Crispr / cas-based in-situ nucleic acid detection method for intracellular mycobacterium tuberculosis and use thereof

By using the CRISPR/Cas12a system and electroporation technology to detect intracellular Mycobacterium tuberculosis nucleic acid in macrophages, the problem of detection under low bacterial load conditions has been solved, achieving in situ detection with high sensitivity and specificity, which is suitable for the diagnosis of latent infection and dynamic efficacy evaluation.

WO2026143924A1PCT designated stage Publication Date: 2026-07-09THE THIRD PEOPLES HOSPITAL OF SHENZHEN
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/092831
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-02
Filing Date
2025-05-06
Publication Date
2026-07-09

Smart Images

  • Figure CN2025092831_09072026_PF_FP_ABST
    Figure CN2025092831_09072026_PF_FP_ABST
Patent Text Reader

Abstract

Provided in the present invention are a CRISPR / Cas-based in-situ nucleic acid detection method for intracellular Mycobacterium tuberculosis and the use thereof, wherein the method comprises the following steps: S1, designing crRNA and primer pairs for a target gene sequence of Mycobacterium tuberculosis, and synthesizing a single-stranded DNA fluorescent probe; S2, preparing a standard solution containing the target gene sequence, and incubating same with a CRISPR / Cas12a system; S3, extracting nucleic acids of different types of bacteria, uniformly mixing said nucleic acids with the CRISPR / Cas12a system, and performing incubation; S4, incubating an attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe, infecting macrophages, and performing incubation to obtain infected cells; S5, electroporating the CRISPR / Cas12a system into the infected cells from S4 by using electroporation technology, performing incubation, and detecting the intensity of a fluorescent signal; and S6, performing quantitative and positioning analysis on the detected fluorescent signal to complete detection. By directly introducing the CRISPR / Cas12a system into macrophages by using electroporation technology, intracellular in-situ detection is achieved, thereby avoiding the operational complexity and the loss of detection sensitivity in the nucleic acid extraction process in the prior art.
Need to check novelty before this filing date? Find Prior Art

Description

CRISPR / Cas-based in situ nucleic acid detection method and application for intracellular Mycobacterium tuberculosis Technical Field

[0001] This invention relates to the field of nucleic acid detection technology, and in particular to a method and application for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas. Background Technology

[0002] Tuberculosis, generally caused by infection with Mycobacterium tuberculosis (Mtb), is one of the major public health problems worldwide. In the early stages of infection or when the bacterial load is low, such as after treatment when residual bacteria remain in the body, clinical symptoms are often not obvious, and the pathogen remains latent within macrophages. In this state, Mycobacterium tuberculosis exhibits low metabolic activity, slow replication, and low antigen expression levels. Furthermore, its complex cell wall structure increases the difficulty of detection, raises the risk of missed diagnoses, and may lead to delayed treatment, disease progression, the development of drug resistance, and increased risk of disease transmission. Existing diagnostic methods include sputum smear examination, bacterial culture, nucleic acid amplification detection (such as PCR), and imaging examinations. These methods have limitations such as insufficient sensitivity, long detection cycles, and complex operations, particularly in diagnosing latent tuberculosis infection and the early stages of tuberculosis. In recent years, the CRISPR / Cas system has received widespread attention in nucleic acid detection due to its high sensitivity and specificity. CRISPR / Cas12a, in particular, significantly amplifies signals through its unique non-specific ssDNA cleavage activity, making it an ideal tool for rapid and convenient nucleic acid detection.

[0003] Current technologies such as SHERLOCK, DETECTR, and HOLMES systems primarily combine isothermal amplification (AFA) to achieve efficient nucleic acid detection in extracellular samples. However, under low bacterial load conditions, the complex cell wall structure of Mycobacterium tuberculosis makes nucleic acid extraction difficult, leading to a risk of false negatives. Furthermore, portable detection technologies using CRISPR combined with lateral flow strips are limited to extracellular liquid nucleic acid sample analysis and have not yet solved the problem of accurate in-situ detection of intracellular Mtb nucleic acid. Existing technologies for Mycobacterium tuberculosis detection suffer from insufficient sensitivity, long detection cycles, limited specificity, and complex operation. Traditional methods such as sputum smears, PCR, and bacterial culture, while meeting clinical needs to some extent, have low diagnostic efficiency for patients with low bacterial loads or latent infections. They are also complex to operate and rely on expensive equipment, making them difficult to promote in resource-scarce areas. In addition, existing detection technologies are mostly designed for in vitro samples and cannot directly achieve accurate detection and dynamic monitoring of Mtb nucleic acid within host cells.

