Nucleic acid molecule for inhibiting mRNA expression via rnai, and use thereof
By designing chemically modified double-stranded RNA molecules, the problems of insufficient stability and effectiveness of dsRNA molecules in vivo were solved, achieving highly efficient inhibition of Lp(a), PCSK9, ANGPTL3 and FXI genes, which has the potential to treat cardiovascular and cerebrovascular diseases and hypercholesterolemia.
Patent Information
- Application Number
- PCT/CN2025/147946
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-06-17
- Filing Date
- 2025-12-31
- Publication Date
- 2026-07-09
AI Technical Summary
In existing RNAi technologies, there is still room for improvement in the stability and effectiveness of dsRNA molecules in vivo, making it difficult to effectively and persistently inhibit the expression of target genes.
Design and synthesize double-stranded RNA (dsRNA) molecules with specific chemical modifications, including sense and antisense strands, and ligand modifications to enhance targeting and cellular uptake, for use in gene repression targeting specific tissues or cells.
It improves the stability and effectiveness of dsRNA molecules and enhances the inhibitory effect on target genes, especially the specific silencing of Lp(a), PCSK9, ANGPTL3 and FXI genes, and has potential application prospects in the treatment of cardiovascular and cerebrovascular diseases and hypercholesterolemia.
Smart Images

Figure PCTCN2025147946-FTAPPB-I100001 
Figure PCTCN2025147946-FTAPPB-I100002 
Figure PCTCN2025147946-FTAPPB-I100003
Abstract
Description
Nucleic acid molecules that inhibit mRNA expression via RNAi and their applications
[0001] Citation of relevant applications
[0002] This application claims priority to the following applications:
[0003] Chinese Patent Application No. 202510011197.7, filed on January 3, 2025;
[0004] Chinese Patent Application No. 202510411394.8, filed on April 2, 2025;
[0005] Chinese Patent Application No. 202510411738.5, filed on April 2, 2025;
[0006] Chinese Patent Application No. 202510425223.0, filed on April 7, 2025;
[0007] Chinese Patent Application No. 202510441941.7, filed on April 9, 2025;
[0008] PCT international application No. PCT / CN2025 / 093475, filed on May 8, 2025;
[0009] Chinese Patent Application No. 202510591389.X, filed on May 8, 2025;
[0010] PCT international application No. PCT / CN2025 / 098085, filed on May 29, 2025;
[0011] Chinese Patent Application No. 202510721293.0, filed on May 30, 2025;
[0012] Chinese Patent Application No. 202510747112.1, filed on June 5, 2025;
[0013] Chinese Patent Application No. 202510746833.0, filed on June 5, 2025; and
[0014] Chinese Patent Application No. 202510808383.3, filed on June 17, 2025.
[0015] The entire contents of the aforementioned patent application are incorporated herein by reference and used for all purposes. Technical Field
[0016] This application relates to the field of molecular biology, particularly RNA interference (RNAi) technology, and specifically to modified dsRNA molecules for use in RNAi technology and their applications. Background Technology
[0017] RNA interference (RNAi) refers to the highly conserved phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) during evolution. RNAi is a ubiquitous monitoring mechanism in eukaryotes for defending against viral invasion, inhibiting transposon activity, and regulating gene expression. Small interfering RNA (siRNA) is a class of short double-stranded RNA molecules, 19-30 bp in length, and is one of the important tools in RNAi technology. In nature, after dsRNA enters the cell, it is specifically recognized by the Dicer enzyme and cleaved into small RNA fragments of 21-23 nucleotides in length (i.e., dsRNA). The resulting dsRNA fragments unwind into single strands and form complexes (RISCs) with certain proteins. RISCs can bind to mRNA complementary to dsRNA in the cell and cleave the mRNA, causing it to be degraded, resulting in the inability to synthesize proteins and producing gene "silencing." In industrial production, researchers tend to chemically synthesize dsRNA and modify it to further improve the stability and efficacy of dsRNA drugs. In recent years, breakthroughs have also been made in the research of dsRNA-based drugs.
[0018] Stable siRNAs have been reported to be obtained by replacing native RNA with modified RNA. For example, 2'-O-methyl and 2'-F modifications have been introduced into the sense and antisense strands of siRNA. There are also RNA molecules that combine DNA, 2'-O-methyl, and 2'-F modifications, and can achieve RNAi activity comparable to or higher than that of unmodified siRNA, and maintain relative stability in serum.
[0019] There is still a need in this field for new chemically modified motif technologies that can enable RNA molecules to more effectively and persistently suppress the expression of target genes.
[0020] Invention Overview
[0021] In a first aspect, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomers, solvates, isotope derivatives, or pharmaceutically acceptable salts that inhibit target gene expression via RNAi, wherein the double-stranded RNA molecule comprises a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, and the sense strand and antisense strand of the dsRNA molecule include various structures described in this application. The first aspect also provides engineered nucleic acid molecules associated with the dsRNA molecule, nucleic acid molecules capable of being transcribed into the dsRNA molecule or its precursor in cells, delivery systems, cells, pharmaceutical compositions, and related applications.
[0022] Secondly, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof that inhibits the expression of the lipoprotein A (Lp(a)) gene by RNAi, and the use thereof.
[0023] Thirdly, this application provides double-stranded RNA (dsRNA) molecules or their stereoisomers, solvates, isotopic derivatives or pharmaceutically acceptable salts thereof that inhibit the expression of the preprotein convertase subtilisin-9 (PCSK9) gene via RNAi, and their uses.
[0024] Fourthly, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof that inhibits the expression of the angiopoietin-like protein 3 (ANGPTL3) gene via RNAi, and the use thereof.
[0025] Fifthly, this application provides double-stranded RNA (dsRNA) molecules or their stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts that inhibit the expression of the coagulation factor XI (FXI) gene via RNAi, and their applications.
[0026] Brief description of the attached diagram
[0027] Figure 1 shows the relative expression levels of LP(a) mRNA after treating RT4 cells with multiple LP(a)dsRNA assay molecules.
[0028] Figure 2 shows the relative expression levels of LP(a) mRNA after treating RT4 cells with multiple LP(a)dsRNA assay molecules.
[0029] Figure 3 shows the inhibition curves of LP(a) gene expression and their respective IC50 values after treating Hep3B cells with multiple LP(a) dsRNA assay molecules at multiple concentrations. 50 value.
[0030] Figure 4 shows the percentage change in serum Lp(a) protein levels over time relative to baseline levels before administration of multiple LP(a)dsRNA assay molecules to rhesus monkeys.
[0031] Figure 5 shows the psicheck-2 plasmid map.
[0032] Figure 6 shows the percentage change in Lp(a) protein levels in mouse serum over time relative to baseline levels before administration after administering multiple LP(a)dsRNA assay molecules to LP(a) humanized mice.
[0033] Figure 7 shows the percentage change in serum Lp(a) protein levels over time relative to baseline levels before administration after administering LP(a) dsRNA assay molecules loaded with 5'-vp-modified LP(a) dsRNA to LP(a) humanized mice.
[0034] Figure 8 shows the relative expression levels of PCSK9 mRNA with different modifications after 48 h of treatment in HepG2 cells.
[0035] Figure 9 shows the percentage change in serum PCSK9 protein levels over time relative to baseline levels after administration of PCSK9 dsRNA molecules with different modifications to PCSK9 humanized mice.
[0036] Figure 10 shows the change in the percentage of leakage area relative to baseline over time in each group of rabbits after applying different dual-target dsRNA molecules to rabbits with an RNV disease model.
[0037] Invention Details
[0038] definition
[0039] As used in this article, "LPA" and "Lp(a)" are interchangeable, representing lipoprotein A. Lipoprotein A (Lp(a)) particles are essentially low-density lipoprotein-like particles, composed of apolipoprotein A (APO(a)) linked to LDL-like particles via the ApoB polypeptide. It is synthesized independently of triglycerides in the liver and is not affected by age or diet. High Lp(a) levels can lead to atherosclerosis, and it has been found in the arterial walls. Because its structure is similar to plasminogen, it can also inhibit fibrinolysis, thus forming thrombi; high serum Lp(a) concentrations are associated with premature atherosclerosis and stroke. Serum Lp(a) concentration is mainly related to genetics and is largely unaffected by sex, age, weight, and most cholesterol-lowering drugs. Studies have shown that normal Lp(a) levels should be below 300 mg / L (30 mg / dL), and when Lp(a) concentration exceeds 34 mg / dL, the risk of coronary artery disease approximately doubles. When assessed in conjunction with low-density lipoprotein cholesterol (LDL-C) concentration, the risk increases to approximately six-fold. Ignoring other plasma lipoproteins, Lp(a) assessment values are considered the most sensitive feature for the development of coronary artery disease. Therefore, inhibitors of Lp(a) that reduce blood Lp(a) concentrations hold promise as potential therapeutic targets for the treatment and prevention of cardiovascular and cerebrovascular diseases and their complications. Unless otherwise specified, when describing LPA mRNA or LPA(a) mRNA, it usually refers to APO(a) mRNA; while siRNA or dsRNA targeting LPA or LP(a) refers to siRNA or dsRNA targeting APO(a) mRNA.
[0040] As used in this article, "PCSK9" stands for proprotein convertase subtilisin / kexin-9, a serine protease that indirectly regulates plasma LDL cholesterol levels by controlling the expression of hepatic and extrahepatic LDL receptors (LDLRs) on the plasma membrane. Decreased PCSK9 protein expression increases LDLR receptor expression, thereby reducing plasma LDL cholesterol and leading to hypercholesterolemia and / or atherosclerosis and related complications. Furthermore, studies have found that PCSK9 knockout in mice reduces blood cholesterol levels and exhibits enhanced sensitivity to statins in lowering blood cholesterol. These studies suggest that PCSK9 inhibitors may be beneficial for reducing blood LDL-C concentrations and for treating PCSK9-mediated diseases, thus representing a potential therapeutic target for controlling hypercholesterolemia and its complications.
[0041] As used in this article, "ANGPTL3" stands for angiopoietin-like 3, a member of the angiopoietin-like protein family involved in regulating lipid metabolism. This family also includes ANGPTL4 and ANGPTL8. The protein encoded by the ANGPTL3 gene is produced exclusively in the liver and plays a crucial role in regulating lipid metabolism by interacting with lipoprotein lipase (LPL) and endothelial lipase (EL) to inhibit their catalytic activity and the lipolysis of triglycerides (TG). Human genetic studies have shown that loss-of-function mutations in ANGPTL3 can effectively reduce plasma levels of low-density lipoprotein cholesterol (LDL-C) and triglycerides, thereby reducing the risk of cardiovascular disease. ANGPTL3 has become a therapeutic target for dyslipidemia and cardiovascular disease. Evinacumab, developed by Regeneron, is a fully human monoclonal antibody that targets the IgG4 subtype of angiopoietin-like protein 3 (ANGPTL3). On February 11, 2021, it was approved by the U.S. Food and Drug Administration (FDA) for the treatment of children aged 12 years and older or adults with familial homozygous hypercholesterolemia (HoFH).
[0042] As used in this article, "FXI or F11" refers to coagulation factor FXI or F11, which is an anticoagulant target. Because FXI plays an auxiliary role in hemostasis compared to FX, but plays a necessary role in thrombosis, spontaneous bleeding, central nervous system bleeding, or gastrointestinal bleeding is rarely observed even in patients with severe FXI deficiency.
[0043] When referring to various target genes in this application, the terms may refer to the target gene itself or the nucleic acid molecule encoding the target gene, depending on the context. Taking ANGPTL3 as an example, an RNA molecule targeting ANGPTL3 is an RNA molecule that targets the ANGPTL3-encoding gene, such as dsRNA or hairpin-structured RNAi molecules that target the mRNA or pre-mRNA transcribed from the ANGPTL3-encoding gene.
[0044] In addition to their own base meanings, “G”, “C”, “A”, “T” and “U” can also represent nucleotides with guanine, cytosine, adenine, thymine and uracil as bases, depending on the context of this application.
[0045] As used herein, a "ligand" can form a new conjugate molecule with a nucleic acid molecule. The ligand can be designed to alter the distribution, targeting, half-life, or drug metabolism or kinetic properties of the conjugate molecule it incorporates. The ligand can be a portion taken up by host cells. In some embodiments, ligand-modified RNA molecules exhibit enhanced affinity or cellular uptake of selected targets (such as specific tissue types, cell types, organelles, etc.), such as hepatocytes, compared to unmodified RNA molecules. Ligand modification does not interfere with the activity of the RNA molecule. A ligand that provides enhanced affinity to a selected target is also referred to as a targeting ligand. The targeting ligand has organ-targeting capabilities, such as liver-targeting, lung-targeting, etc., and the ligand can be any ligand with the aforementioned functions disclosed in US20130184328 by Manoha Ran et al., the contents of which are incorporated herein by reference in their entirety. Common examples of ligands include lipids (such as saturated or unsaturated C14-22 hydrocarbons), steroids, vitamins, carbohydrates or sugars (e.g., a dextran, amylopectin, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulins), fatty acids (such as saturated or unsaturated C6-22 fatty acids), peptides, polyamines, and peptide mimics. Ligands may also include targeting groups, such as cell or tissue targets that bind to a specific cell type, such as kidney cells, like lectins, glycoproteins, lipids, or proteins, such as antibodies. The targeting group can be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucinous carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polytrehalose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamate, polyaspartate, lipids, cholesterol, steroids, bile acids, folate, vitamin B12, biotin, RGD peptides, RGD peptide mimics, or aptamers. In some embodiments, the ligand is a desialylate glycoprotein receptor (ASGPR) ligand. In some embodiments, the "ligand" is a GalNac derivative or a GalNac polymer.
[0046] "GalNAc derivative" or "GalNac polymer" refers to an N-acetylgalactosamine derivative or its polymer. As used herein, a GalNAc derivative refers to a galactose derivative with ASGPR-binding ability, and may also refer to a polymer (GalNAc polymer) formed by one, two, three or more galactose derivatives with ASGPR-binding ability. Examples of GalNAc derivatives include, but are not limited to, L96, ligand 1, or a covalent group formed by one, two or more compounds 6 and / or 8.
[0047] L96: A GalNAc conjugate, with the following structure:
[0048] in This means that the RNA molecule is linked to the sense or antisense strand of the RNA molecule via chemical bonds such as phosphodiester bonds or thiophosphodiester bonds.
[0049] Ligand 1: A GalNAc conjugate, with the following structure:
[0050] Where X is O or S (or, when the RNA molecule forms a salt, X is O). - or S - Both of these forms are within the scope of this application. This means that the RNA molecule is linked to the sense or antisense strand of the RNA molecule via chemical bonds such as phosphodiester bonds or thiophosphodiester bonds.
[0051] Instances of GalNAc also include, for example:
[0052] Where X is O or S. Where X is OH or SH (or when the RNA molecule forms a salt, X is O). - or S - Both forms are within the scope of this application. This means that it is linked to an oligonucleotide (i.e., the part of the RNA molecule other than the ligand) via a phosphothioester bond.
[0053] More instances of GalNAc include, for example:
[0054] In this case, when one of X or Y is another part of the RNA molecule, the other is hydrogen; and the following various types: And its ionic form or salt; where 5'Oligo3' indicates that it is linked to the 5' position of the oligonucleotide (Oligo), and 3'Oligo5' indicates that it is linked to the 3' position of the oligonucleotide (Oligo).
[0055] Typically, most nucleotides in each strand of the RNA molecule that inhibits the expression of target genes in this application are ribonucleotides, but as described in detail herein, each strand or both strands may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides.
[0056] As used herein, "dsRNA" refers to double-stranded RNA. Since siRNA is a double-stranded RNA, the term "dsRNA" encompasses siRNA. dsRNA also includes double-stranded RNAs longer than siRNA, where "longer than siRNA" can mean that its sense strand is longer than siRNA, or its antisense strand is longer than siRNA, or both its sense and antisense strands are longer than siRNA. Typically, double-stranded RNAs longer than the siRNA sequence they contain are cleaved into siRNA by a type III endonuclease called Dicer after entering the cell. In some embodiments, the lengths of the two strands of the dsRNA are each independently 15 to 30 nt (in this application, "nt" refers to nucleotides). When "siRNA" is incorporated into the RNA-induced silencing complex (RISC), one or more helicases in the RISC unwind the siRNA double helix. When it binds to a target mRNA complementary to the antisense strand of the siRNA, one or more endonucleases in the RISC cleave the target, inducing gene silencing. Typically, the majority of nucleotides in each strand of a dsRNA molecule are ribonucleotides, but this does not preclude the inclusion of one or more non-ribonucleotides, such as deoxyribonucleotides and / or non-natural nucleotides, in any one or two strands. In some embodiments, the dsRNA molecule does not contain non-natural nucleotides. In some embodiments, each nucleotide in the dsRNA is a ribonucleotide. As used herein, the dsRNA may contain one or more chemically modified nucleotides or may not contain chemically modified nucleotides.
[0057] The term "nucleotide," in addition to referring to naturally occurring ribonucleotide or deoxyribonucleotide monomers, should also be understood herein to refer to their associated structural variants, including derivatives and analogs, which are functionally equivalent in the specific context of the use of the nucleotide, unless the context explicitly indicates otherwise. A nucleotide can be a standard nucleotide (i.e., naturally occurring adenosine, guanosine, cytidine, thymidine, and uridine nucleotides), a nucleotide isomer, or a nucleotide analog. A nucleotide analog refers to a nucleotide having a modified purine or pyrimidine base or a modified ribose moiety. Nucleotide analogs can be naturally occurring nucleotides (e.g., inosine, pseudouridine, etc.) or non-naturally occurring nucleotides. Non-limiting examples of modifications to the sugar or base moiety of a nucleotide include the addition (or removal) of acetyl, amino, carboxyl, carboxymethyl, hydroxyl, methyl, phosphoryl, and thiol groups, as well as the substitution of the carbon and nitrogen atoms of the base by other atoms (e.g., 7-denitropurine). Nucleotide analogs also include dideoxynucleotides, 2'-O-methylnucleotides, locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholino oligonucleotides. In the examples of this application, unless otherwise specified, the target gene sequence portion of the linear DNA molecule is typically composed of natural deoxyribonucleotides. In this application, A, T, C, G, and U refer to nucleotides with adenine, thymine, cytosine, guanine, and uracil bases, respectively, as long as the nucleotide can still perform the physiological function of its corresponding natural nucleotide. This physiological function includes, for example, hybridization with complementary nucleotides, transcription, replication, and translation. For example, the nucleotides in the RNA molecule that inhibits Lp(a) gene expression described in this application, regardless of whether they are modified, still retain the physiological function of their corresponding natural nucleotides, hybridizing with the target mRNA or complementary strand according to the base-complementary pairing principle. The meaning of nucleotide in this application includes cases where its phosphate group is absent or present at the 3' position.
[0058] As used herein, "nucleotide linking" or "nucleoside linking" refers to the chemical bond between two adjacent nucleotides. Unless otherwise specified, the linking group is a phosphate ester bond or a thiophosphate ester bond. However, when a modified motif specifically indicates "s," signifying the position of a thiophosphate ester bond, all other unmarked nucleotide links are phosphate ester bonds, for example:
[0059] (1) Sense strand: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm,
[0060] Antisense strand: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNm;
[0061] Then the linkages between the nucleotides in (1) can be either phosphate ester bonds or thiophosphate ester bonds;
[0062] If it is:
[0063] (2) Meaningful chains:
[0064] NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmsNmsNm,
[0065] antisense chain:
[0066] NmsNfsNmNmNdNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; Due to its specially marked "s", except for the following nucleotide linkages which are phosphate ester bonds, all other nucleotide linkages are phosphate ester bonds: the first and second nucleotide linkages starting from the 5' end of the sense strand, the second and third nucleotide linkages starting from the 5' end of the sense strand, and the third nucleotide linkage starting from the 5' end of the sense strand. The first and second nucleotides from the 3' end of the sense strand are linked together; the second and third nucleotides from the 3' end of the sense strand are linked together; the first and second nucleotides from the 5' end of the antisense strand are linked together; the second and third nucleotides from the 5' end of the antisense strand are linked together; the first and second nucleotides from the 3' end of the antisense strand are linked together; the second and third nucleotides from the 3' end of the antisense strand are linked together.
[0067] In RNA contexts (e.g., mRNA, siRNA, dsRNA, or shRNA), N represents a nucleoside. Nm represents a 2'-O-Me modified nucleoside or a 2'-O-methyl modified nucleoside; Nf represents a 2'-F modified ribonucleoside or a 2'-fluoro modified ribonucleoside; Nd represents a deoxynucleoside. When N in Nd corresponds to A, C, or G, Nd represents a deoxyribonucleoside with the base A, C, or G. When N in Nd corresponds to U or T, Nd represents a deoxythymidine or deoxyuridine. Optionally, when N in Nd corresponds to U or T, Nd can also represent a deoxythymidine. N(hd / hdt / da / dat) represent ribonucleosides modified with 2'-O-C16, 2'-S-C16, 2'-O-C22, or 2'-S-C22, respectively; N(hd) represents ribonucleosides modified with 2'-O-C16; N(hdt) represents ribonucleosides modified with 2'-S-C16; N(da) represents ribonucleosides modified with 2'-O-C22; and N(dat) represents ribonucleosides modified with 2'-S-C22. C16 and C22 are both straight-chain saturated alkyl groups. 's' represents thiophosphate modification, specifically 5'-thiophosphate modification. When this modification occurs between two nucleosides or between a nucleoside and a target moiety (e.g., a lipophilic group), it replaces the phosphate ester bond between the natural nucleosides, and can be called a thiophosphate bond. As used herein, unless otherwise specified, the terms "thiophosphate bond" and "thiophosphate diester bond" are used interchangeably; similarly, the terms "phosphate bond" and "phosphate diester bond" are used interchangeably.
