NHIP based methods and compositions for molecular testing and treatment of hypoxia related brain disorders

A diagnostic assay using WGBS and NHIP gene analysis, combined with peptide therapy, addresses the limitations of current methods by identifying a novel ASD risk gene locus and providing effective treatment for hypoxia-related brain disorders.

WO2026143158A1PCT designated stage Publication Date: 2026-07-02RGT UNIV OF CALIFORNIA +2

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
RGT UNIV OF CALIFORNIA
Filing Date
2025-12-23
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Current diagnostic methods for hypoxia-related brain disorders, such as autism spectrum disorder (ASD) and neurodegenerative diseases, are limited by the lack of sensitivity in detecting genetic mutations and the failure to consider placental DNA methylation patterns, which are crucial for understanding genetic and environmental interactions during fetal development.

Method used

A diagnostic assay using whole genome bisulfite sequencing (WGBS) to analyze placental DNA methylation and detect the neuronal hypoxia inducible, placenta associated (NHIP) gene, combined with a peptide-based therapy involving modified NHIP peptides to treat hypoxia-related brain disorders.

Benefits of technology

The method identifies a novel ASD risk gene regulatory locus at 22q13.33, enabling accurate risk assessment and treatment through modified NHIP peptides, thereby improving diagnostic accuracy and therapeutic efficacy for hypoxia-related brain disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025061210_02072026_PF_FP_ABST
    Figure US2025061210_02072026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein methods and compositions for diagnosing, stratifying risk, and treating hypoxia-related brain disorders using NHIP genetic variants, DNA methylation signatures, and circulating NHIP peptide levels, as well as NHIP based peptide therapeutics for improving neurological and developmental outcomes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No. 11716-026WO1

[0002] NHIP BASED METHODS AND COMPOSITIONS FOR MOLECULAR TESTING AND TREATMENT OF HYPOXIA RELATED BRAIN DISORDERS

[0003] CROSS REFERENCE TO RELATED APPLICATIONS

[0004] This PCT application claims priority to, and the benefit of, U. S. Provisional Patent Application No. 63 / 738,307, filed December 23, 2024, and U. S. Provisional Patent Application No. 63 / 868,818, filed August 22, 2025, which are incorporated by reference herein in their entireties.

[0005] REFERENCE TO SEQUENCE LISTING

[0006] The sequence listing submitted on December 23, 2025, as an XML entitled “11716- 026WOl_ST26.xml” created on December 17, 2025, and having a file size of 32,529 bytes, is hereby incorporated by reference pursuant to 37 C. F. R. § 1.52(e)(5).

[0007] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0008] This invention was made with government support under HD 112991, UHOD035550, and ES029213 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0009] FIELD

[0010] The present disclosure relates to diagnostic assays, risk assessment methods, and therapeutic compositions based on the neuronal hypoxia inducible, placenta associated (NHIP) gene for hypoxia related neurodevelopmental and neurodegenerative disorders.

[0011] BACKGROUND

[0012] Hypoxia can be caused by a variety of causes in fetal, neonatal, and adult life and has immediate consequences to brain health. We recently discovered and functionally characterized a novel gene which we named Neuronal hypoxia, placenta associated (NHIP) that produces a 20 amino acid peptide in response to hypoxia. We also identified a common genetic polymorphism in the NHIP gene locus that was associated with autism spectrum disorder (ASD). The NHIP genetic locus was a better predictor of ASD than the existing polygenic risk score. This invention combines a blood-based screen for genetic risk of low NHIP with an antibody-based quantitationAttorney Docket No, 11716-026WO1

[0013] of NHIP peptide levels. For individuals with high genetic risk and low NHIP levels, it is proposed here to use a peptide-based therapy. The endogenous NHIP peptide will have amino acid substitutions and modifications to increase stability.

[0014] Autism spectrum disorders (ASD) are growing in prevalence, with 1 in 54 children diagnosed in the USA. Diagnosis of ASD is based on a child’s behavioral difficulties in social communication and interactions, language deficits, restricted interests and repetitive behaviors, and sensory sensitivities. The etiology of ASD is complex and heterogeneous, and it is likely to involve multiple genetic and environmental factors, as well as poorly understood geneenvironment interactions. Twin and sibling studies have shown a strong heritability of ASD risk within families, and most genetic risk for ASD is expected to come from common variants. Exome sequencing of ASD trios has identified genes with rare mutations in ASD children, which are enriched for neuronal, embryonic development, and chromatin regulation functions, but no single gene ex- plains more than 1% of disease risk. A large genome-wide association study (GWAS) identified individual genetic variants that contribute to an individual’s ASD risk and showed that the weighed sum of the risk alleles and their effect sizes can be combined to create a polygenic risk score (PRS) for ASD. The variance explained for ASD using this approach was 2.45%, which was further improved to 3.77% by in- including in the prediction model additional PRS for traits co-heritable with ASD, including schizophrenia, depression, and educational attainment. Common polygenic risk also interplay with early environmental and perinatal factors in other hypoxia-related brain disorders. For example, a PRS derived from a set of 108 previously identified genome-wide significant variants for schizophrenia was shown to be significant only in the presence of early-life maternal complications (ELCs), and the subset of variants interacting with ELCs also corresponded with patterns of placental gene expression, consistent with the importance of placental gene regulation as a window into neurodevelopnient. However, most ASD genetic or environmental studies have not included placental molecular measures, despite the potential convergence between placental biology and genetic risk for ASD. Term placenta is an accessible tissue normally discarded at birth; however, the convergence between placental biology and genetic risk for ASD is relatively unexplored.

[0015] The placenta maintains a distinct landscape of DNA methylation characterized by partially methylated domains (PMDs), which is more similar to oocytes and preimplantation embryos, where methylation over gene bodies is positively correlated with expression, compared with the high overall methylated pattern of fetal or adult tissues. In this way, placental methylation patterns are also similar to most epithelial-derived tumors, where PMDs are also found. Both placenta andAttorney Docket No, 11716-026WO1

[0016] tumors show a strong responsiveness to hypoxia that promotes cell proliferation and angiogenesis, which are both required for invasion of the placental trophoblasts into the uterine decidua during placentation. In vivo, hypoxia and reactive oxygen species promote neurogenesis in embryos, newborns, and adults and also play a role in neuronal differentiation in vitro. Furthermore, exposure to most environmental pollutants produces excessive oxidative stress that can impact both placentation and neurodevelopment.

[0017] Because of its multiple roles in support of fetal development during intrauterine life, the placenta is a promising tissue for identifying DNA methylation alterations at genes relevant to fetal brain and gene-environment interactions in ASD. Most epigenome-wide association studies (EWAS) for ASD have used array-based methods to assess DNA methylation which lack coverage over the most epigenetical ly and genetically polymorphic regions of the human genome, such as correlated regions of systemic interindividual variation (CoRSIVs) and structural variants (SVs). CoRSIVs, which are regions of the genome with similar DNA methylation patterns across tissue types, are sensitive to the periconceptional environment, observed across diverse tissues, associated with human disease genes, and enriched for transposable elements and subtelomeric locations. SVs arising from transposable elements have been associated with many human phenotypes, especially immune responses and neurodevelopmental disorders, such as schizophrenia. SVs exhibit a nonrandom distribution in hotspots within relatively gene -poor regions in primate genomes but are enriched for gene functions in oxygen transport, sensory perception, synapse assembly, and antigen binding. Recent studies suggested that a large SV burden was associated with lower cognitive ability and ASD, but most GW AS and EWAS studies ignore SVs and CoRSIVs in the genome. Therefore, the combination of utilizing the unique placental DNA methylation landscape reflective of in-utero gene expression with sequencingbased epigenome-wide investigations inclusive of understudied genomic regions is warranted.

[0018] Infertility is increasing in prevalence in the US due to complex reasons involving lifestyle and environmental factors interacting with genetics. The use of Assisted Reproductive Technologies (ART) as a treatment for infertility is also increasing rapidly, particularly in vitro fertilization with intracytoplasmic sperm injection (IVF). However, the cost of IVF is a barrier for many infertile couples and there have been few improvements in its effectiveness. Combating the biological consequences of excessive oxidative stress that result from the artificial environments in IVF has been identified as a way to improve IVF effectiveness, but there is a demand for novel products developed from recent discoveries in human genetics. Therefore, methods to treat a hypoxia-related brain disorder are necessary to mitigate hypoxia and reactive oxygen speciesAttorney Docket No. 11716-026WO1

[0019] promoted neurogenesis in embryos, newborns, and adults. Furthermore, a therapeutic is needed to reverse the ongoing exposure to most environmental pollutants which produces excessive oxidative stress that can impact both placentation and neurodevelopment.

[0020] While highly sensitive, nucleic acid-based technologies are limited at detecting genetic mutations in hypoxia-related brain disorders. Given the limitations described above, a bulk¬ analysis diagnostics based on a multi-omics screening assay is needed.

[0021] SUMMARY

[0022] Disclosed herein is an association of hypoxia-related brain disorders risk with placental DNA methylation in two high-risk familial ASD cohorts through whole genome bisulfite sequencing (WGBS) analysis of 204 individuals. A block of differential methylation was identified in ASD at 22ql 3.33, a region previously described as a CoRSIV and SV hotspot but not previously associated with ASD. A novel gene LOG 105373085 (renamed as NHIP for neuronal hypoxia inducible, placenta associated) within 22ql3.33 was demonstrated to be expressed in brain, responsive to oxidative stress, and to influence expression of other known ASD-risk genes. A common SV insertion within 22ql3.33 was associated with increased ASD risk, reduced expression of NHIP, and reduced methylation, but first month prenatal vitamin use counteracted this effect. Together, these results demonstrate a novel ASD risk gene regulatory locus at the interface of common genetics and perinatal environmental resilience.

[0023] In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a hypoxia-related brain disorder (such as for example, neurodevelopmentai or neurodegenerative disorder (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, nearAttorney Docket No, 11716-026WO1

[0024] drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing) in a subject, comprising a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b) detecting presence or absence of a neuronal hypoxia, placenta associated (NHIP) gene risk allele in the sample; c) measuring circulating levels of NHIP peptide in the sample, wherein the subject is predicted to have the hypoxia-related brain disorder if the sample has homozygous NHIP risk alleles or low circulating NHIP peptide levels than in comparison to a control; and d) administering a therapeutically effective dose of a peptide based therapeutic (such as, for example, a modified endogenous NHIP peptide with one or more amino acid substitutions including, but not limited to SEQ ID NOS: 8, 9 or 10) to the subject who is predicted to have the hypoxia-related brain disorder. In some aspects, the modified NHIP peptide can be administered in combination with a pharmaceutically acceptable carrier.

[0025] Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a hypoxia-related brain disorder (such as for example, neurodevelopmental or neurode enerative disorder (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing) in a subject, comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b) detecting the presence of a NHIP risk allele in the sample; c) measuring circulating levels of NHIP peptide in the sample; d) calculating aAttorney Docket No. 11716-026WO1

[0026] polygenic risk score (PRS) based on the presence of the NHIP risk allele, and the circulating levels of the NHIP peptide, wherein a high-risk score relative to a control indicates an increased risk for the hypoxia-related brain disorders; and e) administering a peptide based therapeutic (such as, for example, a modified endogenous NHIP peptide with one or more amino acid substitutions including, but not limited to SEQ ID NOS: 8, 9 or 10) alone or in combination with a second therapeutic agent to the subject with the high-risk score. In some aspects, the high-risk score comprises a homozygous NHIP risk allele and low circulating NHIP peptide levels. For example, the PRS comprises a Low Risk: PRS < -1, a Moderate Risk: PRS between -1 and +1, a High Risk: PRS between +1 and +2, or Very High Risk: PRS > +2; wherein a score higher than +1 relative to a control indicates an increased risk for the hypoxia-related brain disorder.

[0027] Also disclosed herein are peptide based therapeutic compositions for treatment of hypoxia- related brain disorders, comprising a modified NHIP peptide with one or more amino acid substitutions (such as for example SEQ ID NO: 9); and a pharmaceutically acceptable carrier.

[0028] In one aspect disclosed herein are peptide-based therapeutics of any preceding aspect, wherein the modified NHIP peptide is delivered to a subject, wherein the subject has low circulating NHIP peptide levels and homozygous NHIP risk allele.

[0029] Also disclosed herein are peptide based therapeutics of any preceding aspect, further comprising a second therapeutic agent.

[0030] In one aspect, disclosed herein are multi-omics screening assays for determining hypoxia-related brain disorders (such as for example, neurodevelopmental or neurodegenerative disorders (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion,Attorney Docket No, 11716-026WO1

[0031] cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing) comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from a subject; b) detecting NHIP risk alleles in the sample; c) measuring circulating levels of NHIP peptide in the sample; d) measuring DNA methylation levels at NHIP gene locus; and e) calculating a polygenic risk score (PRS) based on presence of the NHIP risk alleles, the DNA methylation levels at NHIP gene locus, and the circulating levels of NHIP peptide; wherein a high-risk score relative to a control indicates an increased risk for hypoxia-related brain disorders. In some aspects, the high-risk score comprises a homozygous NHIP risk allele and low circulating NHIP peptide levels. For example, the PRS comprises a Low Risk: PRS < -1, a Moderate Risk: PRS between -1 and +1, a High Risk: PRS between +1 and +2, or Very High Risk: PRS > +2; wherein a score higher than +1 relative to a control indicates an increased risk for the hypoxia-related brain disorder.

[0032] Also disclosed herein are methods of improving, increasing, and / or rescuing cognitive function and brain health in a subject recovering from hypoxia, comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b ) identifying the subject with low circulating NHIP peptide levels and presence of a NHIP risk allele in the sample; and c) administering a customized NHIP peptide therapeutic (such as, for example, a modified endogenous NHIP peptide with one or more amino acid substitutions including, but not limited to SEQ ID NOS: 8, 9 and 10) alone or in combination with a second therapeutic agent to the subject with low circulating NHIP peptide levels and presence of the NHIP risk allele in the sample. In some aspects the method further involves calculating a polygenic risk score (PRS) based on the presence of the NHIP risk allele, and the low circulating levels of NHIP peptide, wherein a high-risk score relative to a control indicates a compromised cognitive function and brain health.

[0033] In one aspect, disclosed herein are methods for determining a predisposition to hypoxia- related brain disorders (such as for example, neurodevelopmental or neurodegenerative disorder (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternalAttorney Docket No, 11716-026WO1

[0034] hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing) in a subject, comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b) performing a genetic assay on the sample to detect presence of one or more NHIP risk alleles; and c) identifying if the subject is homozygous for NHIP risk allele, whereby the subject is predisposed to hypoxia- related brain disorders in presence of homozygous NHIP risk allele.

[0035] Also disclosed herein are methods of improving, promoting, facilitating, increasing, expanding, or enhancing developmental outcome in assisted reproductive technology (ART) (including but not limited to in vitro fertilization, intracytoplasmic sperm injection, embryo culture, embryo cryopreservation, or embryo thawing) comprising: supplementing a medium (such as, for example, including but not limited to a sperm preparation media, an oocyte maturation media, a fertilization media, an embryo culture media, a vitrification media, a warming media, or a freeze thaw media) with an NHIP peptide (such as, for example, SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 95%, 98%, 99% or 99.8% identity thereto), thereby obtaining a supplemented medium; culturing a gamete, zygote, or embryo in the supplemented medium; isolating RNA from cultured gamete, zygote, or embryo; and determining a developmental outcome (such as, for example, including but not limited to fertilization rate, cleavage rate, blastocyst formation, embryo developmental competency, implantation rate, or live birth rate).

[0036] In some aspects, disclosed herein are methods of improving, promoting, facilitating, increasing, expanding, or enhancing developmental outcome in of any preceding aspect, wherein the embryo developmental competency is determined using an embryo competency index (ECI), wherein the ECI is calculated from normalized expression levels of predictive genes (such as, for example, including but not limited to GSTO1, CHSY1, TPI1, YWHAG, CCNA2, LSM4, CDK7, or EIF4A3).

[0037] Also disclosed herein are methods of improving, promoting, facilitating, increasing, expanding, or enhancing developmental outcome in of any preceding aspect, wherein the NHIP supplementation increases the embryo competency index at least at one effective NHIP dose.Attorney Docket No, 11716-026WO1

[0038] In further aspects, disclosed herein are methods of improving, promoting, facilitating, increasing, expanding, or enhancing developmental outcome in of any preceding aspect, wherein the at least one effective NHIP dose comprises the NHIP peptide at a concentration of at least 0.01 ng / ml to about 100 ng / ml.

[0039] Also disclosed herein are methods of improving, promoting, facilitating, increasing, expanding, or enhancing developmental outcome in of any preceding aspect, wherein the method further comprises transferring an embryo cultured in the supplemented medium into a recipient uterus or oviduct, and wherein the supplementation results in an increased rate of implantation, pregnancy, or live birth relative to a control embryo not exposed to the supplemented medium.

[0040] In one aspect, disclosed herein are compositions, comprising: an NHIP peptide or a functional derivative thereof (such as, for example, SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 95%, 98%, 99% or 99.8% identity thereto); and a pharmaceutically acceptable carrier (such as, for example, including but not limited to a nanoparticle or a liposome). In some aspects, the composition is formulated to support embryo development, cryopreservation, or post thaw recovery.

[0041] In one aspect disclosed herein is a method for determining embryo competency, comprising: obtaining a biological sample comprising at least one reproductive cell associated with the embryo; detecting a DNA methylation level at an NHIP locus in the reproductive cell; comparing the DNA methylation level in the reproductive cell to a reference methylation level; and determining embryo competency, wherein a reduced DNA methylation level at the NHIP locus in the reproductive cell relative to the reference methylation level indicates an increased embryo competency. In some aspects, the at least one reproductive cell is selected from the group consisting of cumulus cells, oocytes, and embryos. In some aspects, the reproductive cell is obtained during an in vitro fertilization procedure. In some aspects, the method further comprising generating an embryo competency score by: measuring an expression level of one or more NHIP regulated transcripts in the biological sample; and combining (i) the DNA methylation level at the NHIP locus and (ii) the expression level of the one or more NHIP regulated transcripts to produce the embryo competency score, wherein a reduced DNA methylation level at the NHIP locus or a reduced expression level of the one or more NHIP regulated transcripts is indicative of an increased embryo competency score. In some aspects, the one or more NHIP regulated transcripts comprise TPI1, YWHAG, CCNA2, or a combination thereof. In some aspects, an increased embryo competency score is indicative of an increased likelihood of achieving at least one predefined developmental outcome selected from the group consisting of blastocyst formation, implantation,Attorney Docket No. 11716-026WO1

[0042] clinical pregnancy, and live birth, as compared to an embryo having a lower embryo competency score.

[0043] Also disclosed herein, are methods of treating in vitro fertilization (IVF) induced oxidative stress, comprising: supplementing a culture medium (such as, for example, including but not limited to a sperm preparation media, an oocyte maturation media, a fertilization media, an embryo culture media, a vitrification media, a warming media, or a freeze thaw media) with an NHIP peptide (such as, for example, SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 95%, 98%, 99% or 99.8% identity thereto), thereby obtaining a supplemented culture medium; and culturing a gamete, zygote, or embryo in the supplemented culture medium. In some aspects, the NHIP peptide is supplemented in the culture medium during at least one stage of IVF, wherein the stage of IVF comprises oocyte maturation, fertilization, cleavage stage development, morula stage development, blastocyst stage development, or combinations thereof. In some aspects, the NHIP peptide is supplemented in the culture medium continuously throughout from fertilization through blastocyst formation. In some aspects, the NHIP peptide is supplemented in the culture medium intermittently for at least 2 hours, 6 hours, 12 hours, 24 hours, or 48 hours. In some aspects, the NHIP peptide is supplemented in the culture medium during a single treatment cycle corresponding to one IVF cycle. In other aspects, the NHIP peptide is supplemented across multiple treatment cycles corresponding to sequential IVF cycles. In some aspects, the method further comprises determining embryo developmental outcome (including but not limited to fertilization rate, cleavage rate, blastocyst formation, embryo developmental competency, implantation rate, or live birth rate). In some aspects, the embryo developmental competency is determined using an embryo competency index (ECI), wherein the ECI is calculated from normalized expression levels of predictive genes (such as, for example, including but not limited to GSTO1, CHSY1, TPI1, YWHAG, CCNA2, LSM4, CDK7, or EIF4A3). In some aspects, the NHIP supplementation increases the embryo competency index at least at one effective NHIP dose. In some aspects, the at least one effective NHIP dose comprises the NHIP peptide at a concentration of at least 0.01 ng / ml to about 100 ng / ml.

[0044] BRIEF DESCRIPTION OF FIGURES

[0045] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.

[0046] Figs. 1A, IB, 1C, ID, and IE depict ASD-associated DMRs are enriched at fetal brains enhancers and a co-methylated block at 22ql3.33 replicates across studies and platforms. Fig. 1AAttorney Docket No. 11716-026WO1

[0047] shows a schematic of the experimental design for discovery of ASD DMRs, replication of the co¬ methylated 22ql3.33 locus, genetic associations, and functional follow-up of anovel gene (NHIP). Fig. IB shows circular Manhattan plot of the epigenome-wide association of DNA methylation in placenta with ASD diagnosis at 36 months. Results are represented as DMR association test results (- log 10(p)). Significant thresholds are blue for permutation p value < 0.05, red for FDR-adjusted permutation p value < 0.05, and gray for nonsignificant. Fig. 1C shows 134 ASD DMRs (permutation p value < 0.05) tested for enrichment within chromatin states defined by Epigenome Roadmap ChromHMM. Each row represents a different ChromHMM state and each column a single tissue type, with the heatmap plotting the - loglO(q-value) significance of ASD DMR enrichment. Fig. ID shows correlation matrix of methylation levels using the Pearson correlation coefficient for the 12 DMRs located in the 22ql3.33 hypomethylated block. Fig. IE shows smoothed methylation values were averaged over the 22ql3.33 hypomethylated block (y-axis) and compared across diagnosis groups (x-axis). In the discovery group, ASD samples had significantly lower methylation than TD samples (MARBLES, HiSeq X, ASD n - 46, TD n - 46) (p value = 0.002). The same result and direction were observed in the external replication group (EARL1, HiSeq 2500, ASD n = 16, TD n = 31) (p value = 0.009). For the specificity replication group (MARBLES, NovaSeq, ASD n = 21, Non-TD n = 13, TD n - 31), ASD methylation levels were also significantly lower than both I'D (p value = 0.005) and Non-TD (p value = 0.049), while Non-TD was significantly lower than TD samples (p value = 0.050) by Mann- Whitney- Wilcoxon. Box plot center lines, box limits, and whiskers represented median, interquartile range, and minimum and maximum values, respectively.

[0048] Figs. 2A, 2B, 2C, 2D, 2E, 2F, 2G and 2H depict Functional characterization of NHIP transcript levels in response to neuronal hypoxia. In a-e RT-qPCR assays, NHIP levels were normalized to GAPDH with at least three independent experiments per condition. Fig. 2A shows NHIP levels in human tissues, including adult brain, fetal brain, placenta, and testis. Fig. 2B shows NHIP levels in placenta samples from the discovery group (ASD n = 17, TD n = 11). ASD samples show significantly lower NHIP levels than TD samples (Mann-Whitney-Wilcoxon, p value = 0.009). Fig. 2C shows NHIP levels in human cell lines, HEK293T, IMR90, LUHMES, and SH- SY5Y. In LUHMES cells, NHIP levels were significantly higher in differentiated neurons compared to undifferentiated neurons (Mann-Whitney-Wilcoxon, p value = 0.034). Fig. 2D shows differentiated LUHMES cells are more sensitive to hypoxia than undifferentiated LUHMES cells. Formation of reactive oxygen species (ROS) was measured in differentiated and undifferentiated LUHMES cells treated with 100 nM CoCh, a hypoxia mimetic, or vehicle (mock) (Mann-Attorney Docket No. 11716-026WO1

[0049] Whitney-Wilcoxon, p value = 0.0001). Fig. 2E shows NHIP levels increase in response to hypoxia, specifically in differentiated neurons. Differentiated or undifferentiated LUHMES cells were treated with 100 nM CoCh. In differentiated LUHMES cells, CoCh treatment significantly increased NHIP levels (Mann-Whitney-Wilcoxon, p value = 0.009). Fig. 2F shows NHIP overexpression in HEK293T cells resulted in a faster doubling time than vector control cells, indicating increased cell proliferation. (Hour 142, Mann -Whitney- Wilcoxon, p value - 0.045, NHIP overexpression cells n - 3, control cells n = 3, effect size - 3.10; Hour 166, Mann-Whitney- Wilcoxon, p value = 0.0009, NHIP overexpression cells n = 3, control cells n = 3, effect size= 7.80). Fig. 2G shows vector design of NHIP peptide-eGFP (dotted line represents excised ATG of EGFP) and combined phase and fluorescent microscopy. Green, eGFP linked to NHIP peptide; red, mCherry, transfection positive control. Scale bars, 100 pm. Fig. 2H, shows immunofl uorescent staining of human frontal cortex, showing nuclear localization with anti-NHIP, but not pre-immune control. Blue, DAPI nuclear counterstain; red, anti-NHIP staining. Scale bars, 100 pm. Data are mean ± SEM.

[0050] Figs. 3A, 3B, 3C, 3D, 3E, and 3F depict a common genetic structural variant that is significantly associated with 22ql3.33 DNA methylation and ASD. Fig. 3A shows insertion location (orange) relative to the 22ql3.33 hypomethylated block (blue), and the novel transcript, NHIP (red) in the UCSC genome browser. The 22ql.33 co-methylated block was 117,974 bp in length (blue). NHIP TSS was located 7881 bp downstream from the start of the 22ql3.33 hypomethylated block. The insertion (not in the reference genome) is 15,013 bp upstream from the start of the 22q 13.33 hypomethylated block. Fig. 3B shows the association matrix shows ANOV A p values for the comparison of the insertion genotype (homozygous for insertion versus not) with smoothed methylation levels within each of 12 DMRs located in the 22ql3.33 hypomethylated block from the discovery group (ASD n = 41, TD n = 37). Fig. 3C shows association was tested between insertion genotype (Y, homozygous for insertion; N, not) and 22ql3.33 co-methylated block methylation levels (discovery group, ASD n = 41, TD n - 37). ASD showed significantly lower DNA methylation levels compared to TD placenta samples within the entire 22ql3.33 co-methylated block (Mann-Whitney-Wilcoxon, p value = 0.008, ASD n = 41, TD n = 37, effect size = -0.645). Samples homozygous for the insertion had significantly lower methylation than those not having insertion on one or both alleles (Mann-Whitney-Wilcoxon, p value = 0.004, Y n = 29, Nn = 49, effect size = - 0.644). When broken down by diagnosis, samples with insertion had significantly lower methylation specifically in ASD samples (Mann-Whitney-Wilcoxon, p value - 0.005, Y n = 20, N n = 21, effect size - -0.878), not TD samples (Mann-Attorney Docket No. 11716-026WO1

[0051] Whitney-Wilcoxon, p value = 0.847, Y n =9, N n = 28, effect size = -0.173). Fig. 3D shows periconceptional prenatal vitamin use was a significant modifier of 22ql3.33 block methylation in placenta (discovery group, ASD n = 41, TD n = 37). Lower percent methylation at the 22ql.33 co-methylated block was significantly associated with not taking prenatal vitamins during the first month of pregnancy (Mann-Whitney-Wilcoxon, p value = 0.001), which was in the same direction as ASD risk. Fig. 3E shows UCSC genome browser map showing the insertion location (orange vertical line) relative to two adjacent CTCF sites (green arrows) and NHIP. Both undifferentiated and differentiated LUHMES cells have both CTCF sites, consistent with them being homozygous for the reference sequence. Additional brain tracks show the variability of the upstream CTCF site between human samples. ChromHMM tracks were derived from fetal brain, multiple brain regions, ovary, and placenta. Red, active promoter; yellow, active enhancer; green; active transcriptional elongation; purple, bivalent poised chromatin. Fig. 3F shows working model to explain ASD risk associated with SV homozygosity.

