A recombinant vector useful for endosperm-specific genome

The CRISPR/Cas12a recombinant vector system with an endosperm-specific GluB-1 promoter achieves precise genome editing in rice, addressing off-target issues and enhancing traits like starch content by restricting Cas12a expression to the endosperm.

WO2026139997A1PCT designated stage Publication Date: 2026-07-02COUNCIL OF SCI & IND RES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
COUNCIL OF SCI & IND RES
Filing Date
2025-12-23
Publication Date
2026-07-02

Smart Images

  • Figure IN2025052127_02072026_PF_FP_ABST
    Figure IN2025052127_02072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a recombinant vector for genome editing in rice. The vector comprises of GluB1 promoter of rice along with Cas 12 a gene and a guide RNA. Editing the targeted gene within localized tissue effectively mitigates the pleiotropic effect observed in non- targeted tissues, thus reducing the potential for unintended consequences. Tissue-specific genome editing (TSGE) plays a pivotal role in alleviating the metabolic burden on plants by restricting modifications to specific areas. The designed CRISPR-ESGE binary construct was introduced into Agrobacterium, which was then used to infect rice callus derived from seeds. The regenerated transformed plants were confirmed to contain the Cas12a gene, and the endosperm-specific expression of Cas12a was validated through RT-PCR analysis. Genome editing (GE) utilizing Cas12a offers distinct advantages over Cas9, which is characterized by heightened target specificity and decreased propensity for off-target effect, thereby potentially enhancing the grain starch content.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P-W0100789

[0002] A RECOMBINANT VECTOR USEFUL FOR ENDOSPERM-SPECIFIC GENOME EDITING IN RICE FIELD OF THE INVENTION

[0003] The present invention relates to a recombinant vector having Sequence ID No. 2 useful for endosperm- specific genome editing in rice. The present invention relates to notable advancement for rice crop improvement through CRISPR / Casl2.

[0004] BACKGROUND OF THE INVENTION

[0005] The CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated proteins) mediated prokaryotic genome editing tool offers precise targeting of desired genomic sequence in any organism (Ran et al., 2013). In the CRISPR / Cas system, short RNA- guided Cas protein for genome editing offers immense opportunities for crop improvement. Moreover, further advancement in these fields makes it a more suitable tool for crop improvement. One such advancement is the tissue-specific expression of Cas protein for editing the gene only in the targeted tissues in plants. The availability of variants of Cas protein makes it suitable to apply for various purposes. Among the variants, Cas 12a (formerly known as Cpfl) has advantages over traditional Cas9. Cas 12a recognizes a T-rich protospacer adjacent motif (PAM), which is different from Cas9's NGG PAM. This allows Cas 12a to target different DNA sequences and may expand the range of editable sites (Zetsche et al., 2015). Casl2a has demonstrated a lower frequency of off-target mutations compared to Cas9, making it a potentially safer choice for precise genome editing (Kim et al., 2017). The size of Cas 12a is smaller than Cas9, which can simplify the delivery of the editing system into plant cells (Zetsche et al., 2015). Cas 12a has shown less interference with the transcriptional activity of RNA polymerase compared to Cas9, which is advantageous for minimizing unintended effects on gene expression (Tang et al., 2017). Cas 12a exhibits decreased tolerance to mismatches in both the guide RNA and target DNA when compared to Cas9, leading to diminished off-target sequence recognition and cleavage (Kim et al., 2020).

[0006] Tissue-specific genome editing (TSGE), such as ESGE, has many advantages over constitutive genome editing (Fig.1). It is not always possible to edit genes constitutively that are essential and / or have a pleiotropic effect (Decaestecker et al., 2019). Editing of those genes may be associated with unintended effects such as interference in the physiological cellular machinery or reproduction. Therefore, the function of those genes cannot be elucidated through constitutive GE. On the other hand, TSGE offers editing of the targetedP-W0100789

