Treatment of HSV-2 using meganuclease

Viral vectors encoding HSV-2 specific meganucleases are used to treat HSV-2 infection by reducing or eliminating latent virus, addressing the limitations of existing treatments.

JP2026518140APending Publication Date: 2026-06-04FRED HUTCHINSON CANCER RESEARCH CENTER
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-21
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

Current treatments for HSV-2 infection, such as antiviral drugs, do not cure the infection and cannot eliminate or prevent latent virus reactivation, and vaccines have not been effective in treating individuals already infected.

Method used

Compositions comprising viral vectors encoding HSV-2 specific meganucleases are administered to cells or subjects to reduce or eliminate latent HSV-2 infection and reactivation.

Benefits of technology

The method effectively reduces or eliminates latent HSV-2 infection and reactivation, providing a therapeutic approach without detectable toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026518140000001_ABST
    Figure 2026518140000001_ABST
Patent Text Reader

Abstract

Described herein are compositions and methods for providing a viable therapeutic approach to latent herpes simplex virus type 2 (HSV-2) infection by reducing or eliminating latent HSV-2 from HSV-2-infected cells, or by reducing or eliminating the reactivation of latent HSV-2 in HSV-2-infected cells. The compositions comprise a plurality of viral vectors, each comprising a sequence encoding an HSV-2-specific meganuclease. The methods comprise the step of delivering a plurality of viral vectors to HSV-2-infected cells, each of which comprises a sequence encoding an HSV-2-specific meganuclease.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 503541, filed on 22 May 2023, the disclosures of which are incorporated herein by reference in their entirety.

[0002] Statement regarding sequence listings The sequence listing XML related to this application is provided in XML format and is incorporated herein by reference. The name of the XML file containing this sequence listing is 1896-P83WO_Seq_List_20240521.xml. This XML file is 61,447 bytes in size, was created on May 21, 2024, and was filed electronically via the Patent Center together with the application herein.

[0003] Statement regarding the government's licensing rights This invention was made with government support under GM105691 and AI132599, awarded by the National Institutes of Health. The government has certain rights with respect to this invention. [Background technology]

[0004] Herpes simplex virus type 2 (HSV-2) is a member of the Herpesviridae family of double-stranded DNA viruses. HSV-2 is a widely prevalent pathogen and the main cause of genital herpes, a sexually transmitted infection. In 2016, it was estimated that 491.5 million people aged 15-49 worldwide were infected with HSV-2, representing 13% of the world's population in this age group. HSV-2 is a lifelong disease, with prevalence increasing with age, and women are about twice as likely to be infected as men.

[0005] HSV-2 is transmitted through body surface contact with the unprotected genitals of an infected person, but in most cases, it is transmitted through sexual contact. HSV-2 infection often causes recurrent lesions in the genital and perianal areas, as well as viral shedding from mucosal surfaces. Viral shedding can also occur in the absence of lesions or other physical symptoms.

[0006] Following a primary infection of the skin or mucous membrane surface, HSV-2 may migrate from the primary infection site and infect nerve nuclei such as sensory ganglia (e.g., dorsal roots) and autonomic ganglia (e.g., superior cervical and greater pelvic regions) of the peripheral nervous system via retrograde transport, establishing a latent infection. Such neuronal infections may occur without apparent cytopathology.

[0007] Lifetime HSV-2 infection primarily occurs when the virus remains dormant within nerve cells. However, HSV-2 can subsequently reactivate due to certain factors, such as stress, and return to the primary infection site or other peripheral sites via axonal retrograde transport, leading to new lesions and / or viral shedding.

[0008] HSV-2 lesions are often painful, condemned, and have social significance that can affect sexual relationships, potentially leading to further serious health risks. For example, in addition to lesions, HSV-2 infection can cause meningoencephalitis (brain infection) and disseminated infection. In addition, HSV-2 infection triples the risk of acquiring and spreading human immunodeficiency virus (HIV). HSV-2 can also be transmitted to newborns during childbirth. HSV-2 infection in immunocompromised individuals or newborns can be fatal.

[0009] Currently, there is no cure for HSV-2 infection. Treatment options include antiviral drugs such as acyclovir, famciclovir, and valacyclovir. While these drugs can reduce the severity and frequency of symptoms, they cannot cure the infection, nor can they reduce, eliminate, or prevent the latent virus that causes recurrence. In addition, the use of antiviral drugs requires that the patient recognizes the symptoms of HSV-2 infection, seeks a doctor's diagnosis, has access to a pharmacy, has the funds to pay for ongoing treatment, and adheres to the treatment regimen. Such requirements may not be supported for people in parts of the world who do not have access to ongoing antiviral treatment or who are unaware of continued infection and transmission during the incubation period.

[0010] The vaccine has shown some promise in animal models. However, its ability to induce immunity within the nervous system (which would be necessary to inhibit the virus before or during the reactivation process of nerve cells) remains unproven. To date, the vaccine has not been effective in treating millions of people who are already infected with HSV-2. [Overview of the Initiative] [Problems that the invention aims to solve]

[0011] Therefore, there is a need for novel and effective therapeutic measures for HSV-2 and latent HSV-2 infections. This disclosure addresses these needs. [Means for solving the problem]

[0012] This summary is provided to introduce a selection of concepts in a simplified form, which will be further explained in the detailed description below. This summary is not intended to identify any significant features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

[0013] Disclosed herein are compositions comprising one or more viral vectors, each of which comprises a sequence encoding an HSV-2 specific meganuclease.

[0014] Similarly disclosed herein are methods for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells, comprising administering to cells one or more viral vectors containing sequences encoding HSV-2-specific meganucleases.

[0015] Furthermore, disclosed herein are methods for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject, comprising the step of administering to the subject one or more viral vectors containing sequences encoding HSV-2 specific meganucleases.

[0016] Many of the aforementioned aspects of the present invention, and their associated advantages, will be more readily apparent and better understood by referring to the detailed description below in conjunction with the accompanying drawings. [Brief explanation of the drawing]