[0004] Therefore, the relevant technologies and applications of in situ nucleic acid detection methods for Mycobacterium tuberculosis still need further improvement. Summary of the Invention

[0005] In view of this, the present invention proposes a method and application for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas, which solves the technical problems of insufficient sensitivity, long detection cycle, limited specificity and complicated operation in the existing technology for Mycobacterium tuberculosis detection.

[0006] The technical solution of this invention is implemented as follows: This invention provides a method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas, comprising the following steps: S1, designing guide RNA (i.e., crRNA) and primer pairs for the target gene sequence of Mycobacterium tuberculosis, and synthesizing a single-stranded DNA fluorescent probe; S2, preparing a standard solution containing the target gene sequence, diluting it, incubating it with a CRISPR / Cas12a system, and detecting the fluorescence signal intensity; S3, extracting nucleic acids from different types of bacteria, mixing the nucleic acids of different types of bacteria with the CRISPR / Cas12a system, incubating, and detecting the fluorescence signal intensity; S4, incubating an attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe, infecting macrophages, incubating for 2-4 hours, washing, and obtaining infected cells; S5, using electroporation technology, electroporating the CRISPR / Cas12a system into the infected cells obtained in S4 at different ratios, incubating, and detecting the fluorescence signal intensity; S6, quantitatively and locally analyzing the detected fluorescence signal to complete the detection.

[0007] Based on this technical solution, and further preferably, when the sample to be tested has a low bacterial count, the method further includes: S7, mixing the CRISPR / Cas12a system with the RPA isothermal amplification system and RPA buffer, and repeating S1-S6.

[0008] Based on this technical solution, and further preferably, the target sequence in step S1 includes IS6110, IS1081, esxB, gryB, rpoB, katG, inhA, rpsL, gyrA, gyrB, eis, or pncA.

[0009] The crRNAs mentioned in step S1 include crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8, and crRNA9.

[0010] The nucleotide sequence of crRNA1 described in step S1 is shown in SED IQ NO 1: UAAUUUCUACUCUUGUAGAUAUCAGCUCGGUCUUGUAUAG (SED IQ NO 1).

[0011] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown in SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 3.

[0012] GGTCGGAAGCTCCTATGACAATGCACTAGCC(SED IQ NO 2).

[0013] TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC (SED IQ NO 3).

[0014] The nucleotide sequence of crRNA2 in step S1 is shown in SED IQ NO 4: 5'-AAUUUCUACUAAGUGUAGAUCGGGCACCGUAAACACCGUA-3' (SED IQ NO 4).

[0015] Based on this technical solution, and further preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown in SED IQ NO 5, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 6: GAGTTTGGTCATCAGCCGTT (SED IQ NO 5).

[0016] CATCGACCTACTACGACCACAT(SED IQ NO. 6).

[0017] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 7, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 8: ACAGGCCGAGTTTGGTCAT (SED IQ NO 7).

[0018] CGACCTACTACGACCACATCAA (SED IQ NO 8).

[0019] The nucleotide sequence of crRNA3 described in step S1 is shown in SED IQ NO 9: 5'-AAUUUCUACUAAGUGUAGAUAUCAGCUCGGUCUUGUAUAG-3' (SED IQ NO 9).

[0020] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 10, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 11: CGTAGTAGGCAGCCTCGAGTT (SED IQ NO 10).

[0021] CGGATAGGGGATCTCAGTACAC(SED IQ NO 11).

[0022] The nucleotide sequence of crRNA4 in step S1 is shown in SED IQ NO 12: 5'-AAUUUCUACUAAGUGUAGAUGUCAUCAGCCGUUCGACGGU-3' (SED IQ NO 12).