[0007] gene in localized cells or tissues. TSGE also reduces the metabolic burden on the plant through its restricted editing in the intended areas (Singhaetal., 2021). ThroughTSGE, the pleiotropic effects of the HCL gene, a lignin biosynthesis essential gene was reduced by tissue specifically knocking down in the xylem cells in Arabidopsis (Liang et al., 2019). The fiber- specific promoter was used to drive Cas9 expression in the xylem vessels. Tissue-specific efficient editing in the cotton germline cells (GSGE) was achieved by using the GhPLIMP2b and GhMYB24 promoters for Cas9 expression (Lei et al., 2020). In the case of tomatoes, a genome editing technique known as Fruit-Specific Genome Editing (FSGE) was used to target the SIEZ2 gene, which is a counterpart of the Arabidopsis Curly leaf (CL ) gene. This approach aimed to address previous pleiotropic effects observed when the gene was mutated through RNA interference (Feder et al., 2020). To achieve this, a fruit- specific promoter derived from the phosphoenolpyruvate carboxylase 2 gene was employed. However, there is no report on tissue-specific genome editing in crop plants such as cereals.

[0008] Rice serves as a significant staple food globally and is also a model plant for cereal crops. The escalating demand for rice production due to a growing global population necessitates the development of improved rice varieties with higher crop yields. Furthermore, the strategies employed in enhancing rice as a model plant can be extended to other cereal crops. The field of Genetic Engineering (GE) has made notable advancements, providing strategies for rice crop improvement. Efforts to enhance rice yield through GE have included gene editing techniques. However, there has been a lack of reports on improving rice production in a tissue- specific manner. Here, we present a concept for developing Endosperm-Specific Genome Editing (ES GE) in rice by editing the ethylene gene using CRISPR / Casl2a. Overall, endosperm-specific glutelin promoter GluB-1 was selected for the endospermspecific expression of the Casl2a protein. We have self-designed the endosperm- specific construct for Casl2a genome editing (ESGE).

[0009] OBJECTIVES OF THE INVENTION

[0010] The main objective of the present invention is to provide a recombinant vector useful for genome editing in rice.

[0011] Another objective of the present invention is to expression of Casl2a exclusively in the endosperm.

[0012] Another objective of the present invention is to minimize off-target effect and enhance desirable trait in rice.P-W0100789

[0013] The further objective of the present invention is to enhance grain starch content.

[0014] SUMMARY OF THE INVENTION

[0015] The present invention relates to a recombinant vector having an amino acid sequence as set forth in Sequence ID No. 2.

[0016] In an embodiment the recombinant vector comprising promoter sequence, target protein sequence and guide RNA.

[0017] In one embodiment the promoter sequence is an endosperm tissue-specific promoter and the target protein comprising a gene encoding Cas 12a gene.

[0018] In another embodiment the present invention relates to a recombinant vector having Sequence ID No. 2 useful for genome editing in rice.

[0019] In another embodiment a host cell comprising the recombinant vector as described above, wherein the said host cell is a plant cell.

[0020] In another embodiment the present invention discloses a recombinant vector for use in expression in plant cell.

[0021] In another embodiment the present application discloses a recombinant plant cell comprising the recombinant vector.

[0022] In another embodiment the present application discloses a transgenic plant comprising the recombinant plant cell.

[0023] The present invention introduces a Cas 12a system, termed Casl2a-ESGE, meticulously designed for precise genome editing within the rice endosperm. By restricting the expression of Cas 12a to the endosperm tissue, this system significantly reduces unintended off-target effects and allows for the editing of negative regulatory genes, potentially enhancing traits such as rice grain starch content.

[0024] The uniqueness of Casl2a-ESGE lies in its strategic design, integrating the Cas 12a nuclease under the control of the endosperm- specific GluB-1 promoter, isolated from rice endosperm. This ensures that gene editing occurs efficiently within the targeted tissue. Additionally, the system incorporates a guide RNA (gRNA) driven by the Ubi promoter, providing specificity and precision in directing the editing process. To facilitate the selection and validation of successful genome edits, the system includes a hygromycin resistance gene (hptII).

[0025] Overall, Casl2a-ESGE represents a significant advancement in plant biotechnology, offering a precise, efficient, and tissue- specific approach to genome editing that minimizes off-target effects and enhances desirable traits in rice. The overall work is presented in the graphicalP-W0100789

[0026] abstract (Fig. 2).

