Medium composition comprising il-6-based cytokine for improving hair follicle-forming ability of human dermal papilla cells, culture method, and use thereof
A culture medium with IL-6-series cytokines and growth factors enhances the proliferation and follicle formation ability of human dermal papilla cells, addressing the challenge of maintaining follicle-forming capacity in vitro and enabling hair follicle regeneration.
Patent Information
- Application Number
- PCT/KR2025/022738
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-24
- Filing Date
- 2025-12-24
- Publication Date
- 2026-07-02
AI Technical Summary
Human dermal papilla cells lose their follicle-forming ability during in vitro culture, making it difficult to induce new hair follicles, and existing treatments like hair transplantation are limited for patients lacking sufficient donor follicles.
A culture medium composition containing IL-6-series cytokines and growth factors, along with specific culture methods, is developed to enhance the proliferation and follicle formation ability of human dermal papilla cells, enabling their use in inducing hair follicle regeneration.
The culture medium and method significantly improve the proliferation and follicle formation ability of human dermal papilla cells, allowing for effective hair follicle regeneration and providing a potential treatment for hair loss.
Smart Images

Figure KR2025022738_02072026_PF_FP_ABST
Abstract
Description
A culture medium composition containing IL-6-series cytokines for enhancing the follicle-forming ability of human dermal papilla cells, a culture method, and uses utilizing the same
[0001] The present invention relates to a culture medium composition and a culture method that exhibits the characteristics of mass culture of human hair follicle dermal papilla cells (hDPC) and improvement of hair follicle formation performance, and to the use of human dermal papilla cells cultured through the above culture to induce hair follicle regeneration.
[0002] Hair loss, or alopecia, is a common problem for both men and women, regardless of age. Humans have approximately 100,000 to 150,000 hairs, each with a distinct growth cycle. The hair growth cycle is broadly composed of three stages: the anagen stage, when growth is most active; the catagen stage, when degeneration begins; and the telogen stage, when growth stops or the hair enters a resting phase. Hair loss generally refers to a condition where the proportion of hair in the anagen stage decreases while the proportion of hair in the catagen or telogen stages becomes abnormally high, resulting in a significant increase in the number of hairs shed.
[0003] Various causes of hair loss include the decline in function and inhibition of proliferation of hair papilla cells and germinal matrix cells that regulate hair follicle formation and growth cycles, excessive secretion and action of male hormones, genetic factors, aging, and stress; these causes are known to induce hair loss by acting individually or in combination.
[0004] A characteristic of hair exhibiting hair loss is the miniaturization of the hair follicle, which contains dermal papilla cells that play a crucial role in hair production. As hair loss progresses due to various factors, the growth phase shortens, and the transition to the regression and resting phases is accelerated. Subsequently, the volume of the dermal papilla decreases, causing the follicle to become increasingly smaller and the hair thickness to decrease. Therefore, in treating hair loss, it is important to rapidly return follicles from the resting phase to the growth phase or to extend the shortened growth phase. Accordingly, from a therapeutic perspective, it is necessary to analyze the causes of hair loss and adopt a personalized treatment approach. In cases of hair loss caused by dihydrotestosterone, where genetic factors are the main cause, oral or topical medications such as 5α-reductase inhibitors like finasteride and dutasteride or minoxidil are used for treatment, and hair transplantation using the patient's own hair and platelet-rich plasma (PRP) treatment are also being used.
[0005] Hair transplantation, which involves harvesting the patient's own healthy, growing hair follicles and transplanting them to the affected area, is used as a method for permanent hair loss treatment. However, this method has the disadvantage of being limited for patients who do not have an sufficient number of transplantable follicles. Therefore, a technique utilizing cultured dermal papilla cells possessing follicularity to induce new hair follicles has long been proposed as a treatment method. However, human dermal papilla cells exhibit limitations; their follicularity is rapidly lost when cultured in vitro, and even if mass culture is successful, maintaining this capacity is difficult, making them unsuitable for inducing new hair follicles. Since effective new hair follicles require the maintenance of follicularity in mass-cultured human dermal papilla cells, numerous studies are being conducted to maintain and enhance this capacity during in vitro culture. Fibroblast growth factor 2 (FGF2) and epidermal growth factor (EGF), known to be involved in the regulation of hair follicle growth and cycles, have been reported to also be involved in the proliferation and differentiation of human dermal papilla cells cultured in vitro (PeusD et al., Dermatol Clin. 1996;14(4):559-72). By reporting that leukemia inhibitory factor (LIF) is expressed in human skin and adnexal cells, it has been reported that the leukemia inhibitory factor may play various roles related to hair follicle formation (JC Szepietowski et al., Acta Dermatovenerol Alp Pannonica Adriat. 2004 Dec;13(4):125-9.). In addition, it has been reported that the expression of leukemia-inhibitory factor differs according to the hair follicle cycle in mouse dermal papilla cells, and the leukemia-inhibitory factor receptor (LIFR) is expressed in the dermal papilla of human hair follicles (Mei Yu et al., Exp Dermatol.(2008 Jan;17(1):12-9), research on the role of leukemia suppressors in the proliferation and differentiation of dermal papilla cells, as well as in follicular development and the hair cycle, is currently necessary. It has been confirmed that human dermal papilla cells generate human-mouse hybrid hair follicles by combining with mouse neonatal epithelial cells, generally only in cases where dermal papilla cells retain follicular developmental capacity during the early stages of in vitro culture (Gnedeva et al., PLoS One 10, e0116892, 2015). However, there have been no successful cases to date in recovering the follicular developmental capacity of dermal papilla cells that have lost it through multiple in vitro passages, or inducing follicular regeneration using this recovery. Therefore, it is necessary to discover factors capable of mass-producing human dermal papilla cells capable of inducing follicular regeneration, and to develop culture media compositions and culture methods utilizing these factors.
[0006] With the aim of overcoming the aforementioned problems, the inventors discovered factors necessary to significantly improve the proliferation and follicle formation performance of human dermal papilla cells and developed a specific culture medium composition utilizing these factors. They established a culture method capable of improving proliferation and follicle formation performance by utilizing this in vitro culture of human dermal papilla cells, and completed the present invention by developing a technology to induce new hair follicle formation using human dermal papilla cells cultured by the above method.
[0007] Accordingly, the present invention aims to identify a factor important for the proliferation and hair follicle formation ability of human hair papilla cells and to provide a culture medium composition for improving hair follicle formation ability utilizing the same.
[0008] In addition, the present invention aims to provide a culture method for the proliferation of human hair papilla cells.
[0009] In addition, the present invention aims to provide a method for culturing human hair papilla cells to improve hair follicle formation performance and human hair papilla cells cultured by said method.
[0010] In addition, the present invention has another objective of providing a composition for inducing hair follicle regeneration comprising the above-mentioned hair papilla cells as an active ingredient, a method for inducing hair follicle regeneration by delivering the composition to an individual, and a use of the composition for hair follicle regeneration.
[0011] In addition, another objective of the present invention is to provide a pharmaceutical composition for preventing or treating hair loss, comprising the human hair papilla cells as an active ingredient.
[0012] In addition, the present invention has another objective of providing a method for producing a human hair follicle-like structure by co-culturing the above-mentioned hair papilla cells with human outer root sheath cells, and a model for screening candidate substances for hair loss treatment using the same.
[0013] Furthermore, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below.
[0014] The present invention discovers a factor important for the proliferation and hair follicle formation ability of human hair papilla cells and provides a culture medium composition for improving hair follicle formation ability utilizing the same.
[0015] The present invention provides a method for culturing human hair papilla cells to improve hair follicle formation performance and human hair papilla cells cultured by said method.
[0016] The present invention provides a composition for inducing hair follicle regeneration comprising the above-mentioned hair papilla cells as an active ingredient, a method for inducing hair follicle regeneration by delivering the composition to an individual, and a use of the composition for hair follicle regeneration.