[0023] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown in SED IQ NO 13, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 14: GTCGACACATAGGTGAGGTCTG (SED IQ NO 13).

[0024] CAAAGTGTGGCTAACCCTGAAC(SED IQ NO 14).

[0025] The nucleotide sequence of crRNA5 in step S1 is shown in SED IQ NO 15: 5'-AAUUUCUACUAAGUGUAGAUAGGUCGAGUACGCCUUCUUG-3' (SED IQ NO 15).

[0026] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 16, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 17, ACCGGATCGATGTGTACTGAG (SED IQ NO 16).

[0027] GACCTCACCTATGTGTCGACCT(SED IQ NO 17).

[0028] The nucleotide sequence of crRNA6 in step S1 is shown in SED IQ NO 18: 5'-AAUUUCUACUAAGUGUAGAUGGUCGAGUACGCCUUCUUGU-3' (SED IQ NO 18).

[0029] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 19, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 20: ACCGGATCGATGTGTACTGAG (SED IQ NO 19).

[0030] GACCTCACCTATGTGTCGACCT(SED IQ NO 20).

[0031] The nucleotide sequence of crRNA7 in step S1 is shown in SED IQ NO 21: 5'-AAUUUCUACUAAGUGUAGAUACGAUGGCCACCUCCAUGGU-3' (SED IQ NO 21).

[0032] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown in SED IQ NO 22, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 23: TGTACTGAGATCCCCTATCCGT(SED IQ NO 22).

[0033] GACCTCACCTATGTGTCGACCT(SED IQ NO 23).

[0034] The nucleotide sequence of crRNA8 in step S1 is shown in SED IQ NO 24: 5'-AAUUUCUACUAAGUGUAGAUCCUACGUGGCCUUUGUCACC-3' (SED IQ NO 24).

[0035] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown in SED IQ NO 25, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 26: GGTGGATAACGTCTTTCAGGTC (SED IQ NO 25).

[0036] CTGTGGGGTAGCAGACCTCACC(SED IQ NO 26).

[0037] The nucleotide sequence of crRNA9 in step S1 is shown in SED IQ NO 27: 5'-AAUUUCUACUAAGUGUAGAUGGGUUAGCCACACUUUGCGG-3' (SED IQ NO 27).

[0038] Based on this technical solution, and more preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 28, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 29: GTCGACACATAGGTGAGGTCTG (SED IQ NO 28).

[0039] GAACTCAAGGAGCACATCAGC (SED IQ NO 29).

[0040] Based on this technical solution, and further preferably, the single-stranded DNA fluorescent probe has a first signal molecule labeled at one of its 5' and 3' ends, and a second signal molecule labeled at the other of its 5' and 3' ends; Optionally, the first signal molecule and the second signal molecule are independently selected from FAM, FITC, BHQ, Biotin, or Digoxin, and the first signal molecule is different from the second signal molecule.

[0041] Based on this technical solution, and more preferably, the sequence of the single-stranded DNA fluorescent probe is as shown in SED IQ NO 30.

[0042] FAM-TTTTTTTTTTTT-BHQ (SED IQ NO 30).

[0043] Based on this technical solution, and further preferably, the CRISPR / Cas12a system includes Cas12a protein, crRNA and single-stranded DNA fluorescent probe, wherein 100 nM of Cas12a protein, 100 nM of crRNA and 1500 nM of single-stranded DNA fluorescent probe are incubated at 37°C for 20-40 min.

[0044] Based on this technical solution, and more preferably, the different types of bacteria mentioned in step S3 are H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli, or Staphylococcus aureus.

[0045] Based on this technical solution, and further preferably, step S3 specifically includes the following steps: S3, using the acid-washing glass bead method, extracting nucleic acids from different types of bacteria including H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansas, Escherichia coli, and Staphylococcus aureus, then mixing the CRISPR / Cas12a system with the nucleic acids of different types of bacteria and incubating at 37°C, and using an enzyme-linked immunosorbent assay (ELISA) reader to monitor the fluorescence signal in real time.

