L7S5 sequence), as shown in SEQ ID NO: 2-7, to obtain the corresponding plasmid.

[0097] Primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., as shown below (SEQ ID NO:13-20):

[0098] Z15-f:CTGACAGGGGTCTCCGCCACCATGCATTCCTCAG

[0099] Furin-r:CTCATCAATGTATCTTAGGATCCTCATTAAGCGGCC

[0100] Qa1-r:CTCATCAATGTATCTTAGGATCCTCATTAACGCCACG

[0101] Qa2-r:CTCATCAATGTATCTTAGGATCCTCATTACAACCGCG

[0102] Qa3-r:CTCATCAATGTATCTTAGGATCCTCATTAAGGGCCCG

[0103] Qa4-r:CTCATCAATGTATCTTAGGATCCTCATTAAGGGCCGG

[0104] Qa5-r:CTCATCAATGTATCTTAGGATCCTCATTAGCGGCC

[0105] Qa6-r:CTCATCAATGTATCTTAGGATCCTCATTAGGCGGC

[0106] Taking the construction of plasmid pTini-CES-Z15-12Z1-Fc-0-F as an example, pTini-CES-Z15-12Z1-Fc-0-2 was used as a template, and Z15-f and Furin-r were used as front and back primers respectively, ligated seamlessly. The subsequent plasmid mutation construction method is the same as above, the difference being the back primers used, as shown in Table 1. The corresponding template is amplified using the corresponding primers, and then seamlessly cloned into the corresponding template to obtain the corresponding mutant plasmid.

[0107] Table 1

[0108] Example 2: Effect of CHO-K1 cell detection on bispecific antibody secretion

[0109] 1) CHO-K1 electroporation (or electrodialysis)

[0110] Culture medium preparation: Mix DMEM medium and RPMI 1640 medium in a 1:1 ratio, and then add 10% fetal bovine serum, 1% glutamine, 1% hypoxanthine and thymidine mixture.

[0111] Preparation of electroporation mixture: Follow the instructions of the Human T Cell Nucleofector transfection kit. Add 5 μg of plasmid to 100 μL of electroporation buffer. Experimental groups are shown in Table 2. pTini-CES-Z15-12Z1-Fc-0 has no Qα or L7S5 sequence.

[0112] Table 2

[0113] Prepare 1E6 CHO-K1 cells in the logarithmic growth phase. Mix the electroporation mixture from the above steps with the cell pellet and add it to the electroporation cuvette. Place the cuvette in a Lonza-Nucleofector 2b electroporator and select the CHO cell high-activity program (H-014) for electroporation. After electroporation, use the micropipette in the kit to aspirate the preheated culture medium and mix it with the electroporation suspension. Quickly transfer the mixture to a 6-well plate containing 3 mL of preheated culture medium, mix well, and incubate at 37°C in a 5% CO2 incubator.

[0114] On day 2 after electroporation, 500 μL of supernatant was collected from each group for antibody secretion detection.

[0115] 2) Antibody secretion level detection

[0116] Antigen coating: Prepare human PD-1 antigen (for first use, dissolve the antigen in sterile water, dilute the antigen to 1ug / ml with coating buffer, coat 100ul per well with the ELISA plate, and incubate overnight at 4°C). The next day, wash 3 times with PBST, 300ul per well each time, and pat dry with absorbent paper.

[0117] Blocking: Add 300 μL of blocking solution (3% BSA + PBST) to each well, then incubate the microplate in a 37°C biochemical incubator for 2 hours. After blocking, wash the wells three times with PBST, 300 μL per well each time, and pat dry with absorbent paper.

[0118] Sample addition: Dilute the sample with blocking buffer to a suitable gradient, generally two gradients. At the same time, prepare the standard. Dilute the standard with blocking buffer to the highest concentration of 6.25 ng / ml, and then add a gradient of 7 by step dilution of 2-fold. Use the blocking buffer as a negative control. Add the sample and standard to the plate, 100 μl per well. Each group of samples should be set up in duplicate. Then place the plate in a 37°C biochemical incubator for 2 hours. After that, wash 3 times with PBST, 300 μl per well each time, and pat dry with absorbent paper.

[0119] Add secondary antibody: Dilute the secondary antibody at a ratio of 1:10000 with blocking buffer, 100 μL per well, and then incubate the microplate in a 37°C biochemical incubator for 1 hour. After incubation, wash the plate 3 times with PBST, 300 μL per well each time, and pat dry with absorbent paper.

[0120] Color development: Add 100 μL of color development solution to each well and develop at room temperature in the dark for 5-10 minutes.

[0121] Termination: Add 50 μL of stop solution to each well to terminate the reaction.