[0017] The inventors have developed a method for culturing human dermal papilla cells into human dermal papilla cells that possess hair follicle-forming ability even in ex vivo serial culture, and a composition of a dermal papilla cell-specific culture medium for said cultivation. Since the human dermal papilla cells obtained by said cultivation method were used to effectively induce hair follicle regeneration in combination with mouse epidermal cells, an ex vivo model of the dermal papilla cell culture method according to the present invention can be created and utilized as a research model for the process of enhancing the hair follicle-forming ability of dermal papilla cells and hair follicle regeneration. Furthermore, it is expected that human dermal papilla cells and hair germs generated by applying the culture technology for the proliferation and enhancement of hair follicle-forming ability of dermal papilla cells according to the present invention can be usefully utilized as a cell therapy agent for the treatment of patients suffering from hair loss.
[0018] Figures 1a and 1b show the results of comparing photographs (Figure 1a) and proliferation rates (Figure 1b) of human hair follicle papilla cells with and without the use of Matrigel coating during subculture of human hair follicle papilla cells. It was confirmed that the proliferation of human papilla cells significantly increased when using Matrigel-coated plates compared to when cultured on plates not coated with Matrigel. Figure 1c compares the expression of signature markers ALPL, SOX2, VCAN, and LIN28 of human papilla cells cultured using Matrigel plates with that of papilla cells cultured on uncoated plates.
[0019] Figure 2a shows the results of comparing the time it takes for the number of cells to double under different conditions after treating human dermal papilla cells with epidermal growth factor (EGF), fibroblast growth factor 2 (FGF2), LIF, and interleukin-6 (IL-6), respectively, on Matrigel-coated plates. Figure 2b shows the results confirming that when human dermal papilla cells are cultured in EFL medium with different concentrations of LIF on Matrigel-coated plates, the cell proliferation rate significantly increases compared to when they are cultured in the control medium. Since LIF is an interleukin-6 (IL-6) family cytokine, it was confirmed that cell proliferation significantly increases when IL-6 is treated, similar to LIF. Figure 2c shows the results confirming the increase in the cell proliferation rate according to the number of LIF treatments. Figure 2d shows the results of confirming gene expression related to cell proliferation ability after culturing in EFL medium, revealing a significant increase in the expression of the genes C-MYC and BCL-XL compared to the control group. Figure 2e confirms that when cultured in EFL medium, the expression of Ki-67, a marker related to cell proliferation, increased compared to the control group, while the expression of β-GAL stain, a marker for cellular senescence, decreased. Figures 2f and 2g show the results of partially switching cellular energy metabolism from oxidative phosphorylation (OXPHOS) to glycolysis when human dermal papilla cells are cultured in EFL medium and EFLSC medium. Figure 2h confirms that when human dermal papilla cells are cultured in EFL medium, the expression of genes related to cellular energy metabolism increases, specifically the expression of genes related to glycolysis, and analyzes the differences in gene expression related to anti-aging.Figure 2i shows the results of confirming that when human dermal papilla cells are cultured in EFL medium and then cultured into three-dimensional spheroids, the spherical area of human dermal papilla cells cultured in EFL medium is larger than that of the control group, and Figure 2j shows the results of confirming and analyzing the activity of alkaline phosphatase, a marker of hair follicle formation ability, on spheroids cultured in three-dimensional EFL medium.
[0020] Figure 3a shows the results of analyzing the time it takes for the number of cells to double after treating human dermal papilla cells with various growth factors, and the cell proliferation rates when human dermal papilla cells corresponding to each passage were cultured in EFLSC and EFSC media, respectively. Figure 3b shows the results confirming that when cultured in EFLSC media, the expression of follicle formation ability markers significantly increased compared to the control group, regardless of the number of passages. Figure 3c shows the results of confirming the expression of follicle formation ability-related genes ALPL, SOX2, LEF1, NANOG, GLI1, and LIN28 after initial mass culture in EFL medium followed by culture in EFLSC and EFSC media, which are follicle formation ability activation media; it was confirmed that when cultured in follicle formation ability activation media, the expression of follicle formation ability-related genes significantly increased compared to the control group.
[0021] Figure 4a is a schematic diagram of the optimal culture method for mass production and maintenance of hair follicle formation ability of human dermal papilla cells, which involves culturing in EFL medium for 5 to 10 days followed by culturing in EFLSC and EFSC media for 5 days. Figure 4b shows the results of analyzing the expression of hair follicle formation ability-related genes ALPL, LEF1, and BLIMP-1 after culturing human dermal papilla cells in EFL medium for 5 to 10 days followed by culturing in EFLSC medium for 5 days. Figures 4c and 4d show the results of analyzing the expression of hair follicle formation ability-related protein markers SOX2 and LIN28 after culturing human dermal papilla cells in CONT medium and EFL medium for 5 to 10 days and in EFLSC medium for 5 days. Figure 4e shows the shape of a hair germ prepared by co-culturing human dermal papilla cells and human outer root sheath cells cultured in EFLSC medium in the laboratory, and Figure 4f shows the results of confirming that upon culturing the hair germ, the bulb portion formed a round shape similar to a hair follicle, and the surrounding layers grew with polarity to form a hair follicle-like structure. In the control group, the hair follicle-like structure disappeared after 3 days, whereas in the case where a hair germ was prepared using human dermal papilla cells cultured in EFLSC medium, the hair follicle-like structure was maintained for 15 days. Figures 4g and 4h show the results of cellular energy metabolism partially switching from oxidative phosphorylation (OXPHOS) to glycolysis when human dermal papilla cells are cultured in EFL medium and EFLSC medium.
[0022] Figures 5a-c show the results of alkaline phosphatase staining after treating human dermal papilla cells with follicle-generating factors expected to improve follicle formation performance, ranging from single combinations to total combinations. Figure 5d shows the results of alkaline phosphatase staining after treating combinations of expected substances in 3D spherical culture, a culture method known to partially restore follicle formation performance, and Figure 5e shows the results of analyzing VERSICAN using immunofluorescence therapy. Figure 5f shows the results of identifying SOX2 and LIN28 after selecting 5 factors and 7 factors based on the results from Figures 5a to 5e, treating them with EFSC medium or EFLSC medium.
[0023] Figure 6a shows the results of confirming the expression of spheroids, which are three-dimensional spheroids, by staining for alkaline phosphatase, a signature marker of hair follicle formation ability of hair papilla cells. These spheroids were cultured in EFL medium for 5-10 days as shown in the schematic diagram, then cultured in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY, which are activating media for hair follicle formation ability, for 5 days. Figure 6b shows the results of confirming the expression of genes related to hair follicle formation ability, ALPL, SOX2, LEF1, NANOG, GLI1, and LIN28, after initial mass culture in EFL medium followed by culture in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY. It was confirmed that the expression of genes related to hair follicle formation ability significantly increased when cultured in all activating media compared to the control group. Figure 6c is the result of analyzing the expression of genes related to hair follicle formation ability in human hair papilla cells cultured as shown in the schematic diagram of Figure 6a.
[0024] Figure 7a shows the results of a chamber assay in which human dermal papilla cells were cultured in EFLSC medium, EFSC medium, EFLSCPVP2NY medium, and EFSCPVP2NY medium, and then transplanted together with mouse neoepidermal cells after making a wound on the dorsal skin of an immunodeficient mouse, and the results of a study in which human dermal papilla cells were first cultured in EFL medium, and then transplanted together with mouse neoepidermal cells after culturing them in EFLSC medium, EFSC medium, EFLSCPVP2NY medium, and EFSCPVP2NY medium, to confirm the degree of induction of human-mouse hybrid follicle neogeneration after 4-6 weeks. Figure 7b shows an example in which human dermal papilla cells cultured by the above method were prepared into hair bud and follicle-like structures and utilized as a screening model for alopecia disease candidate substances.
[0025] FIG. 8 is a schematic diagram of a culture medium composition, a culture method, and a culture step that exhibit the characteristics of mass culture of human hair papilla cells and improvement of hair follicle formation performance according to the present invention.
