Method for producing 33-mer alpha-gliadin-deleted wheat

Abstract

The present invention relates to a method for producing 33-mer alpha-gliadin-deleted wheat and wheat produced thereby and, specifically, to a method for producing α-D4-1 and α-D4-2 genes-deleted wheat by using radiation and selecting same. The method for producing 33-mer alpha-gliadin-deleted wheat, according to the present invention, enables the production of a mutant wheat or wheat breeding parental line, which is a radiation breeding-based non-GMO, while having agronomic traits similar to those of a wild-type wheat variety, and thus wheat with reduced toxicity to celiac disease can be produced, for use in the production of processed wheat foods and the like, or a parental line for wheat breeding varieties with reduced toxicity to celiac disease can be produced.

Description

Method for producing wheat deficient in 33-MER alpha-gliadin

[0001] The present invention relates to a method for producing wheat with a 33-mer alpha-gliadin deficiency and wheat produced thereby, specifically to a method for producing wheat with α-D4-1 and α-D4-2 genes deficient using radiation and selecting the same.

[0002]

[0003] Celiac disease is an intestinal disorder of the digestive system caused by digestive problems with gluten, which is abundant in grains such as wheat, barley, rye, and oats. While most people digest and absorb gluten without any issues, those with gluten digestion problems trigger an immune response in the gastrointestinal tract, causing inflammation and damage to the villi of the mucosal cells. This results in an inability to easily absorb nutrients, leading to various symptoms such as growth retardation, loss of appetite, chronic diarrhea, abdominal distension, herpetic dermatitis, and anemia due to iron deficiency. Consequently, this malabsorption of nutrients acts as a cause for serious diseases.

[0004] In other words, when a person who is congenitally lacking or deficient in the enzyme that breaks down gluten consumes it, the gluten is absorbed into the intestines in a lumpy state. At this time, the decline in intestinal function causes the mucosal villi to atrophy and be damaged, leading to malabsorption and causing allergic reactions or hormonal disturbances.

[0005] The prevalence of celiac disease is reported to be over 3 million in the United States, about 300,000 in Canada, and about 1 in 88 to 262 in Europe, with an average global prevalence of about 1%. However, based on data regarding the frequency of HLA-DQ2 and HLA-DQ8 subtypes, the prevalence is reported to be between 5% and as much as 20% in Korea, Japan, Indonesia, China, and the Philippines, and about 20% in the United States, Canada, and Europe, suggesting that the actual prevalence of celiac disease is likely much higher.

[0006] Celiac disease can occur at any age, but symptoms typically begin to appear around 10 to 11 months of age when children start consuming gluten found in wheat flour. In particular, infants with a genetic predisposition face a higher risk of developing celiac disease if they first consume gluten-containing grains before 3 months or after 7 months, and various symptoms persist into childhood and adulthood. Notably, the incidence rate is reported to be higher in high-risk groups.

[0007]

[0008] The present invention aims to solve the aforementioned problem and other related problems.

[0009] One exemplary objective of the present invention is

[0010] (a) a step of irradiating the wheat with radiation; and

[0011] (b) a step of selecting wheat having one or more deletions selected from a group consisting of α-D4-1 and α-D4-2 genes;

[0012] The present invention provides a method for producing mutant wheat, comprising

[0013] Another exemplary objective of the present invention is to provide mutant wheat produced by the above-described manufacturing method.

[0014] Another exemplary purpose of the present invention is

[0015] (a) a step of irradiating the wheat with radiation; and

[0016] (b) a step of selecting wheat having one or more deletions selected from a group consisting of α-D4-1 and α-D4-2 genes;

[0017] The present invention provides a method for manufacturing a wheat breeding parent including

[0018] Another exemplary objective of the present invention is to provide a wheat breeding parent produced by the above-described manufacturing method.

[0019]

[0020] The technical problems to be solved according to the technical concept of the invention disclosed in this specification are not limited to those for solving the problems mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below.

[0021]

[0022] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.