[0052] Figs. 4A, 4B,4C and 4D depict NHIP levels in brain are reduced in ASD and associated with expression of genes enriched for synaptic functions, response to oxidative stress, and ASD risk. Fig. 4A shows brain samples homozygous for the 22ql.33 insertion had significantly lower NHIP levels compared to those who were not (p value = 0.048). The association between NHIP levels and the insertion was observed specifically in ASD (p value = 0.036), not in I'D (p value = 0.711) (Mann-Whitney-Wilcoxon, brain, ASD n = 13, TD n = 10). Fig. 4B shows NHIP-associated differential expression analysis was performed from brain RNA-seq, adjusted for sex, age, brain region, and PMI, identifying 534 genome-wide significant genes (FDR-adjusted q-value < 0.05). Fig.4C shows Gene ontology (GO) enrichment analysis of the 851 NHIP-associated genes in brain identified significantly enriched terms (FDR- adjusted q-value < 0.05). Positively associated GO terms are shown in red and negatively associated GO terms are colored in blue. Fig. 4D shows Venn diagram representing the 30 genes in common between NHIP association in brain (adjusted), differential gene expression (DGE) in the NHIP overexpressed cell line, and SFARI ASD risk genes.

[0053] Fig. 5 depicts 22ql3.33 hypomethylated block location relative to PMDs, multi-ethnic SNP probes, and EPIC-array probe locations. UCSC genome browser (genome assembly: hg38) with the 22ql3.33 hypomethylated block (blue), the insertion location (orange), and NHIP (red). 12 DMRs located inside the 22ql3.33 hypomethylated block are shown in the DMR track. PMD locations are illustrated in the PMD track. SNP-array probe location was extracted from IlluminaAttorney Docket No, 11716-026WO1

[0054] Infinium multi-ethnic genotyping array. EPIC-array probe location was extracted from Illumina Infinium MethylationEPIC.

[0055] Fig. 6 depicts differentiated LUHMES cells are more sensitive to oxidative stress than undifferentiated LUHMES cells. Cell viabilities were detected by fluorescent intensity of CellTiter luminescent assay. The relative levels in treated cells were generated by comparing with the average of PBS-treated cells for both differentiated and undifferentiated experiments (Mann- Whitney -Wilcoxon, pvalue < 0.0001, differentiated LUHMES treated with 50nM H202 (hypoxia mimetic) n = 8, differentiated LUHMES treated with vehicle (mock) n = 8, effect size = -3.58).

[0056] Fig. 7 depicts NHIP transcript levels returning to baseline two days following removal of hypoxia mimetic. LUHMES cells were plated in differentiation media at Day 0. At Day 5, differentiated LUHMES cells were treated with CoC12. After 24 hours of CoC12 treatment (Day 6), LUHMES cells treated with CoC12 showed significantly increased NHIP transcript level compared with LUHMES cells with mock treatment (Mann- Whitney-Wilcoxon, p-value = 0.009, differentiated LUHMES treated with lOOnM CoC12 (hypoxia mimetic) n = 5, differentiated LUHMES treated with vehicle (mock) n = 4, effect size = 2.58). Cells were washed and replaced with media at Day 6 to allow LUHMES cells to recover. NHIP transcript level returned to mock control baseline levels after 48 hours of recovery at Day 8 (treatment p-value - 0.223). NHIP transcript level remained unchanged between Day 6 and Day 8 in the mock treatment cells (Mann-Whitney- Wilcoxon, pvalue = 0.2000), while differentiated LUHMES treated with CoC12 at Day 6 had a significantly higher level of NHIP compared with 48 hours after CoC12 removal on Day 8 (Mann-WhitneyWilcoxon, p-value = 0.009).

[0057] Fig. 8A, 8B, and 8C depict HEK293T cells were successfully transfected with overexpressed NHIP. Schematic diagram of vector used for HEK293T cell transfection. Fig. 8A shows plasmids with NHIP, pb-NHIP-eGFP. EF-la as promoter for NHIP and CMV as promoter for eGFP fused with puromycin resistant gene. Fig. 8B shows negative control plasmid without NHIP, pb-NEG-eGFP. Remove NHIP from pb-NHIP-eGFP and remove the rest of plasmid structure. Fig. 8C shows successful transfection image on HEK293T cells using EVOS microscopy.

[0058] Fig. 9 depicts HEK293T cells overexpressing NHIP exhibited a significantly altered cell cycle. Overexpression of NHIP in HEK293T cells resulted in a significantly shortened cell cycle doubling time (overexpression cells doubling time = 20.23 h, wild type cells doubling time = 24.91 h). Doubling times were calculated based on the 1 / slope of the regression between log (cells) and time.Attorney Docket No. 11716-026WO1

[0059] Fig. 10 depicts mass spectrometry of NHIP peptide and negative control.

[0060] Fig. 11 depicts percent methylation at eight DMRs was significantly associated with in cis SNPs. Percent methylation for each DMR was extracted from WGBS as average smooth methylation of the DMR region. WGS data was used to extract them in cis SNPs located within tire DMRs. Significance tests were done between the in cis SNPs and DMRs using linear regression, with pvalue < 0.05 shown (discovery group, ASD n = 41, TD n - 37).

[0061] Figs. 12A and 12B depict seperation between TD and ASD based on insertion genotype, methylation levels at 22ql.33 in offsprings homozygous for the insertion, whose mothers took a prenatal vitamin in month 1 of pregnancy. In oilier words, for individuals with the genetic risk of the insertion, taking prenatal vitamins at Pl significantly altered 22q 13.33 block methylation, in the protective direction (Mann-Whitney Wilcoxon, p-value = 0.046, ASD n = 3, TD n = 4, effect size = -2.09), a difference which was not significant in in those with the insertion whose mothers did not take a prenatal vitamin (p-value = 0.407).

[0062] Fig. 13 depicts genes significantly associated with NHIP levels that were enriched for neuronal functions. GO terms analysis was based on the genes showing significant NHIP association in brain after adjustment for potential covariates. The enrichment map organized significantly enriched terms into a network with edges connecting overlapping gene sets. Clustered gene sets were identified as functional modules with mutually overlapping genes.

[0063] Fig. 14 shows linkage and long-read sequencing evidence of polymorphisms in linkage with the NHIP insertion.

[0064] Fig. 15 shows Tsp45I restriction enzyme to identify NHIP insertion genotypes.

[0065] Fig. 16. shows a common polymorphism in the NHIP promoter is highly associated with NHIP transcript from an analysis of 2,865 human brain samples.

[0066] Fig. 17 shows a common SNP in the NHIP enhancer is associated with cortical thickness from two independent genome-wide association studies.

[0067] Fig. 18 shows NHIP modified sequences and structures. NHIP sequence with PEG was also tested in the ROS assay, where {PEG2} are two ethylene glycol units at the C terminal. This can increase the hydrophilicity of the peptide, which enhances the overall solubility as well as reduces the enzymatic degradation. NHIP Sequence: MVRGEATARTEEAMETVFIT (SEQ ID NO: 4). “Better NHIP” or “Enhanced NHIP” Sequence: MVRGEATARTEEAMEAVFTT (SEQ ID NO: 9).

[0068] Figs. 19A-19D show saliva DNA methylation analysis from CHARGE cohort using whole genome bisulfite sequencing. Fig. 19A shows saliva methylome distinguishes autism (ASD) fromAttorney Docket No. 11716-026WO1

[0069] control (Non-ASD). Fig. 19B shows SFARI autism genes identified from saliva. Figs. 19C and 19D show CACNA1A and NHIP loci.

[0070] Fig. 20 shows the NHIP gene with plot of WGBS block methylation.

[0071] Fig. 21 shows NHIP expression in adult human tissues from GTEX and their relevance to reproduction and nervous system.

[0072] Fig. 22 shows the structure of NHIP peptide and the interactions between MeCP2- TBL1XR1 at BDNF promoter.

[0073] Figs. 23A-23C show NHIP reduces reactive oxygen species (ROS) levels at a low effective dose in human cells. Fig. 23A shows NHIP peptide knockout normoxia. Fig. 23B shows synthetic NHIP peptide was added directly to cultures of human differentiated neurons prior to a 24 h hypoxia treatment, resulting in significant reductions in ROS levels at 10 pM-1 nM concentrations. Fig. 23C shows detection of intracellular uptake of NHIP-FITC by flow cytometry.

[0074] Figs. 24A-24E show NHIP peptide significantly reduces ROS in mouse neural precursor cells (NPC) in a MeCP2-dependent, modification-dependent, and dose-dependent manner. Fig.

[0075] 24A shows that NHIP peptide added directly to culture could reduce ROS levels in mouse embryonic neural precursor cells (NPC). Fig. 24B shows that 1 nM concentration of NHIP significantly reduced ROS in wild-type (WT), but not MeCP2 deficient NPCs with no significant effect on cell viability. Fig. 24C shows WT mouse NPC dosage experiment with NHIP peptide tagged with fluorescent FAM or unlabeled showed that while both peptides reduced ROS at concentrations >10 nM, the unlabeled peptide was effective at 1 pM. Fig. 24D shows alphaFold3 prediction of interaction between MeCP2, TBL1XR1, and NHIP. Fig. 24E shows model of potential NHIP and MeCP2 interaction and how that affects the interaction of MeCP2 with other proteins such as TBL1XR1.

[0076] Fig. 25 shows that NHIP is significantly hypomethylated in cumulus, oocyte, and embryo in a preconception stress model in rhesus macaque. Females were subject to relocation stress for 3 months prior to oocyte and cumulus collection. Whole methylomes were performed by bulk WGBS for cumulus and single cell (snmCseq) for pools of 3-5 oocytes and single embryos. Each dot represents a single CpG. A Gaussian filter was used to smooth the average methylation levels of each group (red, stressed; blue, control), compared by one-sample t-test, adjusted p values shown.

[0077] Fig. 26 shows the effects of NHIP peptides during bovine IVC on embryo cleavage, blastocyst, and hatching rates.Attorney Docket No, 11716-026WO1

[0078] Figs. 27 A and 27B show Effect of NHIP on hypoxia-induced oxidative stress. Fig. 27 A shows ROS levels in differentiated LUHMES with varying concentrations of exogenous NHIP peptide added, under normoxia or hypoxia (1% 02). Fig. 27B shows CellTiter viability measurements of the differentiated LUHMES in (Fig. 27 A).

[0079] Fig. 28 shows the identification of NHIP-binding proteins using affinity purification mass spectrometry. STRING network of proteins enriched for NHIP-binding in both human and mouse brain extracts. Specific pathways are highlighted in different colors and MeCP2 is highlighted in a red box.

[0080] Fig. 29 shows NHIP genotyping of 2 human embryo TE cells using Taqman SNP assay for insertion risk allele.

[0081] DETAILED DESCRIPTION

[0082] Disclosed herein are methods for detecting and treating hypoxia-related brain disorders. Those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a pail of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.

[0083] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

[0084] Terminology

[0085] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of’ can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in thisAttorney Docket No. 11716-026WO1

[0086] disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise.

[0087] The following definitions are provided for the full understanding of terms used in this specification.

[0088] The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another non-limiting embodiment, the terms are defined to be within 1 %.

[0089] As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

[0090] “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable carrier, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable carrier, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0091] The term “comprising”, and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed.

[0092] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus,Attorney Docket No. 11716-026WO1

[0093] the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100%, or more increase so long as the increase is statistically significant.

[0094] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.

[0095] By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic. It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to.

[0096] By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.

[0097] The term “subject” refers to any individual who is the target of administration or treatment. 'The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient.

[0098] The term “patient” refers to a subject under the treatment of a clinician, e.g., physician. The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directedAttorney Docket No, 11716-026WO1

[0099] toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0100] As used herein, NHIP peptide refers to a synthetic peptide comprising approximately twenty amino acids and configured to promote or enhance embryo development during in vitro culture.

[0101] As used herein, “in vitro culture (IVC)” refers to a process in which embryos are maintained and developed outside a living organism in a controlled laboratory environment using a defined culture medium.

[0102] “Bovine”, as used herein refers to cattle, including embryos derived from cattle.

[0103] As used herein, peptide modification refers to any chemical, structural, or sequence alteration made to a peptide to change its stability, biological activity, detectability, or cellular uptake relative to the unmodified peptide. “PEG or PEGylation” refers to the covalent attachment of polyethylene glycol to a peptide, wherein the polyethylene glycol increases resistance to degradation and extends the functional lifetime of the peptide in a biological environment. “ Biotin or bio,” refers to a detectable chemical moiety covalently attached to a peptide, enabling measurement or capture of the peptide using biotin binding assays. “NHIP PEG bio”, as used herein refers to an NHIP peptide comprising both a polyethylene glycol modification and a biotin moiety. As used herein, negative control refers to a peptide composition designed to lack the biological activity of NHIP and used to confirm that observed effects are attributable to NHIP specific activity. “FLAG peptide” refers to a short peptide sequence that does not possess NHIP activity and is substituted for an active domain to serve as a control peptide.

[0104] As used herein, “9aaTAD” refers to a nine amino acid transcription activation domain sequence associated with biological activity relevant to NHIP function.

[0105] As used herein, “NHIP enhanced (enh)” refers to an NHIP peptide comprising a sequence alteration relative to wild type NHIP, wherein the alteration improves alignment with a consensus 9aaTAD sequence. NHIP without modifications refers to an NHIP peptide lacking polyethylene glycol, biotin, or other chemical modifications. “NHIP WT” refers to a wild type NHIP peptide having a native amino acid sequence without sequence substitutions or chemical modifications.Attorney Docket No. 11716-026WO1

[0106] As used herein, “morpho kinetic assessment” refers to the evaluation of embryo development by monitoring morphological changes and division timing over defined culture periods.

[0107] As used herein, “cleavage rate” refers to the proportion of embryos that undergo at least one successful cell division within a specified time period.

[0108] As used herein, “blastocyst rate” refers to the proportion of embryos that develop to the blastocyst stage during in vitro culture.

[0109] As used herein, “hatching rate” refers to the proportion of blastocysts that emerge from the zona pellucida during later stages of development.

[0110] Spent media refers to culture media collected after incubation with embryos and containing residual peptide and embryo secreted components.

[0111] Analyses of bovine embryos as illustrated in Fig. 26 and associated cost savings estimates, a performance threshold of greater than five percent improvement is commercially and clinically meaningful. A five percent increase in frozen embryo transfer success rate reduces the average number of transfer cycles required to achieve pregnancy in women under thirty five years of age from approximately 1.82 to 1.67, yielding an estimated savings of approximately seven hundred fifty dollars per patient pregnancy. Fewer treatment cycles further shorten the time to successful pregnancy and reduce patient stress, burden, and inconvenience. At the clinic level, this improvement corresponds to an estimated annual cost savings of approximately twenty two thousand five hundred dollars per one hundred patients and provides a competitive advantage through improved reported success rates. Accordingly, an improvement of at least five percent in frozen embryo transfer rate or live birth rate represents a financially attractive outcome for investors, fertility clinic operators, and patients pursuing in vitro fertilization treatment.

[0112] In one aspect, disclosed herein NHIP supplementation produces a statistically significant improvement greater than five percent in one or more clinically relevant in vitro fertilization outcomes in bovine embryos, including embryo cleavage rate, blastocyst rate, hatching rate, or embryo competency index, relative to control. In another aspect, NHIP supplementation produces a statistically significant improvement greater than five percent in one or more clinically relevant outcomes in murine models, including embryo score, birth rate, or SHIRPA score, relative to control. In another aspect, NHIP supplementation of thawing solutions produces a statistically significant improvement greater than 5% in bovine sperm viability relative to untreated control; or sequential NHIP supplementation of sperm thawing media, in vitro fertilization culture, and inAttorney Docket No, 11716-026WO1

[0113] vitro culture produces a statistically significant improvement greater than 5% in bovine embryo cleavage rate relative to untreated control.

[0114] “Correlated regions of systemic interindividual variation (CoRSIVs)” are discrete genomic loci characterized by interindividual differences in DNA methylation that are consistent across diverse somatic tissues within the same individual. These regions were identified through unbiased whole-genome bisulfite sequencing across multiple tissues and defined by high concordance of methylation profiles across germ layer lineages despite substantial variability between unrelated individuals. CoRSIVs occupy approximately 0.1 % of the human genome and represent loci where systemic epigenetic variation is detectable in any accessible tissue, allowing inference of epigenetic states in otherwise inaccessible organs. These regions show long-range inter-CpG correlation, are enriched for transposable elements and subtelomeric sequences, and are associated with genes implicated in a broad spectrum of human phenotypes. Importantly, the establishment of methylation at CoRSIVs occurs during early embryogenesis and is sensitive to periconceptional environmental influences, reflecting gene-environment interplay that may contribute to developmental outcomes. CoRSIV methylation in one tissue can predict gene expression in other tissues, underscoring their systemic regulatory relevance. CoRSIVs are under strong genetic control and host an abundance of methylation quantitative trait loci (mQ'I'L), further linking genetic variation to epigenetic regulation and disease risk.

[0115] “Structural variants (SVs)” constitute a class of genomic polymorphisms defined by rearrangements of DNA segments typically greater than 50 base pairs in length. SVs include deletions, duplications, insertions, inversions, and translocations, as well as complex combinations of these events, and are a major source of genetic diversity and genomic instability in human populations. SV formation mechanisms include non-allelic homologous recombination, replication errors, and activity of mobile genetic elements. The distribution of SVs across the human genome is nonrandom; many SVs cluster in hotspots, often located in regions of low gene density. Despite their localization, subsets of SVs intersect with genes and regulatory elements involved in critical biological processes, including oxygen transport, sensory perception, synapse assembly, and antigen binding, suggesting selective constraints and functional relevance at these loci. SVs have been implicated in a wide range of human phenotypes and disorders, with particular significance in neurodevelopmental conditions. In autism spectrum disorder (ASD), both inherited and de novo SVs, including copy number variants and mobile element insertions, are associated with risk and contribute to disruption of genes expressed in the developing brain. Elevated structural variant burden has been linked with reduced cognitive ability and increased ASDAttorney Docket No. 11716-026WO1

[0116] susceptibility, highlighting the need to integrate SV detection into genomic studies of complex traits.

[0117] As used herein, the term CpG site refers to a cytosine followed by a guanine in the 5’ to 3’ direction linked by a phosphate, which is a primary genomic context for cytosine methylation measurement and analysis in mammalian DNA methylation studies.

[0118] As used herein, the term promoter refers to a regulatory DNA region, typically proximal to a transcription start site, that contributes to initiation and control of transcription through binding of transcription factors and associated regulatory proteins, and that may exhibit functionally relevant DNA methylation variation.

[0119] As used herein, the term whole genome bisulfite sequencing or WGBS refers to a genome scale DNA methylation measurement method in which bisulfite conversion is used to distinguish methylated from unmethylated cytosines, followed by high throughput sequencing to quantify methylation across a substantial portion of cytosines genome wide.

[0120] As used herein, the term differentially methylated position or DM13refers to an individual CpG dinucleotide exhibiting a statistically supported methylation difference between comparison groups or across a modeled variable.

[0121] As used herein, the term differentially methylated region or DMR refers to a genomic interval comprising multiple CpG sites that, considered together, shows a statistically supported difference in methylation between comparison groups or across a modeled variable.

[0122] As used herein, the term genotype refers to an individual’s allelic composition at one or more genomic loci, including single nucleotide polymorphisms or other variants, that can be measured and used for association testing or stratified analyses.

[0123] As used herein, the term epigenotype refers to a measurable epigenetic state of a locus or set of loci, including DNA methylation patterns or other chromatin associated features, that may vary between individuals, tissues, or conditions and may associate with phenotype.

[0124] As used herein, the term assisted reproductive technologies or ART refers to fertility treatments in which oocytes and or embryos are handled outside the body to facilitate conception, including in vitro fertilization and related laboratory procedures.

[0125] As used herein, the term in vitro fertilization or IVF refers to a procedure in which oocytes are fertilized with sperm outside the body under laboratory conditions, followed by transfer of an embryo to a uterus for potential establishment of pregnancy.Attorney Docket No, 11716-026WO1

[0126] As used herein, the term intracytoplasmic sperm injection or ICSI refers to an assisted fertilization technique in which a single sperm is injected directly into the ooplasm of an oocyte to facilitate fertilization, including in settings of severe male factor infertility.

[0127] As used herein, the term oxidative stress refers to a state in which oxidant production exceeds antioxidant defenses, disrupting redox signaling and control and or causing molecular damage.

[0128] As used herein, the term reactive oxygen species or ROS refers to a collective class of oxygen derived oxidants with diverse chemical properties and biological roles, ranging from regulated signaling to damage of lipids, proteins, and nucleic acids when present in excess.

[0129] As used herein, the term redox homeostasis refers to dynamic cellular processes that maintain balance between oxidizing and reducing reactions, thereby controlling redox dependent signaling and limiting inappropriate oxidative injury.

[0130] As used herein, the term methyl CpG binding protein 2 or MeCP2 refers to a chromatin associated protein that binds methylated DNA and can modulate transcriptional regulation through interactions with DNA and other chromatin components, including roles relevant to neuronal gene regulation and stress responsive pathways.

[0131] As used herein, the term brain derived neuro trophic factor or BDNF refers to a neurotrophin whose expression can be regulated by neuronal activity and physiological stressors, and for which MeCP2 has been shown to be required for BDNF upregulation in response to acute intermittent hypoxia in vivo.

[0132] As used herein, the term 9aaTAD refers to a nine amino acid transactivation domain motif found in diverse transcriptional activators and capable of supporting transcriptional activation functions as a compact peptide sequence recognized by transcriptional machinery.

[0133] As used herein, the term AlphaFold2 refers to a machine learning based method for protein structure prediction that can, in many cases, predict three dimensional protein structures at high accuracy from amino acid sequence information.

[0134] As used herein, the term “cord blood” refers to blood collected from the umbilical cord at birth and used as a neonatal biospecimen for molecular assays, including epigenome wide DNA methylation profiling.

[0135] As used herein, the term placenta refers to a fetal derived organ that supports pregnancy and that can be sampled for molecular analyses, including DNA methylation studies investigating associations with later neurodevelopmental outcomes.Attorney Docket No, 11716-026WO1

[0136] As used herein, the term newborn blood spot refers to a dried blood specimen collected shortly after birth and stored on filter paper, which may be used for retrospective molecular profiling in some study designs.

[0137] As used herein, the term machine learning refers to computational methods that learn patterns from data to produce predictive models or classifications, including selection of feature panels for improved prediction performance.

[0138] As used herein, the term embryo cleavage rate refers to the proportion of embryos that undergo early mitotic divisions within a defined time frame following fertilization. In the current invention, increased cleavage rate serves as an early functional readout of NHIP peptide efficacy in reducing oxidative stress and improving embryonic metabolic health during in vitro culture.

[0139] As used herein, the term blastocyst refers to a preimplantation stage embryo characterized by formation of a fluid filled cavity and lineage segregation. In the current invention, blastocyst formation, quality, and hatching rates are used as downstream measures of NHIP mediated improvements in embryo viability and developmental competence.

[0140] As used herein, the term trophectoderm refers to the outer cell layer of the blastocyst that contributes to placental tissues. In the current invention, trophectoderm cell number and quality are evaluated as part of embryo scoring metrics to determine whether NHIP supplementation improves implantation relevant properties.

[0141] As used herein, the term inner cell mass refers to the internal population of blastocyst cells that gives rise to the embryo proper. In the current invention, preservation of inner cell mass integrity relative to trophectoderm supports assessment of whether NHIP improves overall embryo quality without compromising lineage allocation.

[0142] As used herein, the term trophectoderm to inner cell mass ratio refers to a morphological indicator reflecting relative allocation of blastocyst cell lineages. In the current invention, this ratio is used as a quantitative endpoint to assess whether NHIP treatment enhances embryo competency in a manner consistent with improved implantation potential.

[0143] As used herein, the term zygotic genome activation refers to the developmental transition at which transcription from the embryonic genome becomes predominant. In the current invention, timing of zygotic genome activation in bovine and human relevant models provides a window during which NHIP mediated epigenetic modulation may influence downstream developmental trajectories.

[0144] As used herein, tire term vitrification refers to an ultrarapid cryopreservation process that prevents ice crystal formation during embryo freezing. In the current invention, NHIPAttorney Docket No, 11716-026WO1

[0145] supplementation during vitrification and drawing is evaluated for its ability to reduce oxidative stress induced damage and improve post thaw embryo survival and re expansion.

[0146] As used herein, the term post thaw re expansion refers to recovery of blastocyst cavity expansion following cryopreservation and warming. In the current invention, improved re expansion rates in the presence of NHIP peptide serve as functional evidence of enhanced cellular resilience to oxidative stress during freeze thaw procedures.

[0147] As used herein, the term mouse embryo assay refers to a standardized in vitro test used to evaluate embryotoxicity of materials used in IVF. In the current invention, the mouse embryo assay is employed to establish safety margins for NIIIP peptide supplementation across a wide dose range.

[0148] As used herein, the term computer assisted sperm analysis refers to automated systems that quantify sperm motility and morphology parameters. In the current invention, such analysis is used to evaluate whether NIIIP supplementation during semen thawing reduces oxidative stress and improves sperm functional parameters relevant to fertilization.

[0149] As used herein, the term “embryo competency index” refers to a composite molecular score derived from expression levels of defined transcripts predictive of embryo developmental success. In the current invention, NHIP induced changes in embryo competency index genes provide mechanistic evidence that NHIP improves embryo metabolic and epigenetic fitness.

[0150] As used herein, the term expression quantitative trait locus refers to a genetic variant associated with variation in gene expression. In the current invention, NHIP eQTLs are used to link genetic variation to differential NHIP expression, oxidative stress susceptibility, autism risk, and differential responsiveness to NHIP supplementation.

[0151] As used herein, the term hypoxia refers to reduced oxygen availability relative to cellular demand. In the current invention, NHIP is transiently induced under hypoxic conditions and functions to protect cells from hypoxia associated oxidative stress, directly linking this term to the biological mechanism of the invention.

[0152] used herein, the term micro peptide refers to a short peptide, typically fewer than 50 amino acids in length, that is translated from a previously uncharacterized or minimally annotated transcript and can exert biologically significant regulatory functions. In the current invention, NHIP encodes a 20 amino acid micro peptide that directly modulates epigenetic regulatory complexes involved in redox balance and cellular stress responses.

[0153] As used herein, the term epigenetic regulation refers to heritable or stable changes in gene activity that do not involve alterations in DNA sequence, including DNA methylation andAttorney Docket No. 11716-026WO1

[0154] chromatin associated mechanisms. In the current invention, epigenetic regulation of the NHIP locus underlies tissue specific expression, sex differences, and susceptibility to oxidative stress related phenotypes relevant to neurodevelopment and fertility.

[0155] As used herein, the term correlated regions of systemic interindividual variation or CoRSIV refers to genomic regions exhibiting DNA methylation patterns that are correlated across multiple tissues within an individual. In the current invention, NHIP resides within a CoRSIV, enabling saliva and blood based methylation measurements to reflect systemic and placental epigenetic states relevant to autism risk and embryo health.

[0156] As used herein, the term genome wide refers to analyses that assess molecular features across a substantial portion of the genome rather than at a single locus. In the current invention, genome wide approaches are used to identify NHIP associated methylation blocks, transcriptional networks, and interacting pathways involved in oxidative stress and neurodevelopment.