[0026] The present invention relates to a culture medium composition for improving the hair follicle formation performance of human dermal papilla cells, a culture method, and the use of inducing hair follicle regeneration using human dermal papilla cells cultured through the culture method.
[0027] The term 'human dermal papilla cell' as used in this invention refers to a specialized mesenchymal cell within the hair bulb that plays an important role in the development, growth, and growth cycle of the hair follicle through cell proliferation, division, and apoptosis.
[0028] Accordingly, the present invention,
[0029] The present invention provides a culture medium composition for human dermal papilla cells (hDPC) characterized by including IL-6-series cytokines and growth factors in the basic medium.
[0030] The basic medium used in the present invention may be DMEM (Dulbecco's Modified Eagle Medium), DMEM / F12 (Dulbecco's Modified Eagle Medium / Ham's F-12), KSFM (Keratinocyte Serum-Free Medium), or a mixture thereof, and the basic medium may include L-glutamine, antibiotics, and fetal bovine serum (FBS).
[0031] The IL-6-series cytokine used in the culture medium composition of the present invention may be one or more selected from the group consisting of leukemia inhibitory factor (LIF), IL-6, IL-11, IL-27, CNTF (ciliary neurotrophic factor), Oncostatin M, CLC (cardiotrophin-like cytokine), and CCT-1 (cardiotrophin 1), and preferably may be a leukemia inhibitory factor, but is not limited thereto.
[0032] The growth factor used in the culture medium composition of the present invention may be one or more of epidermal growth factor (EGF) and fibroblast growth factor-2 (FGF2), and preferably may include both EGF and FGF2, but is not limited thereto.
[0033] In a specific embodiment, the culture medium composition for human dermal papilla cells (hDPC) according to the present invention may include L-glutamine, antibiotics, fetal bovine serum (FBS), LIF, EGF, and FGF2 in a mixed medium of DMEM / F12 (Dulbecco's Modified Eagle Medium / Ham's F-12) and KSFM (Keratinocyte Serum-Free Medium), and it was confirmed that the proliferative capacity of human dermal papilla cells cultured in the medium composition is improved. Accordingly, the medium composition comprising a basic medium containing IL-6-series cytokines and growth factors may be defined as a "medium composition for human dermal papilla cell proliferation."
[0034] In addition, the culture medium composition of the present invention may further include a transforming growth factor-β (TGF-β) type 1 receptor inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor.
[0035] The transforming growth factor-β type 1 receptor inhibitor used in the culture medium composition of the present invention may be one or more from the group consisting of SB431542, A83-01, SB525334, SB505124, LY2109761, LY2157299, LY3200882, LY364947, RepSox, Vactosertib, ITD-1, DMH-1, Dorsormorphin, LDN193189, LDN212854, LDN193719, LDN214117, SD-208, GW788388, R-268712, J-1149, M4K2281, ALK5-IN-9, ALK5-IN-80, TGFβ1-IN-2, and TGFβ1-IN-3, and preferably It may be SB431542, but is not limited to this.
[0036] The GSK-3 inhibitor used in the culture medium composition of the present invention is CHIR99021, 6-bromoindirubin-3'-oxime (6-bromoindirubin-3'-oxime:BIO), SB216763, Kenpaullone, Bisindolyl-maleimide I, Tagtociclib hydrate, TWS119, Ceftriaxone sodium salt, GSK-3b Inhibitor XI, LY2090314, AR-A014418, Cromolyn sodium, IM-12, 1-Aza-kenpaullone, 9-ING-41, SAR502250, A 1070722, GNF4877, Manzamine A hydrochloride, BRD0209, CHIR98024, ARN25068, BIP-135, Indirubin-3′-oxime, It may be one or more selected from the group consisting of 5-Iodo-indirubin-3'-monoxime, ABC1183, (R)-(+)-O-Demethyl buchenavianine, (R)-BRD3731, NSC693868, TCS2002, Ceftriaxone sodium hydrate, COB-187, 3F8, Aloisine A, BMP agonist 1, Indirubin-5-sulfonate, ZDWX-25, GS87, BRD1652, Cazpaullone, and TD114-2, preferably CHIR99021, but is not limited thereto.
[0037] In addition to the transforming growth factor-β (TGF-β) type 1 receptor inhibitor and the glycogen synthase kinase-3 (GSK-3) inhibitor, the culture medium composition of the present invention may further include one or more selected from the group consisting of PDGF-AA (Platelet-derived growth factor-AA), valproic acid, purmorphamine, nicotinamide, and Y27632. In a specific embodiment, it was confirmed that when a human dermal papilla cell culture medium composition containing the above components was used, not only the proliferation of dermal papilla cells but also the hair follicle formation ability was maintained and enhanced. Here, a culture medium composition containing a transforming growth factor-β (TGF-β) type 1 receptor inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor and additional components can be defined as a "culture medium composition for maintaining and enhancing the follicle-forming ability of human dermal papilla cells."
[0038] In addition, the present invention provides a culture method comprising the step of culturing human dermal papilla cells in a culture medium composition for the proliferation of human dermal papilla cells defined above and / or a culture medium composition for maintaining and enhancing the hair follicle-forming ability of human dermal papilla cells.
[0039] Specifically, the present invention provides a culture method comprising the step of first culturing human dermal papilla cells in a culture medium composition for human dermal papilla cell proliferation, and then secondarily culturing human dermal papilla cells in a culture medium composition for maintaining and enhancing the hair follicle formation performance of human dermal papilla cells.
[0040] Descriptions of the compositions of each culture medium for human dermal papilla cells are omitted to avoid duplication.
[0041] In a specific embodiment of the present invention, human dermal papilla cells can be cultured on a culture plate coated with Matrigel, and specifically, human dermal papilla cells can be cultured on a culture plate coated with 1% to 2% Matrigel containing the medium composition of the present invention. It was confirmed that the proliferation of human dermal papilla cells is most effective within the above concentration range, and that cell proliferation is significantly increased compared to when cultured on a plate not coated with Matrigel.
[0042] In each culture medium composition used in the method of the present invention, EGF may be included at a concentration of 5-20 ng / ml, FGF2 at 5-20 ng / ml, LIF at 10-20 ng / ml, SB431542 at 2-5 μM, CHIR99021 at 3-10 μM, PDGF-AA(P) at 10-20 μM, Valproic acid(V) at 0.1 mM-1 mM, Purmorphamine(P2) at 0.1-1 μM, Nicotinamide(N) at 100-200 mM, and / or Y27632(Y) at 5-20 μM. In the above concentration ranges, the follicle-forming ability of human dermal papilla cells may be excellent.
[0043] The method for culturing human dermal papilla cells according to the present invention allows human dermal papilla cells to be cultured for 5 to 10 days, preferably 10 days, in a culture medium composition for human dermal papilla cell proliferation.
[0044] The method for culturing human dermal papilla cells according to the present invention may involve culturing for 5 to 10 days in a medium composition for human dermal papilla cell proliferation, followed by culturing for 5 to 10 days in a medium composition for maintaining and enhancing the follicle-forming ability of human dermal papilla cells. In a specific embodiment, it was confirmed that cells expressing alkaline phosphatase (ALP), VCAN, SOX2, LIN28, and α-SMA (α-smooth muscle actin), which are markers of follicle-forming ability, were significantly increased compared to cases where cells were cultured in a medium composition for maintaining and enhancing the follicle-forming ability of human dermal papilla cells without prior culture in a medium composition for human dermal papilla cell proliferation.
[0045] In a specific embodiment of the present invention, to verify the follicle-forming ability of the cultured human dermal papilla cells, a chamber assay was performed in which the human dermal papilla cells and C57BL / 6 neonatal mouse epidermal cells (mEPI) were transplanted together into an immunodeficient mouse after creating a 10 mm wound. As a result, it was confirmed that human-mouse hybrid follicle regeneration was induced after 4 weeks, and the expression of human nuclear markers was confirmed in the dermal papilla of the newly formed follicles.