[0023] As one embodiment for achieving the above objective, the present invention

[0024] (a) a step of irradiating the wheat with radiation; and

[0025] (b) a step of selecting wheat having one or more deletions selected from a group consisting of α-D4-1 and α-D4-2 genes;

[0026] A method for producing mutant wheat comprising

[0027] In step (a) of the present invention, the wheat may be of the Butte 86 variety, but is not limited thereto.

[0028] In step (a) of the present invention, the 'radiation' may specifically be a proton beam, and the 'proton beam' may irradiate 33 MeV to 100 MeV, specifically irradiate 33 to 35, 35 to 40, 40 to 45, 45 to 50, 50 to 55, 55 to 60, 60 to 65, 65 to 70, 70 to 75, 75 to 80, 80 to 85, 85 to 90, 90 to 95, or 95 to 100 MeV, and more specifically irradiate 100 MeV.

[0029] In step (b) of the present invention, the α-D4-1 gene may have the nucleotide sequence of SEQ ID NO. 1, and the α-D4-2 gene may have the nucleotide sequence of SEQ ID NO. 2.

[0030] In step (b) of the present invention, the α-D4-1 gene and the α-D4-2 gene may be simultaneously deleted, and the α-D4-1 gene and the α-D4-2 gene may be genes located in the Gli-D2 locus within the wheat 6D chromosome, and may encode the amino acid sequence of a 33-mer alpha-gliadin having 8 celiac disease epitopes.

[0031] The '33-mer alpha gliadin' of the present invention refers to a 33-mer peptide of alpha gliadin and corresponds to the alpha gliadin that is most toxic to celiac disease. The 'alpha gliadin' is a type of gliadin, and gliadin is a component of gluten and is an essential element for bread to rise properly while baking.

[0032] The above 33-mer alpha-gliadin contains epitopes that cause celiac disease, and the number of epitopes possessed varies depending on the gene encoding the 33-mer alpha-gliadin. For example, the 33-mer alpha-gliadins encoded by the α-D4-1 gene and the α-D4-2 gene each have eight epitopes that cause celiac disease, and the epitopes include one DQ2.5-glia-α1a, two DQ2.5-glia-α1b, three DQ2.5-glia-α2, one DQ2.5-glia-α3, and one DQ8-glia-α1.

[0033] In step (b) of the present invention, the 'deletion' refers to a state in which gene expression becomes difficult or impossible due to damage to the gene sequence, and includes abnormal expression patterns. The deletion may involve damage to part or all of the DNA sequence, and includes the destruction of gene function due to deletion, alteration, or insertion of the sequence.

[0034] The above defect may be caused by a defect in the Gli-D2 locus.

[0035] In step (b) of the present invention, the screening may utilize mutant lineage screening methods commonly used in the art, specifically, gene copy number variation (CNV), RP-UPLC (Reverse Phase Ultra Performance Liquid Chromatography), 2-dimensional electrophoresis (2-DE), NuPAGE (Neutral pH Polyacrylamide Gel Electrophoresis), 2D immunoblots, or genome-specific primer platforms, but is not limited thereto.

[0036] In step (b) above, the screening may be performed by performing PCR with a primer pair represented by SEQ ID NO. 3 and SEQ ID NO. 4, or by analyzing gene copy number variations with a primer pair represented by SEQ ID NO. 3 and SEQ ID NO. 5.

[0037] In one embodiment of the present invention, the mutant wheat produced by the above manufacturing method was deposited at the National Institute of Agricultural Sciences Agricultural Genetic Resources Center (KACC) on July 15, 2024, and the 33-mer alpha-gliadin deficient line with α-D4-1 and α-D4-2 genes was assigned accession number KACC 88009BP.

[0038] As another embodiment for achieving the above objective, the present invention provides mutant wheat produced by the above manufacturing method.

[0039] In the present invention, the mutant wheat may be deficient in 33-mer alpha gliadin, and the deficiency includes cases where 33-mer alpha gliadin is not produced at all or the production amount is reduced, as well as cases where incomplete or inactive proteins are produced.

[0040] The above mutant wheat may have reduced toxicity to celiac disease.