[0027] BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Fig. 1. Representation of the importance and advantages of Endo sperm- specific genome editing (ESGE).

[0029] Fig. 2. Graphical abstract of the development of a novel CRISPR / Casl2a system for endosperm- specific genome editing (CRISPR-ESGE) in rice. The GluB-1 promoter from rice was cloned in the Casl2a entry vector. The Casl2a entry vector was assembled with the destination vector and gRNA entry vector to construct the CRISPR-ESGE Binary Expression vector. Agrobacterium containing the binary vector infects and transformed the rice callus. The expression of the Casl2a is observed only in the rice endosperm, indicating the chances of editing only in the endosperm. No editing is observed in other tissues.

[0030] Fig. 3. The process of cloning approach for the tissue- specific destination vector pMDC32-GluB- 1: (a): Cloning of amplified GluB-1 promoter from rice to the pCR2.1 cloning vector (Sequence 8) in the Kpnl and Hindi!! site; (b): Restriction digestion of the pCR2.1-GluB-l vector with Kpnl and Hind!!! enzymes; (c): Restriction digestion of the pMDC32-HPB vector with Kpnl and Hind!!! enzymes; (d) & (e): Selection of the GluB-1 digested product (1.3kb) and pMDC32-HPB vector backbone (11.6Kb); (f): Ligation of the two products resulting in the tissue- specific destination vector pMDC32-GluB-l

[0031] Fig. 4. Restriction digestion result for the cloning of the tissue-specific destination vector pMDC- GluB-1; Lane 1: Ikb ladder; Lane 2: Uncut pCR2.1-GluB-l; Lane 3,4,5: pCR2.1-GluB-1 -digested with Kpnl and Hind!!!', Lane 6: Uncut pMDC32; Lane 7: pMDC32 digested with Kpnl and Hind!!!.

[0032] Fig. 5. PCR analysis of the cloned plasmid pMDC-GluB-1; First Lane: 1Kb ladder; Lane 1: water; Lane 2-10: individual colonies.

[0033] Fig. 6. Cloning of the gRNA; the gRNA entry vector pYPQ141 is linearized with BsmBI. To the linearized region, amplified ACO-sgRNA oligos are ligated. The cloned sgRNA in the vector is confirmed through PCR.

[0034] Fig. 7. Confirmation of the correct sgRNA insertion through sequencing in the gRNA entry vector; Clone 1 & 2 (Sgl_Cl & Sgl_C2) showed correct insertion. The highlighted section is the correct sgRNA sequence.

[0035] Fig. 8. Confirmation of the assembled tissue- specific binary vector (17. Ikb) through restriction digestion: The expected 2. Ikb, 4.2kb, and 10.8kb size fragments were recovered after digestion of the plasmid with Kpnl restriction enzyme. First & Last Lane 1: Ikb ladder, Lane 1-4: Plasmid digested with Kpnl, Lane 5: pMDC32 digested with Kpnl, Lane 6:P-W0100789

[0036] pMDC32 plasmid uncut.

[0037] Fig. 9: Nipponbare rice transformation with the CRISPR-ESGE construct: The several steps of rice transformation are shown in the figure, including the callus initiation from the mature rice seeds to Agrobacterium transformation in the embryonic callus and selection of the transformed callus in the hygromycin-containing CHU N6 medium. After three rounds of antibiotic selection, the final survived calli were regenerated into shoots. The shoots developed roots and transformed into complete plants.

[0038] Fig. 10. PCR confirmation of the transformed rice plants with Casl2a primer; L: 500bp DNA ladder; B: Blank; Line 1-43: Ti putative lines.

[0039] Fig. 11: Molecular analysis of the transformed GE2 (2ndgenome edited generation) in the endosperm and leaf tissues; Ila: Separated total RNAs in agarose gel from leaf and endosperm samples, L: RNA ladder, Lane 1-14: RNA of Leaf (1-7) and endosperm (8-14) samples, P-P6: RNA samples of endosperm of PCR positive samples (P-P3), RNA of leaf of PCR positive samples (P4-P6); 11b: RT-PCR analysis of the cDNAs prepared from the total RNAs of endosperm and leaf samples, Lane L: lOObp DNA ladder, Lane 1-27: RT-PCR of samples of endosperm (10b left) and leaf (10b right) respectively, Lane N: Negative control with water, Lane P: Positive control with plasmid, Lane P1-P3: Positive control of endosperm of other constitutively expressing genome edited rice lines. Lane P4-P6: Positive control of leaves of other constitutively expressing genome-edited rice.