[0046] In addition, the present invention provides a method for producing hair follicles comprising the step of co-culturing human hair papilla cells and human outer root sheath cells cultured according to the human hair papilla culture method of the present invention.
[0047] In the method for producing hair follicles according to the present invention, the 'co-culture' may be performed in vitro. Additionally, a method for screening candidate substances for hair loss treatment using pseudo-hair follicles and hair germs produced by the co-culture is provided.
[0048] Specifically, the present invention provides a method for screening candidate substances for hair loss treatment, comprising: (a) a step of forming a hair follicle-like structure by co-culturing human hair papilla cells cultured according to the culture method of the present invention with human outer root sheath cells; (b) a step of treating the hair follicle-like structure of step (a) with a candidate substance; and (c) a step of screening candidate substances by analyzing the growth or morphological change of the hair follicle-like structure.
[0049] In addition, the present invention provides a method for inducing hair follicle regeneration, comprising the step of transplanting the human hair papilla cells having hair follicle-forming ability into a tissue other than the human body.
[0050] In addition, the present invention provides a pharmaceutical composition for treating hair loss comprising human hair papilla cells cultured in the culture medium composition of the present invention or cultured according to the culture method of the present invention as an active ingredient.
[0051] In addition, a method for treating hair loss is provided, comprising the step of administering a pharmaceutical composition containing the above-mentioned human hair papilla cells as an active ingredient to an individual.
[0052]
[0053] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the following embodiments.
[0054]
[0055] [Example]
[0056] Example 1. Experimental Preparation and Experimental Method
[0057] 1-1. Isolation and Culture of Human Dermal Papilla Cells from Human Scalp Tissue
[0058] After isolating hair follicles from human scalp tissue that were judged to be in the growth phase based on morphology, hair papilla cells were isolated from each follicle and seeded onto culture plates coated with 1-2% Matrigel. The cells were then primary cultured for one week under conditions of 5% CO2 and 37°C in a medium supplemented with Dulbecco's Modified Eagle's Medium (DMEM), 1% L-glutamine, 1% antibiotics, and 10% non-activated fetal bovine serum (FBS).
[0059]
[0060] 1-2. Subculture and Characterization of Human Dermal Papillary Cells
[0061] (1) Two-dimensional attachment culture
[0062] One week after primary culture, the cells were subcultured using 0.05% Trypsin-EDTA and seeded onto plates coated with 1% Matrigel. The culture medium was then replaced with Dulbecco's Modified Eagle's Medium (DMEM), 1% L-glutamine, 1% antibiotics, 10 ng / ml FGF2, and 10% fetal bovine serum (FBS). The expression of alkaline phosphatase (ALP), VCAN (versican), SOX2, and LIN28, markers of follicular formation ability, was confirmed in the subcultured dermal papilla cells.
[0063] (2) Three-dimensional spheroid culture
[0064] Spontaneous three-dimensional spheres were constructed using 5 x 10^3 human dermal papilla cells and cultured in a 37°C 5% CO2 incubator for 1 to 9 days while replacing 50% of the culture medium daily. The characteristics of the human dermal papilla cells were confirmed by alkaline phosphatase (ALP) staining.
[0065]
[0066] 1-3. Culture of human dermal papilla cells possessing follicle-forming ability
[0067] (1) Development of culture medium composition
[0068] To develop a culture medium composition to improve the follicular formation ability of human dermal papilla cells lost due to in vitro culture, the potential to enhance follicular formation ability of dermal papilla cells was confirmed by treating them individually and in combination with various factors known as important substances that induce entry into the growth phase of the hair follicle cycle. Staining was performed using mouse anti-human ALP, goat anti-human VCAN, goat anti-human SOX2, and rabbit anti-human LIN28 antibodies as markers of follicular formation ability of human dermal papilla cells, and their expression was subsequently analyzed using a fluorescence microscope.
[0069] (2) Development of a leukemia suppressor factor-added medium for the proliferation culture of human dermal papilla cells
[0070] In order to overcome the disadvantage of the loss of cell proliferation ability during in vitro culture of human dermal papilla cells by including a leukemia suppressor factor known to exhibit cell proliferation ability of human skin cells and skin appendages, a culture medium for human dermal papilla cell proliferation, EFL, was developed by mixing human dermal papilla cells with DMEM / F12 and KSFM in a 3:1 (volume ratio) ratio and including 1% L-glutamine, 1% antibiotic, 10% non-activated fetal bovine serum (FBS), EGF, FGF2, and LIF. It was confirmed that the proliferation rate significantly increased when human dermal papilla cells were cultured in the EFL medium.
[0071] (3) Development of a human hair papilla cell culture medium to improve hair follicle formation performance
[0072] As a result of culturing human dermal papilla cells in a medium (EFLSC medium) containing DMEM / F12 and KSFM mixed in a 3:1 (volume ratio) ratio and supplemented with L-glutamine, antibiotics, 10% non-activated fetal bovine serum (FBS), EGF, FGF2, LIF, SB431542, and CHIR99021, and in the medium excluding LIF from the above medium (EFSC medium), the proliferation rate of human dermal papilla cells cultured in EFLSC medium supplemented with LIF was higher than that of dermal papilla cells cultured in EFLSC medium without LIF, and it was confirmed that the number of positive cells regarding the expression of follicle formation ability markers significantly increased in the case of culture in EFLSC medium containing LIF. In addition, to secure a substance that can further enhance the expression of hair follicle formation markers in human hair papilla cells cultured in EFLAC medium and EFSC medium, we searched for several candidate substances known to induce the hair growth cycle, such as PDGF-AA (P), Valproic acid (V), Purmorphamine (P2), Nicotinamide (N), and Y27632 (Y), and developed EFLSCPVP2NY medium and EFSCPVP2NY medium.
[0073] (4) Establishment of a human hair papilla cell culture method to improve hair follicle formation performance
[0074] When analyzing the expression of follicle formation markers, human dermal papilla cells were cultured for 5 days in a medium (EFLSC medium) or EFSC medium containing DMEM / F12 and KSFM mixed in a 3:1 ratio and supplemented with L-glutamine, antibiotics, 10% non-activated fetal bovine serum (FBS), EGF, FGF2, LIF, SB431542, and CHIR99021 on a plate coated with 1% Matrigel, or human dermal papilla cells cultured for 5 days were subcultured and cultured for an additional 5 days. In addition, it was confirmed that the expression of markers of follicular formation ability in human dermal papilla cells significantly increased in the case of a culture method in which proliferation, glycolytic switching, and anti-aging of human dermal papilla cells were induced by first culturing in EFL medium, followed by activating follicular formation ability with EFLSC medium, EFSC medium, EFLSCPVP2NY medium, and EFSCPVP2NY medium.
[0075] (5) Three-dimensional spheroid culture of human dermal papilla cells
[0076] When 5 x 10^3 human dermal papilla cells were cultured on a low-adhesion culture plate in each medium containing a follicle-forming ability-inducing substance alone or in combination for 1 to 3 days or more, it was confirmed that the expression of follicle-forming ability-inducing markers increased depending on the medium composition.
[0077]
[0078] 1-4. Immunocytochemical staining
[0079] Human dermal papilla cells fixed with 4% paraformaldehyde were treated with a blocking solution containing 10% donkey serum for antibody staining against cell membrane proteins, and with a blocking solution containing 0.01% Triton X-100 and 10% donkey serum for antibody staining against transcription factors to increase cell membrane permeability. Afterward, the cells were cultured with a primary antibody in each blocking solution and subsequently stained with a secondary antibody. Afterward, the cell nuclei were stained with DAPI (4′,6-diamidino-2-phenyl-indole), and the expression patterns were confirmed using a fluorescence microscope.