[0122] Reading the data: Adjust the absorbance value in the ELISA template to OD450nm, then place the microplate into the instrument and run it. The instrument will automatically detect the absorbance. After the detection is completed, analyze the ELISA data results.

[0123] The test results are shown in Figure 2. On CHO-K1 cells, the bispecific antibody secretion levels of the pTini-CES-Z15-12Z1-Fc-0-F and pTini-CES-Z15-12Z1-Fc-0-mQα1 groups were better than those of the pTini-CES-Z15-12Z1-Fc-0-mQα6 groups.

[0124] Example 3: Detection of the effect of L7S5 sequence on bispecific antibody secretion in PBMC cells

[0125] 1) PBMC recovery and revitalization

[0126] Preparation of activation medium: Take AIM-V medium, add 2% fetal bovine serum and 500 IU / ml IL-2. Take a 15 ml centrifuge tube, add 9 ml of medium to the tube, remove the cryovial from the -80℃ freezer, and thaw it in a 37℃ constant temperature water bath as soon as possible. When a small piece of ice remains, transfer the cell suspension to a centrifuge tube containing medium in a laminar flow hood. Centrifuge at 300 g for 5 min, discard the supernatant, resuspend the cells with an appropriate amount of medium, take 10 μL of the cell suspension, and then dilute it with 0.4% trypan blue at a 1:1 ratio. After thorough mixing, perform cell counting. Based on the counting results, for every 1E7 cells, use 30 μL of Miltenyi T Cell TransAct.TM To activate the culture, add 3 ml of culture medium to each well, mix well, and incubate at 37°C in a 5% CO2 incubator.

[0127] 2) PBMC electro-rotation

[0128] Preparation of culture medium after electroporation: Take AIM-V culture medium and add 2% fetal bovine serum and 100 IU / ml IL-2.

[0129] Preparation of electroporation mixture: Follow the instructions of the Human T Cell Nucleofector transfection kit. Mix Nucleofector Solution:Supplement at a ratio of 82:18 and add 5 μg of plasmid to 100 μL of electroporation buffer. Experimental groups are shown in Table 1 above.

[0130] Prepare 7E6 activated human T cells. Mix the electroporation mixture from the above steps with the cell pellet and add it to the electroporation cuvette. Place the cuvette in a Lonza-4D electroporator and select the program human T cell stim (EO115) for electroporation. After electroporation, use the micropipette in the kit to aspirate the preheated culture medium and mix it with the electroporation suspension. Quickly transfer the mixture to a 6-well plate containing 3 ml of preheated culture medium, mix well, and incubate at 37°C in a 5% CO2 incubator.

[0131] On day 2 after electroporation, 500 μL of supernatant was collected from each group for antibody secretion detection.

[0132] 3) Antibody secretion level detection is as described in Example 1.

[0133] The test results are shown in Figure 3. On PBMC cells, pTini-CES-Z15-12Z1-Fc-0-F and pTini-CES-Z15-12Z1-Fc-0-mQα1 and pTini-CES-Z15-12Z1-Fc-0-mQα6 showed better secretion of dual antibodies compared to pTini-CES-Z15-12Z1-Fc-0-mQα6.

[0134] Example 4: Detection of the effect of L7S5 sequence on bispecific antibody secretion in DC cells

[0135] 1) DC cell generation

[0136] Monocyte-derived dendritic cells (DCs) were generated from peripheral blood mononuclear cells (PBMCs) via standard Ficoll density centrifugation to isolate PBMCs from patient leukocyte removal samples. PBMCs were seeded in serum-free AIM-V medium and allowed to adhere to culture flasks with 0.22 μm filter caps. After 2 hours, non-adherent cells were removed, and adherent monocytes were subsequently cultured for 6 days in AIM-V containing 50 ng / ml rhIL-4 and 100 ng / ml rhGM-CSF. On day 3, half of the medium was replaced with fresh medium containing GM-CSF and IL-4. A maturation mixture consisting of 100 IU / ml IFN-γ, 10 μg / ml poly(I:C), 5 μg / ml R848, and 1 μg / ml PGE2 was used to induce DC maturation for 24 hours.

[0137] 2) DC cell transformation

[0138] Observe cell morphology under a microscope, collect DCs into centrifuge tubes, and centrifuge at 300g for 10 min at room temperature; discard the supernatant, add an appropriate amount of DPBS to resuspend, and count the cells; take the number of cells for electroporation, and centrifuge at 300g for 10 min at room temperature. Take the electroporation kit (from Lonza), add 100 μl of electroporation reagent according to the 4D electroporation kit instructions, and then electroporate 3 μg of plasmid per 2E6 cells to prepare the electroporation mixture; resuspend the centrifuged cell pellet, gently mix, transfer the mixture to an electroporation cuvette, and select the DC human DNA program for electroporation; use the micropipettes in the kit to transfer the electroporated cell suspension to 6-well or 12-well plates (containing DC induction medium), mix well, and incubate at 37℃ in a 5% CO2 incubator.