[0068] As used herein, unless otherwise specified, the term "base sequence" refers only to the arrangement of bases in a nucleic acid molecule or nucleic acid chain. "Base" does not limit the type of base to natural or non-natural bases, and it does not limit ribose modification in nucleotides, nor does it limit phosphate group modification. Unless otherwise specified, the term "nucleoside sequence" refers only to the arrangement of nucleosides in a nucleic acid molecule or nucleic acid chain. It may specify that the nucleoside has a certain ribose and / or base modification, but it does not limit phosphate group modification. However, it does not exclude the possibility of other modifications to the base or ribose beyond the specified modifications. Unless otherwise specified, the term "nucleotide sequence" refers to the sequence of nucleotides, which may specify that the nucleotide has base, phosphate, and / or ribose modifications. Similarly, it does not exclude the possibility of other modifications to the base, ribose, and phosphate groups beyond the specified modifications.
[0069] As used herein, a "modification motif" refers to a pattern of nucleotide modification along an oligonucleotide (e.g., dsRNA), consisting of sequential modifications to each nucleotide in a nucleic acid sequence that differ from the native nucleotide. Unmodified nucleotides are represented by a single N, where an N is not adjacent to any lowercase letter or lowercase letter in parentheses on either side. The nucleotides in an oligonucleotide modified using a "modification motif" change accordingly with the nucleotide modification at the corresponding position in the motif. In some embodiments, the 2' hydroxyl groups of the 2nd, 14th, and 16th nucleotides of the antisense strand of the dsRNA in this application are substituted with fluorine, and the 2' hydroxyl groups of the other nucleotides in the antisense strand are substituted with methoxy or hydrogen. In some embodiments, the 2' hydroxyl groups of the 9th and 11th nucleotides of the sense strand of the dsRNA molecule in this application are substituted with fluorine, the 2' hydroxyl group of the 10th nucleotide is substituted with fluorine or hydrogen, and the 2' hydroxyl groups of the other nucleotides are substituted with fluorine, methoxy, or hydrogen. In some embodiments, the 2' hydroxyl groups of the 9th and 11th nucleotides of the sense strand in the dsRNA molecule of this application are substituted with fluorine, the 2' hydroxyl group of the 10th nucleotide is substituted with fluorine or hydrogen, the 2' hydroxyl groups of the 7th and 12th nucleotides are substituted with fluorine or methoxy, and the 2' hydroxyl groups of the other nucleotides are substituted with methoxy or hydrogen. In some embodiments, the 2' hydroxyl groups of the 9th and 11th nucleotides of the sense strand in the dsRNA molecule of this application are substituted with fluorine, the 2' hydroxyl group of the 10th nucleotide is substituted with fluorine or hydrogen, and the 2' hydroxyl groups of the other nucleotides are substituted with fluorine, methoxy, or hydrogen. In some embodiments, the 2' hydroxyl groups of the 9th and 11th nucleotides of the sense strand in the dsRNA molecule of this application are substituted with fluorine, the 2' hydroxyl group of the 10th nucleotide is substituted with fluorine or hydrogen, the 2' hydroxyl groups of the 7th and 12th nucleotides are substituted with fluorine or methoxy, and the 2' hydroxyl groups of the other nucleotides are substituted with methoxy or hydrogen. In some embodiments, the 2' hydroxyl groups of the sense strand at positions 9 and 11, starting from the 5' end, of the dsRNA molecule of this application are substituted with fluorine, the 2' hydroxyl group at position 10 is substituted with fluorine or hydrogen, the 2' hydroxyl groups at positions 7 and 12 are substituted with fluorine or methoxy, and the 2' hydroxyl groups of the other nucleotides are substituted with methoxy.
[0070] As used herein, a "5'-phosphate mimic" generally refers to a phosphate mimic linked to the 5' end nucleotide of a nucleic acid sequence. This mimic can be a phosphate ester, phosphonate ester, or other similar substance, linked to the 4' or 5' position of the 5' end nucleotide of the nucleic acid sequence. For example, it can be linked to the 4' or 5' position of the 5' end nucleotide of the nucleic acid sequence via a carbon-containing or carbon-free linker. It can maintain or increase the phosphorylation of the 5' end nucleotide of the nucleic acid sequence, reducing or preventing its degradation from the 5'-3' position by phosphatases and exonucleases. Non-limiting examples of the "5'-phosphate mimic" include, for example, vinylphosphonates, which are also referred to herein as "VP," "E-VP," or "5'-vp."
[0071] As used in this article, "VP modification" or "E-VP" is a modification that links a vinylphosphonate to the 5' position of a nucleotide, and the resulting structure after linkage with the nucleotide is shown below:
[0072] in:
[0073] Bx1 is a natural or modified base; T2 is a phosphate ester or thiophosphate nucleotide linker that connects the above compound to the oligonucleotide chain; and G is a substituent at the 2' position of the corresponding nucleotide, including but not limited to F, hydroxyl, H, methoxy, methoxyethoxy, etc.
[0074] In this application, "3' end / terminus," "3' side," "5' end / terminus," and "5' side" have their conventional meanings in the art. However, when referring to them, "3' end / terminus" and "5' end / terminus" are more often used to indicate specific nucleotide positions. For example, "3' end / terminus" is often used to refer to the position of the first nucleotide or base pair at the 3' end of a single nucleotide sequence or double-stranded polynucleotide; while "5' end" is often used to refer to the position of the first nucleotide or base pair at the 5' end of a single nucleotide sequence or double-stranded polynucleotide. "3' side" and "5' side" are used to describe the relative positions of nucleotides.
[0075] As used in this application, the term "nucleic acid molecule" may be used to refer to any molecule having a nucleotide sequence consisting of two or more nucleotides linked by phosphodiester bonds, or modified phosphodiester bonds (e.g., thiophosphate bonds).
[0076] As used herein, the terms "overhang," "dangling end," and "dangling sequence" are used interchangeably and refer to one or more unpaired nucleotides extending beyond the double-stranded region at the end of a strand. A nucleotide overhang is typically formed when the 3' end of one strand extends beyond the 5' end of another strand, or when the 5' end of one strand extends beyond the 3' end of another strand. The length of a nucleotide overhang is typically between 1 and 6 nucleotides, 1 and 5 nucleotides, 1 and 4 nucleotides, 1 and 3 nucleotides, 2 and 6 nucleotides, 2 and 5 nucleotides, or 2 and 4 nucleotides. In some embodiments, the nucleotide overhang comprises 1, 2, 3, 4, 5, or 6 nucleotides. In one specific embodiment, the nucleotide overhang comprises 1 to 4 nucleotides. In some embodiments, the nucleotide overhang comprises 2 nucleotides. In some other embodiments, the nucleotide overhang comprises a single nucleotide.
[0077] The nucleotide at the overhang can be a ribonucleotide as described herein or a modified nucleotide. In some embodiments, the nucleotide at the overhang is a 2′-modified nucleotide (e.g., a 2′-fluorinated nucleotide, a 2′-O-methylated nucleotide), a reverse nucleotide (e.g., a reverse abase nucleotide, a reverse deoxyribonucleotide), or a combination thereof. For example, in some embodiments, the nucleotide at the overhang is a deoxyribonucleotide, such as deoxythymidine. In other embodiments, the nucleotide at the overhang is a 2′-O-methylated nucleotide, a 2′-fluorinated nucleotide, a 2′-methoxyethylated nucleotide, or a combination thereof. In other embodiments, the overhang comprises 5′-uridine-uridine-3′ (5′-UU-3′) dinucleotide. In such embodiments, the UU dinucleotide may comprise a ribonucleotide or a modified nucleotide, such as a 2′-modified nucleotide. In other embodiments, the overhang comprises 5′-deoxythymidine-deoxythymidine-3′ (5′-TdTd-3′) dinucleotide. When a nucleotide overhang is present in the antisense strand, the nucleotide in the overhang can be complementary to the target gene sequence, forming a mismatch with the target gene sequence or containing some other sequences (such as polypyrimidine or polypurine sequences, such as UU, TT, AA, GG, etc.).
[0078] Nucleotide overhangs can be located at the 5' or 3' end of one or both strands. For example, in some embodiments, the RNA molecule includes nucleotide overhangs at the 5' and 3' ends of the antisense strand. In other embodiments, the RNA molecule includes nucleotide overhangs at the 5' and 3' ends of the sense strand. In some embodiments, the RNA molecule includes nucleotide overhangs at the 5' end of both the sense and antisense strands. In other embodiments, the RNA molecule includes nucleotide overhangs at the 3' end of both the sense and antisense strands.
[0079] RNA molecules may have nucleotide overhangs at one end of a double-stranded RNA molecule and blunt ends at the other end. A "blunt end" means that the sense and antisense strands are completely base-paired at the ends of the molecule, and there are no unpaired nucleotides extending beyond the double-stranded region. In some embodiments, the RNA molecule has a nucleotide overhang at the 3' end of the sense strand and blunt ends at the 5' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the RNA molecule has a nucleotide overhang at the 3' end of the antisense strand and blunt ends at the 5' end of the antisense strand and the 3' end of the sense strand. In some embodiments, the RNA molecule has blunt ends at both ends of the double-stranded RNA molecule. In these embodiments, the sense and antisense strands have the same length, and the length of the double-stranded region is the same as that of the sense and antisense strands (i.e., the molecule is double-stranded along its entire length).
[0080] Furthermore, unless otherwise specified, all abbreviations or symbols appearing in this application as shown in the table below shall be interpreted as follows:
[0081] Table 1
[0082] In this application, when describing the location of nucleotide modifications or the modifications in the modification motif corresponding to the nucleotide base sequence, unless otherwise specified, nucleotides or their analogues (e.g., non-base nucleotides) located in the target ligand are not counted when calculating the dsRNA chain length.
[0083] It should be understood that a nucleoside or nucleotide with "2'-OMe modification" indicates that the 2' position of the nucleoside or nucleotide is directly linked to a methoxy group; that is, when the nucleoside or nucleotide is a ribonucleoside or ribonucleotide, its 2' hydroxyl group is replaced by a methoxy group; when the nucleoside or nucleotide is a deoxyribonucleoside or deoxyribonucleotide, its 2' hydrogen is replaced by a methoxy group. Similarly, a nucleoside or nucleotide with "2'-F modification" indicates that the 2' position of the nucleoside or nucleotide is directly linked to a fluorine group. Furthermore, a nucleoside or nucleotide with "lipophilic moiety modification" indicates that the nucleoside or nucleotide is linked to a lipophilic moiety. In some embodiments, the lipophilic moiety is located in the middle of the nucleic acid chain and is linked to the 2' position of the nucleotide. In some embodiments, the lipophilic moiety is located at the end of the nucleic acid chain, for example, linked to the 3' position of the 3' terminal nucleotide of the nucleic acid chain.
[0084] As used herein, the term "pharmaceutical composition" means a combination of at least one drug, optionally a pharmaceutically acceptable carrier or excipient, used together to achieve a particular purpose. Pharmaceutically acceptable carriers may include, for example, water, saline, glucose, buffer solutions (such as PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives, or combinations thereof.
[0085] In this application, the term "effective amount" means an amount that has a therapeutic effect on a subject, such as: in subjects who have been given the effective amount, the symptoms or state of the disease are alleviated, reduced, or eliminated, or the development of the symptoms or state of the disease is delayed or suppressed, compared to subjects who have not been given the effective amount.
[0086] As used herein, any term “treat,” “treating,” or “treatment” relating to a disease, disorder, or condition means to reduce or improve a disease, disorder, or condition (i.e., to slow or stop the development or progression of a disease, disorder, or condition or at least one of its clinical symptoms); or to reduce or improve at least one physical parameter or biomarker associated with a disease, disorder, or condition, including those physical parameters or biomarkers that the patient may not be able to identify.
[0087] As used herein, any term “prevent,” “preventing,” or “prevention” relating to a disease, disorder, or condition means preventive treatment of the disease, disorder, or condition; or delaying the onset or progression of the disease, disorder, or condition.
[0088] As used herein, a subject, patient, or individual is considered "needed" for treatment if the subject would benefit biologically, medically, or in terms of quality of life from the treatment. In this text, the terms "subject," "patient," and "individual" are used interchangeably in certain contexts and have the same meaning.
[0089] The term “object” or “individual” as used in this article refers to mammals, such as humans, but can also refer to other animals, such as wild animals, livestock, or laboratory animals (e.g., chimpanzees, monkeys, rats, mice, rabbits, guinea pigs, marmots, ground squirrels, etc.).
[0090] This application provides RNA molecules with novel modified motifs that are beneficial for inhibiting target gene expression. The novel modified motifs can produce advantages such as improved efficacy and / or duration of gene silencing activity in vivo. The modified motifs described herein can be universally applied to a variety of RNA molecules with different sequences and targets. RNA molecules can be used to effectively inhibit the expression of target genes in vivo, for example, to achieve therapeutic purposes. This application also provides several specific dsRNA molecules targeting different genes incorporating the novel modified motifs of this application.
[0091] In a first aspect, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt for inhibiting the expression of a target gene via RNAi, wherein the double-stranded RNA molecule comprises a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, wherein the base sequence of the antisense strand comprises a sequence that is completely complementary to a portion of the mRNA sequence of the target gene or comprises a sequence that differs from complete complementarity by 1, 2 or 3 bases from a portion of the mRNA sequence of the target gene, and the length of the double-stranded region is 15-25 nt, wherein the dsRNA molecule comprises a sense strand and an antisense strand as described in any one of (1) to (4) below:
[0092] (1) The sense strand contains 19 consecutive nucleotides with the following structure:
[0093] NmNmNmNmNmNmNXNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0094] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0095] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0096] (2) The sense strand contains at least 19 consecutive nucleotides having the following structure:
[0097] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0098] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0099] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0100] (3) The sense strand contains 19 consecutive nucleotides with the following structure:
[0101] NmNmNmNmNmN*NXNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0102] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0103] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0104] (4) The sense strand contains 19 consecutive nucleotides with the following structure:
[0105] NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0106] The antisense strand contains 21 consecutive nucleotides having the following structure:
[0107] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0108] Wherein, the sense or antisense strand structure defined in any of (1)-(4) above is oriented from 5' to 3' from left to right, NX is an unmodified ribonucleotide, an unmodified deoxyribonucleotide, a 2'-O-methoxy-ethyl (2'-MOE) modified ribonucleotide, a 2'-O-methyl modified ribonucleotide, or a 2'-fluoro modified ribonucleotide, N* is a ribonucleotide with a lipophilic moiety linked at the 2' position, and Nm represents a 2'-O-methyl... The modified ribonucleotide, Nf represents a ribonucleotide modified by 2'-fluorination, and Nd represents a ribonucleotide modified by deoxygenation (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G or C, Nd represents a deoxyribonucleotide with the base part of A, G or C (i.e. Ad, Gd or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
[0109] In some embodiments, for any one of (1)-(4), the 3' nucleotide of the 19 consecutive nucleotides of the structure contained in the sense strand is the 3' nucleotide of the sense strand, and the 5' nucleotide of the 21 consecutive nucleotides of the structure contained in the antisense strand is the 5' nucleotide of the antisense strand.
[0110] In some embodiments, NX is a 2'-O-methyl modified ribonucleotide or a 2'-fluoro modified ribonucleotide.
[0111] In some implementations, N* is a ribonucleotide modified with 2'-O-C16, 2'-S-C16, 2'-O-C22, or 2'-S-C22.
[0112] In some embodiments, the dsRNA molecule comprises a sense strand and an antisense strand as described in any one of (5) to (22) below:
[0113] (5) The sense strand contains 21 consecutive nucleotides with the following structure:
[0114] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0115] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0116] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0117] (6) The sense strand contains 21 consecutive nucleotides with the following structure:
[0118] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0119] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0120] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0121] (7) The sense strand contains 21 consecutive nucleotides with the following structure:
[0122] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0123] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0124] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0125] (8) The sense strand contains 21 consecutive nucleotides with the following structure:
[0126] NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0127] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0128] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0129] (9) The sense strand contains 21 consecutive nucleotides with the following structure:
[0130] NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0131] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0132] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0133] (10) The sense strand contains 21 consecutive nucleotides having the following structure:
[0134] NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0135] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0136] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0137] (11) The sense strand contains 19 consecutive nucleotides with the following structure:
[0138] NmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0139] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0140] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0141] (12) The sense strand contains 19 consecutive nucleotides with the following structure:
[0142] NmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0143] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0144] NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0145] (13) The sense strand contains 19 consecutive nucleotides having the following structure:
[0146] NmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0147] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0148] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNm;
[0149] (14) The sense strand contains 19 consecutive nucleotides with the following structure:
[0150] NmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0151] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0152] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0153] (15) The sense strand contains 19 consecutive nucleotides having the following structure:
[0154] NmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0155] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0156] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0157] (16) The sense strand contains 19 consecutive nucleotides having the following structure:
[0158] NmNmNmN*NfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0159] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0160] NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0161] (17) The sense strand contains 21 consecutive nucleotides having the following structure:
[0162] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0163] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0164] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0165] (18) The sense strand contains 21 consecutive nucleotides having the following structure:
[0166] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0167] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0168] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0169] (19) The sense strand contains 21 consecutive nucleotides having the following structure:
[0170] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNmNm, and
[0171] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0172] NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0173] (20) The sense strand contains 21 consecutive nucleotides having the following structure:
[0174] NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0175] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0176] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0177] (21) The sense strand contains 21 consecutive nucleotides having the following structure:
[0178] NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0179] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0180] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0181] (22) The sense strand contains 21 consecutive nucleotides with the following structure:
[0182] NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0183] The antisense strand contains 21 consecutive nucleotides with the following structure:
[0184] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm.
[0185] In some embodiments, for any one of (5)-(22), the 3' end nucleotide of the 19 consecutive nucleotides of the structure contained in the sense strand is the 3' end nucleotide of the sense strand, and the 5' end nucleotide of the 21 consecutive nucleotides of the structure contained in the antisense strand is the 5' end nucleotide of the antisense strand.
[0186] In some embodiments, the sense strand of the dsRNA molecule is 19-21 nt long and the antisense strand is 21-23 nt long. In some embodiments, the sense strand of the dsRNA molecule is 21 nt long and the antisense strand is 23 nt long. In some embodiments, the sense strand of the dsRNA molecule is 19 nt long and the antisense strand is 21 nt long. In some embodiments, the sense strand of the dsRNA molecule is 21 nt long and the antisense strand is 21 nt long. In some embodiments, the sense strand of the dsRNA molecule is 23 nt long and the antisense strand is 23 nt long.
[0187] In some embodiments, the dsRNA molecule comprises a sense strand and an antisense strand as described in any one of (23) to (40) below:
[0188] (23) The sense chain is 21nt long and has the following structure:
[0189] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0190] The antisense chain is 23nt long and has the following structure:
[0191] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0192] (24) The sense chain is 21nt long and has the following structure:
[0193] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0194] The antisense chain is 23nt long and has the following structure:
[0195] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0196] (25) The sense chain is 21nt long and has the following structure:
[0197] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0198] The antisense chain is 23nt long and has the following structure:
[0199] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0200] (26) The sense chain is 21nt long and has the following structure:
[0201] NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0202] The antisense chain is 23nt long and has the following structure:
[0203] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0204] (27) The sense chain is 21nt long and has the following structure:
[0205] NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0206] The antisense chain is 23nt long and has the following structure:
[0207] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0208] (28) A sense chain of 21nt length has the following structure:
[0209] NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0210] The antisense chain is 23nt long and has the following structure:
[0211] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0212] (29) The sense chain is 19nt long and has the following structure:
[0213] NmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0214] The antisense chain is 21 nt long and has the following structure:
[0215] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0216] (30) The sense chain is 19nt long and has the following structure:
[0217] NmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0218] The antisense chain is 21 nt long and has the following structure:
[0219] NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0220] (31) The sense chain is 19nt long and has the following structure:
[0221] NmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0222] The antisense chain is 21 nt long and has the following structure:
[0223] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNm;
[0224] (32) The sense chain is 19nt long and has the following structure:
[0225] NmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0226] The antisense chain is 21 nt long and has the following structure:
[0227] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0228] (33) The sense chain is 19nt long and has the following structure:
[0229] NmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0230] The antisense chain is 21 nt long and has the following structure:
[0231] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0232] (34) The sense chain is 19nt long and has the following structure:
[0233] NmNmNmN*NfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0234] The antisense chain is 21 nt long and has the following structure:
[0235] NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0236] (35) The sense chain is 21nt long and has the following structure:
[0237] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0238] The antisense chain is 21 nt long and has the following structure:
[0239] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0240] (36) The sense chain is 21nt long and has the following structure:
[0241] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0242] The antisense chain is 21 nt long and has the following structure:
[0243] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0244] (37) The sense chain is 21nt long and has the following structure:
[0245] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNmNm, and
[0246] The antisense chain is 21 nt long and has the following structure:
[0247] NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0248] (38) The sense chain is 21nt long and has the following structure:
[0249] NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0250] The antisense chain is 21 nt long and has the following structure:
[0251] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0252] (39) The sense chain is 21nt long and has the following structure:
[0253] NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0254] The antisense chain is 21 nt long and has the following structure:
[0255] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm;
[0256] (40) The sense chain is 21nt long and has the following structure:
[0257] NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0258] The antisense chain is 21 nt long and has the following structure:
[0259] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm.