[0080] Primary antibodyDilution ratioHostProviderALP1:1000MouseINVITROGENVERSICAN1:1000GoatR&DSOX21:500GoatR&DLIN281:1000RabbitabCAMα-Smooth muscle actin1:1000MouseabCAM
[0081] 1-5. Analysis of Intracellular Metabolic Pathway-Dependent Changes
[0082] Human dermal papilla cells were cultured in a medium (EFLSC medium) containing DMEM / F12 and KSFM mixed in a 3:1 (volume ratio) ratio and supplemented with L-glutamine, antibiotics, 10% non-activated fetal bovine serum (FBS), EGF, FGF2, LIF, SB431542, and CHIR99021, and changes in the intracellular metabolic pathways of oxidative phosphorylation (OXPHOS) and glycolysis were analyzed. To inhibit ATP synthesis via oxidative phosphorylation, oligomycin was used, and to inhibit ATP synthesis via glycolysis, 2-deoxy-D-glucose (2-DG) was used for 5 and 48 hours, respectively, after which the production of ATP and lactic acid was measured.
[0083]
[0084] 1-6. Quantitative reverse transcription polymerase chain reaction
[0085] Total RNA was isolated from cultured dermal papilla cells using TRIzol™ Reagent (invitrogen). cDNA was synthesized using the isolated RNA as a template with the Revert First strand cDNA synthesis kit (bioneer). Subsequently, quantitative reverse transcription polymerase chain reaction analysis was performed using SYBR premix Ex Taq II (invitrogen), and the primer sequences used are shown in Table 2 below.
[0086] Gene direction: Sequence(5'->3')ALPF: TGGCCCTCTCCAAGACGTACAA (Sequence No. 1)R: TGGTTCACTCTCGTGGTGGTCA (Sequence No. 2)cMYC (CDS)F: TCGGATTCTCTGCTCTCCTC (Sequence No. 3)R: CGCCTCTTGACATTCTCCTC (Sequence No. 4)LIN28F: TTCTGTATTGGGAGTGAGAGGCGG (Sequence No. 5)R: CTTCAGCGGACATGAGGCTACCAT (Sequence No. 6)LEF1F: CTTCCTTGGTGAACGAGTCTG (Sequence No. 7)R: GTGTTCTCTGGCCTTGTCGT (Sequence No. 8)NANOGF: GTATTGTTTGGGATTGGGAGGC (Sequence No. 9)R: CGATGCAGCAAATACGAGACC (Sequence No. 10)SOX2F: TTGCTGCCTCTTTAAGACTAGGA (Sequence No. 11)R: TAAGCCTGGGGCTCAAACT (Sequence No. 12)GLI1F: GATCCTAGCTCGCTGCGAAA (Sequence No. 13)R:AGAAATGGATGGTGCCCGAG (Sequence No. 14)
[0087] 1-7. Total RNA sequencing
[0088] Human dermal papilla cells were cultured in EFL, EFLSC, ELSC, EFLSCPCP2NY, and EFSCPVP2NY media, and total RNA was isolated using Trizol reagent. A transcriptome library was prepared for 1 µg of isolated RNA using the CORALL RNA-Seq V2 Library Prep Kit (LEXOGEN, Inc., Austria). Poly(A)+ RNA was isolated using AMPure XP beads (Beckman Coulter) and fragmented using the Ambion Fragmentation Reagents kit (Ambion, Austin, TX, USA). cDNA synthesis, end repair, base addition, and conjugation with Illumina indexed adapters were all performed according to Illumina's protocols. Libraries were selected with a size of 250-300 bp using BluePipin (Sage Science, MA, USA), amplified by performing PCR for 14 cycles using Phusion DNA Polymerase (New England Biolabs), and purified with AMPure XP beads. Library quality was evaluated by measuring size and concentration using an Agilent 2100 Bioanalyzer.
[0089] Libraries were constructed from total RNA using the CORALL RNA-Seq V2 Library Prep Kit (LEXOGEN, Inc., Austria). rRNA removal was performed using the RIBO COP rRNA depletion kit (LEXOGEN, Inc., Austria). The rRNA-removed RNA was used for cDNA synthesis and shearing according to the manufacturer's instructions. Indexing was performed using Illumina indexes 1-12, and the enrichment step was carried out via PCR. Subsequently, the average fragment size of the library was evaluated using the Agilent 2100 bioanalyzer (DNA High Sensitivity Kit). Quantification was performed using the library quantification kit with the Step One Real-Time PCR System (Life Technologies, Inc., USA). High-throughput sequencing was conducted using the NovaSeq 6000 (Illumina, Inc., USA) via paired-end 100 sequencing.
[0090] Subsequently, sequence analysis was performed on the bidirectional end library using Illumina HiSeq 2000 (2 × 100 nucleotide read length), and reads that passed through the purity filter of Illumina BaseCall software were used for subsequent analysis. The R package "Cuffdiff" was used for the analysis of differentially expressed genes, and hierarchical clustering analysis was performed on genes with a q value less than 0.05 to construct heat maps of a total of 3065 genes. In addition, distance matrix analysis, multidimensional scaling plots, and gene cluster analysis were performed using the R package "CummeRbund".
[0091] To generate 50 clusters out of a total of 3,471 genes, gene cluster analysis was performed on important genes with an alpha value of less than 0.01.
[0092]
[0093] 1-8. Alkaline Phosphatase Activity
[0094] Cells cultured on a plate were fixed with 4% paraformaldehyde for 20 minutes, then treated with NBT / BCIP (Roche) diluted in NTMT buffer for 120 minutes, and alkaline phosphatase activity was analyzed.
[0095]
[0096] 1-9. Verification of follicle regeneration via chamber assay
[0097] Human dermal papilla cells cultured as spherical bodies for 3 days (total 5 x 10 5 (100 spherical cells) and C57 / BL6 neonatal epidermal cells (5X10 5 The specimens were mixed with 50% Matrigel and transferred to silicone chambers implanted in wounds made on the dorsal skin of 6-week-old female immunodeficient mice. After 1 week, the chambers were removed and the implantation site was dressed, and the formation and maintenance of hair follicles were observed until 25 weeks, and operational analysis was performed.
[0098]
[0099] 1-10. Statistical Analysis
[0100] Results such as gene expression were analyzed using Student's t-test or ANOVA, and qPCR results were analyzed after correcting for GAPDH. Statistical significance was considered to be p<0.05.
[0101]
[0102] Example 2. Development of Specific Culture Conditions and Medium Composition for Activating Hair Follicle Formation Performance of Human Dermal Papillary Cells
[0103] (1) Preparation of a culture plate to improve the proliferation rate of human hair papilla cells
[0104] The inventors of the present invention, as a culture method capable of overcoming the limitations of human dermal papilla cells, which have the disadvantage of loss of follicle-forming ability and reduced proliferation rate due to subculture during in vitro culture, prepared a 1% to 2% Matrigel using DMEM / F12 from primary cultured dermal papilla cells, dispensed it onto a culture plate, and cultured it at room temperature for 2 hours to coat the plate to be cultured with human dermal papilla cells, and then cultured the human dermal papilla cells. As a result of evaluating the cell proliferation rate after culturing human dermal papilla cells for 5 days in a medium supplemented with 1% L-glutamine, 1% antibiotic, 10 ng / ml FGF2, and 10% non-activated fetal bovine serum (FBS) in DMEM high glucose, a standard human dermal papilla cell culture medium, it was confirmed that the cell proliferation rate was significantly increased when human dermal papilla cells were cultured on Matrigel-coated plates as shown in Figures 1a and 1b compared to when they were cultured on uncoated plates. Additionally, as shown in Figure 1c, it was confirmed that there were more positive cells for the signature expression markers ALP and SOX2 in human dermal papilla cells cultured on Matrigel-coated plates, while the expression of Versican showed a similar trend.