[0139] On day 1 after electroporation, 200 μL of supernatant was collected from each group for antibody secretion detection.

[0140] 3) Antibody secretion level detection is as described in Example 1.

[0141] The test results are shown in Figure 4. On DC cells, pTini-CES-Z15-12Z1-Fc-0-F, pTini-CES-Z15-12Z1-Fc-0-mQα1, pTini-CES-Z15-12Z1-Fc-0-mQα4, pTini-CES-Z15-12Z1-Fc-0-mQα5, and pTini-CES-Z15-12Z1-Fc-0-mQα6 showed better bispecific antibody secretion compared to pTini-CES-Z15-12Z1-Fc-0-mQα5.

[0142] Example 5: Detection of the effect of L7S5 sequence on GM-CSF secretion in DC cells

[0143] 1) Generation and transformation of DC cells

[0144] DC cells were generated according to the method in Example 4, and GM-CSF mRNA without the mQα1 sequence and GM-CSF-mQα1 mRNA were electroporated into DC cells at a rate of 10 pmol / 2E6 cells. On day 1 after electroporation, 200 μL of supernatant was collected from each group for GM-CSF factor secretion detection.

[0145] The structure of GM-CSF-mQα1 mRNA is shown in Figure 5, and its sequence is shown in SEQ ID NO: 21. Compared with GM-CSF-mQα1 mRNA, GM-CSF mRNA lacks the mQα1 sequence.

[0146] 2) GM-CSF factor secretion level detection

[0147] Sample addition: Prepare a suitable gradient of samples using sample diluents, generally two dilutions. At the same time, prepare standards. Dilute the standards with blocking buffer to the highest concentration of 1000 pg / ml, and then add the standards in a 2-fold serial dilution gradient of 7. Use the blocking buffer as a negative control. Add the samples and standards to the standard plate, 50 μL per well. Each sample group should have replicates.

[0148] Add antibodies: Dilute 10x capture antibody and 10x detector antibody to 1x with blocking buffer, 50ul per well, then place the microplate in a 37°C biochemical incubator for 1 hour. After the incubation, wash 3 times with PBST, 300ul per well each time, and pat dry with absorbent paper.

[0149] Color development: Add 100 μL of color development solution to each well and develop at room temperature in the dark for 5-10 minutes.

[0150] Termination: Add 100 μL of stop solution to each well to terminate the reaction.

[0151] Reading the data: Adjust the absorbance value in the ELISA template to OD450nm, then place the microplate into the instrument and run it. The instrument will automatically detect the absorbance. After the detection is completed, analyze the ELISA data results.

[0152] The test results are shown in Figure 6. When the GM-CSF secretion level was detected on the DC, the GM-CSF-mQα1 mRNA electroporation group had a higher secretion level than the GM-CSF mRNA without mQα1.

[0153] Example 6: Detection of the effect of L7S5 sequence on bispecific antibody secretion and tumor-killing function of DC-T cells on DC cells

[0154] 1) Generation and transformation of DC cells

[0155] DC cells were generated according to the method in Example 4. The antigens (Survivin-P53, sequence as shown in SEQ ID NO: 22; MUC1 antigen, sequence as shown in SEQ ID NO: 23) were co-electropoietin into DC cells with pTini-CES-Z15-12Z1-Fc-0-F (without the mQα sequence) and pTini-CES-Z15-12Z1-Fc-0-mQα (containing the mQα sequence (mQα4, sequence as shown in SEQ ID NO: 5) at a dose of 10 pmol / 2E6 cells. On day 1 after electroporation, 200 μL of supernatant was collected from each group for antibody secretion detection. The results are shown in Figure 7. In DCs, pTini-CES-Z15-12Z1-Fc-0-F showed superior secretion of bispecific antibodies.

[0156] 2) Effect of antigen-loaded DCs on the tumor-killing ability of T cells

[0157] DCs were electroporated for 24 hours and then mixed with T cells at a ratio of 1:5 (DCs: 5 × 10⁻⁶). 5 T cells: 2.5 × 10 6 T cells were co-cultured for 7 days. T cell killing ability was detected using a lactate dehydrogenase cytotoxicity assay kit (from Roche). HepG2 cells (from ATCC) were used as target cells, transfected with the antigen one day in advance at an effector-to-target ratio of 20:1. Co-culture time was 4 hours. The difference in killing ability between the MHCI blocking group and the non-blocking group was calculated.