[0040] Fig. 12: pMDC_GLUT_Expression vector-ESGE (Gateway assembled CRISPR / Casl2a binary expression vector).

[0041] DETAILED DESCRIPTION OF THE INVENTION:

[0042] 1. Selection and cloning of the tissue-specific promoter in the pMDC32 destination vector

[0043] Glutelin serve as the primary reservoir for storing energy within the endosperm of rice grains. Within the spectrum of glutelin promoters, Glutelin B-l (pGluB-1) has been extensively examined and employed in the genetic modification of rice plants to facilitate the expression of recombinant proteins specifically within the endosperm. In the current study, a promoter for the glutelin gene (GluB-1) (Accession no. AY427569) selected as an endosperm tissuespecific promoter. In the complete pGluB-1, 1350bp region showing the highest gene expression efficiency was selected. Primers designed to amplify the desired promoter sequence from the genomic DNA isolated from Nipponabare endosperms. The source of genomic DNAP-W0100789

[0044] is isolation from Nipponbare seeds in Inventors lab at Biological Sciences and Technology Division, CSIR-NEIST, Jorhat-785 006, Assam, India. The forward (RG1350_F _HindIIF) and the reverse primers (RG1350_R_KpnI) contain Hindlll and Kpnl at their 5' ends.

[0045] The destination vector taken for the final cloning of the pGluB-1 was the pMDC32. Before cloning directly to the destination vector pMDC32, 1350p GluB-1 region was cloned first into the TA cloning vector pCR2.1 following the protocol instructed. The pCR2.1 is obtained in the TA Cloning™ Kit, with pCR™2.1 Vector from Invitrogen (Catalog number K202020) (Fig. 3a). The pCR™2.1 vector is designed with multiple features to facilitate cloning and sequencing processes. It includes 3'-T overhangs, allowing for direct ligation of PCR products amplified with Taq polymerase, simplifying the cloning of these products. The vector also contains a T7 promoter, enabling efficient in vitro RNA transcription and facilitating sequencing applications. Additionally, it incorporates a versatile polylinker flanked by EcoRI restriction sites, which provides easy excision of inserted sequences when needed. For further convenience in sequencing, the vector is equipped with M13 forward and reverse primer sites, making it a versatile tool in molecular biology workflows for a range of cloning and analysis tasks. The plasmid TA- 1350pGluB-l then sent for sanger sequencing. Finally, to clone the promoter sequence, pMDC32 destination vector linearized with Kpnl and Hindlll restriction enzyme by removing the native 35SCaMV promoter sequence. The 1350Glu-Bl promoter sequence of 1.35kb size then digested with Kpnl and Hindlll from the TA-1350pGluB-l cloning vector (Fig. 3b). The plasmid pMDC32 digested with the same two enzymes (Fig.

[0046] 3c), and the two restriction digested products (1.3 kb from TA-1350pGluB-l and 11.6kb from pMDC32) ligated (Fig. 3d-e). The modified Casl2a entry vector, the pMDC32-pGluB-l construct (Fig. 3f). Fig. 4 represents the restriction digested products resolved in agarose in the process. The confirmation of the final modified Casl2a entry vector the pMDC32-pGluB-1 construct, done through PCR (Fig. 5).