[0260] Target genes include, but are not limited to: ApoB, ApoC, ANGPTL3, PCSK9, SCD1, FVII, p53, HAV, HBV, HCV, HDV, HEV, AGT, Lp(a), XDH, HSD17B13, PNPLA3, HMGCR, FXI, C5, MAPT, SNCA, CFB, MASP-2, C3, CTNNB, LRRK2, APP, FXII, SERPINC1, INHBE, CIDEB, AHP, etc. Target genes may also include viral genes, such as hepatitis B and hepatitis C virus genes, human immunodeficiency virus genes, herpesvirus genes, etc. In some implementations, the target gene is a gene encoding human microRNA (miRNA).
[0261] In some embodiments, the sense strand length of the dsRNA molecule is 19-25 nt (e.g., 19, 20, 21, 22, 23, 24, or 25 nt), and / or the antisense strand length is 21-27 nt (e.g., 21, 22, 23, 24, 25, 26, or 27 nt). In some embodiments, the sense strand length of the dsRNA molecule is 19-23 nt. In some embodiments, the sense strand length of the dsRNA molecule is 21-23 nt. In some embodiments, the antisense strand length of the dsRNA molecule is 21-25 nt. In some embodiments, the antisense strand length of the dsRNA molecule is 23-27 nt. In some embodiments, the sense strand length of the dsRNA molecule is 19-23 nt, and the antisense strand length is 21-25 nt. In some embodiments, the sense strand length of the dsRNA molecule is 21-25 nt, and the antisense strand length is 23-27 nt. In some embodiments, the sense strand of the dsRNA molecule is 21 nt long, and the antisense strand is 23 nt long. In some embodiments, the double-stranded region of the dsRNA molecule is 19-23 nt long. In some embodiments, the double-stranded region of the dsRNA molecule is 21-23 nt long. In some embodiments, the double-stranded region of the dsRNA molecule is 21 nt long. In some embodiments, the double-stranded region of the dsRNA molecule is 23 nt long. In some embodiments, the sense strand of the dsRNA molecule is 21 nt long, the antisense strand is 23 nt long, and the double-stranded region is 19 nt, 20 nt, or 21 nt long. In some embodiments, the sense strand of the dsRNA molecule is 21 nt long, the antisense strand is 23 nt long, and the double-stranded region is 21 nt long.
[0262] In some embodiments, the dsRNA molecule has blunt ends at both the 3' and 5' ends of the antisense strand. In some embodiments, the dsRNA molecule may have nucleotide overhangs (i.e., overhangs) at one or both of the 3' ends of the sense and antisense strands. In some embodiments, the dsRNA molecule has a nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand. In any embodiment in which one or both strands contain an overhang, the overhang consists of 1-5 (1, 2, 3, 4, or 5) nucleotides. In any embodiment in which one or both strands contain an overhang, the overhang consists of 1, 2, or 3 nucleotides. In any embodiment in which one or both strands contain an overhang, the overhang consists of 2 nucleotides.
[0263] In some embodiments, one or more pairs of adjacent nucleotides in the sense and antisense strands of the dsRNA molecule are linked by phosphate thioester bonds. In some embodiments, the antisense strand contains two consecutive phosphate thioester bonds between nucleotides in the 5' region. In some embodiments, the antisense strand contains two consecutive phosphate thioester bonds between nucleotides in the 3' region. In some embodiments, the antisense strand contains two consecutive phosphate thioester bonds between nucleotides in both the 3' and 5' regions. In some embodiments, the sense strand contains two consecutive phosphate thioester bonds between nucleotides in the 5' region. In some embodiments, the sense strand contains two consecutive phosphate thioester bonds between nucleotides in the 3' region. In some embodiments, the antisense strand contains two consecutive phosphate thioester bonds between nucleotides in both the 3' and 5' regions, and the sense strand contains two consecutive phosphate thioester bonds between nucleotides in the 5' region. In some embodiments, the antisense strand contains two consecutive phosphate-thioester bonds between nucleotides in both the 3' and 5' regions, and the sense strand contains two consecutive phosphate-thioester bonds between nucleotides in both the 3' and 5' regions. In some embodiments, the antisense strand contains two consecutive phosphate-thioester bonds between nucleotides in both the 3' and 5' regions, and the sense strand contains two consecutive phosphate-thioester bonds between nucleotides in the 5' region, and the sense strand contains one phosphate-thioester bond between the nucleotide in the 3' region and the ligand. In any embodiment where one or both strands contain one or more phosphate-thioester bonds, the bonds between the nucleotides within the strand can be native 3' to 5' phosphodiester bonds.
[0264] In some embodiments, the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester. In some embodiments, the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester. In some embodiments, the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester. In some embodiments, the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester. In some embodiments, the first and second nucleotides of the antisense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester. In some embodiments, the second and third nucleotides of the antisense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester. In some embodiments, the first and second nucleotides of the antisense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester. In some embodiments, the second and third nucleotides, starting from the 3' end of the antisense strand of the dsRNA molecule, are linked by a phosphate thioester.
[0265] In some embodiments, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester, starting from the 3' end.
[0266] In some embodiments, the dsRNA molecule comprises a sense strand and an antisense strand as described in any one of (41) to (52) below:
[0267] (41) The sense strand contains 21 consecutive nucleotides having the following structure:
[0268] NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmsNmsNm, and
[0269] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0270] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm
[0271] (42) The sense strand contains 21 consecutive nucleotides with the following structure:
[0272] NmsNmsNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmsNmsNm, and
[0273] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0274] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0275] (43) The sense strand contains 21 consecutive nucleotides having the following structure:
[0276] NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmsNmsNm, and
[0277] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0278] NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0279] (44) The sense strand contains 21 consecutive nucleotides with the following structure:
[0280] NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0281] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0282] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm
[0283] (45) The sense strand contains 21 consecutive nucleotides having the following structure:
[0284] NmsNmsNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0285] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0286] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0287] (46) The sense strand contains 21 consecutive nucleotides having the following structure:
[0288] NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNmNm, and
[0289] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0290] NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0291] (47) The sense strand contains 21 consecutive nucleotides having the following structure:
[0292] NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNms, and
[0293] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0294] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm
[0295] (48) The sense strand contains 21 consecutive nucleotides having the following structure:
[0296] NmsNmsNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNms, and
[0297] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0298] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0299] (49) The sense strand contains 21 consecutive nucleotides with the following structure:
[0300] NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNms, and
[0301] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0302] NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0303] (50) The sense strand contains 21 consecutive nucleotides having the following structure:
[0304] NmsNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmsNms, and
[0305] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0306] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm
[0307] (51) The sense strand contains 21 consecutive nucleotides having the following structure:
[0308] NmsNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmsNms, and
[0309] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0310] NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0311] (52) The sense strand contains 21 consecutive nucleotides with the following structure:
[0312] NmsNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmsNms, and
[0313] The antisense strand contains 23 consecutive nucleotides with the following structure:
[0314] NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0315] Wherein, in any of the above (41)-(52) defined sense or antisense strand structures, s indicates that the adjacent nucleotides before and after s are linked by thiophosphate.
[0316] In some embodiments, the 5' terminal nucleotide of the sense strand and / or antisense strand of the dsRNA molecule is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP). In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to the 5'-phosphate mimic. In some embodiments, the 5' end of the antisense strand contains a 5'-vinylphosphonate (5'-vp) modification. 5'-vp can be a 5'-E-VP isomer (i.e., trans-vinylphosphonate), a 5'-Z-VP isomer (i.e., cis-vinylphosphonate), or a mixture thereof. In some embodiments, the 5' end of the antisense strand contains a 5'-E-VP modification.
[0317] In some embodiments, one or more nucleotides in the sense and / or antisense strands of the dsRNA molecule are linked to one or more ligands. In some embodiments, the one or more ligands are designed to perform one or more of the following functions: improve the efficiency of cellular uptake of the dsRNA molecule by cells carrying the target gene, enhance tissue / cell type / organelle targeting, increase half-life, or improve metabolic or kinetic properties. The ligand may be a portion taken up by the host cell. Ligand modification can improve the cellular uptake, intracellular targeting, half-life, or drug metabolism or kinetic properties of the RNA molecule. In some embodiments, compared to unmodified RNA molecules, ligand-modified RNA molecules have enhanced affinity or cellular uptake for selected targets (such as specific tissue types, cell types, organelles, etc.), such as hepatocytes. Ligand modification does not interfere with the activity of the RNA molecule.
[0318] In some embodiments, the 3' terminal nucleotide of the sense strand is linked to the ligand, or the 5' terminal nucleotide of the sense strand is linked to the ligand, or both the 5' and 3' terminal nucleotides of the sense strand are linked to (the same or different) ligands. In some embodiments, the 5' terminal nucleotide and / or the 3' terminal nucleotide of the sense strand are linked to the ligand via a phosphate thioester bond. In some embodiments, the ligand is linked to the middle of the sequence of the sense strand and / or antisense strand.
[0319] In some embodiments, the ligand is selected from the following: cholesterol, C14-22 saturated or unsaturated hydrocarbon groups, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine derivatives or analogs. In some embodiments, the ligand targets cell surface receptors, including galactose, galactosamine, lactose, or N-acetylgalactosamine / glucosamine moieties. In some embodiments, the ligand preferably targets the liver, particularly hepatic parenchymal cells. In some preferred embodiments, the ligand may also be human serum albumin (HSA), hyaluronic acid, peptides, etc. In some preferred embodiments, the ligand targets the ASGPR receptor.
[0320] In some embodiments, the ligand is linked to the 5' or 3' end nucleotide of the sense or antisense strand of the dsRNA molecule via a phosphodiester bond or a phosphothiodiester bond. In some embodiments, the ASGPR ligand is a GalNAc polymer formed from one, two, three, or more GalNAc derivatives (referred to as a monovalent GalNAc conjugate, a divalent GalNAc conjugate, a trivalent GalNAc conjugate, or a polyvalent GalNAc conjugate, respectively).
[0321] In some implementations, the dsRNA molecule further includes at least one desialyl glycoprotein receptor (ASGPR) ligand.
[0322] In some embodiments, the ligand is linked to the 5' or 3' end nucleotide of the sense or antisense nucleotide sequence via a phosphodiester bond or a thiophosphate diester bond.
[0323] In some embodiments, the ASGPR ligand is a GalNAc polymer formed from two or three GalNAc derivatives.
[0324] In some embodiments, the 3' end of the sense chain is attached to an ASGPR ligand, the ASGPR ligand having a structure of L96 as shown in Formula I or ligand 1 as shown in Formula II.
[0325] Where X is OH or SH (or when the RNA molecule forms a salt, X is O). - or S - Both forms are within the scope of this application; among which This means that it is linked to the rest of the RNA molecule via a phosphodiester bond or a thiophosphate diester bond.
[0326] In some implementations, the GalNAc ligand is selected from one of the following structures:
[0327] In this case, when one of X or Y is an oligonucleotide, the other is hydrogen.
[0328] In some implementations, the GalNAc ligand is selected from one of the following structures:
[0329] Where X is OH or SH (or when the RNA molecule forms a salt, X is O). - or S - Both of these forms are within the scope of this application (hereinafter the same). This means that it is linked to the part of the RNA molecule other than the ligand via a phosphodiester bond or a thiophosphate diester bond.
[0330] In some embodiments, the dsRNA molecule has the following structure:
[0331] Sense strand: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNm, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmsNmsNm.
[0332] In some embodiments, the dsRNA molecule has the following structure:
[0333] Sense strand: NmsNmsNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNm, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmsNmsNm.
[0334] In some embodiments, the dsRNA molecule has the following structure:
[0335] Sense strand: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmsNmsNm, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmsNmsNm.
[0336] In some embodiments, the dsRNA molecule has the following structure:
[0337] Sense strand: NmsNmsNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmsNmsNm, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0338] In some embodiments, the dsRNA molecule has the following structure:
[0339] Sense strand: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNm-ligand, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0340] In some embodiments, the dsRNA molecule has the following structure:
[0341] Sense strand: NmsNmsNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNm-ligand, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0342] In some embodiments, the dsRNA molecule has the following structure:
[0343] Sense strand: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNm-L96, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0344] In some embodiments, the dsRNA molecule has the following structure:
[0345] Sense strand: NmsNmsNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNm-L96, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0346] In some embodiments, the dsRNA molecule has the following structure:
[0347] Sense strand: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNm-ligand 1, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0348] In some embodiments, the dsRNA molecule has the following structure:
[0349] Sense strand: NmsNmsNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNm-ligand 1, antisense strand: vp-NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0350] In some embodiments, the dsRNA molecule has the following structure:
[0351] Sense strand: NmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm, antisense strand: vp-NmsNfsNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmsNmsNm.
[0352] In some embodiments, the dsRNA molecule has the following structure:
[0353] Sense strand: NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNm-ligand, antisense strand: vp-NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNfNmNmNmNmNmsNmsNm.
[0354] In some embodiments, the dsRNA molecule has the following structure:
[0355] Sense strand: NmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm-L96, antisense strand: vp-NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0356] In some embodiments, the dsRNA molecule has the following structure:
[0357] Sense strand: NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNm-ligand 1, antisense strand: vp-NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm.
[0358] In a first aspect, an engineered nucleic acid molecule is also provided, comprising one or more of the aforementioned dsRNA molecules and one or more additional nucleotides or chemical groups. In some embodiments, the engineered nucleic acid molecule has a hairpin structure, wherein the 3' end of the sense strand of the dsRNA molecule is linked to the 5' end of the antisense strand by a chemical bond or a linker, the linker being composed of the one or more additional nucleotides or the linker being the chemical group. In some embodiments, the engineered nucleic acid molecule comprises two or more of the aforementioned dsRNA molecules linked by one or more nucleotides and / or chemical groups. In some embodiments, the two or more dsRNA molecules are respectively designed to inhibit the expression of different target genes or to target different mRNA regions of the same target gene via RNAi.
[0359] In some embodiments, the sense and antisense strands of the dsRNA molecules included in the engineered nucleic acid molecule are linked together by linkers or chemical bonds to form a hairpin structure. In some embodiments, the engineered nucleic acid molecule is composed of two or more of the aforementioned dsRNA molecules tandemly linked by cleavable linkers, and the two or more dsRNA molecules can be the same dsRNA molecules or different dsRNA molecules. In some embodiments, the engineered nucleic acid molecule may include two or more nucleic acid molecules among the dsRNA molecules whose sense and / or antisense strands are linked together by linkers or chemical bonds. In some embodiments, the engineered nucleic acid molecule is a dual-targeting or multi-targeting siRNA, i.e., the engineered nucleic acid molecule contains different dsRNA molecules that target different target gene expressions or different mRNA regions of the same target gene. In some embodiments, the dual-targeting or multi-targeting siRNA is composed of multiple dsRNA molecules tandemly linked together (e.g., by cleavable linkers), wherein the antisense and / or sense strands of each dsRNA molecule are linked to the antisense and / or sense strands of its adjacent nucleotide molecules. In some embodiments, the dual-targeting or multi-targeting siRNA is composed of multiple dsRNA molecules tandemly linked, wherein the sense strand of each dsRNA molecule is linked to the sense strand of its adjacent nucleotide molecule. In some embodiments, the dual-targeting or multi-targeting siRNA is composed of multiple dsRNA molecules tandemly linked, wherein the antisense strand of each dsRNA molecule is linked to the antisense strand of its adjacent nucleotide molecule. In some embodiments, the dual-targeting or multi-targeting siRNA is composed of multiple dsRNA molecules tandemly linked, wherein the antisense strand of each dsRNA molecule is linked to the sense strand of its adjacent nucleotide molecule. In some embodiments, the linker is composed of one or more nucleotides and / or chemical groups other than nucleotides. In some embodiments, the linker comprises one or more nucleotides. In some embodiments, the linker is composed of one or more nucleotides. In some embodiments, the linker comprises or is further linked to one or more of the aforementioned targeting ligands.
[0360] The hairpin-structured RNAi molecule of this application can consist of a linker nucleic acid strand connecting the sense and antisense strands of the aforementioned dsRNA molecule. In some embodiments, the linker nucleic acid strand connects the 5' terminal nucleotide of the sense strand and the 3' terminal nucleotide of the antisense strand. In some embodiments, the linker nucleic acid strand connects the 3' terminal nucleotide of the sense strand and the 5' terminal nucleotide of the antisense strand. In some embodiments, the linker nucleic acid strand consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the linker nucleic acid strand in the hairpin-structured RNAi molecule itself does not contain a double-stranded region.
[0361] In the first aspect, a nucleic acid molecule (also referred to herein as a "second nucleic acid molecule") capable of being transcribed into the aforementioned dsRNA molecule or its precursor in a cell is also provided. In some embodiments, the second nucleic acid molecule is a circular or linear nucleic acid molecule. In some embodiments, the second nucleic acid molecule is a circular or linear plasmid. In some embodiments, the nucleic acid molecule belongs to an artificially constructed viral genome, selected from, but not limited to, lentiviral vectors or other retroviral vectors, adenovirus vectors, AAV vectors, poxvirus vectors, baculovirus vectors, and herpes simplex virus vectors. In some embodiments, the nucleic acid molecule belongs to a cellular genome, such as a nuclear genome, mitochondrial nucleic acid, or cytoplasmic free nucleic acid. In some embodiments, the second nucleic acid molecule is an RNA molecule, a DNA molecule, or a chimeric molecule of RNA and DNA.
[0362] In the first aspect, a delivery medium is also provided, comprising the aforementioned dsRNA molecule or second nucleic acid molecule. In some embodiments, the delivery medium is a virus, plasmid, or liposome. In some embodiments, the delivery medium is a liposome, lipid nanoparticles or other polymers, endosomes, exosomes, or vesicles. In some embodiments, the delivery medium is a virus comprising the aforementioned dsRNA molecule or second nucleic acid molecule. In some embodiments, the viral particle is an enveloped virus or a capsular virus particle. In some embodiments, the viral particle is a pseudovirus particle. In some embodiments, the viral particle belongs to AAV, baculovirus, poxvirus, herpesvirus, alphavirus, lentivirus, or other retrovirus.
[0363] In the first aspect, a cell is also provided, said cell comprising the aforementioned dsRNA molecule or second nucleic acid molecule. In some embodiments, said cell is a prokaryotic cell. In some embodiments, said cell is a eukaryotic cell, such as a stem cell, such as a mesenchymal stem cell, mesenchymal cell, etc.
[0364] In the first aspect, a pharmaceutical composition is also provided, comprising the aforementioned dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt, or the aforementioned engineered nucleic acid molecule, or the aforementioned second nucleic acid molecule, or the aforementioned delivery body or the aforementioned cell, and a pharmaceutically acceptable carrier or diluent.
[0365] Secondly, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof that inhibits lipoprotein A (Lp(a)) gene expression via RNAi, wherein the double-stranded RNA molecule comprises a sense strand and an antisense strand that are complementary to each other to form a double-stranded region, the base sequence of the sense strand is shown in SEQ ID NO:1, the base sequence of the antisense strand is shown in SEQ ID NO:2, and the structures of the sense strand and antisense strand of the dsRNA molecule are described in any one of (a) to (c) below:
[0366] (a) A sense chain contains a structure with the following:
[0367] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0368] Antisense chains contain structures with the following features:
[0369] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0370] (b) A meaningful chain contains a structure with the following:
[0371] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0372] Antisense chains contain structures with the following features:
[0373] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0374] (c) A sense chain contains a structure with the following:
[0375] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0376] Antisense chains contain structures with the following features:
[0377] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0378] Wherein, the sense or antisense strand structure defined in any of (a)-(c) above is oriented from 5' to 3' from left to right, Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd correspondingly represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
[0379] In some embodiments, the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester. The link is a phosphate thioester link between the first and second nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the first and second nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule.
[0380] In some embodiments, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester, starting from the 3' end.
[0381] In some embodiments, the sense chain has the structure shown in SEQ ID NO:106, and the antisense chain has the structure shown in SEQ ID NO:107.
[0382] In some embodiments, the sense chain has the structure shown in SEQ ID NO:108, and the antisense chain has the structure shown in SEQ ID NO:107.
[0383] In some embodiments, the sense chain has the structure shown in SEQ ID NO:109, and the antisense chain has the structure shown in SEQ ID NO:110.
[0384] In some embodiments, the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes.
[0385] In some embodiments, the ligand is a GalNac derivative or a GalNac polymer.
[0386] In some embodiments, the ligand has the structure shown in Formula I or Formula II:
[0387] in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
[0388] In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
[0389] The second aspect also provides a pharmaceutical composition comprising the aforementioned dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt, and a pharmaceutically acceptable carrier.
[0390] In some embodiments, the pharmaceutical composition is used for the prevention and / or treatment of conditions, pathologies, or syndromes associated with elevated levels of Lp(a) particles.