[0041] In the present invention, the mutant wheat may be used in the manufacture of wheat processed foods, and the wheat processed foods may be one or more selected from the group consisting of wheat flour, bread, noodles, cookies, and confectionery, but are not limited thereto.

[0042] Specifically, the flour may be manufactured in the form of strong flour, weak flour, medium flour, semolina, gluten flour, whole wheat flour, and whole wheat flour, etc., the bread may be manufactured in the form of sliced ​​bread, baguette, croissant, and bagel, etc., the noodles may be manufactured in the form of ramen, spaghetti, udon, and noodles, etc., and the snacks may be manufactured in the form of crackers, cakes, donuts, and muffins, etc., but are not limited thereto.

[0043] As another embodiment for achieving the above objective, the present invention

[0044] (a) a step of irradiating the wheat with radiation; and

[0045] (b) a step of selecting wheat having one or more deletions selected from a group consisting of α-D4-1 and α-D4-2 genes;

[0046] A method for manufacturing a wheat breeding parent including

[0047] The above 'wheat', 'radiation', 'α-D4-1 gene', 'α-D4-2 gene', 'deletion', and 'selection' are as previously described.

[0048] The term "wheat breeding parent" in this invention refers to a parent line used in the crossbreeding process to develop new varieties, and is a wheat line used to transmit plant genetic characteristics to offspring for the research and mass production of varieties possessing specific traits.

[0049] As another embodiment for achieving the above objective, the present invention provides a wheat breeding parent produced by the above manufacturing method.

[0050] In the present invention, the breeding parent may be used for breeding wheat varieties deficient in 33-mer alpha gliadin, and the breeding parent may be used for breeding wheat varieties with reduced toxicity to celiac disease.

[0051]

[0052] The method for producing wheat with a 33-mer alpha-gliadin deficiency according to the present invention can produce a mutant wheat or wheat breeding parent that is a Non-GMO based on radiation breeding and possesses agricultural traits similar to wild-type wheat varieties, and thereby has the effect of producing wheat with reduced toxicity to celiac disease to be used in the manufacture of wheat processed foods, or producing a parent for breeding wheat varieties with reduced toxicity to celiac disease.

[0053]

[0054] Figure 1 shows the number of celiac disease epitopes per gene in the gluten genome of Butte 86.

[0055] Figure 2 is a schematic diagram showing the process of developing and analyzing mutant wheat.

[0056] Figure 3 shows α-D4-1 gene and α-D4-2 gene-specific PCR primers designed using gluten genome information of Butte 86.

[0057] Figure 4 shows the results of confirming whether the α-D4-1 gene and α-D4-2 gene are expressed by performing PCR on α-D4-1 gene and α-D4-2 gene deletion lines.

[0058] Figure 5 shows primers designed to investigate gene copy number variation (CNV) in α-D4-1 and α-D4-2 gene deletion lines and the results of investigating gene copy number variation (CNV).

[0059] Figure 6 shows the results of RP-UPLC chromatogram analysis of Chinese Spring (CS), CS 6D null line (N6DT6B), Butte 86, and α-D4-1 and α-D4-2 gene null selected lines.

[0060] Figure 7 shows the results of performing two-dimensional electrophoresis (2-DE) on selected defective lines.

[0061] Figure 8 is an enlarged view of the results of Figure 7, specifically showing the two-dimensional electrophoresis spots of the selected defective lines.

[0062] Figure 9 shows the results of NuPAGE using 33-mer alpha-gliadin, specifically antibody G12.

[0063] Figure 10 shows the 2D immunoblot results verifying the reaction of antibody G12 with 33-mer alpha-gliadin using Chinese Spring (CS) and the CS 6D chromosomal deletion line (N6DT6B).

[0064] Figure 11 shows the 2D immunoblot results of wild-type Butte86 and a selected deletion line (#77).

[0065] Figure 12 shows the 2D immunoblot results of wild-type Butte86 and a selected deletion line (#1728).