[0157] As used herein, the term hypomethylation refers to a relative decrease in DNA methylation at a CpG site or genomic region. In the current invention, hypomethylation across the NHIP locus is associated with altered expression, autism related phenotypes, and sensitivity to oxidative stress during early development.

[0158] As used herein, the term hypermethylation refers to a relative increase in DNA methylation at a CpG site or genomic region. In the current invention, sex specific hypermethylation patterns at the NHIP promoter contribute to differential expression and may modify responsiveness to NHIP supplementation.

[0159] As used herein, the term gene desert refers to a genomic region with a low density of protein coding genes. In the current invention, NHIP is located within a gene desert, highlighting the importance of epigenomic and regulatory analyses for identifying functional elements in poorly annotated regions.

[0160] As used herein, the term linkage disequilibrium refers to nonrandom association of alleles at different loci within a population. In the current invention, NHIP associated single nucleotide polymorphisms in linkage disequilibrium are used to infer regulatory variation influencing NHIP expression and disease risk.

[0161] As used herein, the term insertion polymorphism refers to a structural genetic variant in which a DNA fragment is present or absent at a specific genomic location. In the current invention, a polymorphic insertion linked to NHIP expression is associated with altered autism risk and differential epigenetic regulation.Attorney Docket No. 11716-026WO1

[0162] As used herein, the term transcriptional network refers to a group of genes whose expression levels are coordinately regulated through shared regulatory mechanisms. In the current invention, NHIP overexpression alters transcriptional networks enriched for oxidative stress response, synaptic regulation, and embryo competency pathways.

[0163] As used herein, the term protein interaction refers to a physical association between two or more proteins that enables functional regulation. In the current invention, NHIP directly interacts with epigenetic regulators including MeCP2, thereby modulating transcriptional responses to redox imbalance.

[0164] As used herein, the term competitive inhibition refers to a mechanism in which one molecule reduces the activity of another by competing for the same binding interface. In the current invention, NHIP functions as a competitive inhibitor of MeCP2 interaction with transcriptional corepressors, resulting in adaptive gene expression under oxidative stress conditions.

[0165] As used herein, the term cellular uptake refers to the internalization of molecules from the extracellular environment into cells. In the current invention, demonstrated cellular uptake of NHIP peptide supports its direct intracellular activity when added to embryo culture or cell culture media.

[0166] As used herein, the term redox balance refers to maintenance of appropriate levels of oxidized and reduced molecular species within cells. In the current invention, NHIP restores redox balance by reducing excessive reactive oxygen species and supporting metabolic adaptation in embryos and neurons.

[0167] As used herein, the term morphokinetics refers to the timing and dynamics of embryo developmental events observed during in vitro culture. In the current invention, improvements in morphokinetic parameters following NHIP treatment serve as functional indicators of enhanced embryo viability.

[0168] As used herein, the term embryo viability refers to the capacity of an embryo to continue development, implant, and result in a live birth. In the current invention, NHIP supplementation improves multiple indicators of embryo viability, including cleavage rate, blastocyst formation, and post thaw recovery.

[0169] As used herein, the term preimplantation embryo refers to an embryo prior to implantation into the uterine wall. In the current invention, NHIP is applied during preimplan ration stages to mitigate oxidative stress introduced by artificial culture environments.Attorney Docket No, 11716-026WO1

[0170] As used herein, the term freeze thaw injury refers to cellular damage caused by cryopreservation and warming processes. In the current invention, NHIP reduces freeze thaw injury by enhancing cellular stress resilience during vitrification and thawing.

[0171] As used herein, the term sex specific expression refers to differences in gene expression levels between males and females. In the current invention, sex specific NHIP expression and methylation patterns inform stratified analyses of autism risk and differential efficacy of NHIP supplementation.

[0172] As used herein, the term “hypoxic insult” refers to an event, condition, or exposure that causes a reduction in oxygen availability to brain tissue or causes a reduction in cerebral oxygen delivery, optionally by decreasing blood flow, impairing oxygen transport, or impairing pulmonary oxygenation, and that is sufficient to initiate, exacerbate, or be associated with a hypoxia related brain disorder or a hypoxia associated brain injury phenotype. Non limiting examples of a hypoxic insult include neonatal hypoxia and perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation due to uteroplacental insufficiency or placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia or eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia due to pneumonia, asthma exacerbation, acute respiratory distress, or high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension or shock due to sepsis, hemorrhage, or trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, and intermittent hypoxia associated with sleep disordered breathing. In some embodiments, as used herein the hypoxic insult comprises neonatal hypoxia, stroke, cardiac arrest, or smoke inhalation. In other aspects, as used herein the hypoxia-related brain disorder is caused by a hypoxic insult (including but not limited to neonatal hypoxia, stroke, cardiac arrest, smoke inhalation, pulmonary distress, hypoxia during gestation, hypoxia during childbirth, uteroplacental insufficiency, placental insufficiency, preeclampsia, eclampsia, umbilical cord compression, or umbilical cord prolapse). In some aspects, hypoxic insult comprises neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture,Attorney Docket No, 11716-026WO1

[0173] preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrliage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, or intermittent hypoxia associated with sleep disordered breathing.

[0174] Components to determine a predisposition to hypoxia- related disorders

[0175] A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5-carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of nucleotides are adenine (A), cytosine (C), guanine (G), and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule. As used herein, a “trinucleotide repeat” refers to a repetitive sequence of three base pair motifs in a DNA sequence. For example, the DNA sequence “GAA(n)” contains a repetitive sequence of GAA nucleotides, wherein n = any number. The trinucleotide repeat can be located in a coding or non-coding region of a genome.

[0176] A “nucleic acid” is a chemical compound that serves as the primary information-carrying molecules in cells and makes up the cellular genetic material. Nucleic acids are nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). A chimeric nucleic acid comprises two or more of the same kind of nucleic acid fused together to form one compound comprising genetic material.

[0177] The terms “percent identity” and “% identity,” as applied to nucleotide sequences, refer to the percentage of residue matches between at least two nucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U. S. Pat. No.

[0178] 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly usedAttorney Docket No, 11716-026WO1

[0179] and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. el al. (1990) J. Mol. Biol. 215:403 410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known nucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed above).

[0180] Percent identity may be measured over the length of an entire defined nucleotide sequence or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length may be used to describe a length over which percen tage iden ti ty may be measured.

[0181] As used herein, the term "polymerase chain reaction" (" PCR”) refers to a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence typically consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured, and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times to obtain a high concentration of an amplified segment of the desired target sequence. Unless otherwise noted, PCR, as used herein, also includes variants of PCR such as allele-specific PCR, asymmetric PCR, hot-start PCR, ligation-mediated PCR, multiplex-PCR, reverse transcription PCR, or any of the other PCR variants known to those skilled in the art.

[0182] A "primer" is a short polynucleotide, generally with a free 3’-OH group that binds to a target or "template" potentially present in a sample of interest by hybridizing with the target, and thereafter promoting polymerization of a polynucleotide complementary to the target. A "polymerase chain reaction" (" PCR") is a reaction in which replicate copies are made of a targetAttorney Docket No. 11716-026WO1

[0183] polynucleotide using a "pair of primers" or a "set of primers" consisting of an "upstream" and a "downstream" primer, and a catalyst of polymerization, such as a DNA polymerase, and typically a thermally stable polymerase enzyme. Methods for PCR are well known in the art, and taught, for example in " PCR: A PRACTICAL APPROACH" (M. MacPherson et al., IRL Press at Oxford University Press (1991)). All processes of producing replicate copies of a polynucleotide, such as PCR or gene cloning, are collectively referred to herein as "replication." A primer can also be used as a probe in hybridization reactions, such as Southern or Northern blot analyses. Sambrook et al., supra.

[0184] A “polymorphism” is a variation in a gene sequence. The polymorphisms can be those variations (DNA sequence differences, e.g., substitutions, deletions, or insertions) which are generally found between individuals or different ethnic groups and geographic locations which, while having a different sequence, produce functionally equivalent gene products. Typically, the term can also refer to variants in the sequence which can lead to gene products that are not functionally equivalent. Polymorphisms also encompass variations which can be classified as alleles and / or mutations which can produce gene products which may have an altered function. Polymorphisms also encompass variations which can be classified as alleles and / or mutations which either produce no gene product or an inactive gene product or an active gene product produced at an abnormal rate or in an inappropriate tissue or in response to an inappropriate stimulus. Alleles are the alternate forms that occur at the polymorphism.

[0185] Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule or protein that is linked to the variation.

[0186] “Transformation” describes a process by which exogenous DNA is introduced into a recipient cell. Transformation may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method for transformation is selected based on the type of host cell being transformed and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle bombardment. The term “transformed cells” includes stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the inserted DNA or RNA for limited periods of time.Attorney Docket No, 11716-026WO1

[0187] The term "‘methylation” refers to the chemical modification to a molecule by adding a methyl group on a DNA, RNA, or protein molecule. This modification is usually performed by enzymes to regulate gene expression, protein function, and RNA processing.

[0188] In some aspects, used herein, a polypeptide and / or protein is defined as a polymer of amino acids, typically of lengths 100 amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). A peptide is defined as a short polymer of amino acids, of a length typically of 20 or less amino acids, and more typically of a length of 12 or less amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110).

[0189] The term “amino acid,” includes but is not limited to amino acids contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (He or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gin or Q), arginine (Arg or R), serine (Ser or S), threonine (Tim or T), valine (Vai or V), tryptophan (Trp or W), and tyrosine (Tyr or Y) residues. The term “amino acid residue” also may include amino acid residues contained in the group consisting of homocysteine, 2- Aminoadipic acid, N-Ethylasparagine, 3-Aminoadipic acid, Hydroxylysine, P-alanine, P-Amino-propionic acid, allo-Hydroxylysine acid, 2-Aminobutyric acid, 3 -Hydroxyproline, 4- Aminobutyric acid, 4-Hydroxyproline, piperidinic acid, 6-Aminocaproic acid, Isodesmosine, 2-Aminoheptanoic acid, allo-Isoleucine, 2-Aminoisobutyric acid, N-Methylglycine, sarcosine, 3-Aminoisobutyric acid, N-Methylisoleucine, 2-Aminopimelic acid, 6-N-Methyllysine, 2,4- Diamino butyric acid, N-Methylvaline, Desmosine, Norvaline, 2,2'-Diaminopimelic acid, Norleucine, 2,3-Diaminopropionic acid, Ornithine, and N-Ethylglycine. Typically, the amide linkages of the peptides are formed from an amino group of the backbone of one amino acid and a carboxyl group of the backbone of another amino acid.

[0190] As disclosed herein, exemplary peptides, polypeptides, proteins may comprise, consist essentially of, or consist of any reference amino acid sequence disclosed herein, or variants of the peptides, polypeptides, and proteins may comprise, consist essentially of, or consist of an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any amino acid sequence disclosed herein. Variant peptides, polypeptides, and proteins may include peptides, polypeptides, proteins having one or more amino acid substitutions, deletions, additions and / or amino acid insertions relative to a reference peptide, polypeptide, or protein. Also disclosed are nucleic acid molecules that encode the disclosed peptides, polypeptides, and proteinsAttorney Docket No. 11716-026WO1

[0191] (e.g., polynucleotides that encode any of the peptides, polypeptides, and proteins disclosed herein and variants thereof).

[0192] The peptides, polypeptides, and proteins disclosed herein may be modified to include nonamino acid moieties. Modifications may include but are not limited to carboxylation (e.g., N- terminal carboxylation via addition of a di-carboxylic acid having 4-7 straight-chain or branched carbon atoms, such as glutaric acid, succinic acid, adipic acid, and 4,4-dimethylglutaric acid), amidation (e.g., C-terminal amidation via addition of an amide or substituted amide such as alkylamide or dialkylamide), PEGylation (e.g., N-terminal or C-terminal PEGylation via additional of polyethylene glycol), acylation (e.g., O-acylation (esters), N-acylation (amides), S-acylation (thioesters)), acetylation (e.g., the addition of an acetyl group, either at the N-terminus of the protein or at lysine residues), formylation lipoylation (e.g., attachment of a lipoate, a C8 functional group), myristoylation (e.g., attachment of myristate, a C14 saturated acid), palmitoylation (e.g., attachment of palmitate, a C16 saturated acid), alkylation (e.g., the addition of an alkyl group, such as an methyl at a lysine or arginine residue), isoprenylation or prenylation (e.g., the addition of an isoprenoid group such as farnesol or geranyl geraniol), amidation at C- terminus, glycosylation (e.g., the addition of a glycosyl group to either asparagine, hydroxylysine, serine, or threonine, resulting in a glycoprotein). Distinct from glycation, which is regarded as a nonenzymatic attachment of sugars, polysialylation (e.g., the addition of polysialic acid), glypiation (e.g., glycosylphosphatidylinositol (GPI) anchor formation, hydroxylation, iodination (e.g., of thyroid hormones), and phosphorylation (e.g., the addition of a phosphate group, usually to serine, tyrosine, threonine or histidine).

[0193] Variants comprising deletions relative to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion” refers to a change in the amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., an N-terminal truncation or a C-terminal truncation or both of a reference polypeptide or a 5 '-terminal or 3'-terminal truncation or both of a reference polynucleotide).

[0194] Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguousAttorney Docket No, 11716-026WO1

[0195] nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 2.0, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N-terminal region and / or the C -terminal region of a polypeptide or the 5 '-terminal region and / or the 3' terminal region of a polynucleotide. The term “at least a fragment” encompasses the full-length polynucleotide or full length polypeptide.

[0196] The term "antibody" is used in the broadest sense, and specifically covers monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies). Antibodies (Abs) and immunoglobulins (Igs) are glycoproteins that have the same structural characteristics. Wliile antibodies exhibit binding specificity to a specific target, immunoglobulins include both antibodies and other antibody-like molecules which lack target specificity. Native antibodies and immunoglobulins are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains. Each light chain has a variable domain at one end (VL) and a constant domain at the other end.

[0197] The term "antibody fragment" refers to a portion of a full-length antibody, generally the target binding or variable region. Examples of antibody fragments include Fab, Fab’, F(ab')2 and Fv fragments. The phrase "functional fragment or analog" of an antibody is a compound having qualitative biological activity in common with a full-length antibody. For example, a functional fragment or analog of an anti-IgE antibody is one which can bind to an IgE immunoglobulin in such a manner so as to prevent or substantially reduce the ability of such molecule from having the ability to bind to the high affinity receptor, FCERI. AS used herein, "functional fragments" with respect to antibodies, refers to Fv, F(ab) and F(ab’)2 fragments. An " Fv" fragment is the minimum antibody fragment which contains a complete target recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in a tight, non-covalent association (VH-VL dimer). It is in this configuration that the three CDRs of each variable domain interact to define a target binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer target binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for a target) has the ability to recognize and bind target, although at a lower affinity than the entire binding site. " Single-chain Fv" or "sFv"Attorney Docket No. 11716-026WO1

[0198] antibody fragments comprise the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Generally, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for target binding.

[0199] The term “monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules.

[0200] “Substantially isolated or purified” nucleic acid or amino acid sequences are contemplated herein. The term “substantially isolated or purified” refers to nucleic acid or amino acid sequences that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.

[0201] In some embodiments and claims, “multiplex assay” refers to a laboratory technique that allows the simultaneous detection and measurement of multiple analytes (such as proteins, nucleic acids, or other molecules) in a single experimental run. This simultaneous analysis of multiple targets provides several advantages over traditional singleplex assays, including increased efficiency, reduced sample consumption, and the ability to gain comprehensive information from a single sample.

[0202] Compositions

[0203] The United States faces emerging crises of decreased birthrates, increased rates of infertility, and increased rates of neurodevelopmental disorders. These overlapping changes are attributed to a complex mixture of changing lifestyle and environmental factors interacting with genetic predisposition. The use of assisted reproductive technologies (ART) as a treatment for infertility continues to increase rapidly, particularly in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI). In 2023, the number of infants born through IVF increases from 91,771 in 2022 to 95,860, accounting for 2.6% of births in the United States. However, implantation success rates do not improve, resulting in unmet clinical needs within fertility clinics for precision technologies that improve preimplantation embryo health.

[0204] Oxidative stress is defined as an imbalance between reactive oxidants and endogenous antioxidant responses and is implicated in multiple human diseases, including infertility, hypoxia- related brain disorders, and aging. The IVF process introduces additional oxidative stressorsAttorney Docket No, 11716-026WO1

[0205] beyond preexisting burdens in oocytes and sperm, including exposure to atmospheric oxygen levels during laboratory manipulations, exposure to plasticizing chemicals from laboratory ware, and freeze thaw procedures. Although the addition of antioxidants to culture media and reduction of incubator 02 levels provide incremental improvements, oxidative stress remains the most significant problem to be addressed with new technologies in the IVF field. Poor embryonic metabolic health leads to reduced implantation and repeated treatment cycles. A reduction of as little as 5% in reactive oxygen species (ROS) exposure during embryo culture produces significant improvements in embryo health and reduces the average cost of IVF per successful pregnancy.

[0206] The current invention provides a precision solution through a novel peptide designated neuronal hypoxia inducible placenta associated (NHIP). Using placental samples obtained from a prospective high risk autism cohort, NHIP demonstrates epigenetic, genetic, and transcriptional associations with autism. NHIP is encoded by a primate specific gene that is transiently expressed in response to hypoxia and neuronal differentiation, both of which are conditions associated with elevated oxidative stress. NHIP transcript levels are highest in male and female reproductive tracts, including the fallopian tube and uterus, which are sites of embryo maturation and implantation. NHIP overexpression results in altered expression of genes that regulate cellular responses to oxidative stress and development.

[0207] NHIP encodes a 20 aa peptide that folds into an alpha helical structure with an acidic stripe that mimics a conserved transactivation 9aaTAD domain present in transcription factors. The epigenetic regulator MeCP2 functions as a molecular target of NHIP activity and is involved in cellular adaptation to hypoxia and oxidative stress. When NHIP peptide is added directly to cell culture media at pM concentrations, ROS levels are reduced and cell viability is improved in human and murine embryonic stem cells and neurons. In pilot bovine IVF cultures, NHIP peptide supplementation significantly increases the rate of Day 2 embryo cleavage.

[0208] The current invention evaluates NHIP as a product to improve IVF embryo competency through improved redox balance in 3 mammals. NHIP is applied to murine embryos, bovine embryos, and short term culture of surplus human fertility clinic embryos obtained with informed consent for research.

[0209] Artificial reproductive technologies (ART) include fertility treatments in which oocytes or embryos are handled in a laboratory environment, including in vitro fertilization (IVF), which accounts for more than 99% of ART procedures. Most IVF procedures, exceeding 75% since 2018, utilize intracytoplasmic sperm injection (ICSI). Incremental improvements in IVF approaches, including reduction of multiple gestations and use of reduced 02 incubators, as well as increasedAttorney Docket No, 11716-026WO1

[0210] accessibility through employer insurance coverage, increase the number of healthy infants born through IVF in recent years. However, persistently high failure rates in IVF and ICSI, approximately 50% for live birth, result in significant financial, physical, and emotional stress for infertile couples.

[0211] A major limitation of artificial manipulations and laboratory environments associated with IVF and ICSI is their collective contribution to oxidative stress, which produces a redox imbalance that compromises energy availability for developmental processes. Oxidative stress also contributes to IVF and ICSI failure through direct damage to oocyte, sperm, and embryo DNA. This nuclear damage leads to downstream cellular injury in embryos, resulting in fertilization failure, impaired embryo development, implantation failure, and the clinical requirement for multiple IVF cycles to achieve a successful pregnancy. Although IVF culture media are frequently supplemented with antioxidants, these compounds do not target intracellular mechanisms required for embryos to epigenetically adapt metabolic rates to artificial culture environments. Human serum albumin (HSA) is used to partially counteract oxidative stress in IVF; however, recombinant HSA is cost prohibitive and serum derived HSA presents unacceptable clinical risk.

[0212] The current invention provides a novel micro peptide as a cost effective culture media supplement that improves embryo viability and development by modulating epigenetic pathways that restore redox balance.

[0213] NHIP is a biological product that protects embryonic cells from hypoxia and oxidative stress by functioning as a natural mimetic of epigenetic regulators that impact cellular metabolism.

[0214] NHIP is a previously uncharacterized gene that is highly expressed in female and male reproductive tissues and is epigenetically regulated. Prior to its identification and naming as NHIP, this locus corresponds to an uncharacterized transcript designated LOG 105373085 (ENSG00000286381) located within a highly polymorphic and poorly mapped dark region of the human genome. Recently released sequencing based expression data from 946 donors across 54 adult tissue types include expression of the transcript corresponding to NHIP (Fig. 21). NHIP exhibits highest expression in testes, cervix, fallopian tube, and uterus, as well as in brain, spinal cord, and peripheral nerve. In tissues represented by both sexes, NHIP expression levels are consistently higher in females than in males. These expression patterns are consistent with methylation micro array data covering the NHIP promoter region, which show significantly higher DNA methylation levels in males compared to females. Expression quantitative trait locus data further identify 3320 eQTLs for NHIP distributed across approximately 400 kb, despite the NHIP gene spanning only 5 kb within a large gene desert, with the strongest eQTLs localized to the NHIPAttorney Docket No, 11716-026WO1

[0215] promoter region. A CpG site designated cgl5192736 within the NHIP promoter CpG island is among the top 10 sites epigenetically associated with plasma metabolites of oxidative stress.

[0216] NHIP encodes a peptide that blocks MeCP2 binding to TBL1XR1 and is protective in autism spectrum disorder (ASD). A high confidence 118 kb hypomethylated genomic block at chromosome 22q 13.33 associates with ASD diagnosis by age 3 across 2 independent cohorts evaluated using sequencing based epigenome wide association analysis of placental samples (Figs. IE, 2A, 2B, 2C, 2D, 2E, 3A, 3F, and 4D). An uncharacterized transcript within this locus is designated NHIP, reflecting neuronal hypoxia inducible placenta associated expression. NHIP is a primate specific gene expressed in adult and fetal brain tissue and exhibits decreased expression in ASD associated placenta and brain relative to controls. NHIP expression is transiently induced in human neurons following differentiation and hypoxia, both of which represent conditions of elevated oxidative stress arising from metabolic shifts. Overexpression of NHIP in IIEK293 cells alters expression of numerous genes involved in synaptic regulation, neurogenesis, and oxidative stress pathways. These NHIP regulated genes significantly overlap with NHIP associated transcripts identified in postmortem brain tissue and with known ASD risk genes. NHIP functions as a neuroprotective factor through regulation of these pathways.

[0217] NHIP encodes a 20 aa peptide predicted to adopt an alpha helical structure containing an acidic stripe (Fig. 22). The most conserved C terminal region of NHIP conforms to properties of a transactivation 9aaTAD domain commonly found in transcriptional activators. NHIP therefore functions as a natural mimetic of the 9aaTAD motif. An unbiased NHIP bio affinity pull down approach using human and mouse brain extracts followed by label free data independent acquisition mass spectrometry identifies NHIP binding targets. Distinct protein sets are observed in NHIP pull downs relative to FLAG controls, with significant functional connectivity identified among 121 NHIP binding proteins by STRING network analysis (Fig. 28). Functional enrichment among these proteins includes pathways associated with autistic behavior and cellular responses to stress. MeCP2 is identified as an NHIP binding protein in both human and mouse brain, consistent with its known role in adaptation to hypoxia and oxidative stress. MeCP2 functions as a chromatin associated factor required for transcription of BDNF induced by acute intermittent hypoxia. A well characterized MeCP2 binding partner, TBL1XR1, contains 3 9aaTAD domains, including 1 that directly overlaps with the MeCP2 binding interface and with 2 ASD associated mutation sites (Fig. 22). Structural modeling using alphafold2 places NHIP within the known MeCP2 TBL1XR1 interaction complex at the methylated BDNF promoter, consistent with NHIP acting as a competitive inhibitor. NHIP is therefore protective in part by transiently blockingAttorney Docket No, 11716-026WO1

[0218] MeCP2 mediated transcriptional repression under redox imbalance conditions, resulting in increased BDNF expression.

[0219] In one aspect, disclosed herein are compositions, comprising: an NHIP peptide or a functional derivative thereof; and a pharmaceutically acceptable carrier (such as, for example, including but not limited to a nanoparticle or a liposome). In some aspects, the composition is formulated to support embryo development, cryopreservation, or post thaw recovery. In some aspects, the NHIP peptide comprises a sequence as set forth in SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 95%, 98%, 99% or 99.8% identity thereto.

[0220] Also disclosed herein are peptide based therapeutic compositions for treatment of hypoxia- related brain disorders (such as for example, neurodevelopmental or neurodegenerative disorder (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing), comprising a modified NHIP peptide with one or more amino acid substitutions (such as for example SEQ ID NO: 9); and a pharmaceutically acceptable carrier.

[0221] In one aspect disclosed herein are peptide -based therapeutics of any preceding aspect, wherein the modified NHIP peptide is delivered to a subject, wherein the subject has low circulating NHIP peptide levels and homozygous NHIP risk allele. Also disclosed herein are peptide based therapeutics of any preceding aspect, further comprising a second therapeutic agent.Attorney Docket No. 11716-026WO1

[0222] Methods of treatment

[0223] The terms “treat,” “treating,” “treatment,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating, or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating, or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively, or remedially. Treatments are administered to a subject prior to onset (e.g., before obvious signs of disease), during early onset (e.g., upon initial signs and symptoms of disease), or after an established development of the disease. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of an infection.

[0224] The term “administering” refers to an administration that is oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir.

[0225] The term “parenteral” includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques.

[0226] " Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents.

[0227] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of a monomer refers to an amount that is sufficient to achieve the desired improvement in the property modulated by the formulation component, e.g. desired antioxidant release rate or viscoelasticity. The specific level in terms of wt% in a composition required as an effective amount will depend upon a variety of factors including the amount and type of monomer, amount and type of polymer, e.g., acrylamide, amount of antioxidant, and desired release kinetics.

[0228] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms but is generally insufficient to cause adverse side effects. The specific therapeutically effective doseAttorney Docket No. 11716-026WO1

[0229] level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the medical art s. In the case of treating a particular disease or condi tion, in some i n stances, the desired respon se can be inhibiting the progression of the disease or condition. This may involve only slowing the progression of the disease temporarily. However, in other instances, it may be desirable to halt the progression of the disease permanently. Tills can be monitored by routine diagnostic methods known to one of ordinary skill in the art for any particular disease. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.