[0158] The results are shown in Figure 8. The T cell killing ability was detected using a lactate dehydrogenase cytotoxicity assay kit. The effector-to-target ratio was 20:1, and the co-culture time was 4 hours. The difference in killing ability between the MHCI blocking group and the non-blocking group was calculated. The tumor-killing ability of T cells in the DC(TAA+Z15-12Z1-Fc+mQα) co-culture group was significantly higher than that in the DC(TAA+Z15-12Z1-Fc) co-culture group.

Claims

1. A polynucleotide that enhances expression of a polypeptide, comprising, Its nucleotide sequence is as shown in any one of SEQ ID NO: 2-7, or has at least 80%, 85%, 90%, or 95% identity with the nucleotide sequence shown in any one of SEQ ID NO: 2-7.

2. Use of a polynucleotide according to claim 1 for enhancing the expression of a polypeptide, characterized in that The polynucleotide and the coding sequence of the polypeptide are operatively linked.

3. Use according to claim 2, wherein the compound is ###0002### The polypeptide includes one or more of the following: antibody, chimeric antigen receptor, cytokine, vaccine, antigen, synthetic peptide, chimeric polypeptide, signal peptide, and peptide tag.

4. A nucleic acid construct, characterized in that, The invention comprises the coding sequences of the polynucleotide and polypeptide as described in claim 1, wherein the coding sequences of the polynucleotide and polypeptide are operatively linked. Preferably, the operable connection is a direct connection, a connection via a connector, or a connection using a Furin recognition site encoding sequence; More preferably, the sequence of the connector is (GGGGS)n or SGGGGS, where n is a positive integer greater than 0.

5. The nucleic acid construct of claim 4, wherein, The polypeptide comprises one or more of the following: antibody, chimeric antigen receptor, cytokine, vaccine, antigen, synthetic peptide, chimeric polypeptide, signal peptide, and peptide tag; Preferably, the polypeptide comprises a PD-1 / CTLA4 bispecific antibody and an optional signal peptide; More preferably, the sequence of the antibody is as shown in any one of SEQ ID NO:8-11.

6. The nucleic acid construct as described in claim 4 or 5, characterized in that, The nucleic acid construct also includes one or more of the following elements: 5'UTR, 3'UTR, poly(A), polyadenylation signal, promoter, chimeric promoter.

7. The nucleic acid construct of any one of claims 4-6, wherein, The nucleic acid construct is a cloning vector, expression vector, or integration vector.

8. A host cell, characterized in that, It comprises the polynucleotide of claim 1 or the nucleic acid construct of any one of claims 4-7.

9. The host cell of claim 8, wherein The host cell expresses and / or secretes the polypeptide.

10. A method of producing a polypeptide, comprising, The method includes: culturing the host cells of claim 8 or 9 under conditions suitable for polypeptide production, and optionally purifying the polypeptide from the culture. Alternatively, the nucleic acid construct encoding any one of claims 4-7 may be incubated under conditions suitable for the translation of DNA or RNA in a non-cellular system.

11. An engineered antigen presenting cell, characterized in that, The antigen-presenting cells contain the polynucleotide of claim 1 or the nucleic acid constructs of claims 4-7.

12. The antigen presenting cell of claim 11, wherein the antigen is a tumor antigen. The antigen-presenting cells are also loaded with tumor antigens or their coding sequences. Preferably, the tumor antigens include P53, Survivin, and MUC1, wherein Survivin is tandem with P53. Preferably, the antigens also contain hTERT and KRAS.

13. The antigen-presenting cell as described in claim 12, characterized in that, The Survivin and P53 are tandemly linked by a linker; preferably, the linker is GGGSGG; more preferably, the amino acid sequence of the tandemly linked Survivin and P53 is shown in SEQ ID NO:22, the amino acid sequence of MUC1 is shown in SEQ ID NO:23, the amino acid sequence of hTERT is shown in SEQ ID NO:24, and the amino acid sequence of KRAS is shown in SEQ ID NO:

25.

14. The antigen-presenting cell according to any one of claims 11-13, characterized in that, The antigen-presenting cells are selected from macrophages, B cells, or dendritic cells.

15. A method for in vitro activation of immune-active cells derived from a patient with a tumor, comprising: Immune-active cells were obtained from the patient. The immune-active cells are co-cultured with the engineered antigen-presenting cells according to any one of claims 11-14 for a period of time sufficient to activate the immune-active cells, thereby obtaining activated immune-active cells.

16. An activated immune-active cell, obtained by the method of claim 15.

17. A pharmaceutical composition comprising engineered antigen-presenting cells as described in any one of claims 11-14, and pharmaceutically acceptable excipients.

18. Use of the engineered antigen-presenting cells as described in any one of claims 11-14 in the preparation of a medicament; preferably, the medicament is used to prevent the occurrence or metastasis of a tumor in a subject, or to inhibit the growth or metastasis of a tumor in a subject, the tumor expressing the tumor-associated antigen.