[0066] Figure 13 shows a gene map (A) of genes encoded in the Gli-D2 locus of Chinese Spring (CS), PCR results (B) showing the expression of alpha-gliadin genes encoded in the Gli-D2 locus of selected lines (#77, #1728 and #384), and PCR results (C) showing the expression of glutamate receptor-like genes encoded in the Gli-D2 locus of selected lines (#77, #1728 and #384).

[0067] Figure 14 shows wheat obtained from the generation before the M5 generation of selected α-D4-1 and α-D4-2 gene deletion lines together with wild-type Butte 86.

[0068]

[0069] The present invention will be explained in more detail below through the following examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0070]

[0071] Example 1. Identification of 33-mer alpha-gliadin-related α-D4-1 and α-D4-2 genes and selection of deletion lines

[0072] 1.1. Confirmation of α-D4-1 and α-D4-2 gene sequences and selection of deletion lines

[0073] Using the gluten genome information of the wheat variety Butte 86, the sequence information of the 33-mer alpha-gliadin full-length genes α-D4-1 and α-D4-2, located in the 6D chromosome Gli-D2 locus among the alpha-gliadin genes, was confirmed (Table 1), and eight celiac disease epitopes were observed in the amino acid sequences of these genes (Figure 1). Through this, it was confirmed that genes α-D4-1 and α-D4-2 encode the 33-mer alpha-gliadin that is most toxic to celiac disease.

[0074]

[0075]

[0076] The approximate process of developing and analyzing wheat with α-D4-1 and α-D4-2 defects by irradiating with a proton beam is shown in Figure 2. To breed a Butte 86 radiation mutant population, the Proton Science Research Group at the Korea Atomic Energy Research Institute irradiated 5,000 seeds with a proton beam of 100 MeV and sowed them in a vinyl greenhouse at the Department of Agricultural Life Resources, National Institute of Agricultural Sciences to secure a population of 2,800 M2 mutants. PCR primers specific to the α-D4-1 and α-D4-2 genes were designed using the gluten genome information of Butte 86 (Table 2 and Fig. 3). Genomic DNA was extracted from 2800 M2 plants, and PCR was performed twice. Three α-D4-1 and α-D4-2 gene deletion lines (#77, #384, and #1728) were selected in which the α-D4-1 and α-D4-2 genes were not expressed when compared to Butte 86, Chinese Spring (CS), N6AT6B, and N6BT6A, in which the α-D4-1 and α-D4-2 genes were normally expressed, and N6DT6B, a negative control in which the α-D4-1 and α-D4-2 genes were deleted (Fig. 4).

[0077] Among the selected wheat lines, seeds of lines #77 and #1728 were mixed and deposited at the National Institute of Agricultural Sciences Agricultural Genetic Resources Center (KACC) on July 15, 2024, and accession number KACC 88009BP was assigned to the 33-mer alpha-gliadin deficient line with α-D4-1 and α-D4-2 genes.

[0078]

[0079] Gene primer sequences (5' → 3') Sequence numbers α-D4-1 and α-D4-2 FTAGCAACCACCGCCACAATT3RGCAAAACTTGTGAGCTTCCATACGC4

[0080] 1.2. Confirmation of α-D4-1 and α-D4-2 gene deletions in selected lines through verification of gene copy number variations

[0081] To investigate gene copy number variation (CNV) of the 33-mer alpha-gliadin gene present in α-D4-1 and α-D4-2 in the genomes of the α-D4-1 and α-D4-2 gene deletion lines selected in Example 1.1, primers for qPCR were designed as shown in Table 3 below. As a result of performing qPCR on the α-D4-1 and α-D4-2 deletion lines using these primers, it was confirmed once again that the α-D4-1 and α-D4-2 genes were deleted in the selected deletion lines, as they were close to 0, similar to the negative control N6DT6B which has a deletion in the 6D chromosome containing the 33-mer alpha-gliadin gene, unlike the positive controls Butte86, Chinese Spring (CS), and N6AT6D which have a deletion in the 6D chromosome containing the 33-mer alpha-gliadin gene (Fig. 5).