[0230] In some aspects, the hypoxia-related brain disease or disorder is selected from aphasia, amyotrophic lateral sclerosis (ALS), Alzheimer’s disease, ataxia, ALS and neuromuscular diseases, adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP), autism and neurodevelopment, bipolar disorder, Batten disease, Bell’s palsy, brain and nerve tumors, Cushing’s syndrome, cerebral palsy, chronic traumatic encephalopathy (CTE), concussion, dystonia, dyslexia, dementia - Alzheimer’s and LBD, encephalitis, epilepsy, fibromyalgia, frontotemporal disorders, Guillain-Barre syndrome, headache, Huntington’s disease, Lewy body dementia, mal de debarquement syndrome (MdDS), meningitis, migraine, myasthenia gravis, multiple sclerosis, muscular dystrophy, movement disorders, neurogenetic diseases, neuroinfectious diseases, neurorehabilitation, peripheral neuropathy, Parkinson’s disease, stiff person syndrome, sleep disorders, spinal muscular atrophy, stroke, tremors, Tourette syndrome, traumatic brain injury, brain cancer, or other brain diseases or disorders. In some aspects, the brain cancer is selected from glioma, astrocytoma, ependymomas, glioblastoma, oligodendroglioma, ganglioglioma, hemangioblastoma, medulloblastoma, meningioma, rhabdoid tumors, schwannoma, pituitary adenoma, craniopharyngioma, nasopharyngeal angiofibroma, choroid plexus tumors, dysembryoplastic neuroepithelial tumors, neurofibroma, schizophrenia or other brain cancers. In some aspects, the hypoxia- related brain disease or disorder is selected from Alzheimer’s Disease, Parkinson’s Disease, or a brain cancer. In some aspects, the hypoxia- related brain disease or disorder is Alzheimer’s Disease. In some aspects, the hypoxia-related brain disorder is neonatal autism spectrum disorder (ASD).Attorney Docket No, 11716-026WO1

[0231] Disclosed herein is an association of hypoxia-related brain disorders risk with placental DNA methylation in two high-risk familial ASD cohorts through whole genome bisulfite sequencing (WGBS) analysis of 204 individuals. A block of differential methylation was identified in ASD at 22ql 3.33, a region previously described as a CoRSIV and SV hotspot but not previously associated with ASD. A novel gene LOG 105373085 (renamed as NHIP for neuronal hypoxia inducible, placenta associated) within 22ql3.33 was demonstrated to be expressed in brain, responsive to oxidative stress, and to influence expression of other known ASD-risk genes. A common SV insertion within 22ql3.33 was associated with increased ASD risk, reduced expression of NHIP, and reduced methylation, but first month prenatal vitamin use counteracted this effect. Together, these results demonstrate a novel ASD risk gene regulatory locus at the interface of common genetics and perinatal environmental resilience.

[0232] In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a hypoxia-related brain disorder (such as for example, neurodevelopmental or neurodegenerative disorder (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing) in a subject, comprising a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b) detecting presence or absence of a neuronal hypoxia, placenta associated (NHIP) gene risk allele in the sample; c) measuring circulating levels of NHIP peptide in the sample, wherein the subject is predicted to have the hypoxia-related brain disorder if the sample has homozygous NHIP risk alleles or low circulating NHIP peptide levelsAttorney Docket No. 11716-026WO1

[0233] than in comparison to a control; and d) administering a therapeutically effective dose of a peptide based therapeutic (such as, for example, a modified endogenous NHIP peptide with one or more amino acid substitutions including, but not limited to SEQ ID NOS: 8, 9 or 10) to the subject who is predicted to have the hypoxia-related brain disorder. In some aspects, the modified NHIP peptide can be administered in combination with a pharmaceutically acceptable carrier.

[0234] Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing a hypoxia-related brain disorder (such as for example, neurodevelopmental or neurodegenerative disorders (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing) in a subject, comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b) detecting the presence of a NHIP risk allele in the sample; c) measuring circulating levels of NHIP peptide in the sample; d) calculating a polygenic risk score (PRS) based on the presence of the NHIP risk allele, and the circulating levels of the NHIP peptide, wherein a high-risk score relative to a control indicates an increased risk for the hypoxia-related brain disorders; and e) administering a peptide based therapeutic (such as, for example, a modified endogenous NHIP peptide with one or more amino acid substitutions including, but not limited to SEQ ID NOS: 8, 9 or 10) alone or in combination with a second therapeutic agent to the subject with the high-risk score. In some aspects, the high-risk score comprises a homozygous NHIP risk allele and low circulating NHIP peptide levels. For example, the PRS comprises a Low Risk: PRS < -1, a Moderate Risk: PRS between -1 and +1, a High Risk:Attorney Docket No, 11716-026WO1

[0235] PRS between +1 and +2, or Very High Risk: PRS > +2; wherein a score higher than +1 relative to a control indicates an increased risk for the hypoxia-related brain disorder.

[0236] In one aspect, disclosed herein is a method of treating a hypoxia related brain disorder in a subject, comprising administering to the subject a therapeutically effective amount of a therapeutic agent, wherein the hypoxia related brain disorder comprises a neurodevelopmental disorder or a neurodegenerative disorder, and wherein the hypoxia related brain disorder is caused by a hypoxic insult. In some embodiments, the hypoxic insult comprises neonatal hypoxia, stroke, cardiac arrest, or smoke inhalation. In some embodiments, the neurodevelopmental disorder comprises a hypoxia associated neurodevelopmental impairment characterized by at least one of delayed milestone attainment, impaired motor function, or impaired cognitive function. In some embodiments, the neurodegenerative disorder comprises a hypoxia associated neurodegenerative condition characterized by at least one of progressive neuronal loss, synaptic dysfunction, or neuroinflammation. In some embodiments, the method further comprises determining, prior to or after administering the therapeutic agent, a hypoxia associated biomarker level in a biological sample obtained from the subject, wherein the hypoxia associated biomarker level comprises a level of a hypoxia inducible factor pathway marker, an oxidative stress marker, or a neuronal injury marker, relative to a reference.

[0237] In another aspect, disclosed herein is a method of identifying a candidate therapeutic for a hypoxia related brain disorder, comprising generating the hypoxia related brain disorder phenotype in the non human subject or the in vitro biological system as described herein, contacting the non human subject or the in vitro biological system with a test agent, and selecting the test agent as the candidate therapeutic when the test agent reduces at least one measurable phenotype relative to a hypoxic insult control. In some embodiments, the hypoxic insult is selected from neonatal hypoxia, stroke, cardiac arrest, and smoke inhalation, and the measurable phenotype is associated with a neurodevelopmental disorder or a neurodegenerative disorder.

[0238] Also disclosed herein, are methods of treating inhibiting, reducing, decreasing, ameliorating, and / or preventing in vitro fertilization (IVF) induced oxidative stress, comprising: supplementing a culture medium (such as, for example, including but not limited to a sperm preparation media, an oocyte maturation media, a fertilization media, an embryo culture media, a vitrification media, a warming media, or a freeze thaw media) with an NHIP peptide, thereby obtaining a supplemented culture medium; and culturing a gamete, zygote, or embryo in the supplemented culture medium. In some aspects, the NHIP peptide is supplemented in the culture medium during at least one stage of IVF, wherein the stage of IVF comprises oocyte maturation,Attorney Docket No, 11716-026WO1

[0239] fertilization, cleavage stage development, morula stage development, blastocyst stage development, or combinations thereof. In some aspects, the NHIP peptide is supplemented in the culture medium continuously throughout from fertilization through blastocyst formation. In some aspects, the NHIP peptide is supplemented in the culture medium intermittently for at least 2 hours, 6 hours, 12 hours, 24 hours, or 48 hours. In some aspects, the NHIP peptide is supplemented in the culture medium during a single treatment cycle corresponding to one IVF cycle. In other aspects, the NHIP peptide is supplemented across multiple treatment cycles corresponding to sequential IVF cycles. In some aspects, the method further comprises determining embryo developmental outcome (including but not limited to fertilization rate, cleavage rate, blastocyst formation, embryo developmental competency, implantation rate, or live birth rate). In some aspects, the embryo developmental competency is determined using an embryo competency index (ECI), wherein the ECI is calculated from normalized expression levels of predictive genes (such as, for example, including but not limited to GSTO1, CHSY1, TPI1, YWHAG, CCNA2, LSM4, CDK7, or EIF4A3). In some aspects, the NHIP supplementation increases the embryo competency index at least at one effective NHIP dose. In some aspects, the at least one effective NHIP dose comprises the NHIP peptide at a concentration of at least 0.01 ng / ml to about 100 ng / ml.

[0240] Methods of improving or determining hypoxia related disorders or developmental outcomes In one aspect, disclosed herein are methods for determining a predisposition to hypoxia- related brain disorders (such as for example, neurodeveiopmental or neurodegenerative disorders (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar' disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion,Attorney Docket No, 11716-026WO1

[0241] cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing) in a subject, comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b) performing a genetic assay on the sample to detect presence of one or more NHIP risk alleles; and c) identifying if the subject is homozygous for NHIP risk allele, whereby the subject is predisposed to hypoxia- related brain disorders in presence of homozygous NHIP risk allele.

[0242] Also disclosed herein are methods of improving, increasing, and / or rescuing cognitive function and brain health in a subject recovering from hypoxia, comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from the subject; b) identifying the subject with low circulating NHIP peptide levels and presence of a NHIP risk allele in the sample; and c) administering a customized NHIP peptide therapeutic (such as, for example, a modified endogenous NHIP peptide with one or more amino acid substitutions including, but not limited to SEQ ID NOS: 8, 9 and 10) alone or in combination with a second therapeutic agent to the subject with low circulating NHIP peptide levels and presence of the NHIP risk allele in the sample. In some aspects the method further involves calculating a polygenic risk score (PRS) based on the presence of the NHIP risk allele, and the low circulating levels of NHIP peptide, wherein a high-risk score relative to a control indicates a compromised cognitive function and brain health.

[0243] Also disclosed herein are methods of improving, promoting, facilitating, increasing, expanding, or enhancing developmental outcome in assisted reproductive technology (ART) (including but not limited to in vitro fertilization, intracytoplasmic sperm injection, embryo culture, embryo cryopreservation, or embryo thawing) comprising: supplementing a medium (such as, for example, including but not limited to a sperm preparation media, an oocyte maturation media, a fertilization media, an embryo culture media, a vitrification media, a wanning media, or a freeze thaw media) with an NHIP peptide, thereby obtaining a supplemented medium; culturing a gamete, zygote, or embryo in the supplemented medium; isolating RNA from cultured gamete, zygote, or embryo; and determining a developmental outcome (such as, for example, including but not limited to fertilization rate, cleavage rate, blastocyst formation, embryo developmental competency, implantation rate, or live birth rate). In some aspects, the NHIP comprises a sequence as set forth in SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 90% identity thereto. In some aspects, the embryo developmental competency is determined using an embryo competency index (ECI), wherein the ECI is calculated from normalized expression levels of predictive genes (such as, for example, including but not limited to GSTO1, CHSY1, TPI1,Attorney Docket No, 11716-026WO1

[0244] YWHAG, CCNA2, LSM4, CDK7, or EIF4A3). In another aspect, the NHIP supplementation increases the embryo competency index at least at one effective NHIP dose. In further aspects, the at least one effective NHIP dose comprises the NHIP peptide at a concentration of at least 0.01 ng / ml to about 100 ng / ml. In some aspects, the method further comprises transferring an embryo cultured in the supplemented medium into a recipient uterus or oviduct, and wherein the supplementation results in an increased rate of implantation, pregnancy, or live birth relative to a control embryo not exposed to the supplemented medium.

[0245] In one aspect, disclosed herein are multi-omics screening assays for determining hypoxia- related brain disorders (such as for example, neurodevelopmental or neurodegenerative disorders (such as, for example, schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease)) caused by a hypoxic insult (such as for example, neonatal hypoxia, perinatal hypoxia ischemia during labor and delivery, hypoxia during gestation, hypoxia during child birth, uteroplacental insufficiency, placental insufficiency, placental abruption, placenta previa with hemorrhage, uterine rupture, preeclampsia, eclampsia, umbilical cord compression, umbilical cord prolapse, nuchal cord, true knot of the umbilical cord, prolonged labor, obstructed labor, uterine hyperstimulation, shoulder dystocia, maternal hypoxemia, pneumonia, asthma exacerbation, acute respiratory distress, high altitude exposure, maternal anemia, maternal hypotension, maternal hemorrhage, maternal shock, carbon monoxide exposure, smoke inhalation, neonatal respiratory failure, persistent pulmonary hypertension of the newborn, meconium aspiration, congenital heart disease associated with hypoxemia or reduced cerebral perfusion, airway obstruction, near drowning, aspiration, apnea, severe hypotension, sepsis, hemorrhage, trauma, ischemic stroke, transient ischemic attack, cerebral hypoperfusion, cardiac arrest, perioperative respiratory compromise, intermittent hypoxia associated with sleep disordered breathing), comprising: a) obtaining a sample (including, but not limited to placental tissue, blood, serum, urine, sputum, or spinal fluid) from a subject; b) detecting NHIP risk alleles in the sample; c) measuring circulating levels of NHIP peptide in the sample; d) measuring DNA methylation levels at NHIP gene locus; and e) calculating a polygenic risk score (PRS) based on presence of the NHIP risk alleles, the DNA methylation levels at NHIP gene locus, and the circulating levels of NHIP peptide; wherein a high-risk score relative to a control indicates an increased risk for hypoxia-related brain disorders. In some aspects, the high-risk score comprises a homozygous NHIP risk allele and low circulating NHIP peptide levels. For example, the PRS comprises a Low Risk: PRS < -1, a Moderate Risk: PRS between -1 and +1, a High Risk: PRSAttorney Docket No, 11716-026WO1

[0246] between +1 and +2, or Very High Risk: PRS > +2; wherein a score higher than +1 relative to a control indicates an increased risk for the hypoxia-related brain disorder.

[0247] It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of ti e disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

[0248] EXAMPLES

[0249] The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0250] Example 1: Differential methylation analysis using WGBS identifies a hypomethylated block at 22ql3.33 in SD placenta

[0251] To identify novel regions of epigenetic alterations in placenta discriminating later ASD diagnosis, WGBS analysis of genome-wide DNA methylation was performed on 204 subjects from two prospective high-risk ASD cohorts (MARBLES and EARLI) with a diagnosis outcome at 36 months (Fig. 1A). No demographic, cell type or technical variables were significantly associated with ASD outcome, but scores related to ASD severity and cognition were associated. Global methylation levels over 20-kb windows were also not different by diagnostic group. Since sequencing platform differences (Illumina HiSeq 4000, HiSeq X, NovaSeq) impacted global methylation levels, the samples were separated into “discovery,” “external replication,” and “specificity replication” groups for initial analyses of differentially methylated regions.

[0252] Differentially methylated regions (DMRs) distinguishing ASD from typical development (TD) placental samples were identified with a permutation-based statistical approach, adjusted for sex and placental cell types, to identify broad epigenomic signatures of multiple gene regulatory regions at a genome-wide level in the discovery group. In total, 134 DMRs. A cluster of 12 ASD DMRs mapped to 22ql3.33, ail hypomethylated in ASD (5-7% difference from TD), including one that also passed genome- wide significance (FDR-adjusted p value < 0.05). Methylation levelsAttorney Docket No, 11716-026WO1

[0253] within the 134 ASD DMRs were specifically associated with autism severity and cognitive scores but no other demographic and technical variables after adjustment in a linear model. Further evidence that DMRs identified in the placenta reflect epigenetic differences relevant to brain and development came from the significant enrichment of ASD DMRs in fetal brain enhancers, as well as a bivalent enhancer and repressed polycomb regions of placenta compared to background regions using ChromHMM-defined chromatin states from the Roadmap Epigenomics Project (Fig.

[0254] 1C). Demonstrating their functional relevance, hyper-methylated ASD DMRs were enriched within 0-5 -kb and 5-50-kb windows downstream of transcription start sites (TSS), at CpG islands and shores for both hyper- and hypomethylated DMRs and at known transcription factor binding sites. Genes mapping to placental ASD DMRs significantly overlapped with ASD risk genes from the Simons Foundation Autism Research Initiative (SFARI) dataset compared to all expressed genes (Fisher’s exact test, p value = 0.006, odds ratio (OR) = 2.321). The overrepresentation of 12 DMRs at 22ql3.33 hypomethylated in ASD drove the additional enrichment at > 500 kb of TSS as well as gene ontology (GO) enrichment for functions in histone acetyltransferase (HATs) and chromatin modification due to the assignment of the 22ql3.33 hypomethylated DMRs to the nearest downstream gene BRD1, a histone acetyltransferase. Based on the genome- wide significance and observation of multiple DMRs mapping to the same genomic region, it was decided to focus subsequent analyses on further understanding the impact of the 22q 13.33 hypomethylated locus on ASD risk.

[0255] The 22ql3.33 DMRs hypomethylated in ASD were highly positively correlated with each other and formed a 118-kb hypomethylation cluster that was also detected as a hypomethylated block (chr22: 49044669 - 49162642, hg38) (Fig. ID). This chromosomal locus was also previously described as a CoRSIV, a region of correlated methylation differences between individuals. Smoothed methylation levels were examined over the 118 kb 22ql3.33 block for replication in a different ASD enriched risk cohort (EARLI, external replication group). Similar to the discovery group (Mann-Whitney- Wilcoxon, p value = 0.002, ASD n = 46, TD n = 46, effect size = -0.645), 22ql3.33 block methylation levels were significantly lower in ASD compared to TD (Mann-Whitney- Wilcoxon, p value = 0.009, ASD n = 16, TD n = 31, effect size = -0.867) (Fig. IE). Furthermore, an independent “specificity replication group” of MARBLES subjects that included a “Non-TD” diagnostic group sequenced on a different platform also showed significantly lower 22ql3.33 DNA methylation levels in ASD compared to either TD or the additional diagnostic Non-TD samples, de- fined as atypical cognitive scores but not ASD (Mann-Whitney-Wilcoxon, ASD vs TD p value - 0.005, effect size - -0.991, ASD vs Non-TD p value = 0.049, effect size =Attorney Docket No. 11716-026WO1

[0256] -0.282, Non-TD vs TD p value = 0.050, ASD n = 21, Non-TD n = 13, TD n = 31, effect size = -0.452) (Fig. IE) Smoothed methylation levels over the 118-kb 22ql3.33 block remained significantly associated with ASD after adjustment for 18 potential covariates in a linear model in the discovery group and after adjustment for two nominal covariates in all three groups. These results demonstrate that hypomethylation over the 118 kb 22ql3.33 co-methylated block is a reproducible finding across different cohorts and platforms, specifically distinguishing placental samples of newborns later diagnosed with ASD.

[0257] Example 2: NHIP is a primate-specific gene dynamically expressed during neuronal differentiation that exhibits reduced expression in ASD

[0258] The 22q 13.33 co-methylated block was within an apparent gene desert, located more than 500 kb away from the closest annotated protein-coding genes: FAM19A5 (TAFA5) and BRD1. Epigenetic evidence for promoter and enhancer activity within 22ql3.33 was obtained from placenta, ovary, and brain ENCODE datasets. Within 22ql 3.33, an active promoter peak identified by H3K4me3 histone markers was observed in a subset of the ovary, placenta, and brain samples, suggesting variable promoter marks between individuals. This H3K4me3 peak overlapped a CpG island and the TSS of the uncharacterized transcript, LOC 105373085 (also named AK057312), identified from a human testis cDNA library. LOC 105373085 was renamed as NHIP, for neuronal hypoxia-inducible, placenta-associated. NHIP is also variably expressed among brain regions from the Genotype-Tissue Expression (GTEx) database. The full-length NHIP sequence is syntenic in all primates but not in other vertebrates, including mice. When quantified by RT-PCR in human tissues, NHIP was expressed in the placenta, testis, and adult and fetal brain, with relatively lower expression in placenta (Fig. 2A). ASD placental samples showed significantly lower NHIP transcript levels than TD samples in the same direction as methylation changes in the 22ql3.33 block (Mann- Whitney-Wilcoxon, p value = 0.009, ASD n = 17, TD n = 11, effect size = -1.12, Fig. 2B). In placenta, because of the epigenetic feature of PMDs, gene body methylation is positively associated with and predicts active gene expression across mammals. Since the 22ql3.33 co-methylated block mapped to a previously defined PMD in placenta (Fig. 5), these results suggest that hypomethylation of the 22ql3.33 block in ASD is reflective of lower past or current expression of NHIP expression in utero for ASD compared to TD.

[0259] To understand the function of this uncharacterized gene, NHIP expression levels were assayed and detected in four human cell lines selected for their early-life origins (HEK293T, IMR90, LUHMES, SH-SY5Y). All cell lines are derived from human females; HEK293T cellsAttorney Docket No. 11716-026WO1

[0260] are of embryonic kidney origin, IMR90 are fetal fibroblasts, Lund human mesencephalic (LUHMES) are derived from embryonic human mesencephalon, and SH-SY5Y cells are from a neuroblastoma. A significant increase in NHIP transcript levels was observed following neuronal differentiation in LUHMES cells (Mann-Whit- ney-Wilcoxon, p value = 0.034, differentiated LUHMES n = 3, TD undifferentiated LUHMES n = 3, effect size = 3.07, Fig. 2C). Since both neuronal differentiation and placental trophoblast differentiation respond to hypoxic conditions and oxidative stress in response to environmental pollutants, the responsiveness of NHIP to hypoxia was tested. Differentiated LUHMES neurons were more sensitive to treatment with a hypoxia mimetic (CoCh) than undifferentiated cells, with a significant decrease in cell viability and an increase in reactive oxygen species (ROS) levels (Mann-Whitney- Wilcoxon, p value -0.0001, differentiated LUHMES treated with 100 nM CoC12 n = 12, differentiated LUHMES treated with vehicle n = 8, effect size = 2.26, Fig. 2D, H2O2 results, and statistics are in Fig. 6). NHIP transcript levels also increased after exposure to CoC12 specifically in differentiated, but not undifferentiated LUHMES cells (Mann-Whitney- Wilcoxon, p value - 0.009, differentiated LUHMES treated with 100 nM CoC12 n = 9, differentiated LUHMES treated with vehicle n = 9, effect size = 1.56, Fig. 2E). Following removal of hypoxia, NHIP transcript levels returned to untreated levels, demonstrating the transience of the response (Fig. 7). Among the tested human cell lines, embryonic kidney-origin HEK293T cells had the lowest endogenous NHIP transcript levels (Fig. 2C). Since the response to hypoxia is a developmental signal regulating cell proliferation in embryos, the hypothesis was experimentally tested by transiently transfecting HEK293T cells with either a plasmid encoding NHIP with a dual GFP-Puromycin selection cassette or a control vector control lacking NHIP (plasmid construct shown in Fig. 8, sequences of vector and peptide are in SEQ ID NO: 1, 2, 3, and 4). A significantly shortened doubling time was observed in response to NHIP overexpression compared to control cells (20.23 h vs. 24.91 h) (Hour 142, Mann- Whitney-Wilcoxon, p value - 0.045, NHIP overexpression cells n = 3, control cells n = 3, effect size = 3.10; Hour 166, Mann-Whitney-Wilcoxon, p value = 0.0009, NHIP overexpression cells n = 3, control cells n = 3, effect size = 7.80, Fig. 2F, Fig. 9). These results demonstrate that NHIP is a hypoxia-inducible gene in neurons that regulates cell proliferation in an embryonic cell line with low endogenous expression.

[0261] To examine whether NHIP encoded a protein, a 20-amino acid (aa) putative peptide containing a Kozak sequence was identified and tested the existence of the peptide by designing the NHIP peptide-eGFP vector so that the peptide sequence would be in frame with ATG-less GFP transfected in HEK293T cells (Fig. 2G, sequences are in SEQ ID NO: 1, 2, 3, and 4). The presenceAttorney Docket No. 11716-026WO1

[0262] of both transfection control (red, mCherry) and reporter (green, eGFP) confirmed the existence of the 20 aa NHIP peptide (Fig. 2G). The NHIP encoded peptide sequence was confirmed using mass spectrometry after pull-down with anti-GFP antibody (Fig. 10). A search of human protein databases demonstrated that the NHIP peptide partially overlapped protein sequences within BRCA2 and CHD4. Lastly, using a custom antibody against the NHIP-encoded peptide, immunostaining was performed on sections of human postmortem prefrontal cortex, demonstrating nuclear staining in a subset of neuronal nuclei (Fig. 2H). Together, these results demonstrate the existence of a nuclear peptide encoded by NHIP.

[0263] Example 3: A common genetic structural variant at 22ql3.33 is associated with reduced placental DNA methylation, reduced NHIP expression, and increased ASD risk

[0264] To examine genetic factors associated with 22ql3.33 methylation levels and polymorphic expression of NHIP in ASD, the association between 22ql3.33 block DNA methylation levels and common variants was tested from individual-matched whole genome sequencing (WGS), including SNPs, insertions or deletions (indels), copy number variations (CNVs), and SVs. Methylation levels in five out of 12 ASD DMRs within 22ql3.33 were significantly associated with common SNPs located inside the DMRs (linear regression, p values in Fig. 11). A 1674 bp SV insertion (chr22: 49029657, hg38) was identified 15,013 bp upstream of the start of the 22ql3.33 co-methylated block (Fig. 3A, genotypes and demographics of each subject are in SEQ ID NO: 5, 6, and 7) with which DNA methylation levels of all 12 22ql3.33 ASD DMRs were significantly associated (linear regression, p values are in Fig. 3B). In the MARBLES cohort, this SV insertion was identified in significantly more ASD than TD samples (chi-square test, ASD n = 41, TD n= 37, p value - 0.045). Placenta samples with the 22ql3.33 insertion from ASD, but not TD, showed significantly lower methylation levels (methylation vs. diagnosis: Mann-Whitney- Wilcoxon, p value = 0.008, ASD n = 41, TD n = 37, effect size = -0.645; methylation vs genotype: Mann-Whitney-Wilcoxon, p value = 0.004, Y n = 29, N n = 49, effect size = -0.644; in ASD samples: methylation vs genotype: Mann- Whitney-Wilcoxon, p value = 0.005, Y n - 20, N n -21, effect size = -0.878; in TD samples: methylation vs genotype Mann- Whitney-Wilcoxon, p value = 0.847, Y n = 9, N n = 28, effect size = -0.173; Fig. 3C). While not present in the reference genome, the 22ql3.33 insertion was also identified as a structural variant identified from PacBio assembly data of the human CHM1 complete hydatidiform cell line (CHMl_chr22-49029645- INS-1673 contig and NCBI GenBank ID QPKN01007947.1). The WGS identification of the SV using PCR genotyping primer sets was confirmed and provided allelic genotypes (genotypes areAttorney Docket No. 11716-026WO1

[0265] in SEQ ID NO: 5, 6, and 7). The insertion sequence showed high similarity with retrotransposon elements, including SVA and Alu. This 22ql3.33 SV also corresponded to INS_22__115103 in Genome Aggregation Database (gnomAD), which showed an average allele frequency of 0.7 and only a small deviation (10% or less) based on ancestry or sex.

[0266] Since the 22q 13.33 block exhibited lower methylation in ASD compared to TD placental samples from the MARBLES cohort, the relationship between prenatal vitamin use during the first month of pregnancy was evaluated, previously shown to be associated with decreased ASD risk in this cohort, in the general population, and other high-familial risk cohorts, in the context of ASD risk associated with the insertion. Along with other vitamins and minerals, prenatal vitamins contain high folic acid to meet the increased needs during pregnancy and could be an important source of methyl donors. There was a significant positive association between prenatal vitamins use in the first month and methylation level at the 22ql3.33 block, in the protective direction (Mann-Whitney- Wilcoxon, p value = 0.001, took prenatal vita-min n = 31, did not take prenatal vitamin n = 46, effect size - 0.477) (Fig. 3D). When samples were stratified by 22ql3.33 insertion genotype, prenatal vitamin use during the first month of pregnancy showed a nomi nally significant protective effect among individuals with the insertion, although it is acknowledged that the sample size is small (within samples homozygous for the insertion: in samples from mothers who took prenatal vitamin during the first month of pregnancy, Mann- Whitney- Wilcoxon, p value = 0.046, ASD n = 3, TD n = 4, effect size = -2.09; Fig. 12). Unlike the 22ql3.33 insertion, the GWAS- based PRS calculated for the MARBLES cohort was not significantly different between diagnostic groups or associated with 22ql3.33 block methylation by ANOVA in the MARBLES discovery cohort. Together, these results are consistent with the hypothesis that ASD risk associated with the 22ql3.33 SV and the co-methylated block is distinguishable from polygenic ASD risk and tempered by a common nutrient intervention with evidence for an association with ASD protection. Since SVs have been previously implicated in altering chromatin loops regulating promoter-enhancer interactions, it was hypothesized that this 1.7 kb insertion is located within an enhancer-promoter loop relevant to the fetal brain. Using the recent Epi-Map database of chromatin states across multiple humans and tissue types, two CTCF sites flanking the SV insertion (Fig. 3E) were identified. ChromHMM maps demonstrate a fetal brain enhancer that aligns with the distal CTCF binding site. The proximal CTCF site is adjacent to the NHIP TSS, which ChromHMM predicts as an active promoter in brain, ovary, and placenta. These two CTCF binding sites were inside a large ~ 2 Mb topologically associated domain (TAD) spanning from the 48.5 Mb position to the telomere of 22q. Together, these results suggest a model whereby theAttorney Docket No. 11716-026WO1

[0267] SV insertion allele could disrupt the fetal brain enhancer-promoter interaction within a large telomeric TAD, thereby reducing the responsiveness of NHIP expression to neuronal differentiation and excessive oxidative stress (Fig. 3F). Early pregnancy prenatal vitamin use is expected to counteract the effects of oxidative stress through provision of dietary methyl groups, thereby increasing DNA methylation at the NHIP locus in individuals homozygous for the 22ql3.33 insertion.