[0046] Based on this technical solution, and further preferably, step S4 specifically includes the following steps: S4, incubating the attenuated strain of Mycobacterium tuberculosis with the DNA fluorescently labeled probe at 37°C for 2 hours, washing and centrifuging to remove unbound probes, infecting macrophages, incubating at 37°C for 4 hours, washing with PBS to remove uninfected bacteria, and then treating with trypsin to obtain infected cells; wherein, the volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-100).

[0047] Based on this technical solution, and further preferably, step S5 specifically includes the following steps: S5, using electroporation technology, the CRISPR / Cas12a system is electroporated into infected macrophages at different ratios, co-incubated at 37°C, and the fluorescence signal intensity is monitored at different time points using an ELISA reader; wherein, the volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-10).

[0048] Based on this technical solution, and more preferably, the volumes of the CRISPR / Cas12a system, the RPA isothermal amplification system, and the RPA buffer in step S7 are (2-8):(40-50):(1-4).

[0049] Secondly, the present invention also provides the application of the CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis described in the first aspect in real-time in situ imaging.

[0050] The intracellular Mtb nucleic acid detection method and application based on CRISPR / Cas described in this invention have the following advantages over existing technologies: This invention provides an intracellular Mtb nucleic acid detection method based on CRISPR / Cas12a. By designing crRNA targeting specific genes IS6110 or IS1081, combined with an efficient intracellular delivery strategy and fluorescence signal output, it can detect intracellular Mtb nucleic acid with high sensitivity and specificity, providing an innovative technical solution for early diagnosis of tuberculosis, dynamic monitoring of latent infection, and precision treatment. In addition, this invention also uses electroporation technology to introduce Cas12a protein, crRNA, and reporter probes (such as FAM-labeled single-stranded DNA probes) into Mtb-infected macrophages, ensuring that the CRISPR / Cas12a system functions intracellularly. Combining electroporation technology with the CRISPR / Cas12a system for intracellular in situ nucleic acid detection opens up a new avenue for detecting Mycobacterium tuberculosis compared to existing technologies that mainly rely on in vitro detection.

[0051] Electroporation technology is used to directly introduce the CRISPR / Cas12a system into macrophages or clinical samples (such as bronchoalveolar lavage fluid), enabling in situ intracellular detection and avoiding the operational complexity and loss of detection sensitivity in the nucleic acid extraction process of existing technologies.

[0052] During intracellular detection, Cas12a binds to crRNA, recognizes the target nucleic acid, triggers its non-specific cleavage activity, degrades surrounding reporter probes, and releases a fluorescent signal. The intensity of the fluorescent signal is proportional to the content of the target nucleic acid, reflecting the activity and quantity of intracellular Mtb.

[0053] The detection method provided by this invention is not only applicable to laboratory research, but can also be used for the diagnosis of latent tuberculosis infection and dynamic efficacy evaluation. Attached Figure Description

[0054] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0055] Figure 1 shows the specificity test results of the CRISPR-Cas12a system described in this invention; Figure 2 shows the flow cytometry analysis results of the successful introduction of the CRISPR / Cas12a system into macrophages infected with bacteria using the electroporation technology described in this invention; Figure 3 shows the fluorescence signal inside macrophages observed by confocal microscopy after H37Ra bacteria infected macrophages described in this invention. Detailed Implementation

[0056] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0057] This invention provides an innovative in situ nucleic acid detection method using the CRISPR / Cas12a system. By recognizing intracellular Mycobacterium tuberculosis-specific genes (such as IS6110 or IS1081) through precisely designed crRNA, and combining multiple signal output methods such as real-time fluorescence or laser scanning confocal microscopy, it can achieve rapid diagnosis and dynamic monitoring of latent infection, thereby providing technical support for the early diagnosis, precision treatment and anti-tuberculosis drug screening of latent tuberculosis or tuberculosis.