[0082] Gene primer sequence (5' → 3') 33 mer-alphagliadinFTAGCAACCACCGCCACAATT3RTTGCGATTGTGGATATGGTTG5 in sequence numbers α-D4-1 and α-D4-2

[0083]

[0084] Example 2. Confirmation of 33-mer alpha-gliadin-associated Gli-D2 locus deletion in selected lines

[0085] 2.1. RP-UPLC Analysis

[0086] Using Chinese Spring (CS) and the CS 6D chromosome null line (N6DT6B), the pattern of the gliadin fraction was analyzed by RP-UPLC chromatogram, and the alpha-gliadin pattern derived from the 6D chromosome was predicted.

[0087] Based on the results, the results of Butte 86 and the control group were analyzed to predict the alpha-gliadin fraction derived from chromosome 6D in the Butte 86 variety, and when Butte 86 was compared with the α-D4-1 and α-D4-2 deletion selected lines #77-2, #77-10, #1728-11, and #1728-26, it was confirmed that the peak indicated by the arrow disappeared (Fig. 6). Therefore, it was confirmed once that the selected deletion lines had a deletion in the Gli-D2 locus.

[0088]

[0089] 2.2. Two-dimensional Electrophoresis and Proteomic Mapping Confirmation

[0090] Two-dimensional electrophoresis (2DE) was performed to identify Gli-D2 locus deletions in the selected deletion lines. When compared with the Butte86 proteomic map (2D-MS / MS proteomic map, Altenbach et al. 2011, 2020) constructed by the collaborating ARS group in the United States using the same two-dimensional electrophoresis method, it was confirmed that spots (Nos. 2 and 17) expected to be 33-mer alpha-gliadins were deleted in the selected α-D4-1 and α-D4-2 gene deletion lines (Figs. 7 and 8). Therefore, it was confirmed once again that the selected deletion lines have Gli-D2 locus deletions.

[0091]

[0092] 2.3. Confirmation of α-D4-1 and α-D4-2 gene deletions using specific antibodies

[0093] NuPAGE and 2D immunoblots were performed using 33-mer alpha-gliadin, specifically antibody G12, to identify Gli-D2 locus deletions in selected deletion lines.

[0094] In the box indicated by the NuPAGE results, it was confirmed that G12 immune responses were observed in Butte86 and CS, but not in the CS 6D chromosomal deletion line (null line) (N6DT6B), #77, and #1728 deletion lines (Fig. 9).

[0095] In addition, to confirm Gli-D2 locus deletion via 2D immunoblotting with antibody G12, the reaction of 33-mer alpha-gliadin was verified using 2D immunoblotting with antibody G12, utilizing the reference cultivar Chinese Spring (CS) and the CS 6D chromosome null line (N6DT6B) (Fig. 10). The 2D immunoblotting results confirmed that the Gli-D2 locus was deleted by confirming that, unlike the wild-type Butte86, no reaction occurred between the G12 antibody and 33-mer alpha-gliadin in the selected 33-mer alpha-gliadin null lines (#77 and #1728) (Figs. 11 and 12).

[0096]

[0097] 2.4. Confirmation of Gli-D2 locus deletion using a genome-specific primer platform

[0098] To determine whether there was a deletion in the Gli-D2 locus of the wheat 6D chromosome encoding the 33-mer alpha-gliadin gene, PCR was performed using the genome-specific primers platform (http: / probes.pw.usda.gov / GSP) with specific primers designed for all genes encoded in this Gli-D2 locus. As a result, it was confirmed that all genes encoded in the Gli-D2 locus were missing in lines (#77, #1728, and #384) selected based on the genome map of the reference cultivar Chinese Spring (CS), and it was finally confirmed that the 33-mer alpha-gliadin was deleted due to a chromosomal segmental deletion in the Gli-D2 locus of the wheat 6D chromosome (Fig. 13).

[0099]

[0100] Example 3. Comparison of agricultural traits between selected lines and wild type

[0101] Selected α-D4-1 and α-D4-2 gene-deficient lines were subjected to generational succession (M5 generation) in a vinyl greenhouse at the Department of Agricultural Life Resources, National Institute of Agricultural Sciences, and important agricultural traits such as stem length, ear length, tillering number, and 100-grain weight were measured, and the results were similar to the wild type Butte 86 (Fig. 14).