[0268] Example 4: NHIP expression is reduced in ASD brain and associated with the regulation of genes enriched for synaptic functions and ASD risk

[0269] It was tested that the 22ql3.33 insertion was associated with NHIP expression in ASD versus TD postmortem brain samples that were matched for age, sex, and race / ethnicity. Similar to the MARBLES cohort of placenta samples, the 22ql3.33 insertion showed a significantly higher frequency in ASD compared with I'D in a necessarily small group of 58 cortical samples acquired from postmortem brain banks (chi-square test, ASD n = 27, TD n = 30, p value = 0.023). RNA-seq was performed on a subset of 20 cortical samples representing all three SV insertion genotypes (Fig. 15), matched for age, sex, and race / ethnicity between ASD and TD. Brain samples homozygous for the 22ql3.33 insertion (Y) exhibited lower NHIP levels compared to those with one or no insertion alleles (N), specifically in ASD, but not in TD samples (Fig. 4A).

[0270] A genome-wide analysis was performed at the transcript level associated with variable NHIP transcript levels in brain samples as a continuous response variable. In total, 851 genes passed FDR significance for NHIP association, including 195 positively and 656 negatively associated (Fig. 4B). After adjustment for sex, age, brain region, and postmortem interval (PMI), 534 genes passed FDR significance for NHIP association, of which 445 overlapped with those identified without covariate adjustments, including 166 positively and 368 negatively associated with NHIP. Downregulated genes included ASD candidate genes such as CHD8, and a gene previously implicated in ASD from the placenta, IRS2. Gene ontology (GO) enrichment analysis of NHIP-associated genes (covariate-adjusted) revealed 852 terms significant by permutation test (Fig. 4C). Regulation of nervous system development, including gliogenesis, synaptic vesicle transport, and dendritic spine development, and response to oxidative stress, were negatively associated with NHIP transcript levels (Fig. 4G). GO term functions related to the dendritic spine, synapse assembly, and response to reactive oxygen formed a functional module of genes negatively associated with NHIP levels (Fig. 13). In contrast, transcripts positively associated with NHIP levels were enriched for distinct functions in fatty acid metabolism and embryonic organAttorney Docket No. 11716-026WO1

[0271] development. To further examine the relevance of NHIP expression to ASD etiology, brain NHIP-associated transcripts were overlapped with SFARI ASD risk genes and observed a significant overlap of 65 genes. The 65 genes in common were significantly enriched for 14 GO terms, including nervous system development, synapse, chromatin organization, and neurogenesis, demonstrating associations of NHIP levels with functionally relevant gene pathways in brain and ASD.

[0272] Example 5: Overexpression of NHIP in HEK293T cells results in large-scale transcriptional changes to genes relevant to brain and ASD risk

[0273] To experimentally model the transcriptional impact of NHIP induction, RNA-seq, and differential expression analyses were performed on HEK293T cells transiently transfected with NHIP or vector control. 4756 differentially expressed genes (DEG) were identified with genome¬ wide significance (FDR-adjusted p value < 0.05). NHIP overexpression increased the expression of 1490 genes and decreased the expression of 3266 genes. Genes decreased with NHIP expression included the downstream flanking gene BRD1, as well as IRS2, CHD8, and DELI. NHIP overexpression and reduced BRD1 in overexpression cell lines were confirmed with RT-PCR. Genes differentially expressed with NHIP overexpression were enriched for GO terms associated with noncoding RNA processing, histone modification, placental development, cell cycle, and p53 binding, consistent with the proliferation phenotype (Fig. 2F). KEGG gene set enrichment analysis showed enrichment for brain disorders, including Parkinson’s, Alzheimer’s, and Huntington’s diseases and metabolism, such as fatty acid metabolism and drug metabolism, further demonstrating the relevance of NHIP regulated genes to brain functions.

[0274] In a comparison of in vivo and in vitro RNA-seq analyses, 161 genes overlapped between those differentially expressed in response to experimental NHIP overexpression and those associated with NHIP transcript levels in human brain, which was significant compared to all expressed genes. Genes negatively associated with NHIP levels in vitro and in vivo were enriched for functions in synapse, chromatin, and regulation of nervous system development.

[0275] Similarly, 20 GO terms overlapped between in vivo and in vitro RNA-seq analyses, including regulation of translation, peptide biosynthetic process, and rhythmic process, which was significant compared to all GO terms. Furthermore, genes differentially expressed with NHIP overexpression also showed a significant overlap of 263 genes with ASD risk genes from the SFARI database compared to all expressed genes (Fisher’s exact test, p value = 2.752e-05, OR = 1.379) and were enriched for functions in central nervous system development, synaptic signaling,Attorney Docket No. 11716-026WO1

[0276] and response to oxygen levels. There were 30 genes in common among ASD risk, NHIP association in brain, and NHIP overexpression, including BRI, SETD5, ARID1B, EP300, and FOXG1 (Fig. 4D). Genes common to ASD risk, NHIP association in brain, and NHIP overexpression were enriched for chromatin organization, regulation of transcription by RNA polymerase II, histone modification, neurogenesis, and rhythmic processes. Together, these results demonstrate that NHIP is a novel regulatory gene with functions relevant to known ASD risk factors.

[0277] Discussions

[0278] The current invention utilizes placental tissue from a high-risk prospective pregnancy cohort with multi-omics assays to discover novel risk genes related to hypoxia associated brain disorders. In one aspect, disclosed herein is a novel ASD risk gene locus that integrates responsiveness to oxidative stress with the inheritance of a common structural variant. Given the distinctive DNA methylation landscape of the placenta characterized by PMDs and higher gene body methylation overexpressed genes, using unbiased WGBS as a tool enabled the discovery of a novel gene associated with ASD that standard genetic and epigenetic array-based approaches had missed. WGBS previously identified the 22ql 3.33 co-methylated block identified in this study as a correlated region of increased methylation variance (CoRSIV) as well as a region of increased SV in the human genome. The hypothesis confirmed that CoRSIV and SV locations overlap more frequently than expected at random. Although this 22q13.33 region has not been previously associated with ASD risk, the neighboring distal long arm of 22ql3.3 harbors multiple genes implicated in neurodevelopmental disorders, including ASD, intellectual disability, schizophrenia, and bipolar disease. SHANK3, which encodes a postsynaptic protein required for maturation of glutamatergic synapses, is 1.5 Mb telomeric from the 22ql3.33 hypomethylated block identified in this study. Rare SHANK3 mutations are noted in ASD, and large structural variations including SHANK3 are observed in rare ASD children. In addition, 22q 13.33, 22ql3.32, and 22ql3.31 are disease associated hotspot regions in ASD. While these highly polymorphic regions of the genome have the potential to contain regulatory genes such as NHIP, as well as primate-specific sequences relevant to brain development, they are often excluded from the design of array-based platforms because of their complexities. The NHIP locus is sparsely covered by probes in the most current genetic and epigenetic array designs (Fig. 5), a likely explanation for why it was not identified by prior ASD studies. In contrast, sequencing-based approaches, such as the integrated WGS and WGBS approach employed here, are a promising alternative for disease association testing.Attorney Docket No. 11716-026WO1

[0279] Placenta is an often misunderstood and overlooked tissue, despite its importance in regulating and thereby reflecting events critical to brain development in utero. Placenta regulates metabolism and provides steroid hormones as well as neurotransmiters critical for the developing brain. Additionally, placenta regulates oxygen supply, as it consumes 40-60% of the body’s oxygen, and hypoxia metabolic adaptation regulates trophoblast cell fate decisions. Oxygen tension can also modulate extra villous trophoblast proliferation, differentiation, and invasion, all important for successful implantation and placentation, which can all impact brain development and ASD risk. It was demonstrated that NHIP is a primate-specific, variably expressed gene responsible for hypoxia in human placenta and brain tissues. The variability in NHIP transcript levels was influenced by both non-genetic and genetic factors. First, NHIP was induced with neuronal differentiation, but also with hypoxia and oxidative stress. Interestingly, the responsiveness of NHIP expression and oxidative stress was specific to differentiated neurons but not seen in the undifferentiated state. Oxidative stress is a common convergent mechanism that occurs in normal neurodevelopment but can be excessive in cases of many environmental exposures associated with ASD, including air pollution and pesticides. Second, prenatal vitamin use in the first month of pregnancy provides essential methyl donors to the one-carbon metabolism pathway that counteract excessive oxidative stress, a prediction consistent with the elevated methylation over the 22ql3.33 block in placentas from pregnancies with first-month prenatal vitamin use. Third, common genetic variants were also associated with 22ql3.33 methylation levels. 12 SNPs within the 22ql3.33 co-methylated block were identified as significantly associated with methylation; the strongest genetic factor was a 1.7 kb insertion with a high allele frequency in all ethnicities. Homozygosity for this 22ql3.33 insertion was a better predictor of ASD risk than GWAS-based PRS in this mixed ancestry cohort. 22ql3.33 SV homozygosity was also strongly associated with hypomethylation of this locus and reduced expression of NHIP in ASD compared to TD placenta and brain samples.

[0280] Large insertions such as the 22ql 3.33 SV that occur outside coding regions can still modify gene expression through alterations in promoter-enhancer loop size. The NHIP promoter shows differences in active chromatin marks between individuals and is associated with two CTCF binding sites that apparently anchor an intra-TAD loop between the promoter and a distal fetal brain enhancer. These results suggest a model by which the presence of at least one copy of the reference allele without the insertion would allow NHIP to be induced during neurodevelopment and hypoxia, thereby protecting the developing brain through its regulation of downstream regulatory gene pathways (Fig. 3F). Homozygosity for the 22ql3.33 SV allele is associated withAttorney Docket No. 11716-026WO1

[0281] lower NHIP expression and less protection, likely because the enhancer-promoter loop forms less efficiently because of the > 15% increased size of the loop. For the minority of TD children who were also homozygous for the 22ql3.33 SV, the use of prenatal vitamins that can reduce the consequences of oxidative stress have been one source of associated protection from risk, although other genetic and environmental factors not investigated are also involved. Because the NHIP-associated insertion is only detectable in whole genome sequencing studies, not whole exome or SNP arrays, this study used an unconventional approach to identify a new gene locus of potential relevance to ASD etiology.

[0282] Materials and Methods

[0283] Sample population and diagnostic classification

[0284] The Markers of Autism Risk in Babies - Learning Early Signs (MARBLES) study recruited mothers with at least one child who had been diagnosed with ASD and who were pregnant or planning another pregnancy in Northern California, primarily through lists provided by the California Department of Development Services. The following criteria were required for MARBLES study’s enrollment: the prospective chi id has at least one first or second-degree relative diagnosed with ASD; the mother is at least 18 years old; the mother is pregnant or planning for a pregnancy; the mother speaks, reads, and understands English proficiently enough in order to complete the protocol; and the mother lives within a 2.5-h drive distance of Davis / Sacramento region. Demographic, diet, and medical information were collected by prospective telephone interviews or questionnaires throughout the pregnancy. For this analysis, a discovery set of 46 placentae from children subsequently diagnosed with ASD and 46 placentae from children subsequently found to have typical neurodevelopment (TD) was sequenced. An internal WGBS replication group included 65 additional MARBLES placenta samples (ASD n = 21, Non-'I'D n = 13, TD n = 31). Finally, whole genome sequence data were available on 41 ASD and 37 TD MARBLES children, w'liich were used for SNP and SV analyses to characterize WGBS findings.

[0285] The Early Autism Risk Longitudinal Investigation (EARLI) study recruited pregnant mothers who already have a child diagnosed with ASD which has been described in detail previously. EARLI families were recruited from four sites (Drexel / Children’s Hospital of Philadelphia, Johns Hopkins / Kennedy Krieger Institute, Kaiser Pemianente Northern California, and the University of California, Davis) across three US regions (Southeast Pennsylvania, Northeast Maryland, and Northern California). Enrollment criteria for EARLI were as follows: having a biological child diagnosed with ASD; communicating fluently in English or Spanish,Attorney Docket No. 11716-026WO1

[0286] being 18 years or older; living within a 2-h drive distance from the study site; and being less than 2.9 weeks pregnant. For replication analysis of the initial MARBLES WGBS findings, 47 placenta samples (ASD n = 16, I'D n = 31) were available from the EARLI study.

[0287] In both MARBLES and EARLI studies, the subsequent child diagnosis was clinically assessed by trained, professional examiners at 36 months using standardized instruments including the Autism Diagnostic Observation Schedule (ADOS), Autism Diagnostic Interview-Revised (ADI-R), and Mullen Scales of Early Learning (MSEL). Based on a previously published algorithm, children were classified into three outcome groups: ASD, TD, and Non-TD. Children with ASD had scores over the ADOS cutoff and fit ASD DSM-5 criteria. Children with TD had all MSEL scores within 2 standard deviations (SD), and no more than one MSEL subscale 1.5 SD below the normative mean together with scores on the ADOS at least three points lower than the ASD cutoff. Children with Non-TD did not meet ASD or TD criteria but had elevated ADOS scores and low MSEL scores, defined as two or more MSEL subscales with more than 1.5 SD below the normative mean or at least one MSEL subscale more than 2 SD below the normative mean.

[0288] Whole genome bisulfite sequencing (WGBS) library preparation

[0289] The placental samples were frozen within 4 h after birth. DNA was extracted from placenta tissue with the Centra Puregene kit (Qiagen, Hilden, Germany) and quantified with the Qubit DNA Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA). The discovery group included 92 samples (ASD n = 46, TD n = 46) from the MARBLES study that were used for both WGBS and WGS. For WGBS, DNA was bisulfite converted with the EZ DNA Methylation Lightning kit (Zymo, Irvine, CA, USA). WGBS libraries were prepared from bisulfite-converted DNA using the TruSeq DNA Methylation kit (Illumina, San Diego, CA, USA) with indexed PCR primers and a 14 cycle PCR program. Libraries were sequenced at 2 per lane with 1 0 bp paired end reads in Illumina HiSeq X (San Diego, CA, USA) by Novogene (Sacramento, CA, USA). The external replication group included WGBS data from 47 samples (ASD n = 16, TD n = 31) from the EARLI study, with details described previously. The specificity replication group included 65 samples (ASD n = 21, Non-TD n = 13, TD n = 31) from the MARBLES study. DNA was sonicated to ~ 350 bp using a Covaris E220 (Woburn, MA, USA). Sonicated and size-selected DNA was bisulfite converted using the EZ DNA Methylation Lightning kit (Zymo, Irvine, CA, USA). WGBS libraries were prepared using Accel-NGS Methyl -Seq DNA library kit (Swift Biosciences, Ann Arbor, MI, USA) with indexed PCR primers and a 12-cycle PCR program. Libraries were pooled and sequenced on 2 lanes with 150 bp paired end reads of Illumina NovaSeq 6000 S4 (San Diego, CA, USA) by the DNA Tech Core at University of California, Davis (Davis, CA, USA). WGBSAttorney Docket No, 11716-026WO1

[0290] alignment and quality control. Raw sequencing files were preprocessed, aligned to the human reference genome, and converted to CpG methylation count matrices with the default parameters in CpG_Me. Reads were trimmed to remove adapters and methylation bias on both 5' and 3' ends. After trimming, reads were aligned to human reference genome hg38 and filtered for PCR duplicates. Cytosine methylation reports were generated using all covered CpG sites. Quality control was examined for each sample and independently between the three sample cohorts because of the different sequencing platforms used. libraries with CHH methylation greater than 2% were excluded as incomplete bisulfite conversion. The CpG_Me workflow incorporates Trim Galore, Bismark, Bowtie2, SAMtools, and MultiQC.

[0291] Global methylation and principal component analysis (PCA)

[0292] DNA methylation at 20-kb windows sliding across the genome was extracted using the getMeth function in the base R package. Percent methylation for each sample at each window was calculated using the average methylation value from the window. Correlations between DMRs were calculated using Pearson’s correlation coefficient. Principal component analysis (PCA) was performed using the prcomp function in the stats R package and visualized using ggbiplot. The ellipses for each group were illustrated as the 95% confidence limit.

[0293] Methylation array analysis and cell type estimation

[0294] The same 92 placenta DNA sample aliquots in the discovery group (ASD n = 46, TD n= 46) were used for DNA methylation array analysis. DNA was treated and cleaned with the EZ DNA methylation gold kit (Zymo, Irvine, CA, USA). Samples were assayed on the Infinium MethylationEPIC array (Illumina, San Diego, CA, USA) at John Hop- kins University CIDR (Baltimore, MD, USA). Raw image files were analyzed using the minfi R package. Data were corrected for background and dye bias with the normal -exponential by out-of-band probe (noob) method. Cell type composition of placenta (trophoblast cells, stromal cells, Hofbauer cells, endothelial cells, and nucleated red blood cells) was estimated from DNA methylation array in the discovery group, WGBS methylation in the external replication and specificity replication group using a sorted placenta cell reference by PlaNET.

[0295] Detection of DMRs

[0296] DMRs were identified between ASD and TD in the discovery group through DMRichR, with 100 permutations and adjustments for sex and cell types. DMRichR utilized the dmrseq and bsseq algorithms to process methylation levels from a CpG count matrix and identify DMRs. The DMR analysis approach used a smoothing and weighting algorithm that weighs CpGs based on coverage. CpGs in physical proximity with similar methylation values were grouped into candidateAttorney Docket No. 11716-026WO1

[0297] background regions to estimate region statistics. In permutation testing, DMR percent methylation values were randomly shuffled between diagnosis groups and pooled together to form an approximate null distribution using bsseq. The empirical p value was calculated by comparing the observed test to the entire null distribution from all permutation tests to identify significant DMRs. Further correction for genome-wide significance used an FDR of 0.05. Repeating the DMR permutation test with 90 instead of 100 permutations did not change the number of DMRs detected (134 significant by empirical p value, 1 after FDR correction). Individual smoothed methylation levels and chr22q block methylation levels were obtained using the bsseq R package.

[0298] Genes were assigned to DMRs using the Genomic Regions Enrichment of Annotation Tool (GREAT) tool with the default association settings (5 kb upstream, 1 kb downstream, and 1000 kb max extension). The distances (kb) were calculated from DMRs to the transcription start site (TSS) of the GREAT assigned genes. Gene Ontology (GO) enrichment analysis for DMRs, hypermethylation DMRs, and hypomethylation DMRs relative to background regions was done using GREAT. Significant terms were called with FDR-corrected p values less than 0.05.

[0299] Placenta DMR enrichment analysis

[0300] DMRs were examined for enrichment with chromatin marks compared to the background regions using the LOLA R package with Fisher’s exact test followed by FDR correction. Chromatin states were predicted by ChromHMM, which uses a Hidden Markov Model to separate the human genome into 15 functional states based on data from the Roadmap Epigenomics Project]. Promoter-related states included active TSS (TssA) (red), TSS flank (TssAFlnk) (orange- red), bivalent TSS (TssBiv) (Indian Red), and bivalent TSS flank (BivFlnk) (Dark Salmon) states. Enhancer-related states included genic enhancer (EnhG) (Green Yellow), enhancer (Enh) (Yellow), and bivalent enhancer (EnhBiv) (Dark Khaki). CpG island, shore, shelf, and open sea coordinates were obtained from the annotate R package. Encyclopedia of DNA Elements (ENCODE) datasets were used to extract histone post-translational modifications (PTMs), including H3K4mel, H3K4me3, H4K9me3, H3K36me3, H3K27me3, and H3K27ac datasets. Enrichment for known transcription factor binding site motif sequences in DMRs was obtained using Hypergeometric Optimization of Motif EnRichment (HOMER).

[0301] Participant whole genome sequencing (WGS) and variant calling

[0302] WGS was performed using cord blood DNA from a subset of the same individuals in the discovery group (ASD n = 41, TD n = 37). Sequencing libraries were generated using the NEBNest DNA library prep kit (NEB, Ipswich, MA, USA) with 150 bp paired end reads in Illumina HiSeq X (San Diego, CA, USA) by Novogene (Sacramento, CA, USA) with at least 30x coverage perAttorney Docket No, 11716-026WO1

[0303] sample. Raw read files were mapped to human reference genome hg38 using Burrows-Wheeler Aligner (BWA) with the default settings. SAMtools was utilized to sort the bam files and Picard was used to merge bam files from the same sample and identify duplicate reads. Single-nucleotide polymorphisms (SNPs) and small insertions and deletions (InDels) were called using GATK and variants were annotated using ANNOVAR. Copy number variations (CNVs) longer than 50 bp were identified using control-FREEC and CREST. Structural variant (SV) detection and genotyping larger than 50 bp, were performed using DELLY with the default settings. The criteria included filtering for minor allele frequency (MAF) > 5%. The association of the DMR is taken from individual methylation levels using bsseq, and variants by linear regression.

[0304] Polygenic risk score (PRS) generation

[0305] A subset of individuals from the discovery group were also genotyped using the Illumina Multi-Ethnic genotyping array (ASD n = 31, TD n = 35). Stringent QC criteria were used on the raw genotypes in order to remove low-quality SNPs and samples. The criteria included removal of samples with call rates < 98%, sex discrepancy, and relatedness (pi-hat < 0.18) to non-familial samples by filtering out MAF < 5% using PLINK software. After data cleaning, the imputation pipeline was performed using the University of Michigan Imputation Server with minimac4 software to the 1000G Phase v5 reference panel (hg19). Phasing was performed using Eagle software. PRS calculation was performed on the imputed genetic data after applying post imputation filtering (R-squared > 0.80). PRS was informed by discovery GWAS results from the combined PGC-iPSYCH genome-wide meta-analysis and generated at a range of paiscovery thresholds (paiscovery threshold range from 1 x 10“8to 1.0). Using PLINK software, correlated SNPs were removed and applied from 2 to > 20,000 effect sizes to achieve a weighted summation of alleles representing a PRS for ASD risk.

[0306] After evaluating via logistic regression, the R2from a model of ASD on ASD-PRS ranging across the discovery thresholds and adjusting for genetic ancestry, we determined that a pdiscovery of 0.05 achieved the best fit, and thus used this score in further analyses. The association of the 22q13.33 co-methylated block % methylation, taken from individual smoothed chr22q block methylation levels obtained using bsseq, and diagnosis with PRS was tested by analysis of variance (ANOVA), with replication by linear regression, with PRS as the dependent variable.

[0307] Participant genomic insertion characterization and Sanger sequencing

[0308] To validate the 22q13.33 insertion from Illumina WGS data, the expected genomic location of the insertion was queried in a published PacBio long-read sequencing dataset (Fig. 14). The insertion was identified as located at the CHMl__chr22-49029645-INS-1673 contig. The contigAttorney Docket No, 11716-026WO1

[0309] was in a fasta file with accession number GCA.003709635.1 with the correspondence table, it was also named with GenBank ID QPKN01007947.1 in the NCBI database. SAMtools was utilized to isolate the fasta sequence from the contig (85,271 bp in length) and extract the insertion sequence (1673 bp in length)(SEQ ID NOS: 5, 6, and 7). The QPKN01007947.1 contig mapped to chr22: 49,381,532-49,466,902 (reference genome: hg 19) using blat and the insertion was visualized using Miropeats.

[0310] In addition to characterizing the insertion using PacBio long-read sequencing, primer sets were designed to span the insertion location for PCR-based genotyping (SEQ ID NOS: 5, 6, and 7). A 25 µl PCR reaction mixture contained 100 ng genomic DNA, 5 µl 5x LongAmp Taq reaction buffer (NEB, Ipswich, MA, USA), 1 µl LongAmp Taq DNA polymerase (NEB, Ipswich, MA, USA), 1 µl 10 mM dNTPs, and 2 µl of 10 µM for- ward and reverse primer. The PCR amplifications were performed using the following conditions: initial denaturation at 94 °C for 30 s; 30 cycles of denaturing at 94 °C for 30 s, 52 °C for 30 s, and 65 °C for 2 min with a final extension at 65 °C for 10 min. PCR products were subjected to a Topoisomerase (TOPO) PCR Cloning Kit (Thermo Fisher Scientific, Waltham, MA, USA) followed by a 1.5% agarose gel electrophoresis with purification and Sanger sequencing by University of California, Davis DNA Sequencing Facility (Davis, CA, USA), and chromatograms were analyzed using SnapGene (Gene- wiz, South Plainfield, NJ, USA). PCR product genotype and size were characterized using the Bioanalyzer 2100 (Agilent, Santa Clara, CA, USA). The sequence of the insertion was analyzed for repetitive elements using CENSOR and RepeatMasker.

[0311] Cell culture, cell-based assays, and transfection

[0312] LUHMES cells (ATCC, Manassas, VA, USA, CRL-2927) were seeded on fibronectin-coated plates (Thermo Fisher Scientific, Waltham, MA, USA, CWP001, 354402). Undifferentiated cells were maintained in proliferation medium: Advanced DMEM / F12 (Invitrogen, Carlsbad, CA, USA), supplemented with N2 supplement (Invitrogen, Carlsbad, CA, USA), Penicillin-streptomycin-glutamine (Thermo Fisher Scientific, Waltham, MA, USA), and 40 ng / ml recombinant bFGF (Invitrogen, Carlsbad, CA, USA). To generate differentiated LUHMES, cells were switched to differentiation media for 5 days. Differentiation media comprised advanced DMEM / F12, supplemented with N2 supplement, Penicillin-streptomycin-glutamine, 1 mM dbcAMP (MilliporeSigma, Burlington, MA, USA), 1 µg / ml tetracycline (Neta Scientific, Hainesport, NJ, USA), and 2 ng / ml recombinant human GDNF (Thermo Fisher Scientific, Waltham, MA, USA). For cell viability and hydrogen peroxide production experiments, differentiated cells were grown in 96- well plates for 6 days prior to treatment with CellTiter BlueAttorney Docket No. 11716-026WO1

[0313] or ROS-Glo visualization reagent (Promega, Madison, WI, USA). Undifferentiated cells were plated in 96-well plates at the same densities as differentiated neurons and treated identically for cell viability and hydrogen peroxide measurements. For RNA quantification, cells were maintained in 6-well plates. Challenges with hydrogen peroxide (MilliporeSigma, Burlington, MA, USA), cobalt chloride (Thermo Fisher Scientific, Waltham, MA, USA), or mock treatment were carried out after 5 days of differentiation, and cells were treated for 24 h before analysis.