[0391] In some implementations, the diseases associated with elevated Lp(a) particle levels are selected from one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic stenosis.
[0392] The second aspect also provides for the use of the aforementioned dsRNA molecule or its stereoisomers, solvates, isotopic derivatives or pharmaceutically acceptable salts in the preparation of medicaments for the prevention and / or treatment of conditions, pathologies or syndromes associated with elevated levels of Lp(a) particles.
[0393] In some implementations, the diseases associated with elevated Lp(a) particle levels are selected from one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic stenosis.
[0394] The second aspect also provides a method for preventing and / or treating a condition, pathology, or syndrome in a subject associated with elevated levels of Lp(a) particles, the method comprising administering to the subject in need a therapeutic or preventatively effective amount of the aforementioned dsRNA molecule of the second aspect or its stereoisomer, solvate, isotope derivative, or pharmaceutically acceptable salt or pharmaceutical composition of the second aspect.
[0395] In some implementations, the diseases associated with elevated Lp(a) particle levels are selected from one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic stenosis.
[0396] Thirdly, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt thereof that inhibits the expression of the proprotein convertase subtilisin-9 (PCSK9) gene via RNAi, wherein the base sequence of the sense strand is shown in SEQ ID NO:91, the base sequence of the antisense strand is shown in SEQ ID NO:92, and the structures of the sense and antisense strands of the dsRNA molecule are described in any one of (a) to (c) below:
[0397] (a) A sense chain contains a structure with the following:
[0398] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0399] Antisense chains contain structures with the following features:
[0400] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0401] (b) A meaningful chain contains a structure with the following:
[0402] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0403] Antisense chains contain structures with the following features:
[0404] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0405] (c) A sense chain contains a structure with the following:
[0406] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0407] Antisense chains contain structures with the following features:
[0408] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0409] Wherein, the sense or antisense strand structure defined in any of (a)-(c) above is oriented from 5' to 3' from left to right, Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd correspondingly represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
[0410] In some embodiments, the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester. The link is a phosphate thioester link between the first and second nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the first and second nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule.
[0411] In some embodiments, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester, starting from the 3' end.
[0412] In some embodiments, the sense chain has the structure shown in SEQ ID NO:111, and the antisense chain has the structure shown in SEQ ID NO:112.
[0413] In some embodiments, the sense chain has the structure shown in SEQ ID NO:113, and the antisense chain has the structure shown in SEQ ID NO:112.
[0414] In some embodiments, the sense chain has the structure shown in SEQ ID NO:114, and the antisense chain has the structure shown in SEQ ID NO:115.
[0415] In some embodiments, the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes.
[0416] In some embodiments, the ligand is a GalNac derivative or a GalNac polymer.
[0417] In some embodiments, the ligand has the structure shown in Formula I or Formula II:
[0418] in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
[0419] In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
[0420] The third aspect also provides a pharmaceutical composition comprising the aforementioned dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt, and a pharmaceutically acceptable carrier.
[0421] In some embodiments, the pharmaceutical composition is used for the prevention and / or treatment of diseases mediated by PCSK9 expression.
[0422] In some implementations, the disease includes cardiovascular disease or oncological disease, wherein the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia, and the oncological disease is selected from PCSK9-related melanoma or metastatic liver cancer.
[0423] The third aspect also provides the use of the aforementioned dsRNA molecule or its stereoisomers, solvates, isotopic derivatives or pharmaceutically acceptable salts in the preparation of medicaments for the prevention and / or treatment of diseases mediated by PCSK9 expression.
[0424] In some implementations, the disease includes cardiovascular disease or oncological disease, wherein the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia, and the oncological disease is selected from PCSK9-related melanoma or metastatic liver cancer.
[0425] The third aspect also provides a method for preventing and / or treating a PCSK9-mediated disease in a subject, the method comprising administering to a subject in need a therapeutic or preventatively effective amount of the aforementioned dsRNA molecule of the third aspect or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt or the aforementioned pharmaceutical composition of the third aspect.
[0426] In some implementations, the disease includes cardiovascular disease or oncological disease, wherein the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia, and the oncological disease is selected from PCS K9-associated melanoma or metastatic liver cancer.
[0427] Fourthly, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof that inhibits the expression of the angiopoietin-like protein 3 (ANGPTL3) gene via RNAi, wherein the double-stranded RNA molecule comprises a sense strand and an antisense strand that are complementary to each other to form a double-stranded region, the base sequence of the sense strand is shown in SEQ ID NO:93, the base sequence of the antisense strand is shown in SEQ ID NO:94, and the structures of the sense strand and antisense strand of the dsRNA molecule are described in any one of (a) to (c) below:
[0428] (a) A sense chain contains a structure with the following:
[0429] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0430] Antisense chains contain structures with the following features:
[0431] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0432] (b) A meaningful chain contains a structure with the following:
[0433] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0434] Antisense chains contain structures with the following features:
[0435] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0436] (c) A sense chain contains a structure with the following:
[0437] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0438] Antisense chains contain structures with the following features:
[0439] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0440] Wherein, the sense or antisense strand structure defined in any of (a)-(c) above is oriented from 5' to 3' from left to right, Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd correspondingly represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
[0441] In some embodiments, the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester. The link is a phosphate thioester link between the first and second nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the first and second nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule.
[0442] In some embodiments, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester, starting from the 3' end.
[0443] In some embodiments, the sense chain has the structure shown in SEQ ID NO:116, and the antisense chain has the structure shown in SEQ ID NO:117.
[0444] In some embodiments, the sense chain has the structure shown in SEQ ID NO:118, and the antisense chain has the structure shown in SEQ ID NO:117.
[0445] In some embodiments, the sense chain has the structure shown in SEQ ID NO:119, and the antisense chain has the structure shown in SEQ ID NO:120.
[0446] In some embodiments, the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes.
[0447] In some embodiments, the ligand is a GalNac derivative or a GalNac polymer.
[0448] In some embodiments, the ligand has the structure shown in Formula I or Formula II:
[0449] in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
[0450] In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
[0451] The fourth aspect also provides a pharmaceutical composition comprising the aforementioned dsRNA molecule or its stereoisomer, a solvate, an isotope derivative or a pharmaceutically acceptable salt, and a pharmaceutically acceptable carrier.
[0452] In some embodiments, the pharmaceutical composition is used for the prevention and / or treatment of dyslipidemia and / or cardiovascular disease.
[0453] In some implementations, the dyslipidemia and / or cardiovascular disease is selected from hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis, homozygous and heterozygous familial hypercholesterolemia, and statin-resistant hypercholesterolemia.
[0454] The fourth aspect also provides the use of the aforementioned dsRNA molecule or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts in the preparation of medicaments for the prevention and / or treatment of dyslipidemia and / or cardiovascular disease.
[0455] In some implementations, the dyslipidemia and / or cardiovascular disease is selected from hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis, homozygous and heterozygous familial hypercholesterolemia, and statin-resistant hypercholesterolemia.
[0456] The fourth aspect also provides a method for preventing and / or treating dyslipidemia and / or cardiovascular disease in a subject, the method comprising administering to a subject in need a therapeutic or preventatively effective amount of the aforementioned dsRNA molecule of the fourth aspect or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt or the aforementioned pharmaceutical composition of the fourth aspect.
[0457] In some implementations, the dyslipidemia and / or cardiovascular disease is selected from hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis, homozygous and heterozygous familial hypercholesterolemia, and statin-resistant hypercholesterolemia.
[0458] Fifthly, this application provides a double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof that inhibits the expression of coagulation factor XI (FXI) gene via RNAi, said double-stranded RNA molecule comprising a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, the base sequence of said sense strand being as shown in SEQ ID NO:95, the base sequence of said antisense strand being as shown in SEQ ID NO:96, and the structures of said sense strand and antisense strand of said dsRNA molecule being as described in any one of (a) to (c):
[0459] (a) A sense chain contains a structure with the following:
[0460] NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0461] Antisense chains contain structures with the following features:
[0462] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0463] (b) A meaningful chain contains a structure with the following:
[0464] NmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and
[0465] Antisense chains contain structures with the following features:
[0466] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0467] (c) A sense chain contains a structure with the following:
[0468] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and
[0469] Antisense chains contain structures with the following features:
[0470] NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm;
[0471] Wherein, the sense or antisense strand structure defined in any of (a)-(c) above is oriented from 5' to 3' from left to right, Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd correspondingly represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
[0472] In some embodiments, the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 5' end, are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule, starting from the 3' end, are linked by a phosphate thioester. The link is a phosphate thioester link between the first and second nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 5' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the first and second nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule, and / or a phosphate thioester link between the second and third nucleotides starting from the 3' end of the antisense strand of the dsRNA molecule.
[0473] In some embodiments, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester, starting from the 3' end.
[0474] In some embodiments, the sense chain has the structure shown in SEQ ID NO:121, and the antisense chain has the structure shown in SEQ ID NO:122.
[0475] In some embodiments, the sense chain has the structure shown in SEQ ID NO:123, and the antisense chain has the structure shown in SEQ ID NO:122.
[0476] In some embodiments, the sense chain has the structure shown in SEQ ID NO:124, and the antisense chain has the structure shown in SEQ ID NO:125.
[0477] In some embodiments, the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes.
[0478] In some embodiments, the ligand is a GalNac derivative or a GalNac polymer.
[0479] In some embodiments, the ligand has the structure shown in Formula I or Formula II:
[0480] in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
[0481] In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
[0482] The fifth aspect also provides a pharmaceutical composition comprising the aforementioned dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt, and a pharmaceutically acceptable carrier.
[0483] In some embodiments, the pharmaceutical composition is used for the prevention and / or treatment of thromboembolic complications or coagulation disorders;
[0484] In some implementations, the thromboembolic complication is preferably one or more of deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
[0485] The fifth aspect also provides the use of the aforementioned dsRNA molecule or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts in the preparation of medicaments for the prevention and / or treatment of thromboembolic complications or coagulation disorders.
[0486] In some implementations, the thromboembolic complication is preferably one or more of deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
[0487] The fifth aspect also provides a method for preventing and / or treating thromboembolic complications or coagulation disorders in a subject, the method comprising administering to a subject in need a therapeutic or preventatively effective amount of the aforementioned dsRNA molecule of the fifth aspect or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt or the aforementioned pharmaceutical composition of the fifth aspect.
[0488] In some implementations, the thromboembolic complication is preferably one or more of deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
[0489] In a sixth aspect of this application, a nucleic acid molecule for RNAi is provided, comprising a sense strand and an antisense strand that are complementary to each other, each of the sense strand and the antisense strand being independently 15-30 nt long, comprising at least 15-21 nt of a sense strand and at least 15-23 nt of an antisense strand selected from any of the nucleotide motifs in Table 2.
[0490] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 19-25 nt long, comprising consecutive 19 nt nucleotides selected from any of the nucleotide motif sense strand sequences in Table 2 and consecutive 19 nt nucleotides selected from the antisense strand sequence. In some embodiments, the sense strand of the nucleic acid molecule of the sixth aspect is 19-25 nt long, comprising consecutive 19 nt nucleotides selected from any of the nucleotide motif sense strand sequences in Table 2 and consecutive 19 nt nucleotides starting from the 5' end of the antisense strand sequence. In some embodiments, the sense strand of the nucleic acid molecule of the sixth aspect is 19-25 nt long, comprising consecutive 19 nt nucleotides selected from any of the nucleotide motif sense strand sequences in Table 2 starting from the 3' end of the antisense strand sequence and consecutive 19 nt nucleotides selected from the antisense strand sequence. In some implementations, the nucleic acid molecule of the sixth aspect has a sense strand length of 19-25 nt, which comprises a continuous 19 nt nucleotide from the 3' end of the sense strand nucleotide sequence selected from any of the nucleotide motifs in Table 2 and a continuous 19 nt nucleotide from the 5' end of the antisense strand nucleotide sequence.
[0491] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 19-25 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide selected from the antisense strand sequence. In some embodiments, the sense strand of the nucleic acid molecule of the sixth aspect is 19-25 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence. In some embodiments, the sense strand of the nucleic acid molecule of the sixth aspect is 19-25 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0492] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 19-25 nt long, comprising a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide from the antisense strand sequence. In some embodiments, the sense strand of the nucleic acid molecule of the sixth aspect is 19-25 nt long, comprising a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0493] In some implementations, the sense strand and antisense strand of the nucleic acid molecule in the sixth aspect are each 19-25 nt long independently, and contain a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand nucleotide sequences in Table 2 and a continuous 23 nt nucleotide selected from the antisense strand nucleotide sequence.
[0494] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 19-23 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide selected from the antisense strand sequence. In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 19-23 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence. In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 19-23 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0495] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 19-23 nt long, comprising a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide from the antisense strand sequence. In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-23 nt long, comprising a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0496] In some implementations, the sense strand and antisense strand of the nucleic acid molecule in the sixth aspect are each 19-23 nt long independently, and contain a continuous 21 nt nucleotide of sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 23 nt nucleotide of antisense strand nucleoside sequence.
[0497] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-25 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide selected from the antisense strand sequence. In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-25 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence. In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-25 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0498] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-25 nt long, comprising a continuous 21 nt nucleotide of the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 21 nt nucleotide of the antisense strand nucleoside sequence starting from the 5' end.
[0499] In some implementations, the sense strand and antisense strand of the nucleic acid molecule in the sixth aspect are each independently 21-25 nt long, comprising a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand nucleotide sequences in Table 2 and a continuous 23 nt nucleotide selected from the antisense strand nucleotide sequence.
[0500] In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-23 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide selected from the antisense strand sequence. In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-23 nt long, comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence. In some embodiments, the sense strand and antisense strand of the nucleic acid molecule of the sixth aspect are each independently 21-23 nt long, comprising a continuous 19 nt nucleotide starting from the 3' end of any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0501] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand and an antisense strand each independently 21-23 nt in length, comprising a continuous 21 nt nucleotide of the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 21 nt nucleotide of the antisense strand nucleoside sequence starting from the 5' end.
[0502] In some implementations, the sense strand and antisense strand of the nucleic acid molecule in the sixth aspect are each independently 21-23 nt long, comprising a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand nucleotide sequences in Table 2 and a continuous 23 nt nucleotide selected from the antisense strand nucleotide sequence.
[0503] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide from the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 19 nt nucleotide from the antisense strand nucleoside sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 19 nt, each correspondingly comprising a continuous 19 nt nucleotide from the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 19 nt nucleotide starting from the 5' end of the antisense strand nucleoside sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide from the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 19 nt nucleotide from the antisense strand nucleoside sequence. In some implementations, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly containing a continuous 19 nt nucleotide from the 3' end of the sense strand nucleotide sequence selected from any of the nucleotide motifs in Table 2 and a continuous 19 nt nucleotide from the 5' end of the antisense strand nucleotide sequence.
[0504] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide from the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 21 nt nucleotide from the antisense strand nucleoside sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide from the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 21 nt nucleotide from the 5' end of the antisense strand nucleoside sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide from the 3' end of the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 21 nt nucleotide from the antisense strand nucleoside sequence. In some implementations, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly containing a continuous 19 nt nucleotide from the 3' end of the sense strand nucleotide sequence selected from any of the nucleotide motifs in Table 2 and a continuous 21 nt nucleotide from the 5' end of the antisense strand nucleotide sequence.
[0505] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide selected from the antisense strand sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0506] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide selected from the antisense strand. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand.
[0507] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 23 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide selected from the antisense strand sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 23 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 23 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 19 nt nucleotide selected from any of the nucleotide motifs in Table 2, and a continuous 21 nt nucleotide starting from the 5' end of the antisense strand sequence.
[0508] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 19 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 21 nt nucleotide from the sense strand nucleoside sequence selected from any of the nucleoside motifs in Table 2 and a continuous 21 nt nucleotide from the 5' end of the antisense strand nucleoside sequence.
[0509] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 21 nt nucleotide from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide from the antisense strand sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 21 nt, each correspondingly comprising a continuous 21 nt nucleotide from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide from the 5' end of the antisense strand sequence.
[0510] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 21 nt nucleotide from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide from the antisense strand sequence. In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 21 nt nucleotide from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide from the 5' end of the antisense strand sequence.
[0511] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 23 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 21 nt nucleotide selected from any of the nucleotide motif sense strand sequences in Table 2 and a continuous 21 nt nucleotide from the 5' end of the antisense strand sequence.
[0512] In some embodiments, the nucleic acid molecule of the sixth aspect has a sense strand of 21 nt and an antisense strand of 23 nt, each correspondingly comprising a continuous 21 nt nucleotide of the sense strand and a continuous 23 nt nucleotide of the antisense strand selected from any of the nucleotide motifs in Table 2.
[0513] Table 2. Nucleoside sequence
[0514] In some implementations, the nucleic acid molecule of the sixth aspect comprises any nucleoside motif selected from Table 3, which is shown below:
[0515] Table 3. Nucleoside sequence
[0516] In some embodiments, the nucleic acid motif of the nucleic acid molecule of the sixth aspect is as shown by any of the nucleoside motifs in Table 2. In some embodiments, the first and / or second Nd starting from the 3' end of the antisense strand and / or sense strand of the nucleoside motif is Td. In some embodiments, the Nd located at the 3' end of both the antisense strand and the sense strand in the nucleoside motif is Td.
[0517] In a seventh aspect, this application provides an RNA molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand complementary to form a double-stranded region, wherein the antisense strand comprises a nucleotide differing from a complementary sequence of a target gene sequence by 0, 1, 2 or 3 bases, and the sense strand comprises a sequence sufficiently complementary to the antisense strand sequence to form a double-stranded region, wherein the double-stranded region is 15-25 bp in length, and the antisense strand of the RNA molecule comprises at least 21 consecutive nucleotides of the following structure:
[0518] NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm
[0519] In this diagram, the nucleotide orientations from left to right are 5' to 3'. Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxyribonucleotide. Optionally, when N in Nd corresponds to A, G, or C, Nd represents a deoxyribonucleotide with bases A, G, or C. When N in Nd corresponds to U or T, Nd represents a deoxythymidine nucleotide.
[0520] Furthermore, the sense strand of the RNA molecule comprises at least 19 consecutive nucleotides in the following structure:
[0521] NmNmNmNmNmNmNXNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm
[0522] In this diagram, the nucleotide orientations from left to right are 5' to 3'. NX represents unmodified ribonucleotides, unmodified deoxyribonucleotides, 2'-MOE-modified ribonucleotides, 2'-O-methyl-modified ribonucleotides, or 2'-fluoro-modified ribonucleotides. Nm represents 2'-O-methyl-modified ribonucleotides, Nf represents 2'-fluoro-modified ribonucleotides, and Nd represents deoxyribonucleotides. Optionally, when N in Nd corresponds to A, G, or C, Nd represents a deoxyribonucleotide with bases A, G, or C. When N in Nd corresponds to U or T, Nd represents deoxythymidine nucleotides.
[0523] Furthermore, in some embodiments, NX in the RNA molecule is a 2'-O-methyl modified ribonucleotide or a 2'-fluoro modified ribonucleotide.
[0524] Eighthly, this application also provides an RNA molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand complementary to form a double-stranded region, wherein the antisense strand comprises a nucleotide differing from a complementary sequence of a target gene sequence by 0, 1, 2 or 3 bases, and the sense strand comprises a sequence sufficiently complementary to the antisense strand sequence to form a double-stranded region, wherein the double-stranded region is 15-25 bp in length, and the sense strand of the RNA molecule comprises at least 19 consecutive nucleotides of the following structure:
[0525] NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNm,
[0526] The antisense strand of the RNA molecule contains at least 21 consecutive nucleotides of the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNm;
[0527] The nucleotide orientations from left to right are 5' to 3'. Nm represents ribonucleotides modified with 2'-O-methyl, and Nf represents ribonucleotides modified with 2'-fluoro.
[0528] In some embodiments of aspects seven and eight, the sense strand of the RNA molecule is 19-25 nt long (19, 20, 21, 22, 23, 24, or 25 nt); the antisense strand is 21-27 nt long (21, 22, 23, 24, 25, 26, or 27 nt). In some embodiments, the sense strand of the RNA molecule is 19-23 nt long. In some embodiments, the sense strand of the RNA molecule is 21-23 nt long. In some embodiments, the antisense strand of the RNA molecule is 21-25 nt long. In some embodiments, the antisense strand of the RNA molecule is 23-27 nt long. In some embodiments, the sense strand of the RNA molecule is 19-23 nt long, and the antisense strand is 21-25 nt long. In some embodiments, the sense strand of the RNA molecule is 21-25 nt long, and the antisense strand is 23-27 nt long. In some embodiments, the sense strand of the RNA molecule is 21 nt long, and the antisense strand is 23 nt long. In some embodiments, the double-stranded region of the RNA molecule is 19-23 nt long. In some embodiments, the double-stranded region of the RNA molecule is 21-23 nt long. In some embodiments, the double-stranded region of the RNA molecule is 21 nt long. In some embodiments, the double-stranded region of the RNA molecule is 23 nt long. In some embodiments, the sense strand of the RNA molecule is 21 nt long, the antisense strand is 23 nt long, and the double-stranded region of the RNA molecule is 19 nt, 20 nt, or 21 nt long. In some embodiments, the sense strand of the RNA molecule is 21 nt long, the antisense strand is 23 nt long, and the double-stranded region of the RNA molecule is 21 nt long.