[0017] [Figure 1] This document presents a series of libraries designed to manipulate heat-stabilized I-OnuI meganucleases against OnuHSV2a DNA target sequences. The libraries are designed to align the desired final OnuHSV2a target sequence to a wild-type I-OnuI sequence, gradually moving outwards from the center of the target sequence (closest to the enzyme active site) to introduce small, stepwise modifications to the meganuclease. Positions within the DNA target sequence that differ from the wild-type I-OnuI recognition sequence are indicated in lowercase. The structure of the I-OnuI meganuclease is shown above the target sequence alignment, with mismatch locations of the bound DNA target shown in red in color diagrams and black in black-and-white diagrams, and corresponding positions of incorporated amino acid side-chain variations indicated by spheres. [Figure 2] This document presents a series of libraries designed to manipulate heat-stabilized I-OnuI meganucleases against OnuHSV2b DNA target sequences. The libraries are designed to align the desired final OnuHSV2b target sequence to a wild-type I-OnuI sequence, gradually moving outwards from the center of the target sequence (closest to the enzyme active site) to introduce small, stepwise modifications to the meganuclease. Positions within the DNA sequence that differ from the wild-type I-OnuI recognition sequence are indicated in lowercase. The structure of the I-OnuI meganuclease is shown above the target sequence alignment, with mismatch locations of the bound DNA target shown in red in color diagrams and black in black-and-white diagrams, and corresponding positions of incorporated amino acid side-chain variations indicated by spheres. [Figure 3][Figure 3A] Shows the expression of meganuclease on the yeast surface. The pETCON yeast surface presentation vector expresses a meganuclease coding sequence having an HA epitope tag at the N-terminus and a Myc epitope tag at the C-terminus. [Figure 3B] Shows the tethered flow cytometric DNA cleavage assay. The HA tag on the meganuclease expressed on the surface is stained with an anti-HA biotin antibody, and the Myc tag is stained with a fluorescent anti-Myc-FITC antibody. The FITC signal can be measured to confirm the expression of the full-length protein on the yeast surface. It generates a double-stranded DNA target substrate having biotin at one end and a fluorescent A647 tag at the other end. The DNA substrate is pre-conjugated with streptavidin-PE (SAV-PE) and mixed with pre-stained meganuclease to form a biotin-streptavidin crosslink between the DNA target substrate and the N-terminus of the meganuclease. Incubation of the meganuclease with the immobilized DNA target substrate in the presence of divalent calcium metal results in the meganuclease binding to the DNA but not cleaving it, as shown in the lower left of Figure 3B. Incubation in the presence of divalent magnesium metal enables cleavage of the immobilized DNA target substrate, as shown in the lower right of Figure 3B. When cleavage occurs, the A647 fluorophore on the opposite end of the DNA target substrate is released and washed away. [Figure 3C] This shows that immobilization of the DNA target substrate in the presence of calcium forms a sharp diagonal line on the flow cytometry plot of the A647 signal versus the PE signal (the cluster of linear points at the top of the graph above). Cleavage of the fixed substrate in the presence of magnesium leads to loss of the A647 tag, resulting in a population of cells that fall off the diagonal (a broad cluster of points at the bottom of the upper graph). A sorting gate (lower graph) can be set to collect cells showing reduced A647 signaling. [Figure 4][Figure 4A] shows the DNA cleavage activity in the fixed flow cytometry cleavage assay of the finally selected population after generating each of the intermediate libraries against the OnuHSV2a target site. In some cases, multiple versions of the library were created (Examples 03a, 03b) to test a wide range of variations that could not fit into a single library. The A647 signal from the fixed DNA substrate is plotted on the y-axis (collected by the APC channel of the cytometer), and the PE signal from the N-terminal staining is plotted on the x-axis. The meg nuclease expressed on the surface was incubated at 37 °C in pH 7.0 buffer for 30 minutes. [Figure 4B] shows the DNA cleavage activity in the fixed flow cytometry cleavage assay of the finally selected population after generating each of the intermediate libraries against the OnuHSV2a target site. In some cases, multiple versions of the library were created (Examples 03a, 03b) to test a wide range of variations that could not fit into a single library. The A647 signal from the fixed DNA substrate is plotted on the y-axis (collected by the APC channel of the cytometer), and the PE signal from the N-terminal staining is plotted on the x-axis. The meg nuclease expressed on the surface was incubated at 37 °C in pH 7.0 buffer for 30 minutes. [Figure 4C] shows the DNA cleavage activity in the fixed flow cytometry cleavage assay of the finally selected population after generating each of the intermediate libraries against the OnuHSV2a target site. In some cases, multiple versions of the library were created (Examples 03a, 03b) to test a wide range of variations that could not fit into a single library. The A647 signal from the fixed DNA substrate is plotted on the y-axis (collected by the APC channel of the cytometer), and the PE signal from the N-terminal staining is plotted on the x-axis. The meg nuclease expressed on the surface was incubated at 37 °C in pH 7.0 buffer for 30 minutes. [Figure 5][Figure 5A] Shows the DNA cleavage activity in fixed flow cytometry cleavage assays of the final selected population after each intermediate library was generated against the OnuHSV2b target site. In some cases, multiple versions of the library were created (Examples 06a, 06b) to test a wide range of variations that could not be contained in a single library. The first library (Lib01) was tested with both the wild-type I-OnuI active site and the E178D active site mutation, and the E178D version of the active site was found to be superior. Therefore, the E178D active site was used in all subsequent libraries for this target. The A647 signal from the fixed DNA substrate was plotted on the y axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x axis. Meganuclease expressed on the surface was incubated in pH 7.0 buffer at 37°C for 30 minutes. [Figure 5B] Shows the DNA cleavage activity in fixed flow cytometry cleavage assays of the final selected population after each intermediate library was generated against the OnuHSV2b target site. In some cases, multiple versions of the library were created (Examples 06a, 06b) to test a wide range of variations that could not be contained in a single library. The first library (Lib01) was tested with both the wild-type I-OnuI active site and the E178D active site mutation, and the E178D version of the active site was found to be superior. Therefore, the E178D active site was used in all subsequent libraries for this target. The A647 signal from the fixed DNA substrate was plotted on the y axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x axis. Meganuclease expressed on the surface was incubated in pH 7.0 buffer at 37°C for 30 minutes. [Figure 5C] Shows the DNA cleavage activity in fixed flow cytometry cleavage assays of the final selected population after each intermediate library was generated against the OnuHSV2b target site. In some cases, multiple versions of the library were created (Examples 06a, 06b) to test a wide range of variations that could not be contained in a single library.The first library (Lib01) was tested with both the wild-type I-OnuI active site and the E178D active site mutation, and the E178D version of the active site was found to be superior. Therefore, the E178D active site was used in all subsequent libraries for this target. The A647 signal from the immobilized DNA substrate was plotted on the y axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x axis. The meganuclease expressed on the surface was incubated in pH 7.0 buffer at 37°C for 30 minutes. [Figure 5D] shows the DNA cleavage activity in the final selected population in the immobilized flow cytometry cleavage assay after each intermediate library was generated against the OnuHSV2b target site. In some cases, multiple versions of the library were created (Examples 06a, 06b) to test a wide range of variations that could not be contained in a single library. The first library (Lib01) was tested with both the wild-type I-OnuI active site and the E178D active site mutation, and the E178D version of the active site was found to be superior. Therefore, the E178D active site was used in all subsequent libraries for this target. The A647 signal from the immobilized DNA substrate was plotted on the y axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x axis. The meganuclease expressed on the surface was incubated in pH 7.0 buffer at 37°C for 30 minutes. [Figure 5E] shows the DNA cleavage activity in the final selected population in the immobilized flow cytometry cleavage assay after each intermediate library was generated against the OnuHSV2b target site. In some cases, multiple versions of the library were created (Examples 06a, 06b) to test a wide range of variations that could not be contained in a single library. The first library (Lib01) was tested with both the wild-type I-OnuI active site and the E178D active site mutation, and the E178D version of the active site was found to be superior. Therefore, the E178D active site was used in all subsequent libraries for this target.The A647 signal from the immobilized DNA substrate was plotted on the y-axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x-axis. The meganuclease expressed on the surface was incubated in pH 7.0 buffer at 37°C for 30 minutes. [Figure 6] This document outlines a non-fixed DNA cleavage activity assay and provides examples of gels exhibiting various levels of cleavage activity in this assay. Meganucleases expressed on the surface are released from the yeast surface upon addition of DTT (which breaks the disulfide bond between the AGA1 yeast surface protein and the AGA2 fusion protein added to the meganuclease by the pETCON vector). The A647-labeled DNA target substrate is freely suspended in solution without physical constraint. Therefore, the meganuclease must successfully bind to the DNA before it can cleave the target. This reaction is incubated in the presence of a divalent calcium metal to enable binding but prevent cleavage (control lane of uncleaved DNA target substrate). Incubation in the presence of a divalent magnesium metal enables cleavage, resulting in shorter cleavage bands after sample electrophoresis on an acrylamide gel. The bands are visualized using a Typhoon imaging system via a fluorescence signal from the A647 tag on the DNA. [Figure 7][Figure 7A] Shows the DNA cleavage activity of the six final candidate OnuHSV2a targets in fixed flow cytometry cleavage assays. Each of the final engineered meganucleases was assayed against the desired OnuHSV2a target and each of the two "2-off" targets identified in the human genome. The A647 signal from the fixed DNA substrate was plotted on the y-axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x-axis. Surface-expressed meganucleases were incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 7B] Shows the DNA cleavage activity of the six final candidate OnuHSV2a targets in fixed flow cytometry cleavage assays. Each of the final engineered meganucleases was assayed against the desired OnuHSV2a target and each of the two "2-off" targets identified in the human genome. The A647 signal from the immobilized DNA substrate was plotted on the y-axis (collected by the cytometer's APC channel), and the PE signal from N-terminal staining was plotted on the x-axis. The surface-expressed meganucleases were incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 7C] Shows the DNA cleavage activity of the six final candidate OnuHSV2a targets in immobilized flow cytometry cleavage assays. Each of the final manipulated meganucleases was assayed against the desired OnuHSV2a target and each of the two "2-off" targets identified in the human genome. The A647 signal from the immobilized DNA substrate was plotted on the y-axis (collected by the cytometer's APC channel), and the PE signal from N-terminal staining was plotted on the x-axis. The surface-expressed meganucleases were incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 7D] DNA cleavage activity of the six final candidate OnuHSV2a targets in fixed flow cytometry cleavage assays is shown. Each of the final engineered meganucleases was assayed against the desired OnuHSV2a target and each of the two “2-off” targets identified in the human genome.Plot the A647 signal from the immobilized DNA substrate on the y-axis (collected by the APC channel of the cytometer), and plot the PE signal from the N-terminal staining on the x-axis. The meg nuclease expressed on the surface was incubated at 37 °C in pH 7.4 buffer for 30 minutes. [Figure 8] Shows the DNA cleavage activity in the non-fixed activity assay of six final candidates for the OnuHSV2a target. Each of the finally engineered meg nucleases was assayed against the desired OnuHSV2a target, two "2-off" targets identified in the human genome, and a single "1-off" target identified in the mouse genome. The reactions were incubated at 37 °C in pH 7.4 buffer for 30 minutes. [Figure 9][Figure 9A] Shows the DNA cleavage activity of the six final candidate OnuHSV2b targets in fixed flow cytometry cleavage assays. Each of the final engineered meganucleases was assayed against the desired OnuHSV2b target and each of the two "3-off" targets identified in the human genome. The A647 signal from the fixed DNA substrate was plotted on the y-axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x-axis. Surface-expressed meganucleases were incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 9B] Shows the DNA cleavage activity of the six final candidate OnuHSV2b targets in fixed flow cytometry cleavage assays. Each of the final engineered meganucleases was assayed against the desired OnuHSV2b target and each of the two "3-off" targets identified in the human genome. The A647 signal from the immobilized DNA substrate was plotted on the y-axis (collected by the cytometer's APC channel), and the PE signal from N-terminal staining was plotted on the x-axis. The surface-expressed meganucleases were incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 9C] Shows the DNA cleavage activity of the six final candidate OnuHSV2b targets in immobilized flow cytometry cleavage assays. Each of the final manipulated meganucleases was assayed against the desired OnuHSV2b target and each of the two "3-off" targets identified in the human genome. The A647 signal from the immobilized DNA substrate was plotted on the y-axis (collected by the cytometer's APC channel), and the PE signal from N-terminal staining was plotted on the x-axis. The surface-expressed meganucleases were incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 9D] DNA cleavage activity of the six final candidate OnuHSV2b targets in fixed flow cytometry cleavage assays is shown. Each of the final engineered meganucleases was assayed against the desired OnuHSV2b target and each of the two “3-off” targets identified in the human genome.The A647 signal from the immobilized DNA substrate was plotted on the y-axis (collected by the APC channel of the cytometer), and the PE signal from N-terminal staining was plotted on the x-axis. The meganuclease expressed on the surface was incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 10] This study demonstrates the DNA cleavage activity of six final candidate OnuHSV2b targets in unfixed activity assays. Each of the final engineered meganucleases was assayed against the desired OnuHSV2b target (Des) and two different "3-off" targets (A and B) identified in the human genome. The same gel was imaged after three progressively longer exposure times to confirm the presence of faint bands (shown as a vertical stack of three labeled band images from "normal exposure" to "darkest exposure" for the shortest gel exposure time). The reaction mixture was incubated in pH 7.4 buffer at 37°C for 30 minutes. [Figure 11][Figures 11A-C] Figure 11A shows a detailed schematic of the plasmid for a mammalian reporter system containing two sites of HSV-2 ONU along with the m4 and CRISPR / Cas9 sites (LAT-gRNA1 and LATgRNR2). M4 is a control meganuclease that does not mediate anti-HSV-2 activity. The reporter plasmid is co-transfected into mammalian 293T cells along with a plasmid expressing a candidate meganuclease or CRISPR / Cas9. The functioning enzyme removes the sequence between the target sites, and the resulting PCR amplicon is smaller than that of the uncleaved state. Figures 11B and 11C show gels demonstrating enzyme cleavage activity, as shown by the smaller PCR amplicon (lower band / shorter bp sequence) compared to the uncleaved PCR amplicon (higher band / longer bp sequence). A single higher / longer base pair band indicates no activity (e.g., the two lanes on the left control). All experiments were performed twice. spCas9 "duplication" was performed using two different gRNAs. Quantification was performed by dosimetry to create the bar graphs at the bottom of panels B and C. All meganuclease candidates tested were functional, as evidenced by smaller PCR amplicon bands (lower bands / shorter bp sequences) in the gel. Sequences 1831 and 1832 appear to have the strongest activity, as evidenced by the highest deletion rates (31% and 37%, respectively). Negative controls (wild-type Onu and sequence 1840) were negative as expected. [Figure 12] We present an alternative approach to confirming enzyme activity via Sanger sequencing of amplicons. Cleavage at the predicted site (shown at the top by a three-part division line with shifted cut ends) is demonstrated by tracing that changes from a relatively low-background "clean" (small peak below the main trace) to a "dirty" trace with numerous sub-dominant peaks, as indicated by the arrows. Cleavage is most dramatic at 1831 and 1832, with numerous sub-dominant peaks appearing, demonstrating significant activity from these variants. [Figure 13]The body weight of animals administered with the indicated enzyme, delivered by AAV9 under the control of the CbH promoter, is shown. Unlike animals administered with m4 under the same conditions (not shown), animals administered with the onu-based enzyme gained normal body weight after treatment, suggesting that the onu-based enzyme is well-tolerated without obvious signs of toxicity. [Figure 14] [Figure 14A] Shows hepatic IFC, TG axonal damage, and TG inflammation in mice administered with the indicated meganuclease enzyme delivered by AAV9 under the control of the CbH promoter. Unlike animals administered with m4 under the same conditions (not shown), no detectable hepatotoxicity or neurotoxicity was observed. [Figure 14B] Shows hepatic IFC, TG axonal damage, and TG inflammation in mice administered with the indicated meganuclease enzyme delivered by AAV9 under the control of the CbH promoter. Unlike animals administered with m4 under the same conditions (not shown), no detectable hepatotoxicity or neurotoxicity was observed. [Figure 14C] Shows hepatic IFC, TG axonal damage, and TG inflammation in mice administered with the indicated meganuclease enzyme delivered by AAV9 under the control of the CbH promoter. Unlike animals administered with m4 under the same conditions (not shown), no detectable hepatotoxicity or neurotoxicity was observed. [Figure 15][Figure 15A] Shows HSV virus shedding after JQ1 induction in control animals or animals administered with the indicated meganuclease enzyme delivered by AAV9 under the control of the CbH promoter. As shown, 6 out of 10 control animals shed HSV at the indicated levels after JQ1; only 3 out of 9 animals shed when treated with 1838; only one animal shed after treatment with 1834; and only one animal shed after treatment with 1831. [Figure 15B] Shows HSV virus shedding after JQ1 induction in control animals or animals administered with the indicated meganuclease enzyme delivered by AAV9 under the control of the CbH promoter. As shown, 6 out of 10 control animals shed HSV at the indicated levels after JQ1; only 3 out of 9 animals shed when treated with 1838; only one animal shed after treatment with 1834; and only one animal shed after treatment with 1831. [Figure 15C] Shows HSV virus shedding after JQ1 induction in control animals or animals administered with the indicated meganuclease enzyme delivered by AAV9 under the control of the CbH promoter. As shown, 6 out of 10 control animals shed HSV at the indicated levels after JQ1; only 3 out of 9 animals shed when treated with 1838; only one animal shed after treatment with 1834; and only one animal shed after treatment with 1831. [Figure 15D] Shows HSV virus shedding after JQ1 induction in control animals or animals administered with the indicated meganuclease enzyme delivered by AAV9 under the control of the CbH promoter. As shown, 6 out of 10 control animals shed HSV at the indicated levels after JQ1; only 3 out of 9 animals shed when treated with 1838; only one animal shed after treatment with 1834; and only one animal shed after treatment with 1831. [Modes for carrying out the invention]