[0047] 2. Cloning of the gRNA into the guide RNA entry vector pYPQ141-ZmUbi-RZ-Lb

[0048] The performance of CRISPR / Casl2a relies on well-designed single-guide RNA (sgRNA), so a lot of bioinformatic tools have been developed to assist the design of highly active and specific sgRNA. These tools vary in design specifications, parameters, genomes and so on. Before designing the guide RNA, the exonic region of the gene identified using Benchling software. The guide RNA target the functional domain of the gene. Critical parameters followed for designing guide RNA (Casl2a). The guide RNA of 20-25 bp length is selected.P-W0100789

[0049] The GC% of the gRNA is 40-60 is set for the selected sgRNA sequence. The Casl2a recognizes an upstream (5') TTTN PAM site in the genomic sequence. As sgRNA should target the exons only, gRNA is selected from the coding domains. For effective gene editing the target region should be towards the 5' direction. While selecting the sgRNA, only single non-seed mismatches are allowed as Casl2a is more sensitive to mismatches. The specificity score is more than 90% with an efficiency score of more than 60%. The entry vector pYPQ141-ZmUbi-RZ-Lb (Addgene Plasmid #86197) used for cloning the guide RNA. For the gRNA cloning, the pYPQ141-ZmUbi-RZ-Lb vector restriction digested with enzyme Esp3I (BsmBV) and incubation is done at 37°C for Ihr (Fig. 6). The reaction mix subjected to 80°C to inactivate enzymes for 20 min. The vector is purified and cloned with the annealed gRNA oligos. E. coli DH5a cells are transformed with the annealed oligos and cultured overnight. The positive clones are verified with PCR using sgRNA- specific and vector backbone-specific primers before sending for Sanger sequencing (Fig.7).

[0050] 3. Assembly of the tissue-specific CRISPR / Casl2a binary vector

[0051] The Casl2a entry vector pYPQ230 (LbCpfl) was purchased (Addgene Plasmid #86210). The Casl2a entry vector, the cloned guide RNA entry vector pYPQ141-ZmUbi-RZ-Lb and the modified destination vector pMDC32-pGluB-l are assembled through Gateway recombination. The three plasmids are ligated using an LR recombination reaction and incubated at room temperature overnight. The reaction mixture is transformed into E. coli DH5a cells and incubated overnight. The positive clones are confirmed first through colony PCR with the Cas 12a promoter and restriction digested with Kpnl, which has three restriction sites in the assembled plasmid (CRISPR-GluBl-Casl2a- OSACO2) (Fig.8).

[0052] 4. Plant transformation with the CRISPR-GlutBl-Casl2a-OsACO2 construct

[0053] The assembled binary vector (pCRISPR-GluB-l-Casl2a-OsACO2) is bacterial transformed into Agrobacterium strain LBA4404. The strain obtained from a commercial source Invitrogen Thermofisher Scientific (https: / / www.thermofisher.com / ), Catalog No. 18313015. The positive clones are selected through PCR. The embryonic callus induced from the mature seeds of Nipponbare rice cultivar is selected for plant transformation. The commercial source of Nipponbare rice seeds was the International Rice Research Institute, Philippines (https: / / gringlobal.irri.org / gringlobal / accessiondetail?id=136016), Accession No. IRGC 136196. For the transformation, methods by Toki 1997 were followed with modificationsP-W0100789

[0054] according to the cultivar tried. 40-45 numbers of seeds were placed on the CHU N6CI callus induction medium with the embryo side properly touching the medium. Once small embryogenic calli were induced, the callus was sub-cultured to fresh N6CI medium for another 3-4 weeks. After 3-4 weeks, the compact yellow secondary calli transferred to fresh N6CI medium and cultured for three days in continuous light at 28°C. Only the embryogenic calli with the N6 Agro suspension culture incubated for 90 seconds with continuous gentle shaking, and removed the AA solution. The embryogenic calli transferred to sterilized filter paper to remove excess of Agrobacterium. After three days, the calli are washed with sterile water containing 150mg / L timentin (Fig. 9). The calli placed on N6 selection medium containing 30mg / L Hygromycin for three times at 14 days intervals. The healthy compact yellow embryogenic calli, after two rounds of selection, regenerated into an MS regeneration medium. After 6 days of culture, green embryoids observed on the calli. These green embryoids allowed to grow on the same plate for another 10-12 days then the green embryoids transferred to a rooting medium, and after 2-3 weeks of culture, the roots washed carefully under running tape water to remove agar and transferred to the soil.