[0105] (2) Preparation of a culture medium to improve the proliferation rate of human hair papilla cells
[0106] To develop a culture medium composition to prevent a decrease in proliferation rate due to in vitro culture of human dermal papilla cells, a medium supplemented with 1% L-glutamine, 1% antibiotics, and 10% non-activated fetal bovine serum (FBS) in DMEM was used as the base medium, and candidate factors were screened as shown in Figure 2a. Among them, it was confirmed that the proliferation rate of human dermal papilla cells significantly increased even when leukemia inhibitory factor (LIF) was added alone. Leukemia inhibitory factor (LIF) is an interleukin-6 (IL-6) family cytokine, and when human dermal papilla cells were treated and cultured with 10 ng / ml IL-6, a significant increase in cell proliferation rate similar to that observed with LIF treatment was confirmed. In addition, as shown in Figure 2b, when LIF, EGF, and FGF2 were cultured together, it was confirmed that the proliferation rate of human dermal papilla cells increased significantly compared to when they were treated and cultured with only EGF and FGF2.
[0107] (3) Preparation of culture medium for the proliferation rate and anti-aging efficacy of human hair papilla cells
[0108] In order to develop a medium composition to prevent the decrease in proliferation rate and cellular senescence caused by in vitro culture of human dermal papilla cells, DMEM / F12 and KSFM were mixed in a 3:1 volume ratio, and a medium composition (EFL medium) was prepared by combining growth factors EGF and FGF2 with leukemia inhibitory factor (LIF) with a 1% L-glutamine, 1% antibiotic, and 10% non-activated fetal bovine serum (FBS) medium as the base medium and human dermal papilla cells were cultured in it. As a result, as shown in Figures 2b and 2c, the proliferation rate of human dermal papilla cells was significantly increased, and as shown in Figure 2d, the expression of genes related to cellular anti-senescence was also significantly increased. As shown in Figure 2e, in the case of human dermal papilla cells cultured in EFL medium, the number of cells positive for Ki-67, a cell proliferation-related marker, was significantly increased compared to the control group, and the number of cells positive for β-galactosidase was significantly decreased compared to the control group, thus confirming the cell proliferation and anti-aging effects of EFL medium.
[0109] (4) Preparation of culture medium for hair follicle formation activity
[0110] In order to develop a medium composition to improve the follicle-forming ability of human dermal papilla cells lost due to in vitro culture, a base medium was prepared by mixing DMEM / F12 and KSFM in a 3:1 ratio and containing 1% L-glutamine, 1% antibiotics, and 10% non-activated fetal bovine serum (FBS). Human dermal papilla cells were cultured in various combinations of medium compositions prepared with growth factors EGF and FGF2, the TGF-β type I receptor inhibitor SB431542, the GSK-3 inhibitor CHIR99021, and leukemia inhibitory factor (LIF). As a result, as shown in Fig. 3a, regardless of the number of subcultures, human dermal papilla cells in a medium composition (EFLSC medium) supplemented with 10 ng / ml EGF, 10 ng / ml FGF2, 10 ng / ml LIF, 2 μM SB431542, and 3 μM CHIR99021 The proliferation rate was significantly increased, and it was confirmed that the expression of alkaline phosphatase (ALP), versican (VCAN), SOX2, and LIN28 proteins (Fig. 3b) and genes, which are markers of follicular formation ability lost due to in vitro culture, was significantly increased compared to the control group as shown in Fig. 3c. When cultured for 5 to 10 days in EFLSC medium supplemented with LIF, it was observed that the follicular formation ability protein markers increased effectively and significantly compared to when cultured in EFSC medium without LIF, as shown in Fig. 4c. In addition, to improve the follicular formation ability of human dermal papilla cells lost due to in vitro culture, 5–10 ng / ml EGF, 2–10 ng / ml FGF2, 10–100 ng / ml LIF, 2–5 μM SB431542, and 3–10 μM CHIR99021 can be used.
[0111] (5) Culture method for maximizing the hair follicle-forming ability of human hair papilla cells
[0112] To further enhance follicle formation performance, candidate substances known as growth-phase follicle-inducing substances such as PDGF-AA(P), Valproic acid(V), Purmorphamine(P2), Nicotinamide(N), and Y27632(Y) were searched, and an optimal combination (PVP2NY) was discovered to prepare EFLSCPVP2NY and EFSCPVP2NY media by adding 10 μM PDGF-AA(P), 0.1 mM Valproic acid(V), 0.1 μM Purmorphamine(P2), 100 mM Nicotinamide(N), and 10 μM Y27632(Y) to EFLSC and EFSC media. To maximize the follicle-forming ability of human dermal papilla cells, 10–20 μM PDGF-AA(P), 0.1 mM–1 mM Valproic acid(V), 0.1–1 μM Purmorphamine(P2), 100–200 mM Nicotinamide(N), and 5–20 μM Y27632(Y) can be used.
[0113] In a culture method in which mass proliferation of human dermal papilla cells is first induced with EFL medium and then follicular formation ability is activated with EFLSC and EFSC media, as shown in Figure 4c, it was confirmed that the expression of follicular formation ability markers SOX2 and LIN28 tended to increase compared to the case where the cells were cultured with EFLSC and EFSC media, which are follicular formation ability media, without first culturing with EFL medium.
[0114] In addition, to maximize the activation of follicle formation ability, when cultured first in EFL medium and then cultured in EFLSCPVP2NY and EFSCPVP2NY media containing factors that induce hair follicles in the growth phase, it was confirmed that the expression of follicle formation ability-related genes ALPL, SOX2, LIN28, NANOG, LEF1, and GLI1 significantly increased as shown in Figure 6b.
[0115]
[0116] Example 3. Analysis of characteristics of human dermal papilla cells cultured in EFL medium
[0117] To verify the characteristics of dermal papilla cells cultured according to the method of Example 2 above, the proliferation rate and immunochemical staining were performed on human dermal papilla cells cultured in EFL medium to confirm the expression levels of cell proliferation-related genes C-MYC and BCL-XL and cell anti-aging-related genes P53 and P16. As a result, it was confirmed that human dermal papilla cells cultured in EFL medium showed an increased proliferation rate compared to the control group as shown in Fig. 2c, and Ki-67 expression increased as shown in Fig. 2e. Additionally, the expression of cell proliferation-related genes C-MYC and BCL-XL increased as shown in Fig. 2d, and the expression of P53 and P16 decreased as shown in Fig. 2h. In addition, as a result of analyzing the dependence on cellular energy metabolism, human dermal papilla cells were cultured in EFL medium for 5 to 10 days, then seeded into a 96-well plate, and after 24 hours, treated with the glycolysis inhibitor 2-deoxy-D-glucose (2-DG) for 5 to 48 hours, and the amount of ATP and lactic acid produced was measured. As shown in Figure 2f, no cell death caused by 2-DG was observed in the control group, and as shown in Figure 2g, there was no change in the difference in ATP production. Lactic acid production showed a significant decrease compared to the case without inhibitor treatment, but no significant change compared to the case with oxidative phosphorylation inhibitor treatment. On the other hand, in human dermal papilla cells cultured in EFL medium, cell death caused by 2-DG was observed, and it was confirmed that ATP production and lactic acid production were significantly reduced. Accordingly, it was found that when human dermal papilla cells are cultured in EFL medium, a partial transition of cellular energy metabolism from oxidative phosphorylation to glycolysis occurs. As shown in Figure 2h, total RNA sequencing analysis also confirmed that in human dermal papilla cells cultured in EFL medium, the expression of genes related to glycolysis was increased, while the expression of genes related to oxidative phosphorylation was decreased.When human hair papilla cells were cultured in EFL medium into a three-dimensional spheroid shape, it was confirmed that the area of the spheroid increased with increasing cell proliferation rate as shown in Fig. 2i, and that alkaline phosphatase staining, one of the markers for hair follicle formation ability, stained the entire spheroid as shown in Fig. 2j.