[0018] This application describes compositions and methods for reducing or eliminating latent herpes simplex virus type 2 (HSV-2) from HSV-2 infected cells, or reducing or eliminating the reactivation of latent HSV-2 in HSV-2 infected cells, thereby providing a viable therapeutic approach to latent HSV-2 infection.

[0019] Unless otherwise specifically defined herein, all terms used herein have the same meaning as those to those skilled in the art.

[0020] In one embodiment, the present disclosure provides a composition comprising a plurality of one or more viral vectors, each of which comprises a sequence encoding an HSV-2 specific meganuclease.

[0021] As used herein, “contains” means that the sequence is associated with the viral vector, whether the sequence is contained within the viral vector, excreted by the viral vector, bound to the viral vector, or otherwise associated with the viral vector.

[0022] In some embodiments, the present disclosure provides compositions for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells, comprising one or more viral vectors, each of which comprises a sequence encoding an HSV-2 specific meganuclease.

[0023] As used herein, “viral vector” refers to a vector used to deliver or administer a composition to a cell, such composition containing genetic material such as deoxyribonucleic acid (DNA) and / or ribonucleic acid (RNA). “Viral vector” refers to the use of adeno-associated virus (AAV) vectors or any viral vectors engineered from AAV. For example, viral vectors of one or more types of viral vectors include self-complementary adeno-associated virus (scAAV), single-stranded adeno-associated virus (ssAAV), and known serotypes of AAV vectors, scAAV vectors, and ssAAV vectors.

[0024] In some embodiments, one or more viral vectors include one viral vector. In some embodiments, one or more viral vectors include two viral vectors. In some embodiments, one or more viral vectors include three viral vectors.

[0025] In some embodiments, each of the one or more viral vectors is an AAV. This AAV may include any serotype known to those skilled in the art. For example, one or more AAVs may include adeno-associated viruses of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-Dj, AAV-Dj / 8, PHP.eB, PHP.S, AAV-rh8, AAV-rh10, or combinations thereof. In some embodiments, one or more AAVs may include adeno-associated viruses of serotypes AAV-rh10, AAV8, AAV9, AAV1, AAV-Dj / 8, or combinations thereof.

[0026] In some embodiments, one or more viral vectors are self-complementary adeno-associated viruses (scAAVs), single-stranded adeno-associated viruses (ssAAVs), or a combination thereof.

[0027] In some embodiments, the multiple viral vectors include multiple scAAVs; multiple ssAAVs; or each combination of one or more scAAVs and ssAAVs.

[0028] In some embodiments, the viral vector includes both scAAV and ssAAV. For example, in some embodiments, the viral vector includes multiple scAAVs and multiple ssAAVs. In such embodiments, the ratio of scAAV to ssAAV may be about 1:99 to about 99:1; about 10:90 to about 90:10; about 20:80 to about 80:20; about 30:70 to about 70:30; about 50:50 to about 99:1; about 10:90; about 20:80; about 30:70; about 40:60; about 50:50; about 60:40; about 70:30; about 80:20; about 90:10; or about 99:1.

[0029] In some embodiments, the viral vector is ssAAV. In some embodiments, the viral vector comprises multiple ssAAVs. In some embodiments, the ssAAV comprises one ssAAV serotype. In other embodiments, the ssAAV comprises one or more ssAAV serotypes, two ssAAV serotypes, three ssAAV serotypes, four ssAAV serotypes, five ssAAV serotypes, or six ssAAV serotypes.

[0030] In some embodiments, ssAAV includes any serotype known to those skilled in the art. For example, in some embodiments, one or more ssAAVs include adeno-associated viruses of ssAAV1, ssAAV2, ssAAV3, ssAAV4, ssAAV5, ssAAV6, ssAAV7, ssAAV8, ssAAV9, ssAAV10, ssAAV11, ssAAV12, ssAAV-Dj, ssAAV-Dj / 8, PHP.eB, PHP.S, ssAAV-rh8, ssAAV-rh10 serotypes, or combinations thereof. In some embodiments, one or more ssAAVs include ssAAV9, ssAAV-Dj / 8, ssAAV-rh10, ssAAV8, ssAAV1, another serotype of adeno-associated virus, or combinations thereof. In some embodiments, one or more types of ssAV include ssAAV9, ssAAV-Dj / 8, ssAAV-rh10, ssAAV8, ssAAV1, or a combination thereof. In some embodiments, one or more types of ssAV include ssAAV9. In some embodiments, one or more types of ssAAV include ssAAV-Dj / 8. In some embodiments, one or more types of ssAAV include ssAAV-rh10. In some embodiments, one or more types of ssAAV include ssAAV8. In some embodiments, one or more types of ssAAV include ssAAV1.

[0031] In some embodiments, the viral vector is scAAV. In some embodiments, the viral vector comprises multiple scAAVs. In some embodiments, the scAAV comprises one scAAV serotype. In other embodiments, the scAAV comprises multiple scAAV serotypes, two scAAV serotypes, three scAAV serotypes, four scAAV serotypes, five scAAV serotypes, or six scAAV serotypes.

[0032] This scAAV includes any serotype known to those skilled in the art. For example, in some embodiments, one or more scAAVs include adeno-associated viruses of serotypes scAAV1, scAAV2, scAAV3, scAAV4, scAAV5, scAAV6, scAAV7, scAAV8, scAAV9, scAAV10, scAAV11, scAAV12, scAAV-Dj, scAAV-Dj / 8, PHP.eB, PHP.S, ssAAV-rh8, ssAAV-rh10, or combinations thereof. In some embodiments, one or more scAAVs include scAAV9, scAAV-Dj / 8, scAAV-rh10, scAAV8, scAAV1, another serotype of adeno-associated virus, or combinations thereof. In some embodiments, one or more types of scAAV include scAAV9, scAAV-Dj / 8, scAAV-rh10, scAAV8, scAAV1, or a combination thereof. In some embodiments, one or more types of scAAV include scAAV9. In some embodiments, one or more types of scAAV include scAAV-Dj / 8. In some embodiments, one or more types of scAAV include scAAV-rh10. In some embodiments, one or more types of scAAV include scAAV8. In some embodiments, one or more types of scAAV include scAAV1. In some embodiments, one or more types of scAAV include scAAV8. In some embodiments, one or more types of scAAV include scAAV1.

[0033] In some embodiments, multiple viral vectors include various adeno-associated viruses and combinations of adeno-associated virus serotypes.

[0034] As used herein, “sequence” includes a DNA strand and / or an RNA strand. A DNA strand includes the natural DNA bases cytosine (C), guanine (G), adenine (A), and / or thymine (T). An RNA strand includes the natural RNA bases cytosine (C), guanine (G), adenine (A), and / or uracil (U). In some embodiments, the sequence is a double-stranded or single-stranded DNA. In other embodiments, the sequence is a strand of RNA.

[0035] In some embodiments, the viral vector comprises a DNA sequence encoding an HSV-2 specific meganuclease. In some embodiments, the viral vector comprises a different DNA sequence encoding an HSV-2 specific meganuclease. Due to the degeneracy of the DNA encoding, some embodiments may use DNA sequences optimized to reduce the use of rare codons, or to reduce the frequency of CpG motifs, or to use other options to optimize meganuclease production.

[0036] In some embodiments, each of the one or more viral vectors contains the same DNA sequence encoding an HSV-2 specific meganuclease. In some embodiments, each of the one or more viral vectors contains the same DNA sequence encoding an HSV-2 specific meganuclease. In some embodiments, each of the one or more viral vectors contains different DNA sequences encoding an HSV-2 specific meganuclease. In some embodiments, each of the one or more viral vectors contains DNA sequences encoding different HSV-2 specific meganucleases. In some embodiments, some of the one or more viral vectors contain the same DNA sequence encoding an HSV-2 specific meganuclease, while some of the one or more viral vectors contain different DNA sequences encoding an HSV-2 specific meganuclease. In some embodiments, some of the one or more viral vectors contain the same DNA sequence encoding an HSV-2 specific meganuclease, while some of the one or more viral vectors contain DNA sequences encoding different HSV-2 specific meganucleases.

[0037] In some embodiments, the sequence encoding the HSV-2 specific meganuclease is configured to encode an HSV-2 specific meganuclease that targets one or more HSV-2 genes essential for replication.

[0038] In some embodiments, the sequence encoding an HSV-2 specific meganuclease is configured to encode an HSV-2 specific meganuclease that induces one or more DNA double-strand breaks.

[0039] A "meganuclease" is an enzyme that recognizes and cleaves DNA, such as double-stranded DNA. Meganucleases are also known as endonucleases or homing endonucleases.

[0040] As used herein, meganuclease is an endonucleases having polynucleotide recognition sites of at least 12 base pairs (bp); 12 bp to 60 bp; 12 bp to 40 bp; 15 to 60 bp; 15 to 40 bp; 15 to 30 bp; 18 to 26 bp; or 20 to 24 bp. In some embodiments, meganuclease is an endonucleases having polynucleotide recognition sites of 22 base pairs.