[0055] 5. Selection of the transformants through PCR from the genomic DNA of leaf

[0056] One month into growth, when the plants reached the four-leaf stage, genomic DNAs extracted from the leaves of the putative transformed plants using the SDS method. Subsequently, PCR conducted on the isolated genomic DNA employing Cas 12a- specific primers (Fig. 10). 6. Confirmation of the tissue-specific expression of Casl2a in the endosperm

[0057] The total RNA isolated from the endosperm (the embryo was dissected out), and a leaf of the GE2 transformed lines (Fig. Ila). cDNA is synthesized. The RT-PCR performed using the Cas 12a specific primer (265bp) forward- 5’ AGCGATTCCAGTCGGCAAGACTC 3’ and reverse 5’ AGGCTTTCGCGATCTCTTTCCTCA3’ at 60°C annealing temperature (Fig.

[0058] 11b).

[0059] Table 1 List of primers used in this study

[0060] SI. Purpose used Name of the primer Sequence Total Sequen No. for base ce ID pair No.

[0061]

[0062] P-W0100789

[0063] 1 Primer to GluB-1 AATCAAGCTTG 27 5 clone the (RG 1 '35G_F_HindIir) ATCTCGATTTTT

[0064] Glut-Bl Forward GAGG

[0065] promoter GluB-1 AATCGGTACCG 28 6

[0066] (RG1350_R_XpnZ) CTATTTGTACTT

[0067] Reverse GCTTA

[0068] 2 Primers for gRNA specific Forward CGTCGGAGATC 20 10 gRNA GAGAAGCTC

[0069] gRNA specific Reverse GAGCTTCTCGA 20 11

[0070] TCTCCGACG

[0071] 3 Rice Glutenin Rice glutenin 1350 vector GTTTGTCATGG 18 12

[0072] 1350_Vector backbone- specific CTGAGTC

[0073] backbone Forward

[0074] confirmation Rice glutenin 1350 vector GAACGGTCTGG 18 13

[0075] backbone- specific Reverse TTATАGG

[0076] 4 Casl2a Casl2a specific Forward CCGTATCAAGA 20 14 specific CCGACTACC

[0077] amplific Casl2a specific Reverse CTCTTGCGCTTC 20 15 ation ATAGTТCC

[0078]

[0079] Advantages

[0080] 1. Mitigation of pleiotropic effects:

[0081] The primary objective is to edit the targeted gene within localized tissue to effectively mitigate pleiotropic effects observed in non-targeted tissues, thereby reducing the potential for unintended consequences.

[0082] 2. Alleviating the metabolic burden

[0083] TSGE plays a pivotal role in alleviating the metabolic burden on plants by restricting genetic modifications to specific areas such as endosperm.

[0084] 3. Diminishing off-target effects

[0085] The approach of tissue-specific genome editing facilitates precise genetic alterations in particular tissues or organs, significantly diminishing off-target effects.

[0086] 4. Empowerment for gene function studiesP-W0100789

[0087] Tissue-specific editing empowers researchers to unravel the functions of individual genes in diverse tissue types, aiding in the identification of key genes.

[0088] 5. Specificity

[0089] Casl2a is suggested to exhibit higher precision in genome editing compared to the conventional Cas9 nuclease.

[0090] 6. Future application

[0091] The methodology for creating tissue-specific genome editing in rice can be extended to other economically significant crops, contributing to overall crop improvement.

Claims

P-W0100789We Claim1. A recombinant vector having an amino acid sequence as set forth in Sequence ID No. 2.

2. The recombinant vector as claimed in claim 1, comprising promoter sequence, target protein sequence and guide RNA.

3. The recombinant vector as claimed in claim 2, wherein the promoter sequence is an endosperm tissue-specific promoter.

4. The recombinant vector as claimed in claim 2, wherein the target protein comprising a gene encoding Cas 12a gene.

5. The recombinant vector as claimed in claim 1 for use in genome editing in rice.

6. A host cell comprising the recombinant vector of claim 1, wherein the said host cell is a plant cell.

7. The recombinant vector as claimed in claim 1, wherein the recombinant vector is for use in expression in plant cell.

8. A recombinant plant cell comprising the recombinant vector of claim 1.

9. A transgenic plant comprising the recombinant plant cell of claim 7.