[0058] Example 1 A CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis, comprising the following steps: S1, designing guide RNA (i.e., crRNA) and primer pairs for the target gene sequence of Mycobacterium tuberculosis, and synthesizing a single-stranded DNA fluorescent probe; Specifically, the target sequence includes IS6110 and IS1081, and the nucleotide sequence of the crRNA is shown in SED IQ NO 1: UAAUUUCUACUCUUGUAGAUAUCAGCUCGGUCUUGUAUAG (SED IQ NO 1).

[0059] Specifically, the primer pair includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown in SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 3: GGTCGGAAGCTCCTATGACAATGCACTAGCC(SED IQ NO 2).

[0060] TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC (SED IQ NO 3).

[0061] Specifically, the single-stranded DNA fluorescent probe has a first signal molecule labeled at one of its 5' and 3' ends, and a second signal molecule labeled at the other of its 5' and 3' ends; optionally, the first signal molecule and the second signal molecule are independently selected from FAM, FITC, BHQ, Biotin, or Digoxin, and the first signal molecule is different from the second signal molecule.

[0062] More specifically, the sequence of the single-stranded DNA fluorescent probe is as shown in SED IQ NO 30: FAM-TTTTTTTTTTTT-BHQ(SED IQ NO 30).

[0063] S2. Prepare a standard solution containing the target gene sequence, dilute it, incubate it with a CRISPR / Cas12a system, and detect the fluorescence signal intensity; Specifically, prepare a standard solution containing the IS6110 DNA sequence (10... 10 After being serially diluted 10-fold, the samples (copies / μL) were incubated with the CRISPR / Cas12a system (100 nM Cas12a, 100 nM crRNA, 1500 nM single-stranded DNA fluorescent probe) at 37°C. The fluorescence signal intensity was monitored using an ELISA reader to determine the limit of detection of the system.

[0064] S3. Extract nucleic acids from different types of bacteria, mix the nucleic acids of different types of bacteria with the CRISPR / Cas12a system, incubate, and detect the fluorescence signal intensity. Specifically, the acid-washed glass bead method was used at 95℃ for 20 min to extract nucleic acids from different types of bacteria, including H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansas, Escherichia coli, and Staphylococcus aureus. Then, 30 μL of the CRISPR / Cas12a system was mixed with 5 μL of nucleic acids from different types of bacteria and incubated at 37℃. The fluorescence signal was monitored in real time using an ELISA reader.

[0065] S4. Incubate the attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe to infect macrophages. Incubate for 2-4 hours, wash, and obtain infected cells. Incubate the attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe at 37°C for 2 hours. Wash and centrifuge to remove unbound probes, infect macrophages, and incubate at 37°C for 4 hours. Wash with PBS to remove uninfected bacteria, and then treat with trypsin to obtain infected cells. The volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-100).

[0066] S5. Using electroporation, the CRISPR / Cas12a system was electroporated into infected macrophages at different ratios, co-incubated at 37°C, and the fluorescence signal intensity was monitored at different time points using an ELISA reader; wherein, the volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system was 1:(1-10).

[0067] S6. Quantitatively and locally analyze the detected fluorescence signals to complete the detection.

[0068] Example 2 A CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis, comprising the following steps: S1, designing specific molecular elements: designing crRNA targeting the IS6110 gene sequence of Mycobacterium tuberculosis, the nucleotide sequence of which is shown in SED IQ NO 1; designing primer pairs required for IS6110 gene amplification: IS6110-F and IS6110-R, the nucleotide sequence of IS6110-F is shown in SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 3; and then synthesizing a single-stranded DNA fluorescent probe (FAM-TTTTTTTTTTTT-BHQ) as a detection reporter molecule.

[0069] S2. In vitro detection sensitivity verification: A standard solution containing the IS6110 DNA sequence (10...) 10 The samples (copies / μL) were serially diluted 10-fold and incubated with the CRISPR / Cas12a system (100 nM Cas12a, 100 nM crRNA, 1500 nM single-stranded DNA fluorescent probe) at 37°C. The fluorescence signal intensity was monitored using an ELISA reader to determine the limit of detection of the system.