[0529] In some embodiments of aspects seven and eight, the RNA molecule has blunt ends at both the 3' and 5' ends of the antisense strand. In some embodiments, it may have nucleotide overhangs (i.e., protruding ends) at one or both of the 3' ends of the sense and antisense strands. In some embodiments, it has a nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand. In any embodiment in which one or both strands contain an overhang, the overhang consists of 1-5 (1, 2, 3, 4, or 5) nucleotides. In any embodiment in which one or both strands contain an overhang, the overhang consists of 1, 2, or 3 nucleotides. In any embodiment in which one or both strands contain an overhang, the overhang consists of 2 nucleotides.
[0530] In some embodiments of aspects seven and eight, the modification motifs of the sense strand and / or antisense strand of the RNA molecule further comprise one or more phosphate-thioester bonds. In some embodiments, the antisense strand comprises two consecutive phosphate-thioester bonds between the terminal nucleotides at the 5' end. In some embodiments, the antisense strand comprises two consecutive phosphate-thioester bonds between the terminal nucleotides at the 3' end. In some embodiments, the antisense strand comprises two consecutive phosphate-thioester bonds between both the terminal nucleotides at the 3' and 5' ends. In some embodiments, the sense strand comprises two consecutive phosphate-thioester bonds between the terminal nucleotides at the 5' end. In some embodiments, the sense strand comprises two consecutive phosphate-thioester bonds between the terminal nucleotides at the 3' end. In some embodiments, the antisense strand comprises two consecutive phosphate-thioester bonds between both the terminal nucleotides at the 3' and 5' ends, and the sense strand comprises two consecutive phosphate-thioester bonds between the terminal nucleotides at the 5' end. In some embodiments, the antisense strand contains two consecutive phosphate-thioester bonds between the terminal nucleotides at both the 3' and 5' ends, and the sense strand contains two consecutive phosphate-thioester bonds between the terminal nucleotides at both the 3' and 5' ends. In some embodiments, the antisense strand contains two consecutive phosphate-thioester bonds between the terminal nucleotides at both the 3' and 5' ends, and the sense strand contains two consecutive phosphate-thioester bonds between the terminal nucleotides at the 5' end, and the sense strand contains one phosphate-thioester bond between the terminal nucleotide at the 3' end and the ligand. In any embodiment in which one or both strands contain one or more phosphate-thioester bonds, the bonds between the nucleotides within the strand can be native 3' to 5' phosphodiester bonds.
[0531] In some embodiments of aspects seven and eight, the 5' end of the antisense strand of the RNA molecule further comprises a 5'-vinyl phosphate (5'-vp) modification, which may be a 5'-E-VP isomer (i.e., trans-vinyl phosphate), a 5'-Z-VP isomer (i.e., cis-vinyl phosphate), or a mixture thereof. In some embodiments, the 5' end of the antisense strand of the RNA molecule according to this application further comprises a 5'-E-VP modification.
[0532] In some embodiments of aspects seven and eight, the RNA molecule may further comprise ligand modifications. The ligand may be a portion taken up by host cells. Ligand modification can improve properties of the RNA molecule such as cellular uptake, intracellular targeting, half-life, or drug metabolism or pharmacokinetics. In some embodiments, ligand-modified RNA molecules exhibit enhanced affinity or cellular uptake of selected targets (such as specific tissue types, cell types, organelles, etc.), such as hepatocytes, compared to unmodified RNA molecules. The ligand modification does not interfere with the activity of the RNA molecule.
[0533] In some embodiments of the seventh and eighth aspects, the ligand modification is to modify the 3' end, 5' end and / or middle of the sequence of the RNA molecule of this application with one or more ligands.
[0534] In some embodiments of aspects seven and eight, the ligand is selected from the following: cholesterol, C14-22 saturated or unsaturated hydrocarbon groups, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine derivatives or analogs. In some embodiments, the ligand targets cell surface receptors, including galactose, galactosamine, lactose, or N-acetylgalactosamine / glucosamine moieties. In some embodiments, the ligand preferably targets the liver, particularly hepatic parenchymal cells. In some preferred embodiments, the ligand may also be human serum albumin (HSA), hyaluronic acid, polypeptides, etc. In some preferred embodiments, the ligand targets the ASGPR receptor.
[0535] It should be understood that the specific embodiments described above and the examples described below are for the purpose of better illustrating the content of this application, but are not limited to the specific embodiments and examples described herein. This application includes various aspects, embodiments, and combinations of said aspects and / or embodiments described herein. The above description and the following examples are intended to illustrate, not limit, the scope of this application. Other aspects, improvements, and modifications within the scope of this application will be apparent to those skilled in the art. Therefore, those skilled in the art should recognize that the scope of this application also includes the improvements and modifications to the said aspects and embodiments. Example
[0536] The dsRNA molecules prepared and tested in the examples below contain various modifications to their basic RNA structure (also referred to herein as the base sequence or naked sequence), such as nucleotide chemical modifications (e.g., E05, E17, E18, E20 motif modifications or 5'-phosphate mimicry modifications), targeting ligand modifications (e.g., ligand 1 or L96 conjugation), and lipophilic ligand modifications (e.g., A(hdt), C(hdt), etc.). The preparation of the dsRNA molecules prepared and tested in the examples is described below in conjunction with these various modifications.
[0537] Nucleotide chemical modification
[0538] In the RNA modification motifs of this paper, "N" represents ribonucleotides at various positions, including A, U, C, and G; Nm represents N modified with 2'-O-methyl; Nf represents N modified with 2'-fluorine; Nd represents N in the form of deoxyribonucleotide, where Nd represents deoxyribonucleotide when N is A, C, or G, and Nd represents deoxythymidine nucleotide when N corresponds to U; "s" in the modification motif indicates that the two nucleotides on both sides of "s" are linked by a phosphate thioester bond. If "s" is located at the end of the nucleotide sequence, it means that the nucleotide on one side of "s" is linked to the structure on the other side of "s" (e.g., a targeting ligand) by a phosphate thioester bond.
[0539] vp stands for vinylphosphonate. In the exemplary dsRNA molecules of the examples below, vp is attached to the 5' position of the 5' end nucleotide of the nucleotide sequence, also known as 5'-vp modification.
[0540] Targeted ligand modification
[0541] The exemplary dsRNA molecules in the following examples include targeting ligands 1 and L96.
[0542] The structure of L96 is shown in Formula I below, and it was prepared according to the methods of Examples 1-19 in CN104717982B:
[0543] The structure of ligand 1 is shown in Formula II below:
[0544] in This indicates a connection to the end of the sense or antisense strand of the dsRNA molecule (in the examples, this is often the case where the connection is made to the 3' end of the sense strand of the dsRNA via a phosphate thioester bond). The ligand 1 molecule shown in Formula II is a trivalent GalNac conjugate prepared from two compounds 6 and one compound 8, wherein the synthesis methods of compounds 6 and 8 are as follows:
[0545] 1. Synthesis of Compound 1
[0546] ① Synthesis of compound 16:
[0547] 10 g of compound 15 (CAS #: 2140-79-6, 2'-methoxyadenosine, 2'-O-Methyladenosine) and 100 mL of pyridine were added to a flask. After stirring to dissolve, the mixture was cooled in an ice bath. 20 g of B2Cl was carefully added dropwise, and the mixture was stirred in an ice bath for 10 min under nitrogen protection, then stirred for 16 hours at room temperature. Saturated sodium bicarbonate aqueous solution was slowly added to the reaction mixture in an ice bath, and after stirring for 1 hour, the mixture was concentrated to remove pyridine. DCM was added to the residue, and after stirring for 15 min, the mixture was allowed to stand and separated. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was subjected to column chromatography to give 18 g of compound 16 as a white solid powder, with a yield of 85.3%. ESI+MS: m / z 594.3 [M+H] + .
[0548] ② Synthesis of compound 17:
[0549] Add 10g of compound 16 and HOAc / Ac2O (50mL / 50mL) to a flask. Stir to dissolve and then heat to 100°C.
[0550] The mixture was heated to 100℃ and stirred for 2 hours. The reaction solution was cooled to room temperature and carefully poured into 200 mL of ice water. DCM was then added, and the mixture was stirred for 15 min. After standing, the liquid was separated, and the organic phase was washed successively with water, 5% sodium bicarbonate aqueous solution, and saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was subjected to column chromatography to give 5 g of compound 17 as a white solid powder, with a yield of 71.4%. ESI+MS: m / z 415.2 [M+H] + .
[0551] ③ Synthesis of compound 19:
[0552] Add 5 g of compound 17 and 40 mL of DCM to a three-necked flask. After stirring to dissolve, cool to -30 °C and carefully add 4.02 g of TMSOTf dropwise under nitrogen protection, stirring at -30 °C for 30 min. Then carefully add 3.17 g of a DCM solution of compound 18 (CAS#: 24697-70-9), 2-(4-hydroxybutyl)isoindoline-1,3-dione, and (2-(4-Hydroxybutyl)-1H-isoindole-1,3(2H)-dione). After the addition is complete, continue stirring at -30 °C for 1 hour. Heat the reaction solution to 0-5 °C and carefully add 5% sodium bicarbonate aqueous solution dropwise. After stirring for 15 min, allow to stand and separate the liquid. Separate the organic phase, wash successively with 5% sodium bicarbonate aqueous solution and saturated brine, dry the organic phase with anhydrous sodium sulfate, filter and concentrate. The crude product was subjected to column chromatography and reverse-phase chromatography to obtain 2.8 g of compound 19 as a white solid powder, with a yield of 40.5%. ESI+MS: m / z 574.3 [M+H] + .
[0553] ④ Synthesis of Compound 1:
[0554] 2.5 g of compound 19 and 25 mL of MeOH were added to a flask. The mixture was stirred thoroughly, and 320 mg of MeONa was carefully added dropwise under nitrogen protection. The mixture was stirred at room temperature for 6 hours, followed by concentration. The crude product was then converted to a white solid powder (1 g) by reverse phase chromatography, yielding 62.9%. ESI-MS: m / z 424.4 [M+OAc] - ] - .
[0555] 2. Synthesis of Compound 6
[0556] ① Synthesis of compound 2:
[0557] 1.2 g of compound 1 and 12 mL of pyridine were added to a three-necked flask. After stirring to dissolve, 1.2 g of DMTrCl was added, and the mixture was stirred at room temperature for 1 hour under nitrogen protection. Excess DMTrCl was quenched by slowly adding 0.6 mL of methanol to the reaction mixture, and after stirring at room temperature for 15 min, 303.5 mg of NaHCO3 was added. The mixture was concentrated to obtain a crude product, which was dissolved by adding DCM / H2O and washing with water. The organic phase was dried over anhydrous sodium sulfate and filtered. The collected organic phase was concentrated under vacuum to obtain a crude product of compound 2, which was used directly in the next reaction step.
[0558] ② Synthesis of compound 3:
[0559] Ethanol (24 mL) was added to the crude compound 2, and the temperature was slowly raised to 50 °C. After stirring to dissolve, hydrazine hydrate (0.75 mL) was added, and the mixture was stirred overnight at 50 °C. Then, the temperature was lowered to room temperature, and stirring was continued at room temperature for half an hour. At this point, a large amount of white solid gradually precipitated. The mixture was filtered, and the residue was washed with ethanol. The filtrate was concentrated under reduced pressure, then redissolved in DCM / H2O. The liquid was separated, and the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum to obtain the crude compound 3, which was directly used in the next reaction.
[0560] ③ Synthesis of compound 5:
[0561] 0.9 g of compound 4 (CAS#:1159408-54-4, 5-[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy-BD-galacturonic acid)oxy]pentanoic acid, 5-[(3,4,6-Tri-O-Acetyl-2-Acetylamido-2-Deoxy-BD-Galactopyranosyl)Oxy]Pentanoic Acid), DCM (24 mL), 0.84 mL of Et3N, and 2.3 g of HBTU) were added sequentially to the crude compound 3. The mixture was stirred at room temperature for 2 hours under nitrogen protection. The reaction was quenched with 9 mL of water, and the organic phase was separated, washed with saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by reverse-phase preparation (75% ACN-H2O) to give 1.4 g of compound 5, with a three-step yield of 44.2%. ESI-MS: m / z 1025.6 [M+OAc] - ] - .
[0562] ④ Synthesis of compound 6:
[0563] 1.4 g of compound 5 was dissolved in 14 mL of DCM and cooled at 0 ± 2 °C. 524.7 mg of 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphonic diamine was added, followed by 81.3 mg of 1H-tetrazole. The reaction mixture was stirred at 0 ± 2 °C for 15 min, then brought to room temperature and stirred for another 2 hours. The reaction mixture was cooled at 0 ± 2 °C, quenched with 14 mL of 5% NaHCO3, and the organic phase was separated. The organic phase was washed with saturated brine (1 x 14 mL) at 0 ± 2 °C, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum, and the crude product was redissolved in DCM / MTBE and carefully added dropwise to a vigorously stirred heptane solution. A large amount of viscous oil gradually precipitated from the walls and bottom of the flask. After standing for 10 min, the supernatant was decanted. The crude product was chromatographically purified using EA:hept. = 10:1-2:1 eluent. After concentration and drying, 560 mg of compound 6 was obtained as a white solid powder, yield 32%, with a phosphorus spectrum purity of 98.19%. ESI-MS: m / z 1225.4 [M+OAc] - ] - .
[0564] 3. Synthesis of Compound 8
[0565] ① Synthesis of compound 7:
[0566] 2 g of compound 5 was dissolved in 20 mL of DCM, followed by the addition of 248.4 mg of succinic anhydride and 0.69 mL of Et3N. Finally, 25.3 mg of DMAP was added, and the mixture was stirred at room temperature for 16 hours. HPLC monitoring showed a significant amount of reactant remaining, so 310.4 mg of succinic anhydride and 0.69 mL of Et3N were added. Finally, 25.3 mg of DMAP was added, and the mixture was stirred at room temperature for another 36 hours. The reaction mixture was cooled at 0 ± 2 °C, and ice water was added to the reaction mixture, followed by DCM. Finally, 40 mL of 1% HOAc aqueous solution was added, and the mixture was stirred for 10 min. The organic phase was then separated, washed successively with 1% HOAc aqueous solution and water, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum to obtain the crude product. The crude product was chromatographically purified using DCM:MeOH = 70:1-20:1 eluent. After concentration and drying, 0.9 g of compound 7 was obtained as a white solid powder, with a yield of 40.7%. No succinic acid residue was detected, and the succinic anhydride residue was 0.26%. ESI-MS: m / z 1065.7 [MH]-.
[0567] ② Synthesis of compound 8:
[0568] 300 mg of compound 7, 72.7 mg of DIPEA, 106 mg of HBTU, and 10 mL of acetonitrile were added to a three-necked flask. The mixture was stirred at 25 °C for 10 minutes, followed by the addition of 650 mg of solid support PS. Stirring continued at 25 °C for 24 hours. After the reaction was complete, the mixture was filtered, and the filter cake was washed with acetonitrile. The collected filter cake was concentrated under vacuum to remove the solvent, yielding 850 mg of solid. 700 mg of this solid was added to a three-necked flask, along with 1.74 g of acetic anhydride, 4.15 mg of DMAP, 103 mg of triethylamine, and 10 mL of pyridine. The mixture was stirred at 25 °C for 4 hours. After the reaction was complete, the mixture was filtered, and the filter cake was washed successively with acetonitrile, methanol, and acetonitrile. The collected filter cake was concentrated under vacuum to remove the solvent, yielding 750 mg of compound 8. The loading was determined to be 254.82 μmol / g.
[0569] Lipophilic ligand modification
[0570] In the exemplary dsRNA molecules described in the following examples, the lipophilic ligand modification method involves linking a modified nucleoside monomer to hdt (1-hexadecanethiol). The exemplary lipophilic ligand modified nucleoside monomers are shown in Table 4 below.
[0571] Table 4
[0572] Note: The relevant monomers need to carry relevant protecting groups before synthesizing dsRNA. During the synthesis of dsRNA, the protecting groups are removed to form the specific structure in the oligonucleotide.
[0573] The synthetic routes and methods for each hdt-modified nucleoside monomer compound are as follows:
[0574] U(hdt):
[0575] Synthesis of compound 2:
[0576] 4.52 g of compound 1, 25.83 g of 1-hexadecylthiol, 11.51 g of tetramethylguanidine, and 100 mL of N,N-dimethylformamide were added to a 250 mL single-necked flask, and the mixture was stirred at 100 °C for 24 hours. After the reaction was complete, the reaction solution was extracted with ethyl acetate and water. The upper organic phase was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 6.20 g of compound 2, with a yield of 62%. The theoretical calculated value of LCMS(ESI)C25H44N2O5S[M+H]+m / z was 485.30, and the measured value was 485.3.
[0577] Synthesis of compound 3:
[0578] 5.90 g of compound 2 and 60 mL of pyridine were added to a 100 mL single-necked flask. After stirring at room temperature for 10 minutes, 4.50 g of 4,4'-dimethoxytriphenylmethyl chloride was added, and stirring was continued at room temperature for 2 hours. The reaction was quenched with 5 mL of ethanol. The reaction solution was concentrated under vacuum, extracted with dichloromethane and water, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 5.70 g of compound 3, with a yield of 59%. The theoretical calculated value of LCMS(ESI)C46H62N2O7S[M+H]+m / z is 787.44, and the measured value is 787.4.
[0579] Synthesis of compound 4:
[0580] 5.70 g of compound 3, 2.62 g of bis(diisopropylamino)(2-cyanoethoxy)phosphine, and 60 mL of dichloromethane were added to a 100 mL three-necked flask. The mixture was stirred at room temperature for 10 minutes under nitrogen protection, followed by the addition of 0.40 g of tetrazolium. Stirring continued for 6 hours at room temperature. After the reaction was complete, the reaction solution was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 4.0 g of compound 4, with a yield of 55%. The theoretical calculated value of LCMS(ESI)C55H79N4O8PS[M+H]+m / z was 987.54, and the measured value was 987.6.
[0581] C(hdt):
[0582] Synthesis of compound 6:
[0583] 5.0 g of compound 5, 28.7 g of 1-hexadecylthiol, 12.8 g of tetramethylguanidine, and 100 mL of N,N-dimethylformamide were added to a 250 mL single-necked flask, and the mixture was stirred at 100 °C for 24 hours. After the reaction was complete, the reaction solution was extracted with ethyl acetate and water. The upper organic phase was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 10.0 g of compound 6, with a yield of 86%. The theoretical calculated value of LCMS(ESI)C25H45N3O4S[M+H]+m / z was 484.32, and the measured value was 484.3.
[0584] Synthesis of compound 7:
[0585] 9.0 g of compound 6, 18.8 g of triethylamine, 0.23 g of 4-dimethylaminopyridine, and 100 mL of dichloromethane were added to a 250 mL three-necked flask. The mixture was stirred at 0 °C for 10 minutes, then 8.09 g of trimethylchlorosilane was added, and stirring continued for 2 hours at room temperature. The reaction mixture was cooled to 0 °C, and 3.14 g of benzoyl chloride was added dropwise to the reaction mixture. Stirring continued overnight at room temperature. After the reaction was complete, the reaction mixture was washed and extracted successively with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 7.30 g of compound 7, with a yield of 67%. The theoretical calculated value of LCMS(ESI)C32H49N3O5S[M+H]+m / z was 588.35, and the measured value was 588.4.
[0586] Synthesis of compound 8:
[0587] 6.0 g of compound 7 and 60 mL of pyridine were added to a 100 mL single-necked flask. After stirring at room temperature for 10 minutes, 3.8 g of 4,4'-dimethoxytriphenylmethyl chloride was added, and stirring was continued at room temperature for 2 hours. The reaction was quenched with 4 mL of ethanol. The reaction solution was concentrated under vacuum, extracted with dichloromethane and water, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 5.50 g of compound 8, with a yield of 61%. The theoretical calculated value of LCMS(ESI)C53H67N3O7S[M+H]+m / z is 890.48, and the measured value is 890.5.
[0588] Synthesis of compound 9:
[0589] 5.0 g of compound 8, 2.0 g of bis(diisopropylamino)(2-cyanoethoxy)phosphine, and 50 mL of dichloromethane were added to a 100 mL three-necked flask. The mixture was stirred at room temperature for 10 minutes under nitrogen protection, followed by the addition of 0.35 g of tetrazolium. Stirring continued for 8 hours at room temperature. After the reaction was complete, the reaction solution was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 3.0 g of compound 4, with a yield of 49%. The theoretical calculated value of LCMS(ESI)C62H84N5O8PS[M+H]+m / z was 1090.59, and the measured value was 1090.6.
[0590] A(hdt):
[0591] Synthesis of compound 12:
[0592] According to the literature (J.Org.Chem.2021,86,4944-4956), 21.6 g of compound 12 was synthesized from 15.0 g of compound 10 through two steps, with a two-step yield of 60%.
[0593] Synthesis of compound 13:
[0594] 20.0 g of compound 12, 5.69 g of potassium thioacetate, and 100 mL of N,N-dimethylformamide were added to a 250 mL single-necked flask and stirred overnight at room temperature. After the reaction was complete, the reaction solution was concentrated under vacuum, and the residue was extracted with ethyl acetate and a 5% aqueous solution of sodium bicarbonate. The upper organic phase was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum to obtain the crude product.