[0041] The meganuclease may be either a monomer or a dimer. This meganuclease may be any natural meganuclease, such as a homing endonuclease. In some embodiments, the meganuclease is an engineered meganuclease, an artificial meganuclease, or a synthetic meganuclease, such as a homing endonuclease group I intron and intein; a zinc finger protein; a group II intron protein; or a meganuclease derived from a chemically modified nucleic acid derivative. The meganuclease may be any engineered meganuclease, such as a meganuclease engineered by translation from RNA encoded by a synthetic DNA sequence. In some embodiments, the meganuclease is post-translationally modified.

[0042] I-OnuI is an intron-encoded homing endonuclease and a “meganuclease.” Such meganucleases are enzymes that recognize and cleave both strands of a DNA target, for example, 22 base pairs, causing a DNA double-strand break. I-OnuI was modified through protein engineering approaches to recognize altered DNA target sequences of the same length and used to disrupt or otherwise modify genomic targets holding the corresponding target sequences.

[0043] In some embodiments, the meganuclease includes an engineered variant derived from thermally stabilized I-OnuI(eOnuTherm). In some embodiments, the meganuclease includes one of the sequences identified as OnuHSV2a_1831, OnuHSV2a_1832, OnuHSV2a_1834, OnuHSV2a_1838, OnuHSV2a_1840, and OnuHSV2a_1856 (identified herein as Sequence IDs 1-6, respectively). In some embodiments, the meganuclease includes the sequence identified as OnuHSV2a_1831. In some embodiments, the meganuclease includes the sequence identified as OnuHSV2a_1832.

[0044] In some embodiments, the meganuclease comprises one or more of the following sequences.

[0045] OnuHSV2a_1831:

[0046] [ka]

[0047] OnuHSV2a_1832:

[0048] [ka]

[0049] OnuHSV2a_1834:

[0050] [ka]

[0051] OnuHSV2a_1838:

[0052] [ka]

[0053] OnuHSV2a_1840:

[0054] [ka]

[0055] OnuHSV2a_1856:

[0056] [ka]

[0057] In some embodiments, the meganuclease comprises one of the sequences identified as OnuHSV2b_2269, OnuHSV2b_2275, OnuHSV2b_2279, OnuHSV2b_2287, OnuHSV2b_2288, and OnuHSV2b_2290 (identified herein as Sequence IDs 7-12).

[0058] In some embodiments, the meganuclease comprises one or more of the following sequences.

[0059] OnuHSV2b_2269:

[0060] [ka]

[0061] OnuHSV2b_2275:

[0062] [ka]

[0063] OnuHSV2b_2279:

[0064] [ka]

[0065] OnuHSV2b_2287:

[0066] [ka]

[0067] OnuHSV2b_2288:

[0068] [ka]

[0069] OnuHSV2b_2290:

[0070] [ka]

[0071] Gene editing using meganucleases directly targets the latent genome by destroying or eliminating HSV-2 while preserving nerve cells, thus eliminating the possibility of viral reactivation and disease development. Specifically, gene editing with meganuclease proteins involves introducing meganucleases into nerve ganglia via an adeno-associated virus (AAV) vector. Upon entering the nerve cell, the meganucleases bind to and cleave the viral DNA strand, destroying the HSV-2 viral genome. At least two independent cleavage events were optimal for disabling the viral DNA linking and repair mechanisms. Once the viral genome is destroyed, the virus becomes unable to replicate, and ultimately, the latent virus is eliminated from the nerve cell.

[0072] In some embodiments, the HSV-2 specific meganuclease is configured to induce one or more DNA double-strand breaks. In some embodiments, the HSV-2 specific meganuclease is configured to induce one DNA double-strand break. In some embodiments, the HSV-2 specific meganuclease is configured to induce two DNA double-strand breaks. In some embodiments, the HSV-2 specific meganuclease is configured to induce three DNA double-strand breaks.

[0073] In some embodiments, each of one or more HSV-2 specific meganucleases is configured to induce one or more DNA double-strand breaks in the HSV-2 gene. In some embodiments, the HSV-2 specific meganuclease is configured to induce one DNA double-strand break in the HSV-2 gene. In some embodiments, the HSV-2 specific meganuclease is configured to induce two DNA double-strand breaks in the HSV-2 gene. In some embodiments, the HSV-2 specific meganuclease is configured to induce three DNA double-strand breaks in the HSV-2 gene.

[0074] In some embodiments, each of one or more DNA double-strand breaks is achieved by the same meganuclease sequence. In some embodiments, each of two DNA double-strand breaks is achieved by the same meganuclease sequence. In some embodiments, each of one or more DNA double-strand breaks is achieved by different meganuclease sequences. In some embodiments, each of two DNA double-strand breaks is achieved by different meganuclease sequences.

[0075] Each DNA double-strand break can result from one or more mechanisms. For example, an HSV-2 DNA double-strand break may remain broken after being cleaved by a meganuclease. Alternatively, an HSV-2 DNA double-strand break resulting from meganuclease cleavage may be repaired by non-homologous end joining, and repeated cleavage and repair of HSV-2 DNA double-strand breaks can lead to DNA sequence errors, cleavage, or mutations in the HSV-2 gene. HSV-2 DNA double-strand breaks can lead to degradation and / or loss of the HSV-2 genome.

[0076] In some embodiments, the HSV-2 specific meganuclease targets one or more HSV-2 genes essential for replication. In some embodiments, the HSV-2 specific meganuclease is configured to target one or more HSV-2 genes encoding proteins known to be essential for replication in cells, cell culture, or in vivo, for example. In some embodiments, the HSV-2 specific meganuclease is configured to target one or more HSV-2 genes encoding proteins whose essentiality for replication in cells, cell culture, or in vivo is unknown, or whose essentiality for replication in cells, cell culture, or in vivo is known to be unknown, but which may or may not be essential for human infection.

[0077] In some embodiments, the HSV-2-specific meganuclease targets one or more HSV-2 DNA sequences essential for replication. In some embodiments, the HSV-2-specific meganuclease is configured to target one or more HSV-2 DNA sequences that are known to encode proteins, for example, essential for replication in cells, replication in cell culture, or replication in vivo. In other embodiments, the HSV-2-specific meganuclease is configured to target one or more HSV-2 DNA sequences that are unknown to encode a protein or are known not to encode a protein. In further embodiments, one or more HSV-2 specific meganucleases are configured to target one or more HSV-2 DNA sequences that encode proteins known to be essential for replication in cells, replication in cell culture, or replication in vivo; one or more HSV-2 DNA sequences that encode proteins whose essentiality for replication in cells or replication in cell culture is unknown, or which are known not to be essential for replication in cells or replication in cell culture, and which may or may not be essential for human infection; or one or more HSV-2 DNA sequences whose protein encoding is unknown or which are known not to encode a protein; or a combination thereof.

[0078] The HSV-2 genes or DNA sequences essential for replication are estimated to account for approximately 30-40% of the total HSV-2 gene and are essential for productive replication in cultured cells. These essential genes can be broadly classified as follows: functions essential for viral entry (e.g., gB, gD, gH / L), functions essential for viral DNA replication (e.g., DNA polymerase-UL30, helicase-primase complex-UL42, UL52), and functions essential for virion construction (e.g., capsid proteins-UL19, UL26, scaffold proteins-US3). In particular, many essential genes are highly conserved among HSV-2 strains, making them attractive targets for meganuclease therapy.

[0079] In some embodiments, one or more HSV-2 specific meganucleases are configured to target the overlapping portion of the HSV-2 LAT region having the sequence TATCCTTTTTTTCTAGGTGTTT (SEQ ID NO: 13) derived from OnuHSV2a. In some embodiments, one or more HSV-2 specific meganucleases are configured to target the sequence TCTGCATCTATACCTCTTTCTG (SEQ ID NO: 14) derived from OnuHSV2b. The OnuHSV2b gene target is located in the HSV-2 gene UL48. In some embodiments, one or more HSV-2 specific meganucleases include meganucleases configured to target other overlapping portions of the HSV-2 genome. In some embodiments, one or more HSV-2 specific meganucleases include meganucleases configured to target non-overlapping portions of the HSV-2 genome. In some embodiments, one or more HSV-2 specific meganucleases include meganucleases configured to target a combination of HSV-2 genome targets.

[0080] In some embodiments, one or more viral vectors further comprise one or more regulatory sequences. For example, one or more viral vectors further comprise the regulatory sequence described in SEQ ID NO: 42.

[0081] CbH:

[0082] [ka]

[0083] The CbH promoter, identified in Sequence ID No. 42, is a potent constitutive promoter that promotes high levels of transgene expression in various cell types, ensuring high levels of meganuclease expression in neurons and other cell types.

[0084] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier or excipient. Examples of a “pharmaceutically acceptable carrier,” “pharmaceutically acceptable excipient,” or “pharmaceutically acceptable carrier or excipient” include, but are not limited to, any adjuvant, carrier, excipient, flow enhancer, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, humectant, dispersant, suspending agent, stabilizer, isotonic agent, solvent, pH adjuster, hydrogel, salt, inert solid, printing solid, semi-liquid, liquid, or emulsifier approved by the United States Food and Drug Administration as permissible for use in humans, mammals, or livestock. Each carrier must be “acceptable” in the sense that it is compatible with the other components of the formulation and is not harmful to the subject.

[0085] In some embodiments, the compositions and pharmaceutically acceptable carriers or excipients disclosed herein constitute a “pharmaceutical composition,” where the pharmaceutical composition refers to a formulation of the compounds of the disclosure with a medium generally accepted in the art for the delivery or administration of the compounds to mammals (e.g., humans). Such mediums include all of the pharmaceutically acceptable carriers or excipients described herein. For example, these pharmaceutically acceptable carriers or excipients may be carriers or excipients suitable for oral, nasal, rectal, enteral, sacral, vaginal, intraperitoneal, topical, subcutaneous, intramuscular, or oral administration.

[0086] In some embodiments, the composition or pharmaceutical composition is configured for injection, oral administration, vaginal administration, or other administration to provide, for example, an amount of the composition or pharmaceutical composition effective in reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells or subjects. In some embodiments, administration by injection is subcutaneous, intravenous, intraperitoneal, and / or intramuscular. In some embodiments, injections include injection into cerebrospinal fluid, injection into ganglia, autologous cell transplantation, and / or allogeneic cell transplantation.

[0087] Examples of injectable preparations include sterile aqueous or oily suspensions for injection, formulated according to known techniques using appropriate dispersants or wetting agents and suspending agents. Sterile injectable preparations may also be sterile injectable solutions, suspensions, or emulsions in non-toxic, parenterally acceptable diluents or solvents. Among the acceptable media and solvents available are water, Ringer's solution (USP), and isotonic sodium chloride solution. In addition, sterile fixative oils may be used as solvents or suspension media. For this purpose, any non-infectious fixative oil, such as synthetic monoglycerides or diglycerides, may be used. In addition, fatty acids such as oleic acid may also be used in the preparation of injectable preparations.