[0118]
[0119] Example 4. Analysis of characteristics of human dermal papilla cells cultured in EFLSC and EFSC media
[0120] In order to verify the characteristics of dermal papilla cells cultured according to the method of Example 2 above, when the culture medium components EGF, FGF2, LIF, SB431542, and CHIR99021 were treated individually or once, as shown in Figure 3a, a significant increase in cell proliferation rate was confirmed upon LIF treatment, and a slight increasing trend was observed in alkaline phosphatase (ALP) staining, which is one of the markers of hair follicle formation ability. In addition, proliferation rates and immunocytochemical staining were performed on human dermal papilla cells cultured in EFLSC and EFSC media, respectively, to confirm the activity of alkaline phosphatase (ALP), a marker of hair follicle formation ability, and the expression of VCAN (versican), SOX2, and LIN28. The expression levels of genes related to hair follicle formation ability, such as ALP, VCAN, SOX2, LEF1, GLI1, and LIN28, were analyzed. As a result, as shown in Figure 3b, the cell proliferation rate of human dermal papilla cells in EFLSC medium increased compared to the control group for each passage, and it was confirmed that the expression of ALPL and SOX2, which are markers of follicle formation ability, increased compared to the control group. Regarding the expression of genes related to follicle formation ability, as shown in Figure 3c, it was confirmed that ALPL, SOX2, LIN28, NANOG, LEF1, and GLI1 significantly increased when the cells were first cultured in EFL medium for 5 to 10 days and then cultured in EFLSC medium and EFSC medium.
[0121]
[0122] Example 5. Analysis of the characteristics of human dermal papilla cells cultured first in EFL medium for follicle proliferation and then in follicle-forming ability-activating medium
[0123] According to the culture method of Example 2 above, human dermal papilla cells were first cultured in EFL medium for proliferation as shown in Fig. 4a, and then the expression of genes related to follicular formation of human dermal papilla cells cultured in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media, which are follicular formation activation media, was analyzed. As shown in Fig. 4b, a tendency for the expression of ALPL, LEF1, and BLIMP1 to increase was confirmed compared to dermal papilla cells that were not first cultured in EFL medium, and as shown in Fig. 4c, a significant increase in SOX2 and LIN28, which are markers related to follicular formation, was confirmed.
[0124] As shown in Figure 4c, after culturing human dermal papilla cells into spheroids, the results of staining for alkaline phosphatase (ALP) activity, a marker of follicular formation ability, confirmed that it is expressed in both spheroids of dermal papilla cells cultured in EFLSC medium and EFSC medium, which are follicular formation ability medium conditions, regardless of whether they are cultured in EFL medium first. After 5 x 10^3 human dermal papilla cells cultured in the above EFLSC medium were cultured into a spheroid shape and co-cultured in vitro with 5 x 10^3 human outer root sheath cells (hORSCs), the expression of a hair germ was observed as shown in Fig. 4e, and as shown in Fig. 4f, a follicle-like structure was formed that exhibited a round structure very similar to the development of a polar follicle and proliferation in the surrounding cell layer. In the control group, the follicle-like structure disappeared after 3 days, whereas in the case where a follicle-like structure was formed using human dermal papilla cells cultured in the EFLSC medium developed by the inventors to provide follicle-forming ability, the structure similar to the development of a follicle was maintained for more than 12 days, which is a longer period than the control group, and it was confirmed that the growth of the follicle-like structure also significantly increased.
[0125]
[0126] Example 6. Analysis of cellular energy metabolism dependence after culturing human dermal papilla cells in EFLSC medium, a medium for activating follicle formation ability
[0127] As a result of analyzing the dependence on cellular energy metabolism of human dermal papilla cells cultured according to the method of Example 2 above, human dermal papilla cells were cultured in EFLSC medium for 5 to 10 days, then seeded into a 96-well plate, and after 24 hours, treated with 2-deoxy-D-glucose (2-DG), a glycolysis inhibitor, for 5 to 48 hours, and the amount of ATP and lactic acid produced were measured, as shown in Fig. 4g, no cell death caused by 2-DG was observed in the control group, and as shown in Fig. 4h, there was no change in the difference in ATP production, and although the amount of lactic acid produced showed a significant decrease compared to the case where no inhibitor was treated, there was no significant change compared to the case where an oxidative phosphorylation inhibitor was treated, in contrast, cell death caused by 2-DG was observed in human dermal papilla cells cultured in EFLSC medium, and it was confirmed that the amount of ATP and lactic acid produced decreased significantly. Accordingly, it was found that when human dermal papilla cells are cultured in EFLSC medium, a partial transition of cellular energy metabolism from oxidative phosphorylation to glycolysis occurs.
[0128]
[0129] Example 7. Search for candidate substances to enhance the activation of follicle-forming ability of human dermal papilla cells
[0130] In order to improve the proportion of cells positive for follicularity-related markers compared to when human dermal papilla cells were cultured in the follicularity-activating media EFLSC and EFSC, human dermal papilla cells were treated with candidate substances expected to induce growing hair follicles—such as EGF, FGF2, PDGF-AA, IGF-1, Valproic acid, Purmorphamine, A83-01, Y27632, and Vitamin C—either individually or in combination. Subsequently, as shown in Figures 5a-5g, alkaline phosphatase (ALP) activity and the expression of Versican and SOX2, which are representative follicularity-related markers, were stained and confirmed. The results showed that in the case where five substances—10 ng / ml PDGF-AA (P), 0.1 mM Valproic acid (V), 0.1 μM Purmorphamine (P2), 100 mM Nicotinamide (N), and 10 μM Y27632 (Y)—were simultaneously treated and cultured, the follicularity The expression of related markers increased most significantly, so five substances were identified and added to the follicle-forming activation media, EFLSC and EFSC, to prepare the follicle-forming activation media EFLSCPVP2NY (E:EGF, F:FGF2, L:LIF, S:SB431542, C:CHIR99021, P:PDGF-AA, V:Valproic acid, P2:Purmorphamine, N:Nicotinamide, Y:Y27632) and EFSCPVP2NY (E:EGF, F:FGF2, S:SB431542, C:CHIR99021, P:PDGF-AA, V:Valproic acid, P2:Purmorphamine, N:Nicotinamide, Y:Y27632). To prepare a medium for activating the follicular formation ability of human dermal papilla cells, 10–20 μM PDGF-AA(P), 0.1 mM–1 mM Valproic acid(V), 0.1–1 μM Purmorphamine(P2), 100–200 mM Nicotinamide(N), and 5–20 μM Y27632(Y) can be used.
[0131]
[0132] Example 8. Analysis of characteristics of human dermal papilla cells cultured in EFL medium followed by culture in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media
[0133] In order to verify the characteristics of the dermal papilla cells cultured according to the method of Example 2 above, alkaline phosphatase (ALP) activity was confirmed by staining in human dermal papilla cells cultured in three-dimensional spheroids in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media, and in human dermal papilla cells cultured in EFL medium followed by three-dimensional spheroids in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media, respectively. As shown in Figure 6a, while there were few cells positive for alkaline phosphatase (ALP) activity in the control group, cells positive for alkaline phosphatase (ALP) activity could be confirmed throughout the spheroid when cultured in EFL medium, which is a follicle cell proliferation medium, and EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY, which are follicle formation ability activation media. In addition, the expression levels of ALP, VCAN, SOX2, LEF1, GLI1, and LIN28, which are genes related to follicle formation ability, were analyzed in human dermal papilla cells cultured in EFL medium followed by EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media, respectively. As a result, as shown in Figure 6b, it was confirmed that when human dermal papilla cells were cultured in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media, the expression of genes related to follicle formation ability significantly increased in the control group. As shown in Figure 6c, total RNA sequencing also confirmed that the expression of genes related to the Wnt signaling pathway, known as an important signaling pathway for follicle formation, was increased in human dermal papilla cells cultured in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media.