[0595] The crude product and 200 mL of ammonia-methanol solution (7.0 M) were added to a 500 mL single-necked flask and stirred at 0 °C for 4 hours. After the reaction was complete, the reaction solution was concentrated under vacuum, and 14.27 g of 1-bromohexadecane, 6.04 g of diisopropylethylamine, and 150 mL of acetonitrile were added. The mixture was stirred at room temperature for 16 hours. After the reaction was complete, the reaction solution was concentrated under vacuum, and the residue was extracted with dichloromethane and sodium bicarbonate aqueous solution (5%). The lower organic phase was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 9.35 g of compound 13, with a three-step yield of 40%. The theoretical calculated value of LCMS(ESI)C38H71N5O4SSi2[M+H]+m / z is 750.49, and the measured value is 750.5.
[0596] Synthesis of compound 14:
[0597] 9.2 g of compound 13, 12.4 g of triethylamine, 0.15 g of 4-dimethylaminopyridine, and 70 mL of dichloromethane were added to a 250 mL three-necked flask. The mixture was stirred at 0 °C for 10 minutes, then 5.33 g of trimethylchlorosilane was added, and stirring continued for 2 hours at room temperature. The reaction mixture was cooled to 0 °C, and 2.07 g of benzoyl chloride was added dropwise. The mixture was stirred overnight at room temperature. After the reaction was complete, the reaction mixture was washed and extracted successively with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 7.50 g of compound 14, with a yield of 72%. The theoretical calculated value of LCMS(ESI)C45H75N5O5SSi2[M+H]+m / z is 854.51, and the measured value is 854.5.
[0598] Synthesis of compound 15:
[0599] 7.2 g of compound 14 and 25 mL of tetrabutylammonium fluoride-tetrahydrofuran solution (1 M) were added to a 50 mL three-necked flask and stirred at room temperature for 2 hours. After the reaction was complete, ethyl acetate was added, and the organic phase was washed and extracted successively with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 4.80 g of compound 15, with a yield of 93%. The theoretical calculated value of LCMS(ESI)C33H49N5O4S[M+H]+m / z is 612.36, and the measured value is 612.4.
[0600] Synthesis of compound 16:
[0601] 4.5 g of compound 15 and 50 mL of pyridine were added to a 100 mL single-necked flask. After stirring at room temperature for 10 minutes, 2.74 g of 4,4'-dimethoxytriphenylmethyl chloride was added, and stirring was continued at room temperature for 2 hours. The reaction was quenched with 3 mL of ethanol. The reaction solution was concentrated under vacuum, extracted with dichloromethane and water, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 4.6 g of compound 16, with a yield of 68%. The theoretical calculated value of LCMS(ESI)C54H67N5O6S[M+H]+m / z is 914.49, and the measured value is 914.5.
[0602] Synthesis of compound 17:
[0603] 4.2 g of compound 16, 1.66 g of bis(diisopropylamino)(2-cyanoethoxy)phosphine, and 50 mL of dichloromethane were added to a 100 mL three-necked flask. The mixture was stirred at room temperature for 10 minutes under nitrogen protection, followed by the addition of 0.26 g of tetrazolium. Stirring continued for 8 hours at room temperature. After the reaction was complete, the reaction solution was washed successively with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 2.8 g of compound 17, with a yield of 55%. The theoretical calculated value of LCMS(ESI)C63H84N7O7PS[M+H]+m / z was 1114.60, and the measured value was 1114.6.
[0604] G(hdt):
[0605] Synthesis of compound 20:
[0606] According to the literature (J.Am.Chem.Soc.2014,136,10609-10614), 23.2 g of compound 20 was synthesized from 20.0 g of compound 18 through two steps, with a two-step yield of 50%.
[0607] Synthesis of compound 21:
[0608] 22.0 g of compound 20, 6.11 g of potassium thioacetate, and 110 mL of N,N-dimethylformamide were added to a 250 mL single-necked flask and stirred overnight at room temperature. After the reaction was complete, the reaction solution was concentrated under vacuum, and the residue was extracted with ethyl acetate and a 5% aqueous solution of sodium bicarbonate. The upper organic phase was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum to obtain the crude product.
[0609] The crude product and 250 mL of ammonia-methanol solution (7.0 M) were added to a 500 mL single-necked flask and stirred at 0 °C for 4.5 h. After the reaction was complete, the reaction solution was concentrated under vacuum and then 15.32 g of 1-bromohexadecane, 6.48 g of diisopropylethylamine, and 175 mL of acetonitrile were added. The mixture was stirred at room temperature for 16 h. After the reaction was complete, the reaction solution was concentrated under vacuum, and the residue was extracted with dichloromethane and sodium bicarbonate aqueous solution (5%). The lower organic phase was washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 13.9 g of compound 21, with a three-step yield of 54%. The theoretical calculated value of LCMS(ESI)C38H71N5O5SSi2[M+H]+m / z is 766.48, and the measured value is 766.5.
[0610] Synthesis of compound 22:
[0611] 13.0 g of compound 21, 5.05 g of N,N-dimethylformamide methyl acetal, and 100 mL of N,N-dimethylformamide were added to a 250 mL single-necked flask. The mixture was stirred overnight at room temperature under nitrogen protection. After the reaction was complete, the reaction solution was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 11.3 g of compound 22, with a three-step yield of 81%. The theoretical calculated value of LCMS(ESI)C41H76N6O5SSi2[M+H]+m / z is 821.52, and the measured value is 821.5.
[0612] Synthesis of compound 23:
[0613] 11.0 g of compound 22 and 50 mL of tetrabutylammonium fluoride (1 M) / acetic acid (0.5 M)-tetrahydrofuran solution were added to a 100 mL three-necked flask and stirred at room temperature for 3 hours. After the reaction was completed, the reaction solution was concentrated under vacuum, and the residue was dissolved in dichloromethane, concentrated under vacuum, and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 7.0 g of compound 23, with a yield of 90%. The theoretical calculated value of LCMS(ESI)C29H50N6O4S[M+H]+m / z is 579.37, and the measured value is 579.4.
[0614] Synthesis of compound 24:
[0615] 6.5 g of compound 23 and 70 mL of pyridine were added to a 100 mL single-necked flask. After stirring at room temperature for 10 minutes, 4.19 g of 4,4'-dimethoxytriphenylmethyl chloride was added, and stirring was continued at room temperature for 2 hours. The reaction was quenched with 5 mL of ethanol. The reaction solution was concentrated under vacuum, extracted with dichloromethane and water, dried over anhydrous sodium sulfate, and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 7.03 g of compound 24, with a yield of 71%. The theoretical calculated value of LCMS(ESI)C50H68N6O6S[M+H]+m / z is 881.50, and the measured value is 881.5.
[0616] Synthesis of compound 25:
[0617] 6.0 g of compound 24, 2.46 g of bis(diisopropylamino)(2-cyanoethoxy)phosphine, and 60 mL of dichloromethane were added to a 100 mL three-necked flask. The mixture was stirred at room temperature for 10 minutes under nitrogen protection, followed by the addition of 0.38 g of tetrazolium. Stirring continued for 8 hours at room temperature. After the reaction was complete, the reaction solution was washed successively with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and filtered. The collected organic phase was concentrated under vacuum and purified by silica gel column chromatography (n-heptane / ethyl acetate) to give 4.3 g of compound 25, with a yield of 58%. The theoretical calculated value of LCMS(ESI)C59H85N8O7PS[M+H]+m / z was 1081.61, and the measured value was 1081.6.
[0618] Exemplary dsRNA molecular structure
[0619] Some of the dsRNA molecules in the examples below have the structures shown in Table 5 below. Other structural forms of dsRNA molecules will also be specifically described in some examples.
[0620] Table 5.
[0621] Each N in each sequence independently represents a nucleotide from 5' to 3' of that nucleotide sequence from left to right; Nm represents a ribonucleotide modified with 2′-O-methyl; Nf represents a ribonucleotide modified with 2′-fluoro; Nd represents N in the form of deoxyribonucleotide, where Nd represents deoxyribonucleotide when N is A, C, or G, and deoxythymidine nucleotide when N corresponds to U; the “s” in the modified motif indicates that the two nucleotides on either side of “s” are linked by a phosphate thioester bond, and if “s” is at the end of the nucleotide sequence, it means that the nucleotide on one side of “s” is linked to the structure on the other side of “s” (e.g., L96 or ligand 1) via a phosphate thioester bond; vp (vinylphosphonate) is linked to the 5' end nucleotide of the antisense strand AS; L96 or ligand 1 is linked to the 3' end of the sense strand SS.
[0622] Preparation and synthesis of dsRNA molecules
[0623] In the examples, the phosphoramidite monomers used to prepare dsRNA (including unmodified ribonucleotide monomers, DNA monomers, and phosphoramidite nucleoside monomers modified with 2'-methoxy, 2'-fluoro, 5'-vinylphosphonate (5'-VP)) were commercially available and synthesized on a CPG using an Oligo 48 synthesizer. An acetonitrile solution of 0.6 M 5-ethimercaptotetrazole was used as the activating agent. The coupling time was 300 seconds (2′OMe and 2′F). Thiophosphate or phosphate modification was introduced into the sequence via an oxidation step in the cyclic reaction. After solid-phase synthesis, the dried solid support was purified, desalted, and lyophilized after treatment with ammonia solution at 55°C for 16 hours. The crude product was then purified by reversed-phase HPLC. Buffer A was 100 mM TEAA, pH 7.5, containing 5% acetonitrile, and buffer B was 100% acetonitrile. UV traces at 260 nm were recorded, and appropriate fractions were collected. The concentration was determined by UV microplate reader. Equimolar amounts of sense and antisense strands were mixed and placed into a new EP tube. The mixture was heated at 95°C for 5 minutes and then slowly annealed to room temperature. Finally, the product was evaporated to dryness at room temperature using a vacuum concentrator.
[0624] The starting material for constructing the Ga1NAc derivative L96 is a phosphorus amide nucleoside monomer. Similar to the industry-standard solid-phase synthesis methods for phosphorus amides, the synthesis process utilizes phosphorus amide and a functionalized solid support. The GalNAc phosphorus amide, alone or in combination with other GaINAc monomers, forms polymers that can be added to any position on the oligonucleotide to form GalNAc derivatives. The Ga1NAc solid-phase support can be used for GalNAc modification at the 3'-terminus of the oligonucleotide.
[0625] The steps for linking ligand 1 to the oligonucleotide include: synthesizing a nucleic acid chain from the 3' to the 5' end: sequentially reacting one compound 8 with two compounds 6; or, starting with a universal carrier (such as a UnyLinker type carrier), reacting three compounds 6 sequentially. Through conventional solid-phase synthesis cycles (deprotection, coupling, oxidation, and capping), the precursor (or intermediate) of ligand 1 linked to the solid-phase carrier is obtained. Further solid-phase synthesis cycles are then performed using the corresponding 2'-modified monomer. After the reaction is complete, the entire synthesized molecule is dissociated from the solid-phase carrier by ammonolysis, yielding the oligonucleotide linked to ligand 1.
[0626] Example 1: Design and activity screening of dsRNA targeting LP(a)
[0627] 1.1 dsRNA Design
[0628] Based on the human LP(a) mRNA sequence (NM_005577.4, Table 6), multiple LP(a) dsRNAs were designed at different sites (21 bases in the sense strand and 23 bases in the antisense strand were selected as parameters). All designed dsRNA sequences were compared with sequence similarity software and were required to have the lowest homology with all other non-target gene sequences.
[0629] Table 6 Target Genes
[0630] In addition, two dsRNA molecules, OLP2706 and SLN2545, were provided. OLP2706 is from WO2021 / 119034A1, and the sense and antisense sequences of OLP2706 in WO 2021 / 119034A1 are SEQ ID NO:281 and 470 (SEQ ID NO:81 and 82 of this application), respectively. SLN2545 is from WO 2019 / 092283A1, and the sense and antisense sequences of SLN2545 in WO 2019 / 092283A1 are SEQ ID NO:9 and 10 (SEQ ID NO:83 and 84 of this application), respectively.
[0631] The dsRNA tested in this embodiment was unmodified.
[0632] 1.2 Detection of the inhibitory activity of unmodified LP(a)dsRNA in the in vitro psicheck-2 system
[0633] 1. Construct detection plasmid
[0634] The LP(a) recombinant plasmid was constructed using the psicheck-2 plasmid (GenScript Biotechnology Co., Ltd.). The psicheck-2 plasmid was purchased from Promega. The plasmid map is shown in Figure 5. It contains the target sequences (i.e., target sequences, including the portion complementary to the antisense strand of any of the LP(a) dsRNAs to be tested) designed. The cloning sites are the 5'XhoI and 3'NotI sites of the psicheck-2 plasmid.
[0635] 2. Co-transfection of LP(a)siRNA and recombinant plasmid
[0636] 293T cells and transfection reagents were commercially available. 293T cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were digested and plated for transfection assays. After digestion, cells were plated at a density of 5 × 10⁶ cells per well. 4 The cells were seeded into a 96-well plate.
[0637] Preparation of the transfection complex: Mix 5 μL Opti-MEM, 8 ng recombinant plasmid, and 1 μL of dsRNA at different concentrations (calculated based on the working concentration to be tested). Separately, mix 5 μL Opti-MEM and 1 μL Lipofectamine 2000 transfection reagent. Let stand for 5 min. Then mix the two mixtures together and let stand for 5 min. Add the above transfection complex to a 96-well plate and incubate at 37°C with 5% CO2 for 24 h.
[0638] In addition to the experimental group, the following control groups were set up for each cell transfection: NC as the negative control group (with unrelated dsRNA added), Lipo control group as the control group with only transfection reagent added, and blank control group as the untreated control group (without dsRNA added). Both the experimental group and the control group were replicated three times.
[0639] 3. DLR detection and analysis
[0640] The Dual-Luciferase Reporter Assay System (Promega) was used for detection. Cells were lysed and collected according to the kit instructions. The fluorescence intensity of firefly (Photinus pyralis) luciferase and renal (Renilla reniformis) luciferase was detected sequentially using an Infinite Eplex microplate reader (TECAN). The fluorescence intensity ratio of renal (Renilla reniformis) luciferase to firefly (Photinus pyralis) luciferase was calculated, and the NC group was used as a control for normalization. Tables 7 and 8 show the triple-replica results of dsRNA molecule DLR detection at working concentrations of 100 nM and 33 nM, and the average dual-luciferase reporter gene expression level of the LP(a)dsRNA experimental group relative to the NC group.
[0641] Table 7 DLR Detection Results
[0642] Table 8 DLR Detection Results II
[0643] As shown in Tables 7 and 8, the designed dsRNA molecules showed activity in LP(a)siRNA DLR screening in 293T cells. The top 50 dsRNA molecules with high activity were selected for subsequent in vitro RT4 cell screening, as described in Section 1.3.
[0644] 1.3 qPCR screening of 50 unmodified LP(a)dsRNA molecules
[0645] 1. LP(a)dsRNA transfection of RT4 cells
[0646] RT4 cells were cultured in McCoy's medium containing 10% fetal bovine serum at 37°C with 5% CO2. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were digested and plated for transfection assays. After digestion, cells were plated at 1.5 × 10⁶ cells per well. 5 The cells were seeded into a 24-well plate.
[0647] Preparation of the transfection complex: Mix 50 μL of Opti-MEM and 1 μL of dsRNA molecules (prepare the appropriate concentration according to the 100 nM working concentration), mix 50 μL of Opti-MEM and 1.5 μL of RNAi Max transfection reagent, let stand for 5 min, then mix the two mixtures together and let stand for 15 min to form the transfection complex. Add the above transfection complex to a 24-well plate and incubate at 37°C with 5% CO2 for 48 h.
[0648] In addition to the experimental groups, the following control groups were set up for each cell transfection: NC group as negative control group (with added unrelated dsRNA), RNAi Max control group as transfection reagent control group, and blank control group as untreated control group (without added dsRNA).
[0649] 2. Real-time quantitative PCR analysis:
[0650] Cells were lysed 48 hours after transfection, and total RNA was extracted using a column extraction kit (Novizan). Using the GAPDH gene as an internal control, real-time quantitative PCR was performed using the Sybrgreen method with a CFX96 real-time PCR instrument (Bio-Rad).
[0651] The primers used are:
[0652] Table 9 Primer sequence information
[0653] 3. Data Analysis
[0654] After the PCR reaction, relative quantification was performed using the 2–ΔΔCt (Livak) method with the internal reference gene as the standard. Table 10 and Figures 1 and 2 show that LP4553 and LP4927 at a working concentration (i.e., the concentration at cell contact) of 100 nM exhibited high inhibitory activity against LP(a) mRNA expression in RT4 cells, showing 6.9% and 5.6% higher inhibitory activity, respectively, than the positive control OLP2706; and 15.5% and 14.2% higher inhibitory activity, respectively, than the positive control SLN2545.
[0655] Table 10. Inhibitory activity of 50 dsRNA molecules on LP(a) mRNA expression
[0656] The sequence structures of some of the test dsRNA molecules and ginseng dsRNA molecules involved in Example 1 are shown in Table 11.
[0657] Table 11
[0658] Example 2: Optimization of LP(a)-dsRNA
[0659] Based on the activity screening in Example 1, five highly active dsRNA molecules were selected and modified. Specifically, the two strands of the dsRNA molecules were nucleotide modified using the E05 motif (as shown in Table 5), and an L96 ligand was attached to the 3' end of each sense strand. The structural characterization of the five modified dsRNA molecules is shown in Table 12.
[0660] In addition, for the two positive reference dsRNA molecules OLP2706 and SLN2545, the two strands were nucleotide modified using the modification motifs listed in Table 5, and L96 ligands were also attached to the 3' end of their respective sense strands. The structural characterization of OLP2706 and SLN2545 after modification is shown in Table 13.
[0661] Table 12.
[0662] Table 13
[0663] 1. Hep3B cells transfected with LP(a) plasmid
[0664] To enhance LP(a) expression, LP(a) plasmids were transfected into Hep3B cells. A plasmid capable of transcribing LP(a) mRNA (Gene ID: 4018) was constructed using pcDNATM 3.1 plasmid (GenScript Biotechnology Co., Ltd.) by inserting the full-length LP(a) mRNA sequence into the cells. After passage, Hep3B cells were cultured for 24 hours before transfection. In a 10cm culture dish, 5μL of lipo2000 and 10μg of plasmid were added to 500μL of opti-MEM, respectively, and incubated for 5 minutes. Then, the lipo2000 mixture was added to the plasmid mixture, gently pipetted three times, and incubated for 10 minutes. The mixture was then added to a 10cm culture dish, and transfection was performed after 24 hours.
[0665] 2. LP(a) mRNA expression inhibition test
[0666] Following the procedures for preparing the transfection complex, transfection, real-time quantitative PCR analysis, and data analysis in Example 1.3, the effects of the dsRNA molecules listed in Tables 12 and 13 on inhibiting LP(a) mRNA expression were tested, and the results are shown in Table 14.
[0667] Table 14
[0668] 3. IC 50 Value determination
[0669] Following the procedures of the previous test, LP508-E05, LP2941-E05, LP4927-E05, and the positive control OLP2706-modified were serially diluted to different concentrations using Nuclease-Free Water (Invitrogen). The maximum final concentration was set at 10 nM, and six 10-fold serial dilutions were performed to obtain a total of six concentrations. Hep3B cells were transfected with these solutions, and the inhibition rate was measured. The IC50 was calculated using Graphpad Prism software. 50 Values. As shown in Figure 3, LP508-E05, LP2941-E05, LP4927-E05 and the positive control OLP2706-modified have IC50 values in Hep3B cells. 50 The values were 1.822 nM, 3.697 nM, 3.671 nM and 15.62 nM, respectively. The inhibition rates of LP508-E05, LP2941-E05 and LP4927-E05 on LP(a) mRNA expression were better than those of the positive control OLP2706-modified.
[0670] Example 3: Detection of effectiveness in rhesus monkeys
[0671] Based on the results of Example 2, LP508-E05, LP2941-E05, LP4927-E05 and positive control OLP2706-modified were selected for in vivo experimental evaluation.
[0672] 1. Experimental Design
[0673] Eight rhesus monkeys (Beijing Zhaoyan New Drug Research Center Co., Ltd.) were used in the experiment and randomly assigned to four groups (one male and one female) based on body weight and lipoprotein Lp(a) levels: a positive control group (OLP2706-modified) and experimental test groups (LP508-E05, LP2941-E05, LP4927-E05). Each group consisted of two animals. Serum samples were collected from each animal before drug administration, and baseline Lp(a) protein levels were measured for each animal. The test drug was administered once (dose 3 mg / kg, subcutaneous injection). Approximately 3 mL of blood was collected from the subcutaneous vein of the forelimb or hindlimb on days -1 (1 day before administration), 5, 8, 12, 15, 19, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, 92, 99, 106, 113, 120, 127, 134, 141, 148, 155, 162, and 169 (the patient fasted overnight before blood collection, and the day of injection was day 1). Serum was separated for Lp(a) protein detection.