[0088] In another embodiment, the Disclosure provides a method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells, comprising the step of administering compositions described herein. Specifically, in some embodiments, the method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells comprises the step of administering a plurality of one or more viral vectors to HSV-2 infected cells, each of which comprises a sequence encoding an HSV-2 specific meganuclease, as described herein.

[0089] In some embodiments, a method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells comprises the step of administering the composition to HSV-2 infected cells in an amount effective for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells.

[0090] In some embodiments, these cells are mammalian cells. In some embodiments, these cells are human cells. In some embodiments, this composition is administered to HSV-2 infected cells of a mammalian subject. In some embodiments, this mammalian subject is human.

[0091] In some embodiments, HSV-2 infected cells are nerve cells. In some embodiments, these cells are sensory ganglion cells. In some embodiments, these cells are autonomic ganglion cells. In some embodiments, these cells are trigeminal ganglion cells. In some embodiments, these cells are dorsal root ganglion cells. In some embodiments, these cells are superior cervical ganglion cells. In some embodiments, these cells are greater pelvic ganglion cells. In some embodiments, these cells are ganglion cells within a ganglion, for example, ganglion cells within a ganglion disclosed herein. In some embodiments, HSV-2 infected cells are combinations of multiple different types of HSV-2 infected cells. In some embodiments, HSV-2 infected cells include trigeminal ganglion, dorsal root ganglion, superior cervical ganglion, greater pelvic ganglion, sensory ganglion, autonomic ganglion, other HSV-2 infected cells, or combinations thereof. In some embodiments, HSV-2 infected cells include sensory ganglion, autonomic ganglion, or combinations thereof. In some embodiments, HSV-2 infected cells include the trigeminal ganglion, dorsal root ganglion, superior cervical ganglion, greater pelvic ganglion, or a combination thereof.

[0092] In some embodiments, HSV-2 infected cells are superior cervical ganglion cells, trigeminal ganglion cells, dorsal root ganglion cells, greater pelvic ganglion cells, or a combination thereof.

[0093] In some embodiments, one or more viral vectors may be delivered to cells according to methods generally known to those skilled in the art, and these viral vectors are suitable for specific viral vectors and cell types.

[0094] In another embodiment, the Disclosure provides a method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject, comprising the step of administering a composition described herein. Specifically, in some embodiments, the method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject comprises the step of administering a plurality of one or more viral vectors to a subject infected with HSV-2, each of which comprises a sequence encoding an HSV-2 specific meganuclease, as described herein.

[0095] In some embodiments, one or more viral vectors containing sequences encoding HSV-2-specific meganucleases are administered in amounts effective in reducing or eliminating latent HSV-2 or HSV-2 reactivation in the subject.

[0096] In some embodiments, a method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject comprises the step of administering a pharmaceutical composition to the subject, the pharmaceutical composition comprising one or more viral vectors containing sequences encoding HSV-2 specific meganucleases, and a pharmaceutically acceptable carrier or excipient as described herein.

[0097] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0098] As used herein, “administer” means administering to a subject one or more viral vectors containing sequences encoding HSV-2 specific meganucleases by a method or route that is effective in reducing or eliminating HSV-2 in the subject and results in complete or partial inoculation of the subject or a desired site of the subject. Complete inoculation means that the amount of HSV-2 is undetectable by methods known to or used by those skilled in the art. Partial inoculation means that the amount of HSV-2 in the subject is reduced compared to the amount of HSV-2 present in the subject before administration. For example, the amount of HSV-2 in the sample is reduced by approximately 10% to 99%, 15% to 99%, 20% to 99%, 30% to 99%, 40% to 99%, 50% to 99%, 60% to 99%, 70% to 99%, 80% to 99%, 90% to 99%, 10% to 98%, or 20% to 95%.

[0099] In some embodiments, the HSV-2 genome is modified by delivering or administering an “effective” amount of the viral vector. As used herein, the term “effective” refers to any amount that induces the desired response without inducing significant toxicity in the subject. For example, an “effective” amount is an amount that modifies the HSV-2 genome in about 10% to about 100%, about 15% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 10% to about 98%, and about 20% to about 95% of the cells in contact with the composition. The “effective” amount is also the amount that modifies the HSV-2 genome in a cell so that the amount of HSV-2 is undetectable by HSV-2 detection methods known or used in the art.

[0100] An "effective" dose is also the amount that reduces the number of HSV-2 infected cells compared to the number of HSV-2 infected cells present before administration of the viral vector. For example, an "effective" dose is the amount that reduces the number of HSV-2 infected cells by approximately 10% to 100%, 15% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 10% to 98%, or 20% to 95%.

[0101] The terms “decrease” or “reduce” are used herein to generally mean a reduction of only a statistically significant amount. For example, “decrease” or “reduce” means a reduction of at least 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, about 100%, or a reduction of 100% or less (e.g., a level that does not exist or is undetectable compared to the baseline), or any reduction of 10–99% compared to the baseline. “Eliminate” means either complete removal or an amount that is undetectable.

[0102] The use of the term “or” in the claims is used to mean “and / or” unless it is explicitly indicated that it refers only to alternatives, or that the alternatives are not mutually exclusive.

[0103] In accordance with long-standing patent law, the words "a" and "an," when used in combination with the word "include" in the claims or specification, mean one or more unless otherwise specified.

[0104] Unless otherwise clearly required by the context, throughout this description and the claims, the words “including,” “contains,” and similar terms should be interpreted in a comprehensive sense, as opposed to an exclusive or exhaustive sense, and to indicate “including but not limited to.” Words used in singular or plural also include plural and singular forms, respectively. In addition, the words “as specified herein,” “above,” and “below,” and similar terms, when used in this application, refer to the entire application and not to any particular part thereof.

[0105] The term “Target” in this specification includes, but is not limited to: mammals with HSV-2 infection, latent HSV-2 infection, or latent HSV-2 reactivation; mammals being evaluated for reduction or elimination of HSV-2 infection, latent HSV-2 infection, or latent HSV-2 reactivation; mammals suspected of having HSV-2 infection, latent HSV-2 infection, or latent HSV-2 reactivation; or mammals at risk of having HSV-2 infection, latent HSV-2 infection, or latent HSV-2 reactivation.

[0106] In some embodiments, the subjects are those at risk of developing HSV-2 infection, those diagnosed with HSV-2, those seeking treatment for HSV-2, those currently being treated for HSV-2, those currently being treated for HSV-2 and seeking monitoring or modification of their existing therapeutic treatment, those previously treated for HSV-2, or those infected with HSV-2, regardless of whether they have previously received any treatment related to HSV-2.

[0107] As used herein, the term “HSV-2 infection” refers to the undesirable proliferation or presence of HSV-2 in a host organism, or cell, or subject. Infection may be caused by actively replicating lytic HSV-2 and may be referred to as a lytic infection. Infection may be caused by dormant or latent HSV-2 and may be referred to as a latent HSV-2 infection. A latent infection may reactivate to become a lytic infection or recurrent HSV-2 infection, causing a relapse of HSV-2-related illness with active symptoms.

[0108] As used herein, the term “protein” refers to a sequence or polymer of amino acid residues linked to one another by peptide bonds between the alpha-amino and carboxyl groups of adjacent amino acid residues. The term “protein” may also refer to modified amino acids (e.g., phosphorylated, methylated, glycosylated, and similar) and amino acid analogs, regardless of size or function. The term “protein” may also be used to refer to gene products and / or fragments thereof.

[0109] As used herein, the term “pharmaceutically acceptable” means a compound, material, composition, and / or dosage form that is within the bounds of sound medical judgment and suitable for use in contact with human and animal tissues without causing excessive toxicity, irritation, allergic reactions, or other problems or complications, and that is commensurate with a reasonable benefit / risk ratio. [Examples]

[0110] The following examples are provided to give a complete disclosure and explanation of how to manufacture and use the present invention to those skilled in the art. The following examples are not intended to limit the scope of the invention, nor are they intended to represent the entire scope of experiments performed.

[0111] (Example 1) Operation of meganuclease We have successfully engineered heat-stabilized I-OnuI meganucleases to target the OnuHSV2a DNA sequence TATCCTTTTTTTCTAGGTGTTT (SEQ ID NO: 13) and the OnuHSV2b DNA sequence TCTGCATCTATACCTCTTTCTG (SEQ ID NO: 14). The OnuHSV2a target is a duplicate target site, meaning that a single meganuclease targeting this sequence will create two separate cleavage sites in the viral genome. The OnuHSV2b target site is unique in the HSV-2 genome. These custom-specific meganucleases were engineered through repeated rounds of structure-based directed evolution combined with expression on the surface of yeast and selection for desired DNA cleavage activity using fluorescence-activated cell sorting (FACS) and flow cytometry DNA cleavage assays.

[0112] Target site selection From the HSV-2 viral genome, we searched for target sequences of 22 base pairs with up to 10 mismatches from the wild-type DNA recognition sequence of I-OnuI meganuclease (TTTCCACTTATTCAACCTTTTA, Sequence ID No. 15). A target was considered if any mismatch within the central four base pairs of this recognition sequence was included in the list of known acceptable central four sequences of I-OnuI. Target sequences were considered good if they were located within essential HSV-2 genes, and preferred if they were also duplicate target sites (meaning a single meganuclease would cleave the HSV-2 genome at two separate sites). For each HSV-2 target sequence under consideration, we used sequence database search tools to identify closely related DNA sequences (three or fewer mismatches) in both human and mouse genomes.

[0113] Library design strategy The desired 22bp HSV-2 target sequence was aligned to the wild-type DNA recognition sequence of I-OnuI meganuclease. A series of manipulation libraries were designed to highlight the mismatch locations and gradually move outward from the center of the target site (closest to the enzyme's active site) to make small, stepwise modifications to the meganuclease (windows of less than 3bp at a time). The small modifications were designed individually for each half of the target site, then joined at the center of the target, and then progressed outward. See Figure 1 for a list of libraries designed for manipulation of the HSV-2 target "OnuHSV2a" (SEQ ID NO: 13), and Figure 2 for the library design strategy for the HSV-2 DNA target "OnuHSV2b" (SEQ ID NO: 14). The OnuHSV2a DNA target site contains nine mismatches from the wild-type I-OnuI recognition sequence, one of which is an acceptable alternative central 4 sequence. The OnuHSV2b DNA target site contains 10 mismatches, one of which is an acceptable alternative central 4 sequence.

[0114] Using the crystal structure of DNA-bound, heat-stabilized I-OnuI meganuclease (PDB ID 6UVW), we identified individual amino acid side chains that contact the bases of the DNA target site requiring modification. Assembly PCR was used to incorporate degenerate codons into the meganuclease coding sequences, and the resulting sequence collection was recombined into a pETCON yeast surface presentation vector to create a library of meganucleases with variations at specific amino acid positions.

[0115] Libraries were constructed and screened. Briefly, library insert DNA containing degenerate codons at strategically placed locations was combined with an open pETCON yeast surface presentation vector, and EBY100 yeast was transformed using lithium acetate transformation. Expression of the meganuclease library on the yeast surface was induced by growth in a galactose-containing selective medium.