[0314] An overexpression NHIP plasmid, NHIP-eGFP, was synthesized by VectorBuilder (Chicago, IL, USA) with EF-la as the promoter for NHIP and CMV as the promoter for eGFP fused with a puromycin resistance gene (SEQ ID NOS: 1, 2, 3, and 4; Fig. 9). A control plasmid was cut using Xbal and Abai restriction endonucleases based on NHIP-eGFP, named NEG-eGFP, with NHIP removed and the rest of plasmid structure maintained (SEQ ID NOS: 1, 2, 3, and 4; Fig. 9). The plasmid for the NHIP peptide, NHIP peptide-eGFP, was synthesized by VectorBuilder with EF-la as the promoter for the NHIP peptide, and the stop codon removed and fused to the end of the NHIP peptide with eGFP, together with CMV as the promoter for mCherry fused with a puromycin resistance gene (SEQ ID NOS: 1, 2, 3, and 4; Fig. 2G). All constructs were sequenced with Sanger sequencing by the University of California, Davis, DNA Sequencing Facility (Davis, CA, USA) and analyzed using SnapGene (Genewiz, South Plainfield, NJ, USA) to confirm the expected sequence.

[0315] HEK293T cells (ATCC, Manassas, VA, USA, CRL-11268) were grown in DMEM / F12, GlutaMAX medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with MEM non-essential amino acids (Thermo Fisher Scientific, Waltham, MA, USA) and 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA) together with Penicillin-streptomycin-glutamine. Low passage HEK293T cells were transfected with plasmids using Lipofectamine 3000 and Opti-MEM (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Transfections were performed using HEK293T cell lines for each condition. The transfection medium was replaced 24 h post- transfection with complete growth media with puromycin at 3 pg / ml for 7 days.

[0316] All cells were maintained at 37 °C containing 95% O₂ and 5% CO₂. Images were taken using an EVOS microscope under the magnification labeled in the images. Cell numbers were measured using the Countess II FL automated cell counter (Thermo Fisher Scientific, Waltham, MA, USA) under the default steps by mixing 10 µl of samples with 10 µl of trypan blue. CellTiter Blue reagent was used to measure cell viability using luminescence based on manufacturer instructions (Promega, Madison, WI, USA). H₂O₂ production representing relative reactiveAttorney Docket No. 11716-026WO1

[0317] oxygen species (ROS) level was measured with the ROS-Glo H₂O₂ assay system using 50 nM with the default settings with level measured by luminometer (Promega, Madison, WI, USA).

[0318] HEK293T whole cell lysates were prepared by resuspension in lx RIPA buffer and sonication using a Diagenode Bioruptor 300 (Diagenode, Denville, NJ, USA) followed by centrifugation at 21,130xg at 4 °C to remove insoluble material and then resolved on a 4-15% SDS-PAGE gel (Bio-Rad, Hercules, CA, USA). The SDS-PAGE gel was rinsed in three changes of water to remove SDS and stained with Imperial protein stain (Thermo Fisher Scientific, Waltham, MA, USA) to visualize proteins. Stained bands between 25 and 37 kDa were carefully excised from the gel, washed in three changes of 50 mM ammonium bicarbonate followed by three washes with acetonitrile, then swollen in 10 mM DTT in acetonitrile and incubated at 56 °C for 30 min to reduce disulfide bonds. The gel pieces were next shrunk by incubation in acetonitrile, then incubated in 55 mM iodoacetamide (IAA) in 50 mM ammonium bicarbonate prior to washing with 50 mM ammonium bicarbonate, then shrunk with acetonitrile and dried in a speed vac. Gel pieces were suspended in 50 mM ammonium bicarbonate with 0.01% Protease Max (Promega, Madison, WI, USA) and treated with trypsin (Promega) for 4 h at 50 °C. The NHIP / GFP fusion protein was detected from the resulting peptides by LC / MS-MS. MS was performed at University of California, Davis Proteomics Core Facility.

[0319] NHIP peptide immunofluorescence staining utilized a custom polyclonal antibody that was produced in Rabbit by GenScript Inc (Piscataway, NJ, USA) to a truncated NHIP peptide MVRGEATARTEEAMC (SEQ ID NO: 8) and affinity purified. Flash frozen human cortical tissues were fixed in 4% formaldehyde in lx PBS for 72 h, then dehydrated by immersion in 70% ethanol for 7 days and embedded in paraffin. Five-micrometer sections were cut from embedded brain tissue and mounted on glass slides then baked for 4 h at 56 °C. Tissues on slides were washed in four changes of xylene to remove paraffin. Next, slides were washed in two changes of 100% ethanol which was removed by heating to 50 °C on a heat block. The slides were then treated with lx DAKO antigen retrieval solution (Agilent, Santa Clara, CA, USA) at 95 °C for 1 h in a water bath. Slides were washed five times in lx PBS with agitation. To reduce endogenous autofluorescence, slides were immersed in lx PBS and exposed to LED light for 24 h. Slides were next incubated with lx PBS / 0.5% Tween 20 / 3% BSA for 1 h at 37 °C to block background signals then washed three times in lx PBS / 0.5% Tween 20. Anti-NHIP peptide and control pre-immune antibodies were diluted 1 / 200 in lx PBS / 0.5% Tween 20 / 3% BSA and incubated on slides at 37 °C overnight in a humid chamber before three washes in lx PBS / 0.5% Tween. Goat anti-Rabbit Alexa 594 (Thermo Fisher Scientific, Waltham, MA, USA, Catalog #A32740) was diluted in lxAttorney Docket No. 11716-026WO1

[0320] PBS / 0.5% Tween20 / 3% BSA with 5 pg / ml DAPI and added to slides for 2 h at 37 °C in a humid chamber. Slides were washed five times in lx PBS / 0.5% Tween 20 with shaking before mounting in 5 ug / ml DAPI in 50% glycerol and application of glass coverslips.

[0321] RNA extraction, cDNA synthesis, and RT-PCR

[0322] Total RNA was isolated from HEK293T cells transiently transfected with NHIP-eGFP or negative control NEG-eGFP using the AllPrep DNA / RNA / Protein mini kit (Qiagen, Hilden, Germany). Human tissue total RNA samples were obtained commercially, including placenta (Life Technology, Carlsbad, CA, USA), testes (TaKaRa Bio, Kusatsu, Shiga, Japan), and fetal brain (Cell Applications, San Diego, CA, USA). RNA was extracted from frozen placenta samples in the Discovery group samples using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) based on the manufacturer’s protocol. TaqMan Gene Expression Assays for LOC105373085 (renamed as NHIP) (assay ID: Hs01034248_s1), BRD1 (Hs00205849_m1), FAM19A5 (Hs00395354_m1), and GAPDH (assay ID: Hs02786624_gl) were used (Thermo Fisher Scientific, Waltham, MA, USA). The expression of 3 genes of interest and 1 reference gene were examined by real-time TaqMan PCR assay (Thermo Fisher Scientific, Wai- tham, MA, USA). Expression levels were determined by the probes with optimized primer and probe concentrations. Quantification was accomplished with RT-PCR machine using TaqMan Fast Advanced Master Mix with the default parameters by the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). Reactions were performed with three biological replicates. Fold changes of transcript levels were measured using the Fluidigm Real-Time PCR Analysis software with fold change of gene expression calculated as the delta delta CT normalized to GAPDH (Fluidigm, San Francisco, CA, USA).

[0323] Brain sample acquisition

[0324] Human brain samples were obtained from the NICHD Brain and Tissue Bank for Developmental Disorders at the University of Maryland (Baltimore, MD, USA). RNA from the frozen human brain was purified using All Prep DNA / RNA / Protein mini kit (Qiagen, Hilden, Germany).

[0325] RNA-seq library preparation and sequencing

[0326] RNA from cells and brain was prepared as RNA-seq libraries using Kapa RNA HyperPrep kits (Roche, Basel, Switzerland) together with the QIAseq FastSelect Human ribodepletion kit (Qiagen, Hilden, Germany). Libraries were assessed for quality and quantified on the Agilent Bioanalyzer 2100, and then pooled for multiplex sequencing with at least 25 million reads withAttorney Docket No. 11716-026WO1

[0327] 150 bp paired end reads on the Illumina NovaSeq 6000 S4 (San Diego, CA, USA) by the DNA Tech Core at University of California, Davis (Davis, CA, USA).

[0328] RNA-seq data processing and differential gene expression (DGE)

[0329] Raw fastq files were processed and aligned using STAR. After the quality control steps by FASTQC, the count matrixes were generated using featureCounts. Count matrixes were filtered for at least one count in any sample. Size factor estimation and normalization were performed by DESeq2. DGE was generated compared to overexpressed NHIP and negative control cells using DESeq2 (FDR-corrected p value < 0.05). DGE for brain was analyzed by using normalized read count for NHIP levels as a continuous trait using DESeq2 (FDR-corrected p value < 0.05). In brain, the normalized read count for NHIP transcripts were adjusted for potential co- variates of sex, age, brain region, and PM1 using DESeq2 (FDR-corrected p value < 0.05). Gene overlaps between different experiments were tested for significance using Fisher’s exact test in the GeneOverlap R package compared to all genes expressed in at least one read in any sample.

[0330] Gene Ontology terms for DGE were identified using clusterProfiler on Gene Set Enrichment Analysis using gseGO function with 1000 permutations. Normalized enrichment scores (NES) were calculated for enrichment after correcting for multiple testing with FDR. The dotplots illustrate significant GO terms based on GeneRatio, calculated from the number of overlapped genes divided by the total number of genes in the gene set, GO terms to be included in the plots were selected based on GeneRatio ranking. The enrichment map was plotted using the emapplot function by clustering mutually overlapping gene sets to form functional modules. The ridge plot was plotted using the ridge plot R function to visualize expression distributions of core enriched genes. The cent plot depicted the linkages of genes and biological concepts as networks.

[0331] Example 6: Saliva-based autism screening by MSA

[0332] Autism prevalence is increasing worldwide, and diagnosis requires specialized behavioral assessment by trained clinicians. There is an unmet need for molecular diagnostic strategies to conveniently assess the likelihood of autism in young children so that they can equitably receive behavioral diagnosis and intervention. The current invention successfully identified epigenomic signatures of idiopathic autism in postmortem brain, newborn blood spots, cord blood, and placenta using whole-genome bisulfite sequencing (WGBS). Additionally, saliva data from the autism case- control CHARGE cohort detected several differentially methylated genes found in other tissues (Fig.

[0333] 19). This includes NHIP, a novel protective gene for autism that is in a highly polymorphic correlated (CoRSIV) region of chromosome 22 that was poorly represented on prior arrays (Fig. 20).Attorney Docket No. 11716-026WO1

[0334] The MSA, containing 22 promoter and 33 CoRSIV probes for NHIP, is an ideal platform for assessing NHIP genotypes and epigenotypes in children with autism and their parents because of the integration of common genetic variants into the probe design and analyses. The CHARGE cohort is deeply clinically phenotyped, with autism severity and cognitive outcome measurements as well as extensive environmental exposure measurements, making the currently available saliva DNA samples (>600 children, >1000 parents) ideal for MSA analyses. We can perform an unbiased discovery of differential CpGs and differentially methylated regions between autism (n=238) with each of typical (n=203), developmental delay (n=86) and other early concerns (n=73) controls, as well as associations with a continuous variable of autism severity (ADOS). In addition, we can perform an analysis of genetic and epigenetic inheritance patterns over the NHIP locus (and other new loci) in autism trios (n=204). We can further use machine learning approaches to determine the best panel of predictors of autism. Thus, we have developed a potential screening test for autism in saliva samples that could be further tested for accuracy in other cohorts.

[0335] Example 7: To evaluates NHIP as a product to improve IVF embryo competency through improved redox balance

[0336] NHIP mRNA and NHIP peptide demonstrate protective activity with multiple delivery approaches, and the micro peptide is directly taken up by cells in culture. A CRISPR Cas9 knockout of the NHIP peptide coding region exhibits significantly elevated baseline levels of reactive oxygen species (ROS) using both lytic and non lytic fluorescent ROS indicators (Fig.

[0337] 23A). When synthetic NHIP peptide is added directly to cultures of differentiated human neurons prior to a 24 h hypoxia exposure, ROS levels are significantly reduced at concentrations ranging from 10 pM to 1 nM (Fig. 23B). Flow cytometry confirms intracellular uptake of NHIP FITC labeled peptide within 24 h of culture (Fig. 23C). In mouse embryonic neural precursor cells (NPCs), NHIP peptide added directly to culture media significantly reduces ROS levels at 1 nM in wild type cells but not in MeCP2 deficient cells, with no significant effect on cell viability (Fig.

[0338] 24A through Fig. 24E). Dose response analysis using fluorescently labeled FAM tagged NHIP peptide and unlabeled NHIP peptide demonstrates that both forms reduce ROS at concentrations greater than 10 nM, whereas the unlabeled peptide is effective at 1 pM (Fig. 24C). These findings support the conclusion that NHIP reduces ROS levels in embryonic cells from non primate mammalian species despite the absence of endogenous NHIP in their genomes, consistent with NHIP acting as a recently evolved natural mimetic of transcriptional regulators including theAttorney Docket No. 11716-026WO1

[0339] MeCP2 TBL1XR1 axis. The data further indicate that fluorescent labeling partially reduces cellular uptake of NHIP peptide.

[0340] NHIP and its downstream pathways demonstrate relevance to fertility and embryo competency. In addition to NHIP expression within reproductive tract tissues (Fig. 21), epigenetic changes in NHIP are observed in cell types relevant to in vitro fertilization. In a primate model of preconception stress involving 3 months of environmental stress exposure prior to oocyte retrieval, NHIP is significantly hypo methylated in cumulus cells as well as in matched oocytes and embryos derived from stressed females relative to controls (Fig. 25). Evidence of embryo competency markers is also present among NHIP regulated transcripts and protein binding targets. Of the 8 transcripts identified by machine learning analysis to quantify the embryo competency index in bovine in vitro fertilization, 5 are altered in RNA sequencing analysis following NHIP overexpression in human HEK293 cells, with 3 altered in the competency associated direction, including increased TP1 and decreased YWHAG and CCNA2. The YWHAG encoded 14 3 3 protein is also identified as an NHIP binding partner in human ASD brain tissue.

[0341] Deficiency of Tbl Ixrl in mice results in reduced spermatozoa motility through disruption of histone to protamine chromatin transition. Reduced TBL1XR1 protein levels are also observed in spermatozoa from human patients with asthenozoospermia compared to healthy controls, establishing a link between the MeCP2 NHIP TBL1XR1 axis (Fig. 22) and human infertility. NHIP promoter methylation at the cgl5192736 CpG site associated with oxidative stress is additionally correlated with reduced sperm viability. To systematically evaluate the overlap between NHIP regulated genes and genes involved in embryo competency, the top 500 differentially expressed genes from NHIP overexpressing HEK293 RNA seq are queried together with the term embryo competency using Rummagene.

[0342] NHIP peptide during in vitro culture of cow embryos improves the rate of embryo cleavage. A pilot study evaluates the safety and efficacy of 2 NHIP peptide modifications and doses added to in vitro culture (IVC) media on bovine embryo morphokinetics in collaboration with an external research group (Fig. 26). A fluorescent FAM tag is included to enable intracellular detection of NHIP, while PEGylation combined with a less bulky biotin tag (NHIP PEG bio) is used to improve peptide stability. Both peptides are synthesized at 98% purity (Genscript). In Fig. 26, each datapoint represents a replicate of approximately 50 starting oocytes, with 4 replicates per NHIP peptide and dose, corresponding to n approximately 200 embryos per condition. Significant improvements in cleavage rates at Day 2 relative to nontreated control (NTD) are observed for both NHIP peptides at the 1 ng / ml (400 nM) dose, with all values exceeding 90%, although theAttorney Docket No. 11716-026WO1

[0343] effect is greater with NHIP PEG bio at 2.45% compared w'ith NHIP FAM at 1.9%. No significant effects of NHIP are observed in Day 7 to Day 8 blastocyst (BC) or hatched (Hcd) rates; however, all NHIP treatments show positive effects on both BC and Hcd at Day 8, with 3 conditions trending (p<0.2) and demonstrating 6% to 7% rate improvements. Collectively, these preliminary results demonstrate that bovine I VC provides an effective system for evaluating the safety and efficacy of NHIP peptide supplementation and provide preliminary evidence that NHIP peptide improves embryo cleavage rates, a parameter that correlates strongly with pregnancy success.

[0344] Example 8: To test the effect of NHIP in IVF culture on bovine embryo development and competency index

[0345] Evaluation of NHIP in IVF culture on bovine embryo development and competency is conducted to determine its effects on embryonic outcomes. The dairy cattle industry routinely employs IVF as a reproductive strategy because it enables genetic and sex selection, resulting in female offspring with increased milk production. However, the live birth success rate from IVF in cattle remains relatively low at 30% to 50%. Similar to human IVF, bovine oocytes and early stage embryos exhibit high sensitivity to exogenous factors including temperature, pH, oxygen, and lipid composition. The culture environment exposes embryos to multiple cellular stresses that contribute to reduced developmental competence. As in human IVF, there is uncertainty regarding whether greater oxidative stress arises from metabolic waste accumulation in static culture without media change or from repeated handling during sequential culture that alters oxygen tension, pH, and temperature while attempting to mimic in vivo development.

[0346] As a preclinical model for human IVF, cow provides several advantages over mouse for evaluating NHIP efficacy and safety. Large numbers of oocytes are obtained simultaneously and cost effectively from ovaries collected post slaughter, enabling testing of approximately 200 embryos on a biweekly basis over the first 2 years, corresponding to approximately 16000 embryos. Bovine oocytes undergo in vitro maturation (IVM), an approach also used in selected human IVF cases. In addition, bovine embryos closely parallel human preimplantation developmental timing, particularly with respect to zygotic genome activation (ZGA) and progression to the blastocyst stage. Both species exhibit a late major ZGA, occurring at the 4 to 8 cell stage in humans and the 8 to 16 cell stage in cow, whereas mice activate their genome earlier at the 2 cell stage. Bovine embryos reach the blastocyst stage on Day 7 to Day 8, closely aligning with the Day 5 to Day 6 timing in humans and differing from the rapid Day 4 blastocyst formation observed in mice. This similarity provides an appropriate window for assessing morphokinetic andAttorney Docket No. 11716-026WO1

[0347] molecular blastocyst competency indices at a human relevant stage. Preliminary results from NHIP exposure during IVM, in vitro culture (IVC), or both indicate that NHIP demonstrates the greatest efficacy during IVC, and experimental efforts therefore focus on defining the NHIP target product profile within this IVC model.

[0348] Experiments are conducted to determine optimal NHIP modifications for stability and efficacy in bovine IVC. To evaluate NHIP peptide stability, embryo uptake, and effects on efficacy, 5 NHIP peptide variants are tested. These include NHIP PEG bio, a negative control FLAG PEG bio sharing the same N terminal sequence and modifications with NHIP but substituting FLAG for the C terminal 9aaTAD, NHIP enh PEG bio containing a single amino acid substitution to create a perfect 9aaTAD match, NHIP enh without modifications, and NHIP WT representing the native 20 aa peptide without modifications. Two doses of each peptide are tested at 1 ng / ml (400 pM) and 1 pg / ml (400 nM), added to IVC media as described above. To assess peptide stability in the absence of embryos, peptide plus media only controls are established in parallel. Following morphokinetic assessment at Days 2, 7, and 8, spent media and embryos are collected and assayed for NHIP peptide levels alongside media only controls. For efficacy analysis, 6 replicates per condition corresponding to 300 embryos per condition are compared for significant differences in cleavage rate on Day 2 and blastocyst and hatching rates on Days 7 and 8. For stability analysis, peptide concentrations in media and embryos are determined using a NHIP and or bio(SA) ELISA. Additional IVC embryo samples are collected at Days 2, 4, and 6 for stability assessment, with 100 embryos per condition.

[0349] Based on the results shown in Fig. 26, NHIP PEG bio is expected to demonstrate significantly increased cleavage rates at Day 2 relative to negative control FLAG PEG bio and NTC. NHIP enh PEG bio is anticipated to provide additional efficacy relative to NHIP PEG bio. Peptides containing PEG modifications are expected to exhibit increased stability and corresponding efficacy compared to unmodified peptides, although accelerated NHIP turnover remains a potential contributor to enhanced biological activity.

[0350] Methods

[0351] General bovine IVM, IVF, and IVC procedures are conducted in a veterinary assisted reproductive technology laboratory. Bovine ovaries are obtained from a local slaughterhouse and maintained at room temperature during transport. Cumulus oocyte complexes (COCs) are aspirated from 2 mm to 8 mm follicles and selected under a stereomicroscope. Each experiment includes groups of 50 COCs matured in 500 pL of BO IVM medium at 38.5°C in a humidified atmosphere containing 5% CO2 in air for 22 hours to 24 hours, followed by transfer to 4 wellAttorney Docket No, 11716-026WO1

[0352] culture dishes containing BO IVF medium. For fertilization, cryopreserved semen straws are thawed and sperm are washed twice by centrifugation in BO Semen Prep medium. The resulting sperm pellet is resuspended and added to BO IVF medium containing COCs to achieve a final sperm concentration of 2.0 × 106cells / ml. Insemination is performed overnight for approximately 16 hours at 38.5 °C under a humidified atmosphere of 5 % CO2. Following fertilization, presumptive zygotes are freed from residual cumulus cells and attached sperm by vortexing and transferred into BO IVC medium supplemented with NHIP peptide or without supplementation as a non treatment control (NTC). In vitro culture is conducted for 8 days at 38.5°C under 5% CO₂, 5% O₂, and 90% N₂. Embryo development is assessed by cleavage rate on Day 2 and by blastocyst and hatching rates on Days 7 and 8.

[0353] Statistics-To ensure rigor and minimize bias, embryo scoring is performed by an embryologist blinded to treatment conditions. Power analysis based on preliminary bovine IVC data demonstrates that detection of a 5% difference using a Mann Whitney test with a = 0.05 requires 550 embryos per treatment condition. With 50 COCs per replicate, this corresponds to 11 replicates per NHIP peptide dose relative to NTC accumulated across the study period. This sample size provides greater than 80% power to detect a 5% difference in cleavage rate and approaches 80% power for the more variable Day 7 to Day 8 blastocyst rates. For initial screening of 11 conditions corresponding to 5 peptide modifications tested at 2 doses plus NTC, 300 embryos per condition across 6 replicates are used, after which the most effective NHIP peptide design advances to evaluation using the full 550 embryo design.

[0354] Example 9: To determine optimal dosage of NHIP for morpho-kinetic efficacy and embryo competency

[0355] Experiments determine optimal dosage of NHIP for morpho kinetic efficacy and embryo competency. A component of the safety profile of the NHIP product is determination of the highest dosage at which toxicity or other detrimental effects on embryo development occur. Results demonstrate no significant reduction in blastocyst number by Day 7-8 at a dose lOOOx the effective dose (Fig. 26); however, evaluation of a broader dose range is required to optimize safe and effective supplementation. The NHIP peptide demonstrating the highest efficacy from prior experiments is selected, and 8 doses are evaluated at 0, 0.01, 0.1, 1, 10, 100, 1000, and 100000 ng / ml. A vehicle control equivalent to the highest dose is included to determine whether high dose toxicity is attributable to chemicals in the peptide solution, as shown in Fig. 26. Each dose is added to the IVC culture media as previously described and evaluated in 11 replicate cultures comprisingAttorney Docket No. 11716-026WO1

[0356] 550 embryos for cleavage rate on Day 2 and blastocyst and hatching rates on Days 7 and 8. On Day 7, pools of 5-6 hatched embryos are frozen, and RNA is isolated using the Norgen single cell RNA kit for RNA-seq using the SMART-Seq mRNA LP kit from Takara Bio, which is optimized for low input samples and performs reliably with single blastocysts. To determine the embryo competency index (ECI), normalized FPKM levels of 8 predictive genes, GSTO1, CHSY1, TPI1, YWHAG, CCNA2, LSM4, CDK7, and EIF4A3, are quantified using the previously published ECI algorithm. To further test the hypothesis that NHIP acts through epigenetic pathways, additional NHIP regulated transcripts implicated in embryo competency are examined, including DNA methyltransferases DNMT1 and DNMT3B, histone deacetylases HDAC1, HDAC3, HDAC4, and HD AC 10, and 3 IGF2 related genes IGF2R, IGF2BP1, and IGF2BP-AS1. Expression levels of these targeted transcripts are compared across NHIP doses using one way ANOVA with Dunnett’s post hoc test for multiple comparisons to NTC at 0 ng / ml. Sex ratios of each embryo pool are determined by calculating the ratio of male specific SRY to female specific XIST transcripts and are evaluated as a potential covariate. Differential expression analysis is performed to identify differentially expressed genes between NHIP supplemented and control hatched embryos. Raw sequencing reads are aligned to the bovine reference genome ARS-UCD1.2 using STAR, and gene level counts are quantified with featureCounts. Differential expression analysis is performed using limma-voom, which is suitable for small sample sizes with moderate biological replication. Genes with llog2FCI > 1 and FDR adjusted p < 0.05 are considered significant differentially expressed genes. To assess conservation of NHIP regulated pathways across species, bovine NHIP differentially expressed genes in cow embryos are compared to NHIP differentially expressed genes previously identified in NHIP overexpressing human HEK293 cells using Fisher’s exact test on orthologous gene pairs, with significance defined as p < 0.05 after Bonferroni correction. Gene ontology enrichment analysis is performed on significant differentially expressed genes using enrichR to identify overrepresented biological processes and molecular functions. Based on results shown in Figs. 23A-23C, 24A-24E, and 26, multiple NHIP peptide doses within the 0.01-100 ng / ml range corresponding to 4 pM-40 nM demonstrate significant differences relative to NTC and vehicle. The 1000 and 100000 ng / ml doses are nonsignificant or significantly harmful to blastocyst rate by Day 8, respectively. An effective NHIP dose is identified that is greater than lOOOx lower than a dose producing measurable harm. Based on overlap between NHIP regulated genes from human RNA-seq and ECI transcripts in the ECI algorithm, NHIP treatment increases the Day 7 ECI for at least 1 NHIP peptide dose. Additional epigenetic pathway transcripts demonstrate significant dose dependent changes across NHIP doses, with lower doses providing aAttorney Docket No, 11716-026WO1

[0357] protective effect on embryo competency.

[0358] Example 10: To determine the efficacy of NHIP supplementation to bovine freezing and thawing media

[0359] The effect of adding NHIP peptide to thawing media for bovine semen or to freezing and thawing media for Day 7 bovine blastocysts on measures of viability or competency is evaluated, respectively. Bull semen is thawed in the presence or absence of an effective NHIP peptide and dose determined from lai, 2 prior to the IVF stage. Sperm morphology and viability are assessed by a single observer and recorded using the SpemiVisionOSAR computer assisted sperm analysis (CASA) system from Minitube USA, Inc., Verona, WI 53593, as previously described. During the IVF stage, sperm pellets are resuspended in BO-IVF medium containing NHIP or control to achieve the effective dose when added to BO-IVF medium containing COCs. During the IVC stage, embryo development is assessed by cleavage rate on Day 2 and by blastocyst and hatching rates on Days 7 and 8 under the following conditions: thawing only, IVC only, thawing + IVC, NTC, with 550 embryos per condition. To determine whether NHIP supplementation improves reexpansion rates of vitrified embryos, vitrification of Day 7 embryos cultured in standard IVC media is performed in the presence or absence of a single effective dose of NHIP peptide in all vitrification solutions. In humans, Day 5 blastocysts correspond to bovine Day 7 blastocysts, and this serves as a pre-clinical model for NHIP treatment in freeze and thaw procedures for human IVF. Each embryo pool is thawed under the same treatment condition used during vitrification, and re-expansion and hatching rates are evaluated at 4, 2.4, and 48 h post-thaw while maintaining the same NHIP concentrations throughout under the following conditions: vitrification only, thawing only, IVC only, vitrification + thawing + IVC, vitrification + thawing, thawing + ICV, with 550 embryos per condition.