[0674] 2. Lp(a) protein detection
[0675] Serum Lp(a) protein levels were detected using the Human Lipoprotein A ELISA Kit (abcam, ab212165). All values were normalized to baseline values collected for each animal before drug administration and presented as a percentage of the initial level (see Figure 4, Tables 15 and 16).
[0676] Table 15. Changes in serum Lp(a) protein levels in the positive control group and experimental test group up to day 92.
[0677] Table 16. Changes in serum Lp(a) protein levels in the LP4927-E05 group from D99 to D169.
[0678] The results (Figure 4, Tables 15 and 16) showed that serum Lp(a) protein levels in all four groups of animals were significantly reduced after administration compared with pre-administration levels. Specifically, the OLP2706-modified (Yangshen), LP508-E05, and LP2941-E05 groups showed a decrease of 64-84% from day 19 to day 36; the LP4927-E05 group showed a decrease of 97%-99% on day 36. Subsequently, OLP2706-modified (Yangshen), LP508-E05, and LP2941-E05 showed a rebound. Continued observation showed that on day 71, LP4927-E05 maintained a stable decrease, inhibiting serum Lp(a) protein levels by 96%-99%. By day 92, the reduction in Lp(a) protein levels in the OLP2706-modified (Yangshen) and LP508-E05 groups was only 17%-38%, while the LP2941-E05 group had returned to pre-treatment levels, and the LP4927-E05 group showed a sustained reduction of 92%-94%. Therefore, even with extended sampling until day 169, the reduction in serum Lp(a) protein levels with LP4927-E05 remained at 70%-80%. This demonstrates that the long-term effect of LP4927-E05 in reducing serum Lp(a) protein levels is significantly superior to that of Yangshen OLP2706-modified and the other two tested molecules.
[0679] Example 4: Detection of the in vivo efficacy of LP(a) in humanized mice
[0680] Based on the study in Example 3, LP4927 was selected and subjected to various other modifications. The effects of dsRNA targeting LP(a) with different modified motifs (see Table 5) and different ligand conjugates were then tested. The structural characterization of LP4927 after different modifications is shown in Table 17.
[0681] Table 17
[0682] Note: L96 or ligand 1 is attached to the 3' end of the sense chain.
[0683] The experiment used 7-8 week old SPF-grade humanized LP(a) homozygous male mice (Biocytok Jiangsu Gene Biotechnology Co., Ltd.). Before drug administration, serum was collected from each animal, and baseline Lp(a) levels were measured. Seven mice were in each group. The test drug was administered as a single dose (3 mg / kg, subcutaneously (saline was administered to the control group)). Blood was collected from the tail vein on days -3 (3 days before administration), 7, 14, 21, and 28 (the animals were fasted overnight before blood collection, and the day of injection was considered day 1). Serum was separated for Lp(a) detection. Serum Lp(a) protein levels were measured according to the instructions of the Human Lipoprotein A ELISA Kit (abcam, ab212165). All values were normalized to the baseline values collected for each animal before drug administration and presented as a percentage of the initial level (Figure 6, Table 18).
[0684] Table 18. Changes in serum Lp(a) in mice of each group (percentage relative to baseline level before drug administration)
[0685] The results (Figure 6, Table 18) showed that, compared with before administration, the serum Lp(a) protein levels in all seven groups of animals were significantly reduced after administration. Among them, the LP4927-E05-L96, LP4927-E13-ligand 1, LP4927-E17-ligand 1, LP4927-E18-ligand 1, LP4927-E20-ligand 1 and LP4927-E05-L96 administration groups showed the largest decrease in serum Lp(a) protein levels on day 21, ranging from 68% to 85%. The decrease in serum Lp(a) protein levels on day 21 was only 24% to 25% in the LP4927-E19 and LP4927-E21 administration groups. Among them, LP4927-E17-ligand 1 and LP4927-E18-ligand 1 showed the best knockdown effects, while LP4927-E20-ligand 1 was also significantly better than other modified motifs such as E05. All three showed lower knockdown effects and longer duration of efficacy. Optimization of modified motifs, such as changing the motif modification to E17 and E18 compared to E05, can further significantly improve the dsRNA inhibition efficiency (starting from D7, the LP4927-E17-ligand 1 and LP4927-E18-ligand 1 groups and the LP4927-E05-ligand 1 and LP4927-E05-L96 groups showed a 2-way ANOVA test with P < 0.001 at the same sampling time point).
[0686] Example 5: Detection of the in vivo efficacy of LP(a) in humanized mice
[0687] Based on Example 4, this example further modifies LP4927-E17-ligand 1 and LP4927-E20-ligand 1 (see Table 19), and tests the modified molecules.
[0688] Table 19
[0689] Note: Ligand 1 is attached to the 3' end of the sense chain, and the 5' end of the antisense chain is modified with vinyl phosphonate (vp). The only difference between the base sequences SEQ ID NO:89 and SEQ ID NO:90 and the original base sequences SEQ ID NO:1 and SEQ ID NO:2 of LP4927 is that the last base pair is replaced with an AU base pair.
[0690] The experiment used 7-8 week old SPF-grade humanized LP(a) homozygous male mice (Biocytok Jiangsu Gene Biotechnology Co., Ltd.). Before drug administration, serum was collected from each animal, and the baseline Lp(a) level was measured. Seven mice were in each group. The test drug was administered once subcutaneously (3 mg / kg). Blood was collected from the tail vein on days -1 (1 day before administration), 6, 13, 20, and 27 (the animals were fasted overnight before blood collection, and the day of injection was considered day 1). Serum was separated for Lp(a) detection. The serum Lp(a) protein level was measured according to the instructions of the Human Lipoprotein A ELISA Kit (abcam, ab212165). All values were normalized to the baseline values collected for each animal before drug administration, and the change in relative level was presented as a percentage of the initial level (Figure 7, Table 20).
[0691] Table 20: Changes in serum Lp(a) in mice of each group (percentage relative to baseline level before drug administration)
[0692] The results (Figure 7, Table 20) showed that serum Lp(a) protein levels in both groups of animals were significantly reduced after administration compared with pre-administration levels. The LP4927-E17-vpU-ligand 1 group showed the largest decrease in serum Lp(a) protein levels on day 20 (-93%), indicating a better knockdown effect. The LP4927-E20-vpU-ligand 1 group showed an 86% decrease on day 20. This demonstrates that adding 5'-vp (vinylphosphonate) modification to the aforementioned motif modifications can further enhance dsRNA activity.
[0693] Example 6: Screening of antisense strand modified motifs - Detection of knockdown efficiency at the HepG2 cell level
[0694] This embodiment selects a dsRNA molecule targeting the proprotein convertase subtilisin / kexin-9 (also known as PCSK9) to evaluate the effect of different modifications to the antisense strand on dsRNA performance. Information on the specific dsRNA molecule selected is disclosed in WO 2023 / 134609, where it is named "1168," and this application adopts this name. The sense strand sequence of molecule 1168 is CUGUUUUGCUUUUGUAACUUG (SEQ ID NO:91), and the antisense strand sequence is CAAGUUACAAAAGCAAAACAGGU (SEQ ID NO:92).
[0695] According to Table 21, multiple 1168 modified molecules with different antisense chain modification motifs were prepared.
[0696] Table 21
[0697] Note: In the table, m indicates that the nucleotide is a ribonucleotide modified with 2′-O-methyl; f indicates that the nucleotide is a ribonucleotide modified with 2′-fluoro; d indicates that the nucleotide is modified with 2′-deoxy; eo indicates that the nucleotide is modified with 2′-O-MOE (i.e., 2′-O-methoxyethyl, for example, Ceo indicates 2′-O-MOE modified cytidine); s indicates that the nucleotide is linked to the nucleotide adjacent to its 3′ end via a phosphate thioester bond.
[0698] In the experiment, 100 μL of Opti-MEM and 1 μL of Lipofectamine RNAimax transfection reagent were mixed with 0.6 μL of 1 μM, 0.1 μM, or 0.01 μM of the dsRNA molecules listed in Table 21, and then added to 24-well plates and incubated for 15 min. HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were digested and plated for transfection assays. After digestion, cells were plated at a density of 1.0 × 10⁶ cells per well. 5Cells (0.5 mL culture medium) were seeded into 24-well plates and cultured for 48 h. After 48 h of transfection, cells were lysed, and total RNA was extracted using a column extraction kit (Novizan). Real-time quantitative PCR was performed using a CFX96 quantitative PCR instrument (Bio-Rad) with the GAPDH gene as an internal control. After PCR, relative quantification was performed using the 2–ΔΔCt (Livak) method, with the reference gene as the standard. The results are shown in Table 22 and Figure 8. The results in Table 22 and Figure 8 indicate that knockdown of 1168-E07 to 1168-E11 was more efficient than that of 1168-E04, suggesting that DNA modification at positions 5 and 7 of the antisense strand can improve the inhibition efficiency.
[0699] Table 22 Knockout efficiency of 1168-modified molecules with different antisense strand chemical modifications 48 h after HepG2 cell transfection.
[0700] Example 7: Screening of antisense strand modified motifs - Long-term effect detection in humanized PCSK9 mice
[0701] This embodiment tested the seven molecules from Example 6 in vivo.
[0702] Forty-eight 6-8 week old humanized male PCSK9 mice (Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were randomly divided into groups of six based on body weight and administered the drug subcutaneously at a dose of 3 mg / kg. Blood samples were collected on days 7, 14, 21, 28, 35, 42, and 49 (after fasting for 4-6 hours prior to blood collection, with the injection day being day 0). 0.1 ml of blood was collected from behind the eyeball, and serum was separated from the collected blood for PCSK9 protein detection. The expression level of PCSK9 protein in the serum was detected using the Human PCSK9 ELISA Kit (Proteintech), and inter-group comparisons were performed. The results are shown in Table 23 and Figure 9.
[0703] Table 23 Protein levels of 1168-modified molecules with different antisense chain chemical modifications in PCSK9 humanized mice.
[0704] Experimental results (Figure 9) show that, compared with 1168-E04 obtained by the previously reported Advanced ESC modification, 1168-E07 to E09 showed a maximum reduction of 80% in PCSK9 protein at day 7, and the reduction was still around 60% by day 28. Simultaneously, the results indicate that 1168-E10 and 11, which are entirely modified with DNA and 2'-OMe (i.e., without 2'-F modification), showed a sustained rebound, while the inhibition efficiency brought by E07 modification was superior to that of E04 modification. These results suggest that 2'-F at positions 2, 14, and 16 is crucial for maintaining inhibition efficiency, and combining this with DNA modification at positions 5 and 7 can further enhance inhibition efficiency.
[0705] Example 8: Evaluation of the effects of different modified motifs in PCSK9 mice in vivo
[0706] This embodiment uses the dsRNA molecule 1168 targeting PCSK9 from Example 6. By modifying the molecule 1168 as shown in Table 24, the modified motifs E17, E18, E20 and E05 are compared and evaluated.
[0707] Table 24
[0708] Note: In the table, m indicates that the nucleotide it contains is a ribonucleotide modified with 2′-O-methyl; f indicates that the nucleotide it contains is a ribonucleotide modified with 2′-fluoro; d indicates that the nucleotide it contains is modified with 2′-deoxy; s indicates that the nucleotide it contains is connected to the nucleotide adjacent to its 3′ end via a thiophosphate bond; "s-ligand 1" indicates that the nucleotide on the 5′ side of ligand 1 is connected to ligand 1 via a thiophosphate bond.
[0709] Six 6-8 week old humanized male PCSK9 mice (Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were used in the experiment. Each group received a single subcutaneous injection of 2 mg / kg. The saline group served as a blank control. Blood samples were collected on days -3 (3 days before administration), 7, 14, 21, 28, and 42 (after fasting for 4-6 hours before blood collection). Serum was separated, and the expression level of PCSK9 protein in the serum was detected using the Human PCSK9 ELISA Kit (Proteintech). Intergroup comparisons were also performed, and the results are shown in Table 25.
[0710] Table 25 Protein levels of 1168 molecules with different modifications in PCSK9 humanized mice.
[0711] The experimental results (Table 25) showed that, compared with before administration, the serum PCSK9 protein level in each group decreased to its lowest point on day 7 after administration and remained at a low level. Compared with 1168-E05 obtained by modification according to the previously reported Advanced ESC, the 1168 molecules modified by E17, E18 or E20 still showed a lower protein level on day D28, which was more effective than E05.
[0712] Example 9: Evaluation of the effects of different modified motifs in ANGPTL3 mice in vivo
[0713] This embodiment selects a dsRNA molecule targeting angiopoietin-like 3 (ANGPTL3) and evaluates the effects of the E17, E18, E20, and E05 modification motifs on dsRNA performance by modifying it as shown in Table 26. Information on the specific dsRNA molecule selected is disclosed in WO 2025 / 232842, where it is named "ANG639," a name adopted in this application. The sense strand sequence of the ANG639 molecule is GAAAUAGAAAAUCAGCUCAGA (SEQ ID NO:93), and the antisense strand sequence is UCUGAGCUGAUUUUCUAUUUCUU (SEQ ID NO:94).
[0714] Table 26
[0715] Note: In the table, m indicates that the nucleotide it contains is a ribonucleotide modified with 2′-O-methyl; f indicates that the nucleotide it contains is a ribonucleotide modified with 2′-fluoro; d indicates that the nucleotide it contains is modified with 2′-deoxy; s indicates that the nucleotide it contains is connected to the nucleotide adjacent to its 3′ end via a thiophosphate bond; "s-ligand 1" indicates that the nucleotide on the 5′ side of ligand 1 is connected to ligand 1 via a thiophosphate bond.
[0716] Six 6-8 week old humanized male ANGPTL3 mice (Shanghai Southern Model Biotechnology Co., Ltd.) were used in the experiment. Each group received a single subcutaneous injection of 3 mg / kg. The saline group served as a blank control. Blood samples were collected on days -3 (3 days before administration), 7, 14, 21, and 28 (after fasting for 4-6 hours before blood collection). Serum was separated and the expression level of ANGPTL3 protein in serum was detected using the Human ANGPTL3 ELISA Kit (R&D). Intergroup comparisons were also performed, and the results are shown in Table 27.
[0717] Table 27 Protein levels of ANG639 molecules with different modifications in ANGPTL3 humanized mice.
[0718] The experimental results (Table 27) showed that, compared with pre-drug administration, serum PCSK9 protein levels in each group decreased to their lowest point on day 7 after administration, decreasing by 61%, 76%, 75%, and 72%, respectively, before rebounding. Compared with ANG639-E05 obtained by modification according to the previously reported Advanced ESC, ANG639 molecules modified with E17, E18, or E20 still showed lower protein levels on day 28, demonstrating superior efficacy compared to E05.
[0719] Example 10: Evaluation of the effects of different modified motifs in FXI mice in vivo
[0720] This embodiment selects a dsRNA molecule targeting coagulation factor XI (FXI) and evaluates the effects of the E17, E18, E20, and E05 modified motifs on dsRNA performance by modifying it as shown in Table 28. Information on the specific dsRNA molecule selected is disclosed in WO 2025 / 157271, where it is named "GN26," a name adopted in this application. The sense strand sequence of the GN26 molecule is UCACACCAAAUAAGCGCUUGU (SEQ ID NO:95), and the antisense strand sequence is ACAAGCGCUUAUUUGGUGUGAGC (SEQ ID NO:96).
[0721] Table 28
[0722] Note: In the table, m indicates that the nucleotide it contains is a ribonucleotide modified with 2′-O-methyl; f indicates that the nucleotide it contains is a ribonucleotide modified with 2′-fluoro; d indicates that the nucleotide it contains is modified with 2′-deoxy; s indicates that the nucleotide it contains is connected to the nucleotide adjacent to its 3′ end via a thiophosphate bond; “s-ligand 1” indicates that the nucleotide on the 5′ side of ligand 1 is connected to ligand 1 via a thiophosphate bond; vp (vinylphosphonate) is connected to the 5′ end nucleotide of the antisense strand AS at the 5′ position.
[0723] The experiment used 6-8 week old SPF-grade humanized FXI homozygous male mice (Nanmo Biological Experimental Animal Co., Ltd.), randomly divided into groups of 6 mice each, and administered a single subcutaneous injection of 1 mg / kg. Blood samples were collected at different time points after administration, and plasma was used to detect FXI protein content. The percentage of residual rate is a relative result compared to the pre-drug point, and the results are shown in Table 29.
[0724] Table 29. Protein levels of GN26 molecules with different modifications in FXI humanized mice.
[0725] The experimental results (Table 29) showed that, compared with pre-drug administration, serum FXI protein levels in each group decreased to their lowest point on day 7 after administration, decreasing by 81%, 86%, 83%, and 88%, respectively, before rebounding. Compared with GN26-E05 obtained by modification according to the previously reported Advanced ESC, GN26 molecules modified with E17, E18, or E20 still showed lower protein levels on day 35, demonstrating superior efficacy compared to E05.
[0726] Example 11: Test of truncated modification motifs for INHBE gene-dsRNA
[0727] The exemplary dsRNA molecules involved in Examples 1-10 all have a sense strand containing 21 bases and an antisense strand containing 23 bases, and the corresponding modification motifs (E05, E17, E18, E20, etc.) also have the same length.
[0728] In this embodiment, dsRNA targeting the repressor subunit βE (INHBE) gene was used as an example to test the effect of sense and antisense strands of the dsRNA molecule and the modified motif truncation. The base sequences of INHBE250 to 253 of the four molecules tested are shown in Table 30.
[0729] Table 30
[0730] The different modification methods of INHBE250 to 253 are as follows and summarized in Table 31 (none of which are connected to the target ligand):
[0731] INHBE250-E18 (cut short):
[0732] Significant chain: GmsCmsUmUmAmUmAfCdUfUmUmCmUmUmAmAmUmsAmsAm(SEQ ID NO:158),
[0733] Antonym: VP-UmsUfsAmUmTdAmAdGmAmAmAmGmUmAfUmAfAmGmCmsCmsAm(SEQ ID NO:159);
[0734] INHBE250-E18 truncated-sTd:
[0735] Sense chain: GmsCmsUmUmAmUmAfCdUfUmUmCmUmUmAmAmUmsAmsAd(SEQ ID NO:160),
[0736] Antonym chain: VP-UmsUfsAmUmTdAmAdGmAmAmAmGmUmAfUmAfAmGmCmsCmsAm(SEQ ID NO:161);
[0737] INHBE251-E18 truncated - aTd:
[0738] Significant chain: GmsCmsUmUmAmUmAfCdUfUmUmCmUmUmAmAmUmsAmsAm(SEQ ID NO:162),
[0739] Antonym chain: VP-UmsUfsAmUmTdAmAdGmAmAmAmGmUmAfUmAfAmGmCmsCmsTd (SEQ ID NO:163);
[0740] INHBE252-E18 truncated -aTdTd:
[0741] Significant chain: GmsCmsUmUmAmUmAfCdUfUmUmCmUmUmAmAmUmsAmsAm(SEQ ID NO:164),
[0742] Antonym chain: VP-UmsUfsAmUmTdAmAdGmAmAmAmGmUmAfUmAfAmGmCmsTdsTd(SEQ ID NO:165);
[0743] INHBE253-E18 truncated -aTdTd:
[0744] Significant chain: GmsGmsCmUmUmAmUfAdCfUmUmUmCmUmUmAmAmsUmsAm(SEQ ID NO:166),
[0745] Antonym chain: VP-UmsAfsUmUmAdAmGdAmAmAmGmUmAmUfAmAfGmCmCmsTdsTd(SEQ ID NO:167);
[0746] INHBE253-E20 truncated -aTdTd:
[0747] Significant chain: GmsGmsCmUmUfAmUfAfCfUfUmUmCmUmUmAmAmsUmsAm (SEQ ID NO:168),
[0748] Antonym chain: VP-UmsAfsUmUmAmAmGmAmAmAmGmUmAmUfAmAfGmCmCmsTdsTd (SEQ ID NO:169).
[0749] Table 31
[0750] m indicates that the nucleotide it contains is a ribonucleotide modified with 2′-O-methyl; f indicates that the nucleotide it contains is a ribonucleotide modified with 2′-fluoro; d indicates that the nucleotide it contains is modified with 2′-deoxy; when Nd corresponds to U in the base sequence, it represents Td, i.e., deoxythymidine nucleotide; s indicates that the nucleotide it contains is connected to the nucleotide adjacent to its 3′ end via a phosphate thioester bond; in sTd or aTd, “s” or “a” represents “sense strand (s)” or “antisense strand (a)”, Td represents terminal deoxy modification, and the number of Td indicates the number of deoxy modified nucleotides.
[0751] The final concentrations for dsRNA molecular assays were selected as 5, 1, and 0.1 nM.