[0070] S3. Specificity verification of the CRISPR / Cas12a system: Nucleic acid was extracted from different types of bacteria (H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessis, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli, Staphylococcus aureus) using the acid-washed glass bead method (95℃, 20min). The CRISPR / Cas12a system (30μL) was then mixed with the nucleic acid of different types of bacteria (5μL) and co-incubated at 37℃. The fluorescence signal was monitored in real time using an ELISA reader.

[0071] S4. Establishment of the infected cell model: The attenuated strain of Mycobacterium tuberculosis H37Ra was co-incubated with the fluorescently labeled probe TPAPy-Tre at 37°C for 2 h. After washing and centrifugation to remove unbound probe, macrophages (RAW264.7 cells) were infected with H37Ra bacteria at different ratios (1:1, 2:1, 10:1, 50:1, 100:1) and co-incubated at 37°C for 4 h. Uninfected bacteria were removed by washing with PBS, and the infected cells were harvested after treatment with trypsin.

[0072] S5. Electroporation and fluorescence detection of the CRISPR / Cas12a system: Using electroporation technology (exponential wave mode or square wave mode), the CRISPR / Cas12a system (100nM Cas12a, 100nM crRNA, 1500nM single-stranded DNA fluorescent probe) was electroporated into infected macrophages at different ratios (system to cell culture medium ratio of 1:10, 1:5, 1:1), and co-incubated at 37℃. The fluorescence signal intensity was monitored using an ELISA reader at different time points (0.5h, 1h, 2h, 4h, 8h).

[0073] S6. Quantification and localization of fluorescence signals: The proportion of macrophages carrying FAM fluorescence signals was detected by flow cytometry, and the location of FAM fluorescence signals and tuberculosis bacteria labeled with TPAPy-Tre fluorescence were directly observed in macrophages using laser confocal microscopy to confirm the effectiveness of intracellular detection.

[0074] S7. Combining with isothermal amplification systems to improve sensitivity: To further reduce the detection limit, the CRISPR / Cas12a system was optimized for combination with isothermal amplification (such as recombinant polymerase amplification, RPA) to form a one-step detection scheme. The CRISPR / Cas12a system (2.5 μL), the RPA isothermal amplification system (21.5 μL), and the RPA buffer (1.5 μL) were mixed, and the above detection steps were repeated to verify its ability to detect samples with low bacterial counts.

[0075] In a preferred embodiment, the target sequence includes IS6110, IS1081, esxB, gryB, rpoB, katG, inhA, rpsL, gyrA, gyrB, eis, or pncA. In a preferred embodiment, the volumes of the CRISPR / Cas12a system, the RPA isothermal amplification system, and the RPA buffer in step S7 are (2-8):(40-50):(1-4).

[0076] In a preferred embodiment, the crRNA in step S1 includes crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8 and crRNA9; the primer pair in step S1 includes IS6110-F and IS6110-R.

[0077] The nucleotide sequences of crRNA2 are shown in SED IQ NO 4, IS6110-F in SED IQ NO 5, and IS6110-R in SED IQ NO 6; IS6110-F in SED IQ NO 7, and IS6110-R in SED IQ NO 8; the nucleotide sequences of crRNA3 are shown in SED IQ NO 9, IS6110-F in SED IQ NO 10, and IS6110-R in SED IQ NO 11; the nucleotide sequences of crRNA4 are shown in SED IQ NO 12, IS6110-F in SED IQ NO 13, and IS6110-R in SED IQ NO 14; and the nucleotide sequences of crRNA5 are shown in SED IQ NO 14. As shown in Figure 15, the nucleotide sequence of IS6110-F is shown in SED IQ NO 16, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 17; the nucleotide sequence of crRNA6 is shown in SED IQ NO 18, the nucleotide sequence of IS6110-F is shown in SED IQ NO 19, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 20; the nucleotide sequence of crRNA7 is shown in SED IQ NO 21, the nucleotide sequence of IS6110-F is shown in SED IQ NO 22, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 23; the nucleotide sequence of crRNA8 is shown in SED IQ NO 24, the nucleotide sequence of IS6110-F is shown in SED IQ NO 25, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 26; the nucleotide sequence of crRNA9 is shown in SED IQ NO 24. As shown in Figure 27, the nucleotide sequence of IS6110-F is shown in SED IQ NO 28, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 29.