[0360] Supplementation of semen thawing media with NHIP peptide is expected to result in cellular uptake of NHIP within the zygote at an earlier developmental stage than achieved in IVC experiments, thereby further improving Day 2 cleavage rates beyond IVC alone. The presence of NHIP peptide in thawing media is expected to reduce oxidative stress in sperm and zygotes and to result in improved embryo morpho-kinetic scores. The largest improvements in embryo morpho- kinetics are expected in embryos that are vitrified, thawed, and cultured in the presence of NHIP peptide, as oxidative stress is present at all stages.

[0361] Example 11: To test the effect of NHIP in IVF thawing and culture on murine birthrate andAttorney Docket No. 11716-026WO1

[0362] neonatal health

[0363] Mouse IVF as a pre-clinical model complements the cow experiments for the following reasons. First, mouse IVF procedures use superovulation and mature oocyte harvest, which more closely resemble the majority of human IVF procedures than the oocyte IVM procedures used previously. Second, the mouse embryo assay (MEA) is performed across multiple NHIP peptide doses, which is required for FDA approval of IVF media supplements. Third, embryo transfer following IVF is performed more efficiently in mouse due to larger litter size and shorter gestation relative to cow, enabling adequate statistical power for determination of birthrate outcomes following NHIP supplementation. Fourth, mouse developmental phenotypes are efficiently screened using the SmithKline, Harwell, Imperial College, Royal Hospital, Phenotype Assessment (SHIRPA) primary observational assessment screen at postnatal day 7 (PND7).

[0364] Standard methods for mouse IVF are performed. Sperm harvesting is conducted on euthanized CBA male mice to expel clots of spermatozoa released from the cauda epididymides into drops of FERTIUP® (PM). Oocyte harvest is performed on hormone superovulated female C57B16 / J mice bred to vasectomized male mice, euthanized at gestational day 0.5, followed by dissection of the oviducts to release cumulus oocyte complexes (COCs) and transfer into CARD MEDIUM (200 L). Sperm are introduced into the oocyte culture and incubated overnight at atmospheric oxygen levels to allow fertilization. Resulting 2-cell embryos are surgically transferred into the oviducts of pseudo-pregnant female recipients for development into offspring.

[0365] NHIP dosage testing for safety is conducted using the FDA-recommended mouse embryo assay (MEA). The FDA recommends MEA testing on 1 to 2 cell mouse embryos derived from scientifically justified genetic hybrid mice for evaluation of IVF devices or culture media components. Recommended CBA-C57BL6 / J 2 -day IVF embryos are used, with 25 embryos per dose, and the same 8 NHIP doses plus a high-dose vehicle control evaluated previously. Embryos are cultured in IVC media with NHIP treatment for 72 h at atmospheric oxygen levels and scored for expanded blastocysts by a trained mouse embryologist blinded to treatment condition. Blastocyst percentages are compared between treatment groups using Mann-Whitney analysis. Competent blastocysts are pooled from each culture condition and frozen for RNA isolation using the Norgen single cell RNA kit. RNA-seq is performed using the SMART-Seq rnRNA LP kit. RNA-seq data are examined globally using PCA and clustering of transcriptomes and by differential gene expression analysis using LimmaVoom.

[0366] Based on results obtained using NHIP on cow embryos, mouse embryos treated with all effective NHIP doses are expected to exceed the FDA threshold of greater than 80% expandedAttorney Docket No, 11716-026WO1

[0367] blastocyst rates. The highest 1 mg / ml dose and or its vehicle control may fall below this threshold, as this concentration is 10 6 times the effective dose, enabling identification of a potential toxic dose. RNA-seq identifies genes and gene pathways associated with NHIP peptide efficacy or toxicity. Inclusion of a high-dose vehicle control enables determination of whether observed toxicity is attributable to the NHIP peptide or its resuspension media.

[0368] Embryo transfer success rates following NHIP supplementation in IVF culture and freeze thaw media are evaluated using the mouse IVF procedure described above under 3 supplementation conditions, including a negative control FLAG-PEG-bio and 2 doses of NHIP-PEG-bio. Peptide selection and dosing are determined empirically based on prior results. NHIP peptide doses are included in IVF and IVC culture media and freeze and thaw solutions, with inclusion outside IVC determined empirically. Approximately 200 blastocysts are generated per treatment condition, for approximately 600 total blastocysts, with a target of greater than 100 live births per condition, or approximately 315 total. To align embryo transfer timing and model vitrification and thawing procedures used in human IVF, all mouse embryos are vitrified on Day 2 of IVC using a 2-step process. In the first step, embryos are submerged in solutions containing ethylene glycol and DMSO. In the second step, embryos undergo ultra-rapid cooling in liquid nitrogen to prevent ice crystal formation. On the day of embryo transfer, vitrified embryos are rapidly warmed at 37 C and exposed to serial solutions with decreasing concentrations of cryoprotectants for gradual removal. Following cryoprotectant removal, embryos are cultured in standard medium prior to transfer into oviducts of surrogate mice. For oviductal transfer, an approximately 1 mm opening is created in the ovarian bursa, the infundibulum is stabilized with fine forceps, and the transfer pipette is inserted. Approximately 10 to 15 2-cell stage embryos are transferred into one oviduct for bilateral transfers. The peritoneum is closed with suture and the abdominal skin incision is closed with 1 or 2 surgical staples. Numbers of live and dead pups born to each dam are recorded and compared between groups using t-test analysis. Based on observed improvements in embryo cleavage rates with NHIP supplementation (Fig. 26) and the association of this phenotype with improved pregnancy rates, a significant improvement in live births greater than 5% is expected for at least 1 NHIP dose relative to negative control.

[0369] Behavioral and molecular phenotyping is performed on IVF offspring generated with NHIP supplementation. Behavioral and functional screening of all IVF offspring, approximately 315 across all groups, is conducted at postnatal day 7 using the standardized SHIRPA primary observational assessment screen. The primary screen identifies defects in gait or posture, motor control and coordination, excitability and aggression, salivation, lacrimation, piloerection,Attorney Docket No, 11716-026WO1

[0370] defecation, muscle tone, and temperature. All parameters are scored quantitatively to enable comparison across time points and laboratories. Primary SHIRPA scores are compared for significance between treatment groups using 2-way and 3-way ANOVA, including treatment and sex by treatment interactions. Following completion of testing, all offspring are euthanized, brains are removed, and tissues are frozen for RNA isolation. RNA-seq is performed commercially on dissected brain cortex, which exhibits the highest energy and metabolic demands in utero. RNA- seq data are examined globally using PCA and clustering of transcriptomes and by differential gene expression analysis using LimmaVoom. NHIP-associated differentially expressed gene lists are compared for overlap between Day 5 embryos treated previously and IVF-derived PND7 cortical samples using Fisher’s exact test.

[0371] Any changes in birth rate associated with NHIP supplementation during IVF are expected to correlate with improved group-wise SHIRPA scores at PND7. Offspring in any group exhibiting concerns in the primary SHIRPA screen undergo secondary behavioral testing designed to identify specific domains of pathology.

[0372] Example 12: To test the safety and efficacy of NHIP peptide addition to embryo thawing and IVF culture media

[0373] For each participating family, concentrations of NHIP are tested by addition to embryo thawing, culture, and re vitrification media. Based on current results obtained from human, mouse, and cow culture systems with NHIP supplementation, the tested range is 0, 1 ng / ml (400 pM), 10 ng / ml (4 nM), and 1 mg / ml (400 nM). Final concentrations are refined based on efficacy and safety data generated previously. At least 1 dose is selected to be a minimum of 1000 times higher than the lowest expected effective dose to evaluate potential toxic effects.

[0374] Vitrified embryos per family, processed in cohorts of 2 families with 8 embryos every 2 to 3 weeks, are thawed in the presence of the assigned NHIP dose and cultured for 48 h under standard clinical IVF conditions at 5% 02, with the same NHIP concentration maintained throughout culture. After 48 h, treatment assignments are blinded by a member of the LaSalle laboratory. Clinical embryo scoring is performed by Dr. Meng using established criteria. Additional quantitative morphological metrics include the trophectoderm (TE) to inner cell mass (ICM) cell ratio, as well as cleavage stage indicators when available. Following scoring, blinding is lifted and approximately 5 TE cells are biopsied using a glass pipette and transferred to individually labeled tubes containing the family identifier and NHIP dose for downstream genetic analyses. Biospecimens are snap frozen and transported on dry ice to the LaSalle laboratory for storage atAttorney Docket No. 11716-026WO1

[0375] ~80 °C. After evaluation of approximately 200 embryos, embryo clinical scores and TE to ICM ratios are statistically compared across NHIP doses relative to negative controls using appropriate tests, including t tests or generalized linear models depending on data distribution.

[0376] Integration of predictive model metrics is performed using a recently published predictive model for blastocyst development derived from 764 IVF cycles and validated in an independent cohort of 318 cycles. The model identifies independent predictors of Day 5 blastocyst viability, including the number of cleavage stage embryos with more than 10 cells, the number of high quality cleavage stage embryos, the number of 2PN embryos, and a menopause related age index, and demonstrates high predictive accuracy with an AUG of 0.929. When cleavage stage data are available for thawed embryos included in this study, these early developmental indicators are incorporated as baseline covariates to strengthen interpretation of NHIP treatment effects, improve statistical power, and reduce developmental variability between families.

[0377] The lowest NHIP dose effective in bovine and murine models is expected to similarly improve human embryo quality metrics, including clinical grading and TE to ICM ratios. Incorporation of predictive model indicators adjusts for embryo to embryo variability and enhances sensitivity for detecting NHIP mediated improvements.

[0378] Example 13: To determine if NHIP genotype and / or embryo sex modify the effects of NHIP supplementation

[0379] Each of the 200 embryos tested in Aim 2a is used for genetic testing using a protocol recently developed in the LaSalle laboratory for application of Taqman SNP assays to trophectoderm (TE) cells obtained from 2 embryos provided by Dr. Meng (Fig. 29).

[0380] Briefly, trophoblast cells are added to a PGR master mix containing FAM and VIC probes that hybridize to the G or A allele of rs60009365, respectively, followed by 40 cycles of PGR amplification with probe detection at each cycle according to the manufacturer’s instructions (Thermo-Fisher, Waltham, MA). G and A alleles for each sample are called using Taqman Genotyper Software (Thermo-Fisher). Three common SNPs relevant to NHIP expression are tested (Fig. 3F). Fig. 29 demonstrates successful Taqman-based genotyping of rs6009365, which is in linkage with the 1.7 kb insertion previously shown to be associated with NHIP risk for ASD. Additional assays include rs5769796 located in a fetal enhancer associated with cortical thickness and rs4823982 located in the NHIP promoter and identified as the most significant eQTL. For embryos of unknown sex, a Taqman assay targeting SRY, a male-specific gene locus, is included.

[0381] After completion of genotyping for all 200 embryos, a linear modeling framework isAttorney Docket No, 11716-026WO1

[0382] applied to test for effects of genotype, sex, and genotype by sex interaction on each embryo phenotype using established methods. A representative model is defined as:

[0383]

[0384] Yj = β₀ + β₁·G푖 + β₂·S푖 + β₃(G푖×S푖) +

[0385] where Y- represents the measured phenotype for the i-th embryo, <j represents the intercept, Gi represents the coded genotype with 0, 1, or 2 copies of the NHIP risk allele, Si represents the coded sex with 0 for male and 1 for female, GiXSs represents the genotype by sex interaction term, Pi, β₂, and Ps represent the effect size coefficients for genotype, sex, and their interaction, respectively, and represents the error term. These effects are calculated using both an unadjusted model and a model adjusted for additional covariates derived from IVF patient family information.

[0386] Based on GTEX expression data demonstrating higher NHIP expression in females (Fig.

[0387] 21), exogenous NHIP peptide is expected to be more effective in male embryos than female embryos, particularly at higher effective doses. Embryos carrying 2 copies of NHIP risk alleles associated with lower endogenous expression are expected to show greater improvement following NHIP supplementation. Within the linear statistical model, these effects are expected to manifest as significant main effects for genotype and sex (β₁, β₂) as well as a significant genotype by sex interaction term (Pa).Attorney Docket No. 11716-026WO1

[0388] SEQUENCES SEQ ID NO: 1- Vector NHIP-eGFP 5’TTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGC TCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCG CTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGAACT ATAACGACCGCGTGAGTCAAAATGACGCATGAlTATCrmACGTGACTTITAAGAT T1 ' A ACTC A TACGAT A ATI AT A ITGITATITC ATGlT’CTACTrACGTGATAACITAITA TATATATATTTTCTTGTTATAGATATCATCAACTTTGTATAGAAAAGTTGGGCTCCGG TGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAG GGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGT GATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGT GCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTA AGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTG CCTTGAAlTACTrCCACCTGGCTGCAGTACGTGAlTCTTGATCCCGAGClTCGGGTTG GAAGTGGGTGGGAG AGTTCGAGGCCTTGCGC IT AAGGA GCCCCTTCGCCTCG TGCTT GAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTT CGCGCCTG'rCTCGCTGCITrCGATAAGTCTCTAGCCATTTAAAATTTTrGATGACCTG CTGCGACGCTITTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACA CTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCA CATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAG TCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGTCTCGCGCCGCCGTGTATCGCCCCG CCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCC GCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCT

[0389] 'rCATGIGACTCCACGGAGrACCGGGCGCCGTCCAGGCACCTCGATTAGTrCTCGAGC TTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTITTATGCGATGGAGTrTCCC CACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCC TTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGG

[0390] TrCAAAGTTTTTTTCITCCAn’TCAGGTG'rCGTGACAAGTrTG'rACAAAAAAGCAGGC TCAGCGGAACACACGGTCCCAAAAGGCCCTTCCCAAGATGGCCGGGGCTTCCGCCT GCCGCCCTCCCTCCCGTGGTGCTGAGCGCAGGCTGGGCGCGGCCACATCACCCTAAG GGCGTGGGTGTCGGAGTCTTGCAGGCTGGGGTCCCAGGTGAGAGATGCCAGCAGGG AGCTCTAGATGGGGAACTGGGTGAGCCTGGCTCGGTAAGGGCGTGCTCAGAACACCAttorney Docket No. 11716-026WO1

[0391] CCATCCCCGAACACGGTCTTGTGTGATAAAATGTCACGCAAGAAGAATCTGAAACC GCGAGAAGAGGAGGACACGGCCAGACTGCACCGAACCCCGGCACCTCTGTGGGGA AAAGCAGGTCAGGCTGAGCGGGGCCGGCGGGGACACGCGCTCCTGGGCTTCTCCAG AGTCTGCCGGGGCCGGGCCCGGGACCGAGGCTGGGACGCGCTGTGCAGTCCCACCC CTCACACCCCTCGCACGCCTGGAAACACCCTCGGGGTAACACAAGCCGGGGTTGAG TTTCTTGAAGAGAAGCTGGCTGCATCCTGGAGCCAGGGAAAGAGGAGCACAGGGGC CAAGCGGTCCAGGGCCACGGAGGAGCAGGACCCCTGGGGAAAGGCCCGGGTCTAG GCCGGGGCCAGGGGACCGTGGTGGAGACCTCAAAAATGGCAGAACACGGAAGCAG GGCGAGAAAAGTAAACGTAGTCCTTGCGGCAGTTTGAAATACACGCGGGTAAACGC TGGGTGACTCCGCCCGGATGCAGAGTGGGGGTCTGTGTCTCTCCCCACAGGCTGCAG GGACCGGGCTCTGGGTAACCAGCAGAAGGTAACAGAACGAGGCTGCTTTTCCTCCA GGCTGTTCTGGTGTCCGCGCGTGGCTTGTGCGCTGACTCCTGACTTGGAGCGCCGCG TGGCCAGAGAAATCTGGGTGCCTCCAGGCCACCATGGTGAGAGGAGAGGCCACCGC ACGAACGGAAGAAGCGATGGAGACGGTCTTTACGACCTAAGAACAGAAAGAGTTTC TT AT ACAC A ATCCGA AA AGI ’A A A A ATTG ATTGATTG ATTGATTGA GATGGAATCCC A CTCTGTCGTCCAGGTTAGAGTGCAATGGCTTGATCTCGGCTCATTGCAACCTCCGCCT CCCGGGTTCAAGCGAnCTCCTGCCTCAGTCTCCCGAGTAGCTGGGAlTATAGGCGC CCGCC ACCACGACTGGCTA ATTTI T AT ATTTTTAGT AG AGACGC A GTTTC ACCGTGTT GACCAGGCTGGTCTTGAACCCCTGACCTCAGGTGATCCGCCTGCCTCGGTCTCCCAA AGTGCTGGGATTACAGGCGTGAGCCACCGTGCTGGGCCAAAAATCAATTTTAAAAC GACCACATGAAAAATAAATCTCCTGTATCACAGAGCATGTrCTGAGGAAAATGAAA GCCACAGATCCAGAAGATATTTGTGACACATATGAAAAACAAAAACTCATATTCAA AACATACACAGCATTGCTATGAATCATTAAGAAAAATGATTTCGTCTCCTCTACAGG AGCCTGAGTGAAGGACAAGGACAGATCATTATAAACCAGGGAGCTTGAAGAGCTAG ITAACAAGCACAGAAAATATGTTCCCCCACACTGTTAA'ICAAGAAAATTAAAACTGT AATGAGATGCCGCATTGTATCCATGGGATTTCTAAAAGTACAAAGTTCCACAATACC CGTTGTTGACGGAGCAGGGAAACCGCAGGAGCCTGCAGGAGATGAGATTGTAAATG TGCAAGGACATT TGGAGAAGAGTTGACAACATCTCACTCACGTGTATCAAGCCAA GTGCCGAAAGAAGAAITGGTTGTCATAAAGAAAACAGAAACCCAGAA'IGGATGTAG CTTATCCCTCCGATGGA A AG'IT AC A AAGA A GTT A A A ATG A ATGGGCTGC ATCTCTGT GTAACAATTTGGATCAATATCAAAGACACATTTGTTAAAGCAAGGTGTACAATGAA ACCTGCAACATGATTTGTCTGTTTAGTAAAACACAGAAAATCTAACTCCGCCTGGCT TACGAACACACACATGTGTTAGAATTTGGGAAAAGGAAAGGGAGGGAGGCCGGCTAAttorney Docket No. 11716-026WO1

[0392] CACGTGAACTTTTGGAAAATCTCAGAGGGTCTGGGGCACCAGGTGGAGACCATGGC AGCCTTCAGGGATATGAGGTGAGTCC'ITCAACTACArrTGCAAGGTTTTAT'rTCTTAG GAAAATATTTAAAGCAAATATTTCAAAAATGACTAAATCTGAGTGGTAGGGAGTCA CTGTTTTATAGATTATTCACTTTTCCCTGGGCTTGGAATGTTTCGTTTTTTCAAAGGTC AAATGAGATGCTGCCTTTCCACCAGATAAAGATTTACCTGGTGCCTCTGTTACTGCC CAGCAGCGCCTGAGGACGTGGGGGCTGCTGCCCAACACGGAGGCTGGGCTGGCCTG GTCCGTGGGCTCAGGTTCTCATCCTCTGCACGTGCATCTGCCTCCTGTGCGTCTCTGT GCACACGCTTGTATCTGGATGCAGAGTCCTGTGCCCAGTGTACATGCACAGATGTGC GCATCTGGGTAGATGTGCTGGTTCGCTGTGTGAGCATGCACAGACCCTTGTTCACCG TGTGTGCGCATCCGTGCAGTGTGGACATCTGGACAGGACCCCGTGCTCCCTGTCTCT GCCGCTG AGATGTTTCCT AGCTGTGC AC AGA ATTC ACTCTCCTACTGG AGGGCTCTG ACTGAAAGCTCTGATGCGGCAGGCCTTCTCTTGACACTTGGTTAAGGTATGCCTCTC ACATCTGTATGCCCACATCTGCTCTCCTCCCTCCCTCCTTCTCAGCACTTAGCCCTCT GATATGGTrrGCTGGCGTCCCCACCCAAATCTCATClTGAATrGTAGTTCCCATAAAT CCCCACGTATTGTTCGAGGTACCCCGTGGGAGATAATTGAATCATGGGGGTGGTTAC CCAGATGCTGCGGTTCTCGTGTTAGTGAGTTCTCGTGAGATCTGATGGTTTTATAAG GGGCTmCCCCCmTI’CTCGGCACndCCTCGCTGCCGCCACATGAAGAAGGATG TGTTTGCTTCCCCTTCTGCC ATG ATTGGA A. GTTTCCTGA G ACCCCTCC A GCC ATGCTG AACTGATTTCCTGAAGACACCATCCCAGTCAAGTGGTCTGCCTCATACTGAGCCACC AGACCACCCAGCATGTCCTCACCCGCGTGGACAGATGACAGGGGGCTCTGAGCATG CCCCAGTGCACCI ACGCACCTGTGAAGGTTGGGAGCCTGAGTGCAGCTCCTGTGGC ACTGCCCGTGGCCAGGGAGATGCCTCCTCAGTGCTCCTGACCCTCGGTGGAGGACCG GCCAGCGTGTGTGCCGACAGTGTGTCCACACAGGTGTGCTGCGCCCAATGGGCAAG TCGGAAACAAAGGAAAATGCTCTCTGAAGGAAAAGGCAAAGCAATTTGGATTTCTG CGAGAAAATGAGACTGCArGTGGCACTGTAAATACCCTTGCTGCTGAACTTCTCGC'r CCCCCCAGATACACCCTTCATATTGACATGTCTAGAACCTTAAACTGAACCAAGTTG AAAAGTGAGATTAATTAGGGCTGAGTTAACAGTTAACACATACAATGAAATATTGA ATAAGGCTTACTGAGCAAACAAGAATATACAGAAGTGGAGGAGACAAAGAGGATA TTAAAAATGCAGACAGTGATGAGGCAGATAGCTGGGACAAATAATGAAAAATAGTA AAGGAGATAAGGCAGATATIGGAGGAGCAAAGAGTCTCTGAAATAGATATCGGTAT TGAAAGATGCTAAACACGCTTCTAAAGAGACTTTCTAGCCGACACAGGGAGCTCAC TGATGGATGAAGTAGAAACATTTTTAAATGGAATCAAACAGGGCAAAGCGGGAGAA GAAAAAGAAGTAGG'rAAACCAGTAAATTAACTrrTCTCGTGTGTGCTGTG'rACTAITAttorney Docket No. 11716-026WO1

[0393] TGTGAGTGAGCAATGAACGCTGTGGCTCCCTGGAGGGGCTGTGGTGGGAAGTTTCA CTGCGATCAAGTAGAGGTGGTGCCTTTGGACCTCTTCTCCTGAACCTGCAGGGAGAG GCGCAGAATATTCACAAGGTGAAGATGCAACAATTCAAATGAGTGTCCAGGTTTTC AGGGTGGTTGCTAAACCCCAAAAGACCGATAGCTTCGGGCAAAAGACTGCAGAAAG AACAGCTTTACATTTTTACGGAAGCAATGGGAAATATACCCTGTAAGCCTTGAAAAA

[0394] TrCCCGAAGGGATTCCTGTTCATTCCTGTGGATCCTAATGGGCCAGCATAGACCTGT TAGTCAAAAGAGGATTTATCTACAT GCACACTCA1 CAGGCAGGCAGGGAAGTCA ACGCCACTTTCAGATGTTTGTAGAGCATGAACTCTGTCCGTTCCCACGCCCTCCAAA GGCTGTTACACAGGGATGCCCGCTTCTGGACAGAAGTGATTCATGCAGGATGAGAA CCATGACCACAGAAG n rGTGCATGTGGTTATT CAATA n’AATT AAGTGTATG CATGAGTGTTCAGGATAAAAATGCTTGGAGTGTACTTTAATTCCATTAAAAATGTAT ACATTAACCCAGCTTTCTTGTACAAAGTGGTGATCCTCAGGTGCAGGCTGCCTATCA GAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGATCTTTT TCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGG CTA ATA AAGG AA ATTT A' TTTTC ATTGC A ATAGTGTGTTGGA ATTTTTTGTGTCTCTC A CTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTGGT TTAGAGTTTGGCAACATATGCCCATATGCTGGCTGCCATGAACAAAGGTTGGCTATA A AGAGGTC ATC A GT AT ATGA A AC AGCCCCCTGCTGTCC ATTCCTTATTCC ATA GA A A AGCCTTGACTTGAGGTTAGATTTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAA CATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTCTCCTGACTA CTCCC AGTC AT AGCTG I’CCC I’CTICTCT rATGGAGATCCCTCGACC'rGC AGCCC AAGC T1 CGCGTTG AC ATI’GATTATTG ACT' A GTTATT A ATA GTA ATC A ATTACGGGGTC ATTA GTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCT GGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATA

[0395] G'rAACGCCAATAGGGACTTTCCATTGACG'rCAATGGGTGGAGTATTTACGGTAAACT GCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTC AATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTT CCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTT GGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTrCCAAGTCTCC ACCCCAT GACGTCAATGGGAGTTT'GTTTrGGCACCAAAAT'CAACGGGACTTTCCAA AATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGG GAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCGCCACCATG GTGAGCAAGGGCGAGGAGCTGTrCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGAAttorney Docket No. 11716-026WO1

[0396] CGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCA CCTACGGCAAGCTGACCCTGAAGTrCATCTGCACCACCGGCAAGCTGCCCGTGCCCT GGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCG ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAG GAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAA

[0397] GnCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGG GGACGGC A AC ATCCTGGGGC AC A AGCTGG AGTAC AACTAC A AC AGCC AC AACGTC TATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCA CAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCA TCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCC TGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTFCGTGACC GCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGATGACCGAGTACAAGCC CACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCG CCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCG AGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGC AAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAG CGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCG GTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCC AAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAA GGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGG TGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCG GCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATG ACCCGCAAGCCCGGTGCCTGACTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCA GCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTT CCTrGACCCTGGAAGGTGCCACTCCCACTGTCCrrTCCTAATAAAATGAGGAAAT'rG CATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACA GCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCT ATGGCTCGAGTTAATTAACGAGAGCATAATATTGATATGTGCCAAAGTTGTTTCTGA CTGACTAATAAGTA'rAATTTGTITCTATTATGTATAGGTTAAGCTAATrACTrATTrT ATAATACAACATGACTG'rnTrAAAGTACAAAATAA n ATFmGTAAAAGAGAG AATGTTTAAAAG'TTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAAT AAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTATGTAAGTGTAA ATATAATAAAACTTAATATCTAITCAAATTAATAAATAAACC'ICGATATACAGACCGAttorney Docket No. 11716-026WO1

[0398] ATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGA IT ATCTTTCTAGGGT T AAAI AAT AGT 1TCTAAT IT T1TTA1TA1TCAGCCTGCTGTCGT GAATACCGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCG TTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAG CACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTT CCCAACAG1TGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTA AGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCT AGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCC GTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACC TCGACCCCAAAAAAC1TGA1TAGGGTGATGG1TCACGTAGTGGGCCATCGCCCTGAT AGACGGTI TTCGCCCTI TG ACGTTGGAGTCC ACGTI’CITT AATAGTGGACTCTTGTT CCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATT TTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCG AATITTXACAAAATATTAACGCTTACAATITAGGTGGCACTrrTCGGGGAAATGTGC GCGGAACCCCTAT1TG1TT ATTITI’CTA A ATAC ATTC AA A'l ATGTATCC GCTC ATG AG ACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTC AACATl CCGTGTCGCCCTrAlTCCClTTn GCGGCArm GCClTCCTGrmTTGCT CACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGT GGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGA AGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATC CCGTATTGACGCCGGGCAAGAGCAACTCGG'rCGCCGCATACACTATTC'rCAGAATG ACTrGGTirTAGlACTCACCAG'rCACAGAAAAGCA'rCrTACGGATGGC rGACAG'rA AGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTT CTGACJAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGA TCATGTAACTCGCCIT’GATCGITGGGAACCGGAGCTGAATGAAGCCATACCAAACG ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTA ACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCG GATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCT GATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATrGCAGCACTGGGGCC AGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTAT GGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGT AACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTA ATlTAAAAGGATCTAGGTGAAGATCCTTITrGATXATCTCATGACCAAAATCCCTTAAttorney Docket No. 11716-026WO1