[0116] The library was screened for desired DNA cleavage activity using a fixed flow cytometry activity assay. Double-stranded DNA substrates containing the desired DNA target sequence were generated by PCR amplification using a biotinylated primer and another primer conjugated to an Alexa647 (A647) fluorophore. This produced DNA target substrates with biotin at one end and a fluorescent A647 tag at the other end. The PCR product was incubated with Exonuclease I to digest unincorporated primers and then purified using a small exclusion column made of Sephadex G-100 resin.

[0117] The pETCON yeast surface presentation vector expresses a meganuclease coding sequence having an N-terminal hemagglutinin (HA) epitope tag and a C-terminal Myc epitope tag (Figure 3A). In primary staining, the HA tag was stained with an anti-HA biotin antibody, and the Myc tag was stained with a fluorescent anti-Myc-FITC antibody (Figure 3B). The signal from the FITC fluorophore can be measured to detect stable full-length protein expression on the yeast surface. The biotin-labeled DNA target substrate was pre-conjugated with 5 nM streptavidin-phycoerythrin (SAV-PE) at a concentration of 40 nM. The pre-conjugated DNA substrate was then incubated with primary-stained yeast cells to create physical fixation of the N-terminus of the meganuclease between the anti-HA biotin antibody and the biotinylated DNA substrate conjugated with SAV-PE (Figure 3B).

[0118] Yeast libraries were incubated with a calcium-containing cleavage buffer to bind surface-expressed meganucleases to the immobilized substrate (but without cleavage), or incubated with a magnesium-containing buffer to induce cleavage. If the surface-expressed meganucleases are able to cleave the immobilized DNA substrate, the fluorescent A647 tag on the DNA is released and washed away (Figure 3C). Physical immobilization of the DNA target substrate in the presence of calcium creates a sharp diagonal in the A647 signal vs. PE signal flow cytometry plot (Figure 3C). Cleavage of the immobilized substrate in the presence of magnesium reduces the A647 signal. This disappearance of the A647 signal creates a distinct population of yeast cells that fall off the diagonal, allowing for the design of a gate in a cell sorter to capture yeast library variants that have successfully cleaved the immobilized DNA target substrate (Figure 3C).

[0119] For each library, a fixed flow cytometry DNA cleavage assay was used in two consecutive sorting rounds to collect meganuclease variants active against the desired DNA target substrate. The first sorting was performed on the entire yeast library by digestion at 37°C at pH 7.2 for 45 minutes. The sorted cells were grown in rich medium and then re-inductioned for surface expression in a galactose-containing selective medium. A second sorting was then performed on the cultures enriched in the first sorting under more stringent digestion conditions at 37°C at a lower pH 7.0 for a shortened time of 30 minutes. The sorting gate was further lowered to collect only the yeast with the greatest decrease in A647 signal.

[0120] After two rounds of screening for each library, the final selected population was subjected to a fixed flow cytometry DNA cleavage assay to verify enrichment with meganuclease variants possessing cleavage activity against the desired DNA target. See Figure 4 for the results of activity checks on the selected populations after each of the nine libraries required for the OnuHSV2a target. See Figure 5 for the results of activity checks on the selected populations after each of the twelve libraries required for the OnuHSV2b target.

[0121] Yeast minipreps were performed on the final selected populations of each library, and the extracted pETCON plasmid DNA was transformed into chemically qualified bacteria. This process assumes that each resulting bacterial colony contains a single meganuclease-coding pETCON plasmid derived from a single selected yeast cell. Individual bacterial colonies were inoculated into small amounts of preserved culture and sequenced by colony PCR. The resulting meganuclease sequences were aligned to identify unique variants.

[0122] Once unique variant meganuclease sequences were identified, bacterial plasmid minipreps were prepared for each variant meganuclease using bacterial colony-preserved cultures. The plasmid preps were individually converted back into yeast using the lithium acetate method, and cultures of each unique meganuclease variant were grown to induce expression on the yeast surface.

[0123] (Example 2) Meganuclease DNA cleavage Parallel comparisons of meganuclease DNA cleavage activity against desired DNA targets were performed using two separate activity assays. A fixed flow cytometry cleavage assay (described above) was performed in parallel with the surface-release DNA cleavage activity assay (Figure 6). In this unfixed cleavage assay, the same surface-expressing yeast culture was used, but the addition of dithiothreitol (DTT) to the reactant released the meganuclease from the yeast surface, allowing it to float freely in solution. The same biotin / A647-labeled DNA target substrate was added to this reactant, but the substrate did not physically bind to the meganuclease. Therefore, for cleavage activity to be observed, the meganuclease must be able to bind to and cleave the DNA target substrate. The unfixed DNA cleavage activity assay may be considered to more realistically represent the meganuclease's ability to interact with desired DNA target sites. In the flow cytometry cleavage assay, physical fixation of the substrate can artificially induce high cleavage activity in meganucleases whose binding should be impaired. These two DNA cleavage assays are performed together on the same surface-expressing yeast culture when the most complete evaluation of binding and cleavage activity is required.

[0124] From the final library of OnuHSV2a target sites, 48 ​​colonies were sequenced to identify 44 unique meganuclease variants. These 44 unique variants were tested in parallel for activity against desired targets and three different off-target sequences using both fixed flow cytometry cleavage assays (Figure 7) and unfixed DNA cleavage assays (Figure 8). Off-target searches identified two potentially problematic "2-off" targets in the human genome and one "1-off" target in the mouse genome. Off-targets are a concern and should be screened if mismatches exist at the outermost ends of the DNA recognition sequence. Meganucleases have a natural tendency to tolerate more sequence mutations at these outer locations.

[0125] Of the 44 unique OnuHSV2a variants isolated, only six showed minimal to no activity against two off-target sequences in the human genome (Figures 7 and 8), but retained activity against the desired HSV-2 target sequences. All six variants showed activity against mouse 1-off sequences. These six manipulated meganuclease variants were designated as final candidates for OnuHSV2a target sites and were moved to testing in mammalian cell lines.

[0126] From the final library of OnuHSV2b target sites, 104 colonies were sequenced, identifying a total of 83 unique meganuclease sequences. These 83 unique variants were tested in parallel for activity against the desired target and two different off-target sequences identified in the human genome using both fixed flow cytometry cleavage assays (Figure 9) and unfixed DNA cleavage assays (Figure 10). Of the tested meganucleases, six were identified as having minimal to no activity against the two off-target sequences while maintaining activity against the desired HSV-2 target sequences. These six manipulated meganuclease variants were designated as final candidates for the OnuHSV2b target sites and were moved to testing in mammalian cell lines.

[0127] (Example 3) Gene editing reduces genomic HSV. In this example, it has been demonstrated that meganuclease delivered via AAV rather than CRISPR / Cas9 mediated highly efficient gene editing of HSV-2, eliminating over 90% of latent virus from the superior cervical ganglion and reducing HSV-2 shedding from infected animals. Single-cell RNA sequencing has demonstrated that both HSV-2 and individual AAV serotypes are distributed non-randomly among neuronal subsets in the ganglion, suggesting that improved delivery to all neuronal subsets could lead to even more complete HSV-2 shedding.

[0128] To improve endonuclease-induced gene editing of latent HSV genomes to a level necessary for therapeutic efficacy, self-complementary scAAV vectors, simultaneous targeting of multiple sites within the HSV-2 genome, substitution of meganucleases with CRISPR / Cas9, and the relative distribution of HSV-2 compared to AAV vectors at the single-cell level suggest that meganuclease-mediated gene editing is a valid pathway for treating latent HSV-2. The application of meganuclease-mediated gene editing to HSV-2 requires the development of HSV-2-specific meganucleases as described herein.

[0129] method Cells and herpesviruses HEK293 and Vero cell lines were grown in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum. HSV-2 strain F or syn17 was also used in this experiment. + We used this method to proliferate the cells and then titrated them against Vero cells.

[0130] AAV production and titer measurement (tittering) In this study, AAV stocks were constructed using the following AAV vector plasmids: pscAAV-CBh-m5, pscAAV-CBh-m8, pscAAV-CBh-m4, pssAAV-smCBA-m5-T2A-Trex2-2A-mCherry, pssAAV-sCMV-SaCas9-U6-sgRNA, pssAAV-CMV-SaCas9-U6-sgRNA, pssAAV-nEF-SaCas9-U6-sgRNA, pscAAV-CBh-NLS-mScarlet, pscAAV-CBh-NLS-mEGFP, pscAAV-CBh-NLS-DsRed-Express2, and pscAAV-CBh-NLS-mTagBFP2. AAV stocks for all serotypes were prepared by transiently transfecting 293 cells with PEI in a ratio of 4:1 (μl PEI:μg DNA). In short, 1.6 × 10 7 Individual HEK293 cells, DNA from scAAV or ssAAV vector plasmid, Cells were transfected with 28 μg DNA consisting of plasmids expressing AAV rep and capsid protein, and a helper plasmid expressing adenovirus helper protein (pHelper) (in a 5:1:3 ratio). 24 hours after transfection, the medium was replaced with serum-free DMEM. Cells were collected after 72 hours, resuspended in AAV lysis buffer (50 mM Tris, 150 mM NaCl, pH 8.5), and then frozen and thawed four times. AAV stocks were purified by iodixanol gradient separation. Recombinant adeno-associated virus purification using a novel method improves infectivity titer and yield. Samples were concentrated in PBS using an Amicon Ultra-15 column and stored at -80°C. All AAV vector stocks were quantified by qPCR using primers / probes against AAV ITR, with linearized plasmid DNA used as the standard. AAV stocks were treated with DNase I and Proteinase K before quantification.

[0131] Establishment of nerve cell culture Nerve cell cultures were applied to the damaged cornea in a 2x10⁻¹⁰ 5 Neuronal cell cultures were established from TG cells isolated from mice 7 days after infection with PFU HSV(F). Briefly, neuronal cell cultures were established after enzymatic digestion with collagenase and dispase, followed by purification of the resulting cell homogenates using Percoll gradients (12.5% ​​and 28%). Neurons were counted and seeded at a density of 4,000 neurons per well on 12 mm circular slides coated with poly-D-lysine and laminin. Neurons were cultured without removing non-neuronal cells that provide important growth support; therefore, the culture contained a mixed population of neurons, satellite glial cells, and other cell types. The cultures were maintained in complete neuronal cell medium consisting of Neurobasal A medium supplemented with 2% B27 supplement, 1% PenStrep, L-glutamine (500 μM), and nerve growth factor (NGF; 50 ng / ml). The medium was replaced with fresh medium every 2-3 days. Acyclovir (100 nM) was added to this culture medium for the first five days.