[0134]
[0135] Example 9. Analysis of follicle formation ability acquisition and confirmation of follicle neogeneration of human dermal papilla cells cultured in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media
[0136] The inventors believe that the spontaneous formation of spheroids of dermal papilla cells, which is similar to the in vivo structure due to the intrinsic characteristics of dermal papilla cells, is related to the hair follicle induction ability of dermal papilla cells and the restoration of the intrinsic characteristics of human dermal papilla cells, and thus the EFLSC (E:EGF, F:FGF2, L:LIF, S:SB431542, C:CHIR99021), EFSC (E:EGF, F:FGF2, S:SB431542, C:CHIR99021), EFLSCPVP2NY (E:EGF, F:FGF2, L:LIF, S:SB431542, C:CHIR99021, P:PDGF-AA, V:Valproic acid, P2:Purmorphamine, N:Nicotinamide, Y:Y27632), EFSCPVP2NY (E:EGF, F:FGF2, S:SB431542, To analyze the effect of each medium (C:CHIR99021, P:PDGF-AA, V:Valproic acid, P2:Purmorphamine, N:Nicotinamide, Y:Y27632) on the formation of spheroids in dermal papilla cells, human dermal papilla cells were cultured on culture plates with very low adhesion conditions. As a result, spontaneous spheroid formation similar to the in vivo dermal papilla structure was observed in both the control group and dermal papilla cells cultured in EFLSC medium. Generally, it is known that when culturing spontaneous spheroids on plates with very low adhesion conditions, the diameter of the spheroid decreases as the culture period increases. However, as shown in Fig. 2i, when cultured in EFLSC medium, the size of the spheroid increased in a period-dependent manner compared to the control group, similar to the growth of the dermal papilla that occurs when entering the growth phase of the human hair follicle cycle, and the activity of alkaline phosphatase (ALP), a marker of hair follicle formation ability, also significantly increased (Fig. 6a).
[0137] In addition, human dermal papilla cells cultured in the above EFLSC medium were cultured into a spheroid shape and then co-cultured in vitro with human outer root sheath cells (hORSCs). As a result, the expression of hair germs was observed as shown in Fig. 4e, and as shown in Fig. 4f, a follicle-like structure was formed that exhibited a round structure very similar to the development of a polar follicle and proliferation in the surrounding cell layer. In contrast, in the control group, the follicle-like structure disappeared after 3 days, whereas in the case where a follicle-like structure was formed using human dermal papilla cells cultured in the EFLSC medium developed by the inventors to provide follicle-forming ability, the structure similar to the development of a follicle was maintained for more than 15 days, which is a longer period than the control group, and it was confirmed that the growth of the follicle-like structure also significantly increased.
[0138] Furthermore, the inventors performed a chamber assay according to the method of Examples 1-9 to determine whether hair follicle formation could be induced when human dermal papilla cells having the hair follicle-forming ability according to the present invention were transplanted into immunodeficient hairless (Balb / c nude) mice. Specifically, a wound was made on the dorsal skin of an immunodeficient nude mouse and a silicone chamber was implanted. Then, human dermal papilla spheroids were mixed with 50% Matrigel and C57BL / 6 neonatal mouse epidermal cells (mEPI) and injected into the implanted silicone chamber. After one week, the chamber was removed and observed for 5 or 25 weeks. Since immunodeficient nude mice lack hair follicles and have an albino genetic background, the ability to easily distinguish black hair follicles newly formed by C57BL / 6 mouse-derived epidermal cells was utilized to determine whether new hair follicles were formed and whether their sustainability was maintained. As a result, when human dermal papilla cells from passage 9, which had been subcultured multiple times and had completely lost their follicular formation ability, were cultured as shown in the schematic diagram of Fig. 7a and then subjected to chamber assay, no follicular formation was observed in the control group as in Fig. 7a, but black hair could be observed in the group transplanted with human dermal papilla cells cultured in EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media. In addition, a large number of black hairs were observed in the group in which human dermal papilla cells were transplanted after being cultured in EFL medium followed by EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY, thus verifying the ability to induce new hair follicles in all of the follicle-forming performance-enhancing media developed by the inventors, namely EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY. It was also confirmed that the method of first culturing in EFL medium followed by culturing human dermal papilla cells in the follicle-forming performance-enhancing media EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY is a more effective culture method for new hair follicles.
[0139] Through the above results, it was confirmed that human hair papilla cells cultured for a certain period in the EFL, EFLSC, EFSC, EFLSCPVP2NY, and EFSCPVP2NY media developed by the inventors can induce hybrid hair follicle regeneration in mice together with mouse epidermal cells.
[0140] Based on the above results, an in vitro model of the hair papilla cell culture method developed by the inventors can be created as shown in FIG. 7b and used as a research model for the process of improving hair follicle formation performance of hair papilla cells and hair follicle regeneration as shown in FIG. 4e and FIG. 4f.
[0141] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without altering the technical or essential features of the invention and without departing from its essential characteristics. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.
Claims
1. A culture medium composition for human dermal papilla cells (hDPC) characterized by including an IL-6 family cytokine and a growth factor in the basic medium.
2. A culture medium composition for human dermal papilla cells according to claim 1, wherein the basic medium is a mixed medium of DMEM / F12 (Dulbecco's Modified Eagle Medium / Ham's F-12) and KSFM (Keratinocyte Serum-Free Medium), and the medium comprises L-glutamine, antibiotics, and fetal bovine serum (FBS).
3. A culture medium composition for human dermal papilla cells according to claim 1, characterized in that the IL-6-series cytokine is one or more selected from the group consisting of leukemia inhibitory factor (LIF), IL-6, IL-11, IL-27, CNTF (ciliary neurotrophic factor), Oncostatin M, CLC (cardiotrophin-like cytokine), and CCT-1 (cardiotrophin 1).
4. A culture medium composition for human hair papilla cells according to claim 1, characterized in that the growth factor is one or more of Epidermal Growth Factor (EGF) and Fibroblast Growth Factor-2 (FGF2).
5. The culture medium composition according to claim 1, wherein the culture medium composition is for human hair papilla cell proliferation.
6. A culture medium composition for improving the follicle-forming ability of human dermal papilla cells, characterized by additionally comprising a transforming growth factor-β (TGF-β) type 1 receptor inhibitor and a glycogen synthase kinase-3 (GSK-3) inhibitor to the culture medium composition for human dermal papilla cells of claim 1.
7. A culture medium composition for maintaining or enhancing the follicle-forming ability of human dermal papilla cells, characterized in that, in claim 6, the TGF-β type 1 receptor inhibitor is SB431542 and the GSK-3 inhibitor is CHIR99021.
8. A culture medium composition for maintaining or enhancing the follicle-forming ability of human hair papilla cells, characterized in that, in claim 6, it further comprises one or more selected from the group consisting of PDGF-AA (Platelet-derived growth factor-AA), valproic acid, purmorphamine, nicotinamide, and Y27632.
9. A step of culturing human dermal papilla cells in a culture medium composition according to any one of claims 1 to 8; comprising a method for culturing human dermal papilla cells.
10. (a) a step of primary culturing and proliferating human dermal papilla cells in a culture medium composition according to any one of claims 1 to 5; and (b) a step of improving hair follicle formation performance by secondarily culturing the human hair papilla cells proliferated in step (a) in a medium composition according to any one of claims 6 to 8; a method for culturing human hair papilla cells.
11. A culture method according to claim 10, characterized in that the primary culture of step (a) above is performed for 5 to 10 days.
12. A culture method according to claim 10, characterized in that the culture is performed on a culture plate coated with Matrigel.
13. Human hair papilla cells with enhanced follicle-forming ability cultured by the method of paragraph 10.
14. A pharmaceutical composition for preventing or treating hair loss, characterized by comprising the human hair papilla cells of claim 13 as an active ingredient.
15. A composition for inducing hair follicle regeneration characterized by comprising the human hair papilla cells of claim 13 as an active ingredient. 16.(a) A step of co-culturing the human hair papilla cells of paragraph 13 with human outer root sheath cells to form a hair follicle-like structure; (b) a step of treating the hair follicle-like structure of step (a) with a candidate substance; and (c) a step of screening candidate substances by analyzing the growth or morphological change of the above hair follicle-like structure; A method for screening candidate substances for treating hair loss diseases, including