[0078] In a preferred embodiment, the CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis is applied in real-time in situ imaging.

[0079] CRISPR-Cas12a System Specificity Test: The specificity of the CRISPR / Cas12a system was tested by extracting nucleic acids from different types of bacteria (attenuated Mycobacterium tuberculosis strain (H37Ra), BCG, Mycobacterium smegmatis, Mycobacterium abscessis, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli, and Staphylococcus aureus) using the acid-washing glass bead method (95℃, 20 min). The CRISPR / Cas12a system (30 μL) was then mixed with the nucleic acids from different types of bacteria (5 μL) and co-incubated at 37℃. The fluorescence signal was monitored in real time using an ELISA reader.

[0080] As shown in Figure 1, the results indicate that the CRISPR / Cas12a system can specifically recognize the nucleic acids of Mycobacterium tuberculosis attenuated strain (H37Ra) and BCG, while the fluorescence signals of other bacterial samples remain at the background level.

[0081] The experimental procedure included the following grouping: First, macrophages in the experimental group were infected with an attenuated strain of Mycobacterium tuberculosis (H37Ra) at a multiplicity of infection (MII) of 10:1. Then, the CRISPR / Cas12a system was introduced into the bacteria-infected macrophages via electroporation at a volume ratio of 1:1 (CRISPR / Cas12a system to macrophages). The electroporation parameters were (exponential wave mode, 250V, 950μF). Finally, the macrophages were obtained by centrifugation, washing with PBS, and centrifugation again for flow cytometry experiments. Normally cultured macrophages were used as the control group for flow cytometry experiments.

[0082] Figure 2 shows the flow cytometry analysis results. As can be seen, in the experimental group, the CRISPR / Cas12a system was successfully introduced into bacterial-infected macrophages using electroporation. After incubation at 37°C for 2 hours, the samples were analyzed by flow cytometry. The results showed that, compared to the negative control group, 97.3% of the cells in the experimental group showed detectable signals, and the fluorescence intensity was approximately four times higher than that of the control group.

[0083] Figure 3 shows the fluorescence signal inside macrophages infected with H37Ra bacteria, observed by confocal microscopy. Confocal laser microscopy revealed that *Mycobacterium tuberculosis* (H37Ra, red fluorescent label) in the control group remained latent inside macrophages (nuclei stained blue with DAPI). In this state, the FITC signal channel of the confocal microscope failed to detect any signal. In contrast, in the experimental group, the CRISPR / Cas12a system was successfully introduced into bacterial-infected macrophages using electroporation. After incubation at 37°C for 2 hours, the FITC signal channel of the confocal microscope successfully captured a fluorescence signal (green). These experimental results confirm that the CRISPR / Cas12a system can achieve real-time in-situ imaging of intracellular bacterial nucleic acids.

[0084] In summary, this invention provides a CRISPR / Cas-based method and application for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis. Utilizing electroporation technology, the entire system is introduced into macrophages infected with Mycobacterium tuberculosis or positive clinical samples for in situ detection of Mycobacterium tuberculosis nucleic acid in a one-step process. This method not only surpasses existing technologies in sensitivity, specificity, and ease of operation, but also achieves multi-dimensional optimization of Mycobacterium tuberculosis detection through a series of integrated technologies, greatly expanding the application prospects of CRISPR technology in the diagnosis of infectious diseases.

[0085] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis, characterized in that, Includes the following steps: S1. Design crRNA and primer pairs for the target gene sequence of Mycobacterium tuberculosis, and synthesize single-stranded DNA fluorescent probes; S2. Prepare a standard solution containing the target gene sequence, dilute it, incubate it with the CRISPR / Cas12a system, and detect the fluorescence signal intensity. S3. Extract nucleic acids from different types of bacteria, mix the nucleic acids from different types of bacteria with the CRISPR / Cas12a system, incubate, and detect the fluorescence signal intensity. S4. Incubate the attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe to infect macrophages. After incubation for 2-4 hours, wash to obtain infected cells. S5. Using electroporation, the CRISPR / Cas12a system was electroporated into the infected cells described in S4 at different ratios, incubated, and the fluorescence signal intensity was detected. S6. Quantitatively and locally analyze the detected fluorescence signals to complete the detection.

2. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 1, characterized in that, When the sample to be tested has a low bacterial count, the method further includes: S7. Mix the CRISPR / Cas12a system with the RPA isothermal amplification system and RPA buffer, and repeat steps S1-S6.

3. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 1, characterized in that, The target sequence in step S1 includes IS6110, IS1081, esxB, gryB, rpoB, katG, inhA, rpsL, gyrA, gyrB, eis, or pncA.

4. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 3, characterized in that, The crRNAs mentioned in step S1 include crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8, and crRNA9; the primer pairs mentioned in step S1 include IS6110-F and IS6110-R, wherein the nucleotide sequence of crRNA1 is shown in SED IQ NO 1, the nucleotide sequence of IS6110-F is shown in SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 3. The nucleotide sequence of crRNA2 is shown in SED IQ NO 4, the nucleotide sequence of IS6110-F is shown in SED IQ NO 5, the nucleotide sequence of IS6110-R is shown in SED IQ NO 6; the nucleotide sequence of IS6110-F is shown in SED IQ NO 7, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 8. The nucleotide sequence of crRNA3 is shown in SED IQ NO 9, the nucleotide sequence of IS6110-F is shown in SED IQ NO 10, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 11. The nucleotide sequence of crRNA4 is shown in SED IQ NO 12, the nucleotide sequence of IS6110-F is shown in SED IQ NO 13, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 14. The nucleotide sequence of crRNA5 is shown in SED IQ NO 15, the nucleotide sequence of IS6110-F is shown in SED IQ NO 16, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 17. The nucleotide sequence of crRNA6 is shown in SED IQ NO 18, the nucleotide sequence of IS6110-F is shown in SED IQ NO 19, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 20. The nucleotide sequence of crRNA7 is shown in SED IQ NO 21, the nucleotide sequence of IS6110-F is shown in SED IQ NO 22, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 23. The nucleotide sequence of crRNA8 is shown in SED IQ NO 24, the nucleotide sequence of IS6110-F is shown in SED IQ NO 25, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 26. The nucleotide sequence of crRNA9 is shown in SED IQ NO 27, the nucleotide sequence of IS6110-F is shown in SED IQ NO 28, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 29.

5. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 1, characterized in that, The CRISPR / Cas12a system includes Cas12a protein, crRNA, and a single-stranded DNA fluorescent probe, wherein 100 nM of Cas12a protein, 100 nM of crRNA, and 1500 nM of single-stranded DNA fluorescent probe are incubated at 37°C for 20-40 min.

6. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 1, characterized in that, The different types of bacteria mentioned in step S3 are H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli, or Staphylococcus aureus.

7. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 1, characterized in that, Step S4 specifically includes the following steps: S4. The attenuated strain of Mycobacterium tuberculosis and the DNA fluorescently labeled probe were co-incubated at 37°C for 2 hours. The unbound probes were washed and centrifuged to remove them. Macrophages were then infected and co-incubated at 37°C for 4 hours. Uninfected bacteria were removed by washing with PBS and then treated with trypsin to obtain infected cells. The volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-100).

8. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 1, characterized in that, Step S5 specifically includes the following steps: S5. Using electroporation, the CRISPR / Cas12a system was electroporated into infected macrophages at different ratios, co-incubated at 37°C, and the fluorescence signal intensity was monitored at different time points using an enzyme-linked immunosorbent assay (ELISA) reader. The volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-10).

9. The method for in situ nucleic acid detection of intracellular Mycobacterium tuberculosis based on CRISPR / Cas as described in claim 2, characterized in that, The volumes of the CRISPR / Cas12a system, the RPA isothermal amplification system, and the RPA buffer are (2-8):(40-50):(1-4).

10. The application of the CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis as described in any one of claims 1-9 in real-time in situ imaging.