[0132] HSV infection and AAV inoculation in mice Mice were housed in accordance with the guidelines of the Institute for Animal Care and Use in Research and the NIH. Female Swiss Webster mice aged 6–8 weeks were used for all tests. For ocular HSV infection, mice were anesthetized by intraperitoneal injection of ketamine (100 mg / kg) and xylazine (12 mg / kg), and then 2 × 10⁻¹⁶ corneal lesions were incised in the right eye using a 28-gauge needle. 5 PFU was infected with HSV2(F) or syn17+. For AAV inoculation, mice anesthetized with ketamine / xylazine were administered the indicated AAV vector dose to one side via intradermal whisker pad (WP) injection, postorbital (RO) injection, or tail vein (TV) injection. Right (ipsilateral) TG and bilateral SCG were collected at the indicated times. The presence of AAV in the ganglia of treated mice was confirmed by ddPCR.

[0133] Reactivation of exografts The collected TG and SCG were reactivated by incubation in 10% FBS-DMEM culture medium for 24 hours, and then whole-genome DNA was extracted as described below. After tissue reactivation, a statistically significant increase of 2-3 times in the HSV genome was detected in the reactivated tissue compared to the untreated (control mouse) non-reactivated (latent) tissue.

[0134] PCR amplification of HSV target sites Whole-genome DNA (gDNA) was extracted using the DNeasy Tissue & Blood microkit for neuronal cell culture or the DNeasy Tissue & Blood minikit for whole TG. The region containing the target site of HSV1m5 was PCR-amplified using Platinum Pfx DNA polymerase and 5 μl of gDNA with UL19 primers: forward 5'-CTGGCCGTGGTCGTACATGA (SEQ ID NO: 43) and reverse 5'-TCACCGACATGGGCAACCTT (SEQ ID NO: 44). L30 primer: Amplify the region containing the target site of HSV2m8 by forward 5'-GAGAACGTGGAGCACGCGTACGGC (SEQ ID NO: 45) and reverse 5'-GGCCCGGTTTGAGACGGTACCAGC (SEQ ID NO:), or amplify the region containing the target site of HSV1m4 by ICP0 primer: forward 5'-GACAGCACGGACACGGAACT (SEQ ID NO: 47) and reverse 5'-TCGTCCAGGTCGTCGTCATC (SEQ ID NO: 48), or U L 54 primer: Amplify the region containing the target site of SaCas9 / sgRNA UL54 (sgRNA13, sgRNA17, and sgRNA26) by forward 5'-GACCGCATCAGCGAGAGCTT (SEQ ID NO: 49) and reverse 5'-CTCGCAGACACGACTCGAAC (SEQ ID NO: 50), or U L 30 - primer: Amplify the region containing the target site of SaCas9 / sgRNA UL30 (sgRNA1 and sgRNA10) by forward 5'-CGGCCATCAAGAAGTACGAG (SEQ ID NO: 51) and reverse 5'-AAGTGGCTCTGGCCTATGTC (SEQ ID NO: 52). The thermocycler conditions were 94°C for 5 minutes, 40 - 45 cycles (94°C for 30 seconds, 60°C for 30 seconds, 70°C for 30 seconds), and then 70°C for 5 minutes.

[0135] T7 endonuclease 1 (T7E1) assay T7 endonuclease assays and quantifications to determine the level of gene disruption were performed as follows. Target sites were PCR-amplified from the HSV genome, purified using the Zymo Research clean and concentrator-5 kit, and then 300 ng of DNA amplicon was denatured at 95°C for 10 minutes and slowly reannealed by cooling to room temperature. The DNA was then digested with 5-10 units of T7 endonuclease at 37°C for 30-60 minutes and separated on an agarose gel. Gene disruption was quantified using ImageJ software, with the formula: 100 × (1 - [1 - cleavage rate]¹ / ²) (where cleavage rate = density of cleavage products / (density of cleavage products + density of uncleaved products)).

[0136] Quantitative analysis of ddPCR The viral genome was quantified by ddPCR using the aforementioned AAV ITR primer / probe set and the gB primer / probe set for HSV. Cell counts in tissue were quantified by ddPCR using the mouse-specific RPP30 primer / probe set: forward 5'-GGCGTTCGCAGATTTGGA (SEQ ID NO: 53), reverse 5'-TCCCAGGTGAGCAGCAGTCT (SEQ ID NO: 54), and probe 5'-ACCTGAAGGCTCTGCGCGGACTC (SEQ ID NO: 55). In some control ganglia, sporadic samples showed positivity for the AAV genome, but the levels were typically 2–3 log lower than those in ganglia from treated mice treated with AAV. This may be due to the occasional low levels of contamination in tissue samples.

[0137] Illumina Next-Generation Sequencing (NGS) Next-generation sequencing of the meganuclease target site was performed using PCR products generated with the target site-specific primers described above, and a MiSeq sequencer.

[0138] Single-cell RNA analysis Swiss-Webster mice were introduced via the ocular pathway. 5 PFU HSV syn 17+ was used for latent infection, and after 60 days, one of four different AAV serotypes—1, 8, PHP.S, and Rh10 (each carrying a unique fluorescent protein transgene under the CBh promoter: mScarlet, mEGFP, DsRed.Express2, and TagBFP2)—was injected. For each serotype, three mice were independently subjected to 10 12 A single AAV genome was subcutaneously injected into a whisker pad (AAV1) or intravenously into the posterior orbital vein (AAV8, PHP.S, and Rh10). Three weeks later, animal-derived TG and SCG were collected, and each tissue (TG or SCG) was pooled from all animals. Neuronal isolation was performed by enzymatic tissue digestion (see above), followed by density gradient centrifugation and enrichment using a Neuron Isolation Kit, which allowed untouched neurons to pass through the column while non-neuronal cells remained bound.

[0139] Tissues and isolated neurons were maintained in ice-cold Neurobasal A medium supplemented with 2% B27 supplement, 1% PenStrep, L-glutamine (500 μM), or PBS throughout the entire procedure, excluding the enzymatic tissue digestion step. Cells were encapsulated, and scRNA-seq libraries were prepared at the Genomics Core Facility of FHCRC using the 10X Genomics Chromium Single Cell 3' Library and Gel Bead Kit v2 according to the manufacturer's instructions. The 10x Genomics Single Cell 3' expression libraries were sequenced using an Illumina HiSeq 2500 running in high-power mode with a paired-end (26 bp × 8 bp × 98 bp) sequencing strategy. The SCG and TG libraries were pooled and distributed onto eight sequencing lanes. Image analysis and base calling were performed using RTA Version 1.18.66.3. Sequence analysis was performed using 10X Genomics 'Cell Ranger' v2.1.0 and Seurat v2.3.4. High-quality sequence data was obtained from 2,372 purified TG neurons and 2,172 SCG neurons.

[0140] Statistics and Reproducibility Statistical analysis was performed using GraphPad Prism 7 software. HSV loading was compared using multiple t-tests, with an alpha of 0.05%. Each tissue was analyzed individually without assuming a consistent standard deviation. The distribution of HSV and AAV in scRNA-seq experiments was compared using χ². 2 The analysis was performed using a statistical test, and the alpha value was 0.05. Since tissues from animals injected with different AAV serotypes / transgenes were pooled, the cell count was normalized relative to the input value by multiplying the cell count by the number of animals administered that serotype and dividing by the total number of animals. Each graph shows error bars representing the mean and standard deviation. These test results were replicated in multiple experiments using various experimental settings.

[0141] RT-ddPCR quantification of SaCas9, sgRNA, and HSV1m5 expression. DNA and RNA were isolated from experimentally collected ganglion cells using the AllPrep DNA / RNA kit. SaCas9, sgRNA, and HSV2m5 expression were quantified using a One-step RT-ddPCR kit with 2 μl of RNA and the following primer / probe sets: SaCas9-specific primers: SaCas9 forward 5'-CCGCCCGGAAAGAGATTATT (SEQ ID NO: 56), reverse 5'-CGGAGTTCAGATTGGTCAGTT (SEQ ID NO: 57), and probe [FAM]AGCTGCTGGATCAGATTGCCAAGA[MGB] (SEQ ID NO: 58); Tracr-specific primers: TRACR LS forward 5'-TGCCGTGTTTATCTCGTCAACT (SEQ ID NO: 59), reverse 5'-CCCGCCATGCTACTTATCTACTTAA (SEQ ID NO: 60), and probe [FAM]TTGGCGAGATTTTT[MGB] (SEQ ID NO: 61); HSV2m5-specific primer: m5 The mega-forward 5'-TGGACAGCCTGAGCGAGAA (SEQ ID NO: 62), the reverse 5'-GCAGAGACAGAGGAGCAATGTG (SEQ ID NO: 63), and the probe [FAM]CGGCCGGTGATTCCTCTGTTTCTAATTC[BHQ] (SEQ ID NO: 64). The cycling process was as follows: reverse transcription at 50°C for 60 minutes, enzyme activation at 95°C for 10 minutes, 40 cycles (95°C for 30 seconds, 60°C for 1 minute, 70°C for 30 seconds), followed by enzyme inactivation at 98°C for 10 minutes.

[0142] (Example 4) HSV-2-specific meganucleases mediate gene editing in mammalian cells, are well-tolerated in mice, and reduce HSV-2 efflux. The meganuclease manipulation and screening described in Examples 1 and 2 were performed in yeast cells. To confirm that the resulting meganucleases were also active in mammalian cells, a mammalian reporter system was developed consisting of plasmids (LAT-gRNA1 and LATgRNR2) containing two sites of OnuHSV2a and m4 and CRISPR / Cas9 sites (Figure 11A). The functional enzyme removed the sequence between the target sites, and the resulting PCR amplicons were smaller compared to the uncleaved state. Figures 11B and 11C show gels demonstrating enzyme cleavage activity, as shown by smaller PCR amplicons (lower bands / shorter bp sequences) compared to uncleaved PCR amplicons (higher bands / longer bp sequences). A single higher / longer base pair band indicates no activity (e.g., the two control lanes on the left). All experiments were performed twice. spCas9 "duplication" was performed with two different gRNAs. Next, the inventors performed dose measurements to quantify the relative efficiency of the meganucleases (shown in the bar graphs at the bottom of panels B and C). As can be seen from the smaller PCR amplicon bands in the gel (lower bands / shorter bp sequences), all candidates tested were functional. As can be seen from the highest deletion rates (31% and 37%, respectively), the inventors found that meganucleases 1831 and 1832 exhibited the strongest activity. Negative controls (wild-type I-Onu and sequence 1840) were negative as expected.

[0143] As an alternative approach to confirm enzyme activity in mammalian cells, the region of the reporter construct containing the enzyme target site was amplified by PCR, and the amplicon was then analyzed by Sanger sequencing (Figure 12). Cleavage of the predicted site (shown at the top by a three-part division line with shifted cut ends) is demonstrated by tracing that changes from a "clean" trace with relatively little background (small peak below the main trace) to a "dirty" trace with numerous semi-dominant peaks, as indicated by the arrows. Consistent with our results from gel analysis in the previous section, cleavage was most efficient with meganucleases 1831 and 1832, and numerous semi-dominant peaks were observed, demonstrating significance with respect to these variants.