[0399] ACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTC

[0400] 'ITGAGATCCTITITITCTGCGCGTAArCTGCTGCTTGCAAACAAAAAAACCACCGCT ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAAC TGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGG CCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTT ACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACG ATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGC CCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGA GAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCA GGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTT TAT AGTCCTGTCGGGTTTCGCC ACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGT CAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTG GCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGA TAACCGTA1TACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGA GCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCT CTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGG AAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAG1 AGCTCACTCATTAGGCACC CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGAAATTAACC CTCACTAAAGGGAACAAAAGCTGGTACCTCGCGCGACTTGGTTTGCCATTCTTTAGC GCGCGTCGCGTCACACAGCTTGGCCACAATGTGGTT1 TGTCAAACGAAGATTCTAT GACGTGTTrAAAGTTTAGGTCGAGTAAAGCGCAAATCTTIT3’

[0401] SEQ ID NO: 2- Vector NEG-eGFP

[0402] 5 ’ GATCTTTTTCCCTCTGCC AAA AATTATGGGGAC ATC ATGAAGCCCCTTGAGC ATCT GACTTCTGGCTAATAAAGGAAATITATTTTCATTGCAATAGTGTGTTGGAATTTTTTG TGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGA GTATTTGGTTTAGAGTTTGGCAACATATGCCCATATGCTGGCTGCCATGAACAAAGG TIGGCTA TAAAGAGGTC ATC AGTA T ATG AAAC AGCCCCC I’GCTG ICC ATTCC'ITA IT CC AT AG A A A A GCCTTG ACTTG A GGIT AG AITITmT AT AITITGrTITGrGI”? TTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTC TCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGGAGATCCCTCGACCTGC AGCCCAAGCTTCGCGITGACAITGATTATTGACTAGITATTAATAGTAAICAzVlTAC

[0403]

[0404] Attorney Docket No. 11716-026WO1

[0405] GGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAA TGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTA TGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTT ACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCC TATTGACGTCAATGACCiGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTT ATGGGACTTTCCTAC'rTGGCAGTACATCTACGTATTAGTCA'rCGCTA'rTACCATGGTG ATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTT CCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGG GACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGT GTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGC GCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGT CGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGG GCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTG CCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTrCAGC CGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGG CTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCG CCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATC GACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAG CCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCA AGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAG AACACCCCCATCGGCGACGGCC: CCGTGCTGCTGCCCGACAACCACTACCTGAGCAC CCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGG AGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGATGACC GAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACG CACCCTCGCCGCCGCG1 CGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGA CCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCT CGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCA CGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCC GAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCC GCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACC ACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAG CGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTAC GAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACAttorney Docket No. 11716-026WO1

[0406] CTGGTGCATGACCCGCAAGCCCGGTGCCTGACTCGAGTCTAGAGGGCCCGTTTAAAC CCGCTGATCAGCCTCGACTGTGCCn’CTAGl GCCAGCCATCTGlTGTn’GCCCCTCC CCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATG AGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGG GGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGC GGTGGGCTCTATGGCTCGAGTTAATTAACGAGAGCATAATATTGATATGTGCCAAAG TIGTTTCTGACTGACTAATAAGTATAATTTGTTTCTATI rGTATAGGTTAAGCTAAT TACTTATTTTATAATACAACATGACTGTTTTTAAAGTACAAAATAAGTTTATTTTTGT AAAAGAGAGAATGTTTAAAAGTTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGT TTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTAT GTAAGTGTAAATATAATAAAACTT’AATATCTAI CAAATTAATAAA AAACCTCGAT ATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGT C ACAATATGATTATCTTTCTAG(}(}TTAAATAATA(}TTTCTAATTTTTTTATTATTCAG CCTGCTGTCGTGAATACCGAGCTCCAA1 CGCCCTATAGTGAGTCGTA1TACAA1 C ACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAA TCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCAC CGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTA GCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTT GCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCG CCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGC

[0407] 1TTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCC ATCGCCCTG ATAG ACGG' TTTTTC GCCCTTTGACGTTGG AGTCC ACGTTCTTTA ATA GT GGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATT TATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAA AArTrAACGCGAAITrTAACAAAATATTAACGCTTACAATITAGGTGGCAC'rTrTCG GGGA A ATGTGCGCGG A ACC CCT ATTTGTTTATTTTTCT AA AT AC ATTC A AAT ATGTAT CCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAG TATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTC CTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGG GTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTT TTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCG CGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATT CTCAGAATGAC1TGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCAAttorney Docket No. 11716-026WO1

[0408] TGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCC AACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTrnTTGCACAAC ATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCAT ACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCA AACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGA TGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGT

[0409] 1 A1TGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCA1TGCAGCAC TGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAG GCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAA GCA'ITGGTAACTGTCAGACCAAGTrTACTCArATATACTTTAGATTGATrrAAAACTT CATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAA ATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAA GGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAAC CACCGCTACCAGCGGTGGTn’Gn GCCGGATCAAGAGCTACCAACTCTrrrrCCGA A GGT A ACTGGCTTC AGO AG AGCGC AGAT ACC A A AT ACTGTTC TTCTAGTGTAGCCGT AGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAA TCCTGn’ACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTClTACCGGGTrGGACT CAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGC ACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAA GCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTG GTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGA TGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACG GTTCCTG(}C CTTTTGCT(}GCCTTTT(}C TCACATGTTCTTTCCTGCGTTATC CCCTGATT CTGTGGATAACCGTATTACCGCCTrrGAGTGAGCTGATACCGCTCGCCGCAGCCGAA CGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAA ACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCC CGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATT AGGCACCCCAGGCTTTACACTrTATGCTTCCGGCTCGTATGITGTGTGGAATTGIGA GCGGATAACAATITCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGAA ATTAACCCTCACTAAAGGGAACAAAAGCTGGTACCTCGCGCGACTTGGTTTGCCATT CTTTAGCGCGCGTCGCGTCACACAGCTTGGCCACAAT TGGTTTTTGTCAAACGAAG

[0410] A'rTCTATGACGTGTTTAAAGTTTAGGTCGAGTAAAGCGCAAATCTTTTTTAACCCTAAttorney Docket No. 11716-026WO1

[0411] GAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCT AAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTC CCGTGAGGCGTGClTGTCAATGCGGTAAGTGTCACTGA'mTGAACTATAACGACCG CGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATAC GATAATTATATTGTTATITCATGTTCTACTTACGTGATAACTTATTATATATATATTTT CITGITATAGATATCATCAACn GTATAGAAAAGTTGGGCTCCGGTGCCCGTCAGT GGGC AG AGCGC AC ATCGCCC AC AGTCCCCG AGA AGTTGGGGGGA GGGGTCGGC A AT TGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTA CTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGC CGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTG TGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACT TCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGG GAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCC TGGCCTGGGCGCTGGGGCCGC’CGCGTGCGAATCTGGTGGCACCITCGCGCCTGTCTC GCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTIT TTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAA3’

[0412] SEQ ID NO: 3- NHIP Sequence (Nucleotide) ATGGTGAGAGGAGAGGCCACCGCACGAACGGAAGAAGCGATGGAGACGGTCTTTA CGACC

[0413] SEQ ID NO: 4- NHIP WT (Amino Acid)

[0414] MVRGEATARTEEAMETVFTT

[0415] SEQ ID NO: 5- Forward Primer

[0416] AGAATITITGACACCCACTCTIT

[0417] SEQ ID NO: 6- Reverse Primer

[0418] CTGGGTGCAGTAGTGCATGT

[0419] SEQ ID NO: 7- Insertion sequence at chromosome 22 at position 22ql3.33 5’TAAGAAAACTCCTGCTCTCCCTCCTCTCCCTCTCCCTCCTCTCCCTCTCCCTCTCCCT CTCCCTCTCCCCACGGTCTCCCTCTCCCCACGGTCTCCCTCTCCCTCTCTITCCACGGTAttorney Docket No. 11716-026WO1

[0420] CTCCCCCTGATGCTGAGCCGAAGCTGGACTGTACTGCTGCCATCTCGGCTCACTGCA ACCTCCCTGCCTGATTCTCCTGCCTCAGCCTGCCGAGTGCCTGCGATTGCAGGCGCG TGCCGCC AC GCCTG ACTGGTTTTCGT ATTTTTTTGGTGG AGACGGGGTTTC GCTGTGT TGGCCGGGCTGGTCTCCAGCTCCTAATCACGAGTGATCCGCCAGCCTTGGCCTCCCG AGGTGCCGGGATTGCAGACGGAGTCTCGTTCACTCAGTGCTCAATGGTGCCCAGGCT GGAGTGCAGTGGCGTGATCTCGGCTTGCTACAACCTCCACCTCCCAGCCGCCTGCCT TGGCCTCCCAAAGTGCCGAGATTGCAGCCTCTGCCCGGCCGCCACCCCGTCTGGGAA GTGAGGAGCGTCTCTGCCTGGCCGCCCATCGTCTGGGACGTGAGGAGCCCCTCTGCC TGGCTGCCCAGTCTGGAAAGTGAGGAGCGTCTCTGCCCGGCCGCCATCCCATCTAGG AAGTGAGGAGCGCCTCTGCCAGGCCGCCCATCGTCTGAGATGTGGGGAGCGCCTCT GCCCTGCCACCCCGTCTGGGATGTGAGGAGCGTCTCTGCCCGGCCGCCCCGTCTGAG AAGTGAGGAGACCCTCTGCCTGGCAACCGCCCCGTCTGAGAAGTGAGGAGCCCCTC CGCCCGGCAGCCACACCCTCTGAGAAGTGAGGAGCGTCTCTGCCTGGCAGCCACCC CGTCTGGGAGGGAGGTGGGGGTCAGCCCCCTGCCCCGCCAGCTGCCCATCCGGGAG GGAGGTGGGGGGTCAGCCCCCCGCCCGGCCAGCCGCCTCGTCCAGGAGGTGAGGGG CGCCTCTGCCCGGCCGCCCCTACTGGGAAGTGAGGAGCCCCTCTGCCTGGCCAGCCG CCCCGTCGGGGAGGGAGGTGGGGGGACAGCCCCCCGCCCGGCCAGCCGCCCCGTCC GGGAGGTGAGGGGCGCCTCTGCCCGGCCGCCCCTACTGGGAAGTGAGGAGCCCCTC TGCCCGGCCACCACCCCGTCTGGGAGGTGTACTCAACAGCTCATTGAGAACGGGCC ATGATGACAATGGCGGTTTTGTGGAATAGAAAGGGGGGAAAGGTGGGGAAAAGATT GAGAAATCGGATGGTTGCCGTGrCTGTGTAGAAAGAGGTAGACATGGGAGACTTTT CATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGGGATCCTGTTGATCTGTGACC TTACCCCCAACCCTGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTGAATGG ATTAAGGGTGGTGCAAGATGTGCTTTGTTAAACAGATGCTTGAAGGCAGCATGCTCG

[0421] 'ITAAGAGTC rCACCACTCCCTAATCTCAAGTACCCAGGGACACAAACACTGCGGA AGGCCGCAGGGTCCTCTGCCTAGGAAAACCAGAGACCTTTGTTCACTTATCTGCTGA CCTTCCCTCCACTATTGTCCTGTGACCCTGCCAAATCCCCCTCTGCGAGAAACACCC AAGA ATG ATC AATA AAAAAA AAA AAAA3 ’

[0422] SEQ ID NO: 8- truncated NHIP peptide

[0423] MVRGEATARTEEAMC

[0424] SEQ ID NO: 9- modified NHIP peptideAttorney Docket No. 11716-026WO1

[0425] MVRGEATARTEEAMEAVFTT

[0426] Bold is the 9aatad sequence

[0427] SEQ ID NO: 10- modified NIIIP peptide with{PEG2}at the C terminal

[0428] M VRGE AT ARTEE AME A VFTT { PEG2 }

[0429] SEQ ID NO: 11- enhanced NHIP peptide with PEG-biotin MVRGEATARTEEAMEAVFTT-PEG-BioAttorney Docket No. 11716-026 WO 1

[0430] TABLES

[0431] Table 1 shows functional categories of genes showing adjusted NHIP-associated expression in human cortex, differential expression in NHIP overexpressing cells, and known ASD risk.

[0432] GO Terms

[0433] Genes Chromatin Repkation of Histone Rhythmic Dendritic Regulation Count organization transcription by modification process spine of

[0434] RHA polymerase it biosynthetic

[0435] process

[0436]

Claims

Attorney Docket No, 11716-026WO1CLAIMSWhat is claimed is:1) A method of treating a hypoxia-related brain disorder in a subject, comprising:a) obtaining a sample from the subject;b) detecting presence or absence of a neuronal hypoxia placenta associated (NHIP) gene risk allele in the sample;c) measuring circulating levels of NHIP peptide in the sample, wherein the subject is predicted to have the hypoxia-related brain disorder if the sample has homozygous NHIP risk alleles or low circulating NHIP peptide levels than in comparison to a control; and d) administering a therapeutically effective dose of a peptide based therapeutic to the subject who is predicted to have the hypoxia-related brain disorder.2) The method of claim 1, wherein the hypoxia-related brain disorder comprises a neurodevelopmental or neurodegenerative disorder.3) The method of claim 2, wherein the neurodevelopmental or neurodegenerative disorder comprises schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease.4) The method of any one of claims 1-3, wherein the hypoxia-related brain disorder is caused by a hypoxic insult.5) The method of claim 4, wherein the hypoxic insult comprises neonatal hypoxia, stroke, cardiac arrest, smoke inhalation, pulmonary distress, hypoxia during gestation, hypoxia during childbirth, uteroplacental insufficiency, placental insufficiency, preeclampsia, eclampsia, umbilical cord compression, or umbilical cord prolapse.6) The method of claim 1, wherein the sample is a placental tissue, blood, urine, sputum, or spinal fluid.7) The method of claim 1, wherein the peptide based therapeutic comprises a modified endogenous NHIP peptide with one or more amino acid substitutions.Attorney Docket No. 11716-026WO18) The method of claim 1, wherein the peptide based therapeutic comprises an amino acid sequence MVRGEATARTEEAMEAVFTT (SEQ ID NO: 9), wherein threonine (T) is an amino acid with an alanine (A) substitution.9) The method of claim 8, wherein the peptide is a peptide comprising SEQ ID NO:

9. 10) The method of claim 7, wherein the modified NHIP peptide is delivered to the subject in combination with a pharmaceutically acceptable carrier.11) A method of treating a hypoxia-related brain disorder in a subject, comprising:a) obtaining a sample from the subject;b) detecting the presence of a NHIP risk allele in the sample;c) measuring circulating levels of NHIP peptide in the sample;d) calculating a polygenic risk score (PRS) based on the presence of the NHIP risk allele, and the circulating levels of the NHIP peptide, wherein a high-risk score relative to a control indicates an increased risk for the hypoxia-related brain disorders; and e) administering a peptide based therapeutic to the subject with the high-risk score.12) The method of claim 11, wherein the high-risk score comprises a homozygous NHIP risk allele and low circulating NHIP peptide levels.13) The method of claim 11, wherein the hypoxia-related brain disorder comprises a neurodevelopmental or neurodegenerative disorder.14) The method of claim 12, wherein the neurodevelopmental or neurodegenerative disorder comprises schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease.15) The method of any one of claims 11-14, wherein the hypoxia-related brain disorder is caused by a hypoxic insult.16) The method of claim 15, wherein the hypoxic insult comprises neonatal hypoxia, stroke, cardiac arrest, smoke inhalation, pulmonary distress, hypoxia during gestation, hypoxia during childbirth, uteroplacental insufficiency, placental insufficiency, preeclampsia, eclampsia, umbilical cord compression, or umbilical cord prolapse.Attorney Docket No, 11716-026WO117) The method of claim 11, wherein the PRS comprises a Low Risk: PRS < -1, a Moderate Risk: PRS between -1 and +1, a High Risk: PRS between +1 and +2, or Very High Risk: PRS > +2; wherein a score higher than +1 relative to a control indicates an increased risk for the hypoxia- related brain disorder.18) The method of claim 11, wherein the peptide based therapeutic comprises a modified endogenous NHIP peptide with amino acid substitutions.19) The method of claim 11, wherein the peptide based therapeutic comprises an amino acid sequence MVRGEATARTEEAMEAVFTT (SEQ ID NO: 9), wherein threonine (T) is an amino acid with an alanine (A) substitution.20) The method of claim 19, wherein the amino acid sequence is a peptide comprising SEQ ID NO: 9.21) The method of claim 18, wherein the modified endogenous NHIP peptide is delivered to the subject in combination with a pharmaceutically acceptable carrier.22) A peptide based therapeutic composition for treatment of hypoxia-related brain disorders, comprising a modified NHIP peptide with one or more amino acid substitutions; and a pharmaceutically acceptable carrier.23) The peptide based therapeutic composition of claim 22, wherein the modified NHIP peptide is delivered to a subject, wherein the subject has low circulating NHIP peptide levels and homozygous NHIP risk allele.24) The peptide based therapeutic composition of claim 22, wherein the peptide based therapeutic comprises an amino acid sequence MVRGEATARTEEAMEAVFTT (SEQ ID NO: 9), wherein threonine (T) is an amino acid with an alanine (A) substitution.25) The peptide based therapeutic composition of claim 24, wherein the peptide sequence is SEQ ID NO: 9.26) The peptide based therapeutic composition of claim 22, further comprising a second therapeutic agent.Attorney Docket No, 11716-026WO127) A multi-omics screening assay for determining hypoxia-related brain disorders, comprising:a) obtaining a sample from a subject;b) detecting NHIP risk alleles in the sample;c) measuring circulating levels of NHIP peptide in the sample;d) measuring DNA methylation levels at NHIP gene locus; ande) calculating a polygenic risk score (PRS) based on presence of the NHIP risk alleles, the DNA methylation levels at NHIP gene locus, and the circulating levels of NHIP peptide; wherein a high-risk score relative to a control indicates an increased risk for hypoxia-related brain disorders.28) The assay of claim 27, wherein the sample is a placental tissue or blood.29) The assay of claim 27, wherein the hypoxia-related brain disorder comprises a neurodevelopmental or neurodegenerative disorder.30) The assay of claim 28, wherein the neurodevelopmental or neurodegenerative disorder comprises schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease.31) The assay of claim 27, wherein the hypoxia-related brain disorder is caused by a hypoxic insult.32) The assay of claim 31, wherein the hypoxic insult comprises neonatal hypoxia, stroke, cardiac arrest, smoke inhalation, pulmonary distress, hypoxia during gestation, hypoxia during childbirth, uteroplacental insufficiency, placental insufficiency, preeclampsia, eclampsia, umbilical cord compression, or umbilical cord prolapse.33) The assay of claim 27, wherein the PRS comprises a Low Risk: PRS < - 1, a Moderate Risk: PRS between -1 and +1, a High Risk: PRS between +1 and +2, or a Very High Risk: PRS > +2; wherein a score higher than +1 relative to a control indicates an increased risk for the hypoxia- related brain disorders.34) A method of improving cognitive function and brain health in a subject recovering from hypoxia, comprising:a) obtaining a sample from the subject;Attorney Docket No. 11716-026WO1b) identifying the subject with low circulating NHIP peptide levels and presence of a c) NHIP risk allele in the sample; andd) administering a customized NHIP peptide therapeutic to the subject with low- circulating NHIP peptide levels and presence of the NHIP risk allele in the sample.35) The method of claim 34, wherein the sample is blood.36) The method of claim 34, wherein the method further involves calculating a polygenic risk score (PRS) based on the presence of the NHIP risk allele, and the low circulating levels of NHIP peptide, wherein a high-risk score relative to a control indicates a compromised cognitive function and brain health.37) A method for determining a predisposition to hypoxia-related brain disorders in a subject, comprising:a) obtaining a sample from the subject;b) performing a genetic assay on the sample to detect presence of one or more NHIP risk alleles; andc) identifying if the subject is homozygous for NHIP risk allele, whereby the subject is predisposed to hypoxia-related brain disorders in presence of homozygous NHIP risk allele.38) The method of claim 37, wherein the sample is blood.39) The method of claim 37, wherein the hypoxia-related brain disorder comprises a neurodevelopmental or neurodegen erative disorder.40) The method of claim 39, wherein the neurodevelopmental or neurodegenerative disorder comprises schizophrenia, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, autism spectrum disorder, or bipolar disease.41) The method of any one of claims 37-40, wherein the hypoxia-related brain disorder is caused by a hypoxic insult.42) The method of claim 41, wherein the hypoxic insult comprises neonatal hypoxia, stroke, cardiac arrest, smoke inhalation, pulmonary distress, hypoxia during gestation, hypoxia during childbirth, uteroplacental insufficiency, placental insufficiency, preeclampsia, eclampsia, umbilical cord compression, or umbilical cord prolapse.Attorney Docket No, 11716-026WO143) A method for determining embryo competency, comprising:obtaining a biological sample comprising at least one reproductive cell associated with the embryo;detecting a DNA methylation level at an NHIP locus in the reproductive cell; comparing the DNA methylation level in the reproductive cell to a reference methylation level; anddetermining embryo competency, wherein a reduced DNA methylation level at the NHIP locus in the reproductive cell relative to the reference methylation level indicates an increased embryo competency.44) The method of claim 43, wherein the at least one reproductive cell is selected from the group consisting of cumulus cells, oocytes, and embryos.45) The method of claim 43, wherein the reproductive cell is obtained during an in vitro fertilization procedure.46) The method of claim 43, further comprising generating an embryo competency score by:measuring an expression level of one or more NHIP regulated transcripts in the biological sample; andcombining (i) the DNA methylation level at the NHIP locus and (ii) the expression level of the one or more NHIP regulated transcripts to produce the embryo competency score, wherein a reduced DNA methylation level at the NHIP locus or a reduced expression level of the one or more NHIP regulated transcripts is indicative of an increased embryo competency score.47) The method of claim 46, wherein the one or more NHIP regulated transcripts comprise TPI1, YWHAG, CCNA2, or a combination thereof.48) The method of claim 46, wherein an increased embryo competency score is indicative of an increased likelihood of achieving at least one predefined developmental outcome selected from the group consisting of blastocyst formation, implantation, clinical pregnancy, and live birth, as compared to an embryo having a lower embryo competency scoreAttorney Docket No. 11716-026WO149) A method for improving developmental outcome in assisted reproductive technology (ART), comprising:supplementing a medium with an NHIP peptide, thereby obtaining a supplemented medium;culturing a gamete, zygote, or embryo in the supplemented medium; isolating RNA from cultured gamete, zygote, or embryo; anddetermining a developmental outcome.50) The method of claim 49, wherein the ART comprises in vitro fertilization, intracytoplasmic sperm injection, embryo culture, embryo cryopreservation, embryo thawing, or a combination thereof.51) The method of claim 49, wherein the NHIP peptide comprises a sequence as set forth in SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 90% identity thereto. 52) The method of claim 49, wherein the medium comprises a sperm preparation media, an oocyte maturation media, a fertilization media, an embryo culture media, a vitrification media, a warming media, or a freeze thaw media.53) The method of claim 49, wherein the developmental outcome comprises fertilization rate, cleavage rate, blastocyst formation, embryo developmental competency, implantation rate, or live birth rate.54) The method of claim 53, wherein the embryo developmental competency is determined using an embryo competency index (ECI), wherein the ECI is calculated from normalized expression levels of predictive genes.55) The method of claim 54, wherein the predictive genes comprise GSTO1, CHSY1, TPI1, YWHAG, CCNA2, LSM4, CDK7, or EIF4A3.56) The method of claim 49, wherein the NHIP supplementation increases the embryo competency index at least at one effective NHIP dose.57) The method of claim 56, wherein the at least one effective NHIP dose comprises the NHIP peptide at a concentration of at least 0.01 ng / ml to about 100 ng / ml.Attorney Docket No, 11716-026WO158) The method of claim 49, further comprising transferring an embryo cultured in the supplemented medium into a recipient uterus or oviduct, and wherein the supplementation results in an increased rate of implantation, pregnancy, or live birth relative to a control embryo not exposed to the supplemented medium.59) A composition, comprising:an NHIP peptide or a functional derivative thereof; anda pharmaceutically acceptable carrier.60) The composition of claim 59, wherein the composition is formulated to support embryo development, cryopreservation, or post thaw recovery.61) The composition of any of claim 59 or 60, wherein the NHIP peptide comprises a sequence as set forth in SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 95%, 98%, 99% or 99.8% identity thereto.62) The composition of any of claims 59-61, wherein the pharmaceutically acceptable carrier comprises a nanoparticle or a liposome.63) A method of treating in vitro fertilization (IVF) induced oxidative stress, comprising:supplementing a culture medium with an NHIP peptide, thereby obtaining a supplemented culture medium; andculturing a gamete, zygote, or embryo in the supplemented culture medium.64) The method of claim 63, wherein the NHIP peptide is supplemented in the culture medium during at least one stage of IVF, wherein the stage of IVF comprises oocyte maturation, fertilization, cleavage stage development, morula stage development, blastocyst stage development, or combinations thereof.65) The method of claim 63, wherein the NHIP peptide is supplemented in the culture medium continuously throughout from fertilization through blastocyst formation.66) The method of claim 63, wherein the NHIP peptide is supplemented in the culture medium intermittently for at least 2 hours, 6 hours, 12 hours, 24 hours, or 48 hours.67) The method of claim 63, wherein the NHIP peptide is supplemented in the culture medium during a single treatment cycle corresponding to one IVF cycle.Attorney Docket No, 11716-026WO168) The method of claim 63, wherein the NHIP peptide is supplemented across multiple treatment cycles corresponding to sequential IVF cycles.69) The method of claim 63, wherein the NHIP peptide comprises a sequence as set forth in SEQ ID NO: 10, SEQ ID NO: 11, or a sequence having at least 90% identity thereto. 70) The method of claim 63, wherein the culture medium comprises a sperm preparation media, an oocyte maturation media, a fertilization media, an embryo culture media, a vitrification media, a warming media, or a freeze thaw media.71) The method of claim 63, further comprises determining embryo developmental outcome.72) The method of claim 71, wherein the embryo developmental outcome comprises fertilization rate, cleavage rate, blastocyst formation, embryo developmental competency, implantation rate, or live birth rate.73) The method of claim 72, wherein embryo developmental competency is determined using an embryo competency index (ECI), wherein the ECI is calculated from normalized expression levels of predictive genes.74) The method of claim 73, wherein the predictive genes comprise GSTO1, CHSY1, TPI1, YWHAG, CCNA2, LSM4, CDK7, or EIF4A3.75 ) The method of claim 63, wherein NHIP supplementation increases the embryo competency index at least at one effective NHIP dose.76) The method of claim 75, wherein the at least one effective NHIP dose comprises the NHIP peptide at a concentration of at least 0.01 ng / ml to about 100 ng / ml.