[0102] Therefore, it was confirmed that it is possible to obtain wheat that has the same agricultural traits as the existing wild type Butte 86, but has reduced toxicity to celiac disease due to the deletion of the α-D4-1 and α-D4-2 genes.

[0103]

[0104] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

[0105]

Claims

1. (a) A step of irradiating the wheat with radiation; and (b) a step of selecting wheat having one or more deletions selected from a group consisting of α-D4-1 and α-D4-2 genes; A method for producing mutant wheat comprising 2. In Paragraph 1, A method of manufacturing in which, in step (a) above, the wheat is of the Butte 86 variety.

3. In Paragraph 1, A manufacturing method in which, in step (a) above, the radiation is a proton beam.

4. In Paragraph 3, A manufacturing method in which the proton beam irradiates 33 MeV to 100 MeV.

5. In Paragraph 1, A method of manufacturing in which, in step (b) above, the α-D4-1 gene has the nucleotide sequence of SEQ ID NO.

1.

6. In Paragraph 1, A method of manufacturing in which, in step (b) above, the α-D4-2 gene has the nucleotide sequence of SEQ ID NO.

2.

7. In Paragraph 1, A manufacturing method in which, in step (b) above, the defect is caused by a defect in the Gli-D2 locus.

8. In Paragraph 1, A manufacturing method in which, in step (b) above, the screening is performed by performing PCR with a primer pair represented by SEQ ID NO. 3 and SEQ ID NO.

4.

9. In Paragraph 1, A manufacturing method in which, in step (b) above, the screening is to analyze gene copy number variations using a primer pair represented by SEQ ID NO. 3 and SEQ ID NO.

5.

10. Mutant wheat produced by the manufacturing method of any one of paragraphs 1 to 9.

11. In Paragraph 10, The above mutant wheat is a mutant wheat that is deficient in 33-mer alpha gliadin.

12. In Paragraph 10, The above mutant wheat is a mutant wheat with reduced toxicity to celiac disease.

13. In Paragraph 10, The above mutant wheat is a mutant wheat used in the manufacture of wheat processed foods.

14. In Paragraph 13, The above-mentioned wheat processed food is one or more mutant wheat selected from the group consisting of wheat flour, bread, noodles, cookies, and confectionery. 15.(a) Step of irradiating the wheat with radiation; and (b) a step of selecting wheat having one or more deletions selected from a group consisting of α-D4-1 and α-D4-2 genes; A method for producing a wheat breeding parent including 16. In Paragraph 15, A method of manufacturing in which, in step (a) above, the wheat is of the Butte 86 variety.

17. In Paragraph 15, A manufacturing method in which, in step (a) above, the radiation is a proton beam.

18. In Paragraph 17, A manufacturing method in which the proton beam irradiates 33 MeV to 100 MeV.

19. In Paragraph 15, A method of manufacturing in which, in step (b) above, the α-D4-1 gene has the nucleotide sequence of SEQ ID NO.

1.

20. In Paragraph 15, A method of manufacturing in which, in step (b) above, the α-D4-2 gene has the nucleotide sequence of SEQ ID NO.

2.

21. In Paragraph 15, A manufacturing method in which, in step (b) above, the defect is caused by a defect in the Gli-D2 locus.

22. In Paragraph 15, A manufacturing method in which, in step (b) above, the screening is performed by performing PCR with a primer pair represented by SEQ ID NO. 3 and SEQ ID NO.

4.

23. In Paragraph 15, A manufacturing method in which, in step (b) above, the screening is to analyze gene copy number variations using a primer pair represented by SEQ ID NO. 3 and SEQ ID NO.

5.

24. A wheat breeding parent produced by the method of any one of paragraphs 15 to 23.

25. In Paragraph 24, The above breeding parent is a wheat breeding parent used for breeding wheat varieties deficient in 33-mer alpha gliadin.

26. In Paragraph 24, The above breeding parent is a wheat breeding parent used for breeding wheat varieties with reduced toxicity to celiac disease.

Images