[0144] To confirm that I-OnuI-derived meganucleases targeting HSV-2 should be tolerable in vivo, 1 × 10⁶ meganucleases under the control of the CbH promoter were used. 12 Using vector genomes (vg)AAV9, mice were administered meganucleases 1831, 1834, or 1838, and the body weight of these animals was tracked (Figure 13). Administration of m4 under these conditions resulted in slow or no post-treatment weight gain. Unlike animals administered m4 under the same conditions (not shown), animals administered with the Onu-based enzymes gained normal body weight after treatment, suggesting that the Onu-based enzymes are well-tolerated without obvious signs of toxicity.

[0145] As an additional approach to confirm that an Onu-derived meganuclease targeting HSV-2 should be tolerable in vivo, 1 × 10⁶ meganucleases under the control of the CbH promoter were used. 12Using vector genome (vg)AAV9, mice were administered meganucleases 1831, 1834, or 1838, and hepatic inflammatory cell foci (IFCs), TG axonal damage, and TG inflammation were evaluated (Figure 14). Under these conditions, administration of m4 increased IFC, TG axonal damage score, and TG inflammation score. Unlike animals administered m4 under the same conditions (not shown), no detectable hepatotoxicity or neurotoxicity was observed with meganucleases 1831, 1834, or 1838.

[0146] To determine whether treatment with I-OnuI-derived meganuclease can successfully reduce HSV-2 shedding from latent infected animals, latent HSV-2 infected mice were subjected to 1 × 10⁶ treatments with meganucleases 1831, 1834, or 1838 under the control of the CbH promoter. 12 Animals were either treated with vector genome (vg)AAV9 or left untreated (control, CTRL, Figure 15). After one month, HSV-2 efflux was induced using the bromodomain inhibitor JQ1. In the untreated control group, after JQ1, 6 out of 10 control animals effluxed HSV at indicated levels. In contrast, only 3 out of 9 animals effluxed when treated with 1838; only one animal effluxed after treatment with 1834; and only one animal effluxed after treatment with 1831. These results generally reproduce the relative efficiencies of the enzymes in reporter experiments (Figures 11 and 12, 1831 > 1834 > 1838), supporting the in vivo anti-HSV-2 activity of I-OnuI-derived meganucleases.

[0147] Embodiment 1. A composition comprising one or more viral vectors, each of which comprises a sequence encoding an HSV-2 specific meganuclease.

[0148] Embodiment 2. The composition according to Embodiment 1, wherein the one or more viral vectors are self-complementary adeno-associated viruses (scAAV), single-stranded adeno-associated viruses (ssAAV), or a combination thereof.

[0149] Embodiment 3. The composition according to Embodiment 2, wherein the ssAAV is ssAAV9, ssAAV-Dj / 8, ssAAV-rh10, ssAAV8, ssAAV1, another serotype of adeno-associated virus, or a combination thereof.

[0150] Embodiment 4. The composition according to Embodiment 2, wherein the scAAV is scAAV9, scAAV-Dj / 8, scAAV-rh10, scAAV8, scAAV1, another serotype of adeno-associated virus, or a combination thereof.

[0151] Embodiment 5. The composition according to any one of Embodiments 1 to 4, wherein the sequence encoding the HSV-2 specific meganuclease is configured to encode an HSV-2 specific meganuclease that targets one or more HSV-2 genes essential for replication.

[0152] Embodiment 6. The composition according to any one of Embodiments 1 to 5, wherein the sequence encoding the HSV-2 specific meganuclease is configured to encode an HSV-2 specific meganuclease that induces one or more DNA double-strand breaks.

[0153] Embodiment 7. The composition according to any one of Embodiments 1 to 6, wherein the HSV-2 specific meganuclease is configured to induce one or more DNA double-strand breaks.

[0154] Embodiment 8. The composition according to any one of Embodiments 1 to 7, wherein the HSV-2 specific meganuclease is configured to induce two DNA double-strand breaks.

[0155] Embodiment 9. The composition according to any one of Embodiments 1 to 8, wherein the HSV-2 specific meganuclease is configured to target one or more HSV-2 genes essential for replication.

[0156] Embodiment 10. The composition according to any one of Embodiments 1 to 9, wherein the HSV-2 specific meganuclease comprises the sequence described in SEQ ID NOs: 1 to 6.

[0157] Embodiment 11. The composition according to any one of Embodiments 1 to 10, wherein the HSV-2 specific meganuclease comprises SEQ ID NO: 1 or 2.

[0158] Embodiment 12. The composition according to any one of Embodiments 1 to 9, wherein the HSV-2 specific meganuclease comprises the sequences described in SEQ ID NOs: 7 to 12.

[0159] Embodiment 13. The composition according to any one of Embodiments 1 to 12, wherein the HSV-2 specific meganuclease is configured to target one or more sequences described in SEQ ID NOs: 13 and 14.

[0160] Embodiment 14. The composition according to any one of Embodiments 1 to 13, wherein the one or more viral vectors further comprises a regulatory sequence.

[0161] Embodiment 15. The composition according to Embodiment 14, wherein the regulating sequence includes the sequence described in Sequence ID No. 42.

[0162] Embodiment 16. The composition according to any one of Embodiments 1 to 15, wherein the plurality of one or more viral vectors comprises one to three scAAVs, each scAAV having a different serotype, and each scAAV comprising a sequence encoding an HSV-2 specific meganuclease, the sequences being identical or different.

[0163] Embodiment 17. A pharmaceutical composition comprising the composition described in any one of Embodiments 1 to 16 and a pharmaceutically acceptable carrier or excipient.

[0164] Embodiment 18. A method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells, comprising the step of administering to the cells a composition according to any one of claims 1 to 16.

[0165] Embodiment 19. The method according to claim 18, comprising the step of administering the composition to cells in an amount effective in reducing or eliminating latent HSV-2 or HSV-2 reactivation in the cells.

[0166] Embodiment 20. The method according to claim 18 or 19, wherein the cells are mammalian cells.

[0167] Embodiment 21. The method according to any one of claims 18 to 20, wherein the cell is a nerve cell.

[0168] Embodiment 22. The method according to any one of Embodiments 18 to 21, wherein the cells are sensory ganglion cells, autonomic ganglion cells, or a combination thereof.

[0169] Embodiment 23. The method according to any one of Embodiments 18 to 22, wherein the cells are superior cervical ganglion cells, trigeminal ganglion cells, dorsal root ganglion cells, greater pelvic ganglion cells, another HSV-2 infected cell, or a combination thereof.

[0170] Embodiment 24. A method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject, comprising the step of administering to the subject a composition according to any one of Embodiments 1 to 16 in an amount effective for reducing or eliminating latent HSV-2 or HSV-2 reactivation in the subject.

[0171] Embodiment 25. A method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject, comprising the step of administering the pharmaceutical composition described in Embodiment 17 to the subject.

[0172] Embodiment 26. The method according to Embodiment 24 or 25, wherein the administration step is performed by subcutaneous injection or intramuscular injection.

[0173] Embodiment 27. The method according to any one of Embodiments 24 to 26, wherein the subject is a mammal.

[0174] Embodiment 28. The method according to any one of claims 24 to 27, wherein the subject is a human.

[0175] While exemplary embodiments are illustrated and described, it will be understood that various modifications can be made without departing from the spirit and scope of the present invention.

[0176] Embodiments of the present invention for which exclusive ownership or privilege is claimed are defined below.

Claims

1. A composition comprising one or more viral vectors, wherein each of the one or more viral vectors comprises a sequence encoding an HSV-2 specific meganuclease.

2. The composition according to claim 1, wherein the one or more viral vectors are self-complementary adeno-associated viruses (scAAV), single-stranded adeno-associated viruses (ssAAV), or a combination thereof.

3. The composition according to claim 2, wherein the ssAAV is ssAAV9, ssAAV-Dj / 8, ssAAV-rh10, ssAAV8, ssAAV1, another serotype of adeno-associated virus, or a combination thereof.

4. The composition according to claim 2, wherein the scAAV is scAAV9, scAAV-Dj / 8, scAAV-rh10, scAAV8, scAAV1, another serotype of adeno-associated virus, or a combination thereof.

5. The composition according to claim 1, wherein the sequence encoding the HSV-2 specific meganuclease is configured to encode an HSV-2 specific meganuclease that targets one or more HSV-2 genes essential for replication.

6. The composition according to claim 1, wherein the sequence encoding the HSV-2 specific meganuclease is configured to encode an HSV-2 specific meganuclease that induces one or more DNA double-strand breaks.

7. The composition according to claim 1, wherein the HSV-2 specific meganuclease is configured to induce one or more DNA double-strand breaks.

8. The composition according to claim 1, wherein the HSV-2 specific meganuclease is configured to induce two DNA double-strand breaks.

9. The composition according to claim 1, wherein the HSV-2 specific meganuclease is configured to target one or more HSV-2 genes essential for replication.

10. The composition according to claim 1, wherein the HSV-2 specific meganuclease comprises the sequences described in SEQ ID NOs: 1 to 6.

11. The composition according to claim 1, wherein the HSV-2 specific meganuclease comprises SEQ ID NO: 1 or 2.

12. The composition according to claim 1, wherein the HSV-2 specific meganuclease comprises the sequences described in SEQ ID NOs: 7 to 12.

13. The composition according to claim 1, wherein the HSV-2 specific meganuclease is configured to target one or more sequences described in SEQ ID NOs: 13 and 14.

14. The composition according to claim 1, wherein the one or more viral vectors further comprise a regulatory sequence.

15. The composition according to claim 14, wherein the regulatory sequence includes the sequence described in Sequence ID No.

42.

16. The composition according to claim 1, wherein the plurality of one or more viral vectors comprises one to three scAAVs, each scAAV having a different serotype, and each scAAV comprising a sequence encoding an HSV-2 specific meganuclease, the sequences being identical or different.

17. A pharmaceutical composition comprising the composition according to any one of claims 1 to 16 and a pharmaceutically acceptable carrier or excipient.

18. A method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in cells, comprising the step of administering to the cells a composition according to any one of claims 1 to 16.

19. The method according to claim 18, comprising the step of administering the composition to cells in an amount effective in reducing or eliminating latent HSV-2 or HSV-2 reactivation in the cells.

20. The method according to claim 18, wherein the cells are mammalian cells.

21. The method according to claim 18, wherein the cell is a nerve cell.

22. The method according to claim 18, wherein the cells are sensory ganglion cells, autonomic ganglion cells, or a combination thereof.

23. The method according to claim 18, wherein the cells are superior cervical ganglion cells, trigeminal ganglion cells, dorsal root ganglion cells, greater pelvic ganglion cells, other HSV-2 infected cells, or a combination thereof.

24. A method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject, comprising the step of administering to the subject a composition according to any one of claims 1 to 16 in an amount effective for reducing or eliminating latent HSV-2 or HSV-2 reactivation in the subject.

25. A method for reducing or eliminating latent HSV-2 or HSV-2 reactivation in a subject, comprising the step of administering the pharmaceutical composition according to claim 17 to the subject.

26. The method according to claim 24 or 25, wherein the administration step is performed by subcutaneous injection or intramuscular injection.

27. The method according to claim 24 or 25, wherein the subject is a mammal.

28. The method according to claim 24 or 25, wherein the subject is a human.