[0752] A control molecule was also established, which is the AC004285 molecule (referred to as allow-IN in this application) as described in WO 2025 / 049773A1, and its structure is as follows:
[0753] The sense chain (NAG37)s(invAb)sCmUmGmGmCmUmUmAmUfAmCfUfUmUmCmUmUmAmAmUmAms(invAb)(SEQ ID NO:170)
[0754] antisense chain:
[0755] UmsAfsUmUmAfAmGmAmAmAmGmUfAmUfAmAfGmCmCmAmssGm (SEQ ID NO: 171);
[0756] Where “ss” represents a dithiophosphate bond;
[0757] The chemical structure of (NAG37)s is shown below:
[0758] The chemical structure of (invAb)s is shown below, in which... Indicates linkage with nucleotides:
[0759] The chemical structure of s(invAb) is shown below, and the structure contains... This indicates that it is linked to the 3' position of the nucleotide via a phosphate thioester bond:
[0760] HepG2 cells transfected with INHBE dsRNA
[0761] HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2 incubator at 37°C. After cell digestion, the cell density was adjusted to 4 × 10⁶ cells / year. 5 Seed cells at a density of 1 ml / well in 12-well plates. Prepare a 100 μl transfection complex: Mix 45 μL Opti-MEM with 5 μL of dsRNA (test molecule or Yangshen allo w-IN) at different concentrations, and mix 48 μL Opti-MEM with 2 μL RNAiMax transfection reagent. Let stand for 5 min, then mix the two mixtures together and let stand for 20 min to form the transfection complex. Add the transfection complex to the 12-well plates and incubate for 24 h in a 5% CO2, 37°C incubator.
[0762] In each cell transfection test, in addition to the experimental group, a control group (NC) was also set up (the seeding and testing procedures were exactly the same as the control group, but without dsRNA).
[0763] Real-time quantitative PCR analysis
[0764] Cells were lysed 24 hours after transfection, and total RNA was extracted using the Novizan FastPure Cell / Tissue Total RNA Isolation Kit V2 (refer to Novizan RC112-01 manual). The RNA was reverse transcribed into cDNA using Takara PrimeScript RT Master Mix RR036Q. Human GAPDH was used as an internal control gene, and PCR was performed using a Bio-Rad CFX96 real-time PCR instrument. The NC group (blank PBS group) was used as a control for normalization, ensuring that the INHBE mRNA expression level in the NC group was 1.
[0765] 2.3 Data Analysis
[0766] After the PCR reaction, relative quantification was performed using the reference gene as a standard and CFX96 software, followed by statistical analysis using GarphPad software to detect the inhibitory efficiency of the dsRNA on the target mRNA (INHBE). The results are shown in Table 32.
[0767] Table 32: Relative expression levels of INHBE mRNA
[0768] Based on the data, the dsRNA molecules obtained through various E18 or E20 truncated modified motifs of this application exhibit superior or similar inhibitory activity against INHBE compared to *Codonopsis pilosula*.
[0769] Example 12 Dual-target dsRNA molecular assay
[0770] This embodiment tested the effects of a dual-target dsRNA molecule. The selected exemplary dual targets were vascular endothelial growth factor A (VEGF-A) and angiopoietin-2 (Ang-2). In the pathogenesis of wet age-related macular degeneration (wet AMD) and diabetic macular edema (DME), abnormally elevated VEGF-A levels on vascular endothelial cells promote angiogenesis, while elevated Ang-2 levels on pericytes lead to vascular leakage. Therefore, simultaneous inhibition of both genes by dual targets has medical significance.
[0771] The VEGF-A / Ang-2 dual-target dsRNA molecule in this embodiment is essentially composed of two single-target dsRNA molecules that target VEGF-A and Ang-2 respectively. The sense strands of the two single-target dsRNA molecules are connected by a linker to form a sense strand. The antisense strands of the two single-target dsRNA molecules are synthesized separately and bind to their respective sense strands during the annealing process.
[0772] The base sequence of an exemplary VEGF-A / Ang-2 dual-target dsRNA molecule (referred to as "VA4" in this application) is as follows:
[0773] There is a sense chain (VEGF-A-TdU(hdt)Td-Ang-2):
[0774]
[0775] Antisense chain 1 (VEGF-A):
[0776] Antisense chain 2 (Ang-2):
[0777] Based on the base sequence of VA4 mentioned above, VA4 was modified in three ways according to the modification methods shown in Table 33, resulting in three modified dsRNA molecules: VA4-17, VA4-18, and VA4-20.
[0778] Table 33
[0779] m indicates that the nucleotide it contains is a ribonucleotide modified with 2′-O-methyl; f indicates that the nucleotide it contains is a ribonucleotide modified with 2′-fluoro; d indicates that the nucleotide it contains is modified with 2′-deoxy; when Nd corresponds to U in the base sequence, it represents Td, i.e., deoxythymidine nucleotide; s indicates that the nucleotides on both sides are linked by phosphate thioester bonds. The sense strands of VEGF-A dsRNA are linked by phosphate thioester bonds between the first and third nucleotides at the 5' end, and the sense strands of Ang-2 dsRNA are linked by phosphate thioester bonds between the first and third nucleotides at the 3' end. VEGF-A dsRNA and ang-2 dsRNA are linked by phosphate thioester bonds to the adjacent ends of the linkers (i.e., between the first and third nucleotides at the 3' end of the sense strand of VEGF-A dsRNA and between the first and third nucleotides at the 5' end of the sense strand of Ang-2 dsRNA). The antisense strands of VEGF-A dsRNA and ang-2 dsRNA are linked by phosphate thioester bonds between the first and third nucleotides at the 3' end and between the first and third nucleotides at the 5' end.
[0780] This embodiment uses a rabbit retinal neovascularization and leakage (RNV) model induced by DL-AAA to verify the effects of VA4-17, VA4-18, and VA4-20. DL-AAA is a selective glial cytotoxic agent that irreversibly damages Müller cells after intravitreal injection, leading to disruption of the retinal vascular barrier function. Stable retinal angiogenesis and leakage are formed 8-10 weeks after model induction.
[0781] Specifically, male Dutch rabbits, weighing 1.3-2.5 kg, were used. One rabbit was placed in a stainless steel cage (900mm×600mm×500mm). The room for the rabbits was well-ventilated with a filtration system, providing 10-20 air changes per hour. The temperature was maintained between 16-26℃, and the relative humidity between 40-70%. Lighting consisted of 12 hours of fluorescent illumination and 12 hours of no illumination per day. Two to four months after DL-α-aminoadipic acid (DL-AAA) intravitreal injection to induce retinal modeling, retinal angiogenesis and leakage were assessed using FFA before administration. Sufficient successfully modeled eyes without severe inflammation or hemorrhage were selected for the study. The leakage fluorescence area before administration was used as the baseline. The leakage inhibition rate was calculated as (baseline leakage area - leakage area at time T) / baseline leakage area * 100%. The administration grouping and regimen are shown in Table 34. Aflibercept intravitreal injection solution Eylea was used as a positive control.
[0782] Table 34. Dosing Regimen
[0783] The experimental results are shown in Figure 10 and Table 35. Figure 10 shows the leakage area size of each group at each time point, and Table 35 shows the inhibition rate of leakage area of each group relative to the baseline before administration, calculated based on the leakage area size at each time point. VA4-17, VA4-18, and VA4-20 showed different efficacy in the leakage area statistics of the disease model at D14, D28, D42, and D54 after administration. Based on comprehensive data evaluation, the long-term effects of VA4-17, VA4-18, and VA4-20 are all superior to those of the Yangshen drug Eylea.
[0784] Table 35. Results of leakage area inhibition rate for each group
[0785] Table 36. Exemplary dsRNA molecules of this application
[0786] The above description is merely a preferred embodiment, which is only an example and does not limit the combination of features necessary for carrying out this application. The headings provided are not intended to limit the various embodiments of this application. Terms such as “comprising,” “including,” and “comprise” are not intended to be limiting. Furthermore, unless otherwise stated, plural forms are included when not modified by a numeral, and “or,” “or” means “and / or.” Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All disclosures and patents mentioned in this application are incorporated herein by reference. Various modifications and variations of the methods and compositions described in this application will be apparent to one of ordinary skill in the art without departing from the scope and spirit of this application. While this application has been described by way of specific preferred embodiments, it should be understood that the claimed application should not be unduly limited to these specific embodiments. In fact, various variations of the described modes for carrying out this application that are obvious to one of ordinary skill in the art are intended to be included within the scope of the appended items.
Claims
1. A double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof for inhibiting the expression of a target gene via RNAi, said double-stranded RNA molecule comprising a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, said antisense strand comprising a sequence that is completely complementary to a portion of the mRNA sequence of said target gene or comprises a sequence that is 1, 2 or 3 bases away from complete complementarity to a portion of the mRNA sequence of said target gene, said double-stranded region being 15-25 nt in length, said dsRNA molecule comprising a sense strand and an antisense strand as described in any one of (1) to (4): (1) The sense strand contains 19 consecutive nucleotides with the following structure: NmNmNmNmNmNmNXNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (2) The sense strand contains at least 19 consecutive nucleotides having the following structure: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (3) The sense strand contains 19 consecutive nucleotides with the following structure: NmNmNmNmNmN*NXNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (4) The sense strand contains 19 consecutive nucleotides with the following structure: NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides having the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; in, The sense or antisense strand structure defined in any of (1)-(4) above is oriented from 5' to 3' from left to right, NX is an unmodified ribonucleotide, an unmodified deoxyribonucleotide, a 2'-O-methoxy-ethyl (2'-MOE) modified ribonucleotide, a 2'-O-methyl modified ribonucleotide, or a 2'-fluoro modified ribonucleotide, N* is a ribonucleotide with a lipophilic moiety attached at the 2' position, and Nm represents a 2'-O-methyl modified ribonucleotide. The ribonucleotide, Nf represents a ribonucleotide modified with 2'-fluorination, and Nd represents a ribonucleotide modified with deoxyribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G or C, Nd represents a deoxyribonucleotide with the base part of A, G or C (i.e., Ad, Gd or Cd). When the base part of N in Nd is U, Nd represents deoxythymidine nucleotide (i.e., Td).
2. The dsRNA molecule of claim 1 or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, wherein for any one of (1)-(4), the 3' end nucleotide of the 19 consecutive nucleotides of the structure contained in the sense strand is the 3' end nucleotide of the sense strand, and the 5' end nucleotide of the 21 consecutive nucleotides of the structure contained in the antisense strand is the 5' end nucleotide of the antisense strand.
3. The dsRNA molecule of claim 1 or 2 or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, wherein the NX is a 2'-O-methyl modified ribonucleotide or a 2'-fluoro modified ribonucleotide.
4. The dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt according to any one of claims 1-3, wherein N* is a ribonucleotide modified with 2'-O-C16, 2'-S-C16, 2'-O-C22 or 2'-S-C22.
5. The dsRNA molecule according to any one of claims 1-4, or a stereoisomer, solvate, isotope derivative, or pharmaceutically acceptable salt thereof, wherein the dsRNA molecule comprises a sense strand and an antisense strand as described in any one of (5) to (22): (5) The sense strand contains 21 consecutive nucleotides with the following structure: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (6) The sense strand contains 21 consecutive nucleotides with the following structure: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (7) The sense strand contains 21 consecutive nucleotides with the following structure: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (8) The sense strand contains 21 consecutive nucleotides with the following structure: NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (9) The sense strand contains 21 consecutive nucleotides with the following structure: NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (10) The sense strand contains 21 consecutive nucleotides having the following structure: NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (11) The sense strand contains 19 consecutive nucleotides with the following structure: NmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (12) The sense strand contains 19 consecutive nucleotides with the following structure: NmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (13) The sense strand contains 19 consecutive nucleotides having the following structure: NmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNm; (14) The sense strand contains 19 consecutive nucleotides with the following structure: NmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (15) The sense strand contains 19 consecutive nucleotides having the following structure: NmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (16) The sense strand contains 19 consecutive nucleotides having the following structure: NmNmNmN*NfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (17) The sense strand contains 21 consecutive nucleotides having the following structure: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (18) The sense strand contains 21 consecutive nucleotides having the following structure: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (19) The sense strand contains 21 consecutive nucleotides having the following structure: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (20) The sense strand contains 21 consecutive nucleotides having the following structure: NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (21) The sense strand contains 21 consecutive nucleotides having the following structure: NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (22) The sense strand contains 21 consecutive nucleotides with the following structure: NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 21 consecutive nucleotides with the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm.
6. The dsRNA molecule of claim 5 or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, wherein for any one of (5)-(22), the 3' end nucleotide of the 19 consecutive nucleotides of the structure contained in the sense strand is the 3' end nucleotide of the sense strand, and the 5' end nucleotide of the 21 consecutive nucleotides of the structure contained in the antisense strand is the 5' end nucleotide of the antisense strand.
7. The dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt according to any one of claims 1-6, wherein the sense strand is 19-21 nt long and the antisense strand is 21-23 nt long.
8. The dsRNA molecule according to any one of claims 1-7, or its stereoisomer, solvate, isotopic derivative, or pharmaceutically acceptable salt thereof, wherein: The sense chain is 21nt long and the antisense chain is 23nt long, or The sense chain is 19nt long and the antisense chain is 21nt long, or The sense chain is 21nt long and the antisense chain is 21nt long, or The length of the sense chain is 23nt and the length of the antisense chain is 23nt.
9. The dsRNA molecule according to any one of claims 1-8, or a stereoisomer, solvate, isotope derivative, or pharmaceutically acceptable salt thereof, wherein the dsRNA molecule comprises a sense strand and an antisense strand as described in any one of (23) to (40): (23) The sense chain is 21nt long and has the following structure: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 23nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (24) The sense chain is 21nt long and has the following structure: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 23nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (25) The sense chain is 21nt long and has the following structure: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 23nt long and has the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (26) The sense chain is 21nt long and has the following structure: NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 23nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (27) The sense chain is 21nt long and has the following structure: NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 23nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (28) A sense chain of 21nt length has the following structure: NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 23nt long and has the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (29) The sense chain is 19nt long and has the following structure: NmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (30) The sense chain is 19nt long and has the following structure: NmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (31) The sense chain is 19nt long and has the following structure: NmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNm; (32) The sense chain is 19nt long and has the following structure: NmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (33) The sense chain is 19nt long and has the following structure: NmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (34) The sense chain is 19nt long and has the following structure: NmNmNmN*NfNmNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (35) The sense chain is 21nt long and has the following structure: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (36) The sense chain is 21nt long and has the following structure: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (37) The sense chain is 21nt long and has the following structure: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (38) The sense chain is 21nt long and has the following structure: NmNmNmNmNmN*NfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (39) The sense chain is 21nt long and has the following structure: NmNmNmNmNmN*NmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNm; (40) The sense chain is 21nt long and has the following structure: NmNmNmNmNmN*NfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and The antisense chain is 21 nt long and has the following structure: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNm.
10. The dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt according to any one of claims 1-9, wherein one or more pairs of adjacent nucleotides in each of the sense strand and antisense strand of the dsRNA molecule are linked by a phosphate thioester. Preferably, the first and second nucleotides from the 5' end of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides from the 5' end of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the first and second nucleotides from the 3' end of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides from the 3' end of the sense strand of the dsRNA molecule are linked by a phosphate thioester. And / or the first and second nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the first and second nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester; More preferably, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester.
11. The dsRNA molecule according to any one of claims 1-10, or a stereoisomer, solvate, isotope derivative, or pharmaceutically acceptable salt thereof, wherein the dsRNA molecule comprises a sense strand and an antisense strand as described in any one of (41) to (52): (41) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmsNmsNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (42) The sense strand contains 21 consecutive nucleotides with the following structure: NmsNmsNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmsNmsNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (43) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmsNmsNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (44) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (45) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmsNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (46) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNmNm, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (47) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmsNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNms, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (48) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmsNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNms, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (49) The sense strand contains 21 consecutive nucleotides with the following structure: NmsNmsNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNms, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (50) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmsNms, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (51) The sense strand contains 21 consecutive nucleotides having the following structure: NmsNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmsNms, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (52) The sense strand contains 21 consecutive nucleotides with the following structure: NmsNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmsNms, and The antisense strand contains 23 consecutive nucleotides with the following structure: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; in, The sense or antisense strand structure defined in any of (41)-(52) above, s indicates that the adjacent nucleotides before and after s are linked by a phosphate thioester.
12. The dsRNA molecule or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts according to any one of claims 1-11, wherein one or more nucleotides in the sense strand and / or antisense strand of the dsRNA molecule are linked to one or more ligands (e.g., targeting ligands), optionally, the one or more ligands are designed to perform one or more of the following functions: improving the efficiency of dsRNA molecule uptake by cells carrying the target gene, improving tissue / cell type / organelle targeting, increasing half-life, improving metabolic or kinetic properties.
13. The dsRNA molecule of claim 12 or its stereoisomers, solvates, isotopic derivatives or pharmaceutically acceptable salts thereof, wherein the 3' terminal nucleotide of the sense strand is linked to the ligand, or the 5' terminal nucleotide of the sense strand is linked to the ligand, or both the 5' terminal nucleotide and the 3' terminal nucleotide of the sense strand are linked to (the same or different) ligands. Optionally, the 5' terminal nucleotide and / or 3' terminal nucleotide of the sense strand are linked to the ligand via a phosphate thioester bond.
14. The dsRNA molecule of any one of claims 1-13 or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts thereof, wherein the 5' terminal nucleotides of the sense strand and / or antisense strand are linked to a 5'-phosphate mimic, such as vinylphosphonate (VP). Optionally, the 5' terminal nucleotide of the antisense strand is linked to the 5'-phosphate mimic.
15. An engineered nucleic acid molecule comprising one or more dsRNA molecules according to any one of claims 1-14 and one or more additional nucleotides or chemical groups.
16. The engineered nucleic acid molecule of claim 15, wherein the engineered nucleic acid molecule has a hairpin structure, and the 3' end of the sense strand of the dsRNA molecule is connected to the 5' end of the antisense strand by a chemical bond or a linker, wherein the linker is composed of the one or more additional nucleotides or the linker is the chemical group.
17. The engineered nucleic acid molecule of claim 15, comprising two or more dsRNA molecules of any one of claims 1-14 linked by one or more nucleotides and / or chemical groups; Optionally, the two or more dsRNA molecules are designed to inhibit the expression of different target genes or target different mRNA regions of the same target gene via RNAi.
18. A nucleic acid molecule that can be transcribed in a cell into a dsRNA molecule or a precursor thereof according to any one of claims 1-14.
19. A delivery body comprising a nucleic acid molecule according to claim 18, optionally, said delivery body being a virus, plasmid, or liposome.
20. A cell comprising a nucleic acid molecule according to claim 18.
21. A pharmaceutical composition comprising a dsRNA molecule or a stereoisomer thereof, a solvate, an isotope derivative or a pharmaceutically acceptable salt according to any one of claims 1 to 14, an engineered nucleic acid molecule according to any one of claims 15 to 17, a nucleic acid molecule according to claim 18, a delivery system according to claim 19 or a cell according to claim 20, and a pharmaceutically acceptable carrier.
22. A double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt thereof that inhibits lipoprotein A (Lp(a)) gene expression via RNAi, said double-stranded RNA molecule comprising a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, said sense strand having the base sequence shown in SEQ ID NO:1, said antisense strand having the base sequence shown in SEQ ID NO:2, and said dsRNA molecule having the structures of the sense strand and antisense strand as described in any one of (a) to (c): (a) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (b) A meaningful chain contains a structure with the following: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (c) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; in, The sense or antisense strand structures defined in any of (a)-(c) above are oriented from 5' to 3' from left to right. Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
23. The dsRNA molecule of claim 22 or its stereoisomers, solvates, isotopic derivatives, or pharmaceutically acceptable salts thereof, wherein the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the third nucleotide of the sense strand of the dsRNA molecule is ... The 2nd and 3rd nucleotides from the 5' end are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester; Preferably, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester.
24. The dsRNA molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt according to any one of claims 22-23, wherein: The sense chain has the structure shown in SEQ ID NO:106, and the antisense chain has the structure shown in SEQ ID NO:107; or The sense chain has the structure shown in SEQ ID NO:108, and the antisense chain has the structure shown in SEQ ID NO:107; or The sense chain has the structure shown in SEQ ID NO:109, and the antisense chain has the structure shown in SEQ ID NO:
110.
25. The dsRNA molecule of any one of claims 22-24 or a stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, wherein the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes. Optionally, the ligand is a GalNac derivative or a GalNac polymer; For example, the ligand has the structure shown in Formula I or Formula II: in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
26. The dsRNA molecule of any one of claims 22-25 or a stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
27. A pharmaceutical composition comprising a dsRNA molecule or a stereoisomer thereof, a solvate, an isotope derivative or a pharmaceutically acceptable salt according to any one of claims 22 to 26, and a pharmaceutically acceptable carrier.
28. The pharmaceutical composition of claim 27 for the prevention and / or treatment of a condition, pathology, or syndrome associated with elevated levels of Lp(a) particles; Optionally, the diseases associated with elevated Lp(a) particle levels are selected from one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic stenosis.
29. Use of the dsRNA molecule of any one of claims 22 to 26 or its stereoisomers, solvates, isotopic derivatives or pharmaceutically acceptable salts in the preparation of a medicament for the prevention and / or treatment of a condition, pathology or syndrome associated with elevated levels of Lp(a) particles; Optionally, the diseases associated with elevated Lp(a) particle levels are selected from one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic stenosis.
30. A method for preventing and / or treating a condition, pathology, or syndrome in a subject associated with elevated levels of Lp(a) particles, the method comprising administering to a subject in need a therapeutically or preventively effective amount of a dsRNA molecule or stereoisomer thereof, solvate, isotope derivative, or pharmaceutically acceptable salt of any of claims 22 to 26, or a pharmaceutical composition of claim 27. Optionally, the diseases associated with elevated Lp(a) particle levels are selected from one or more of the following: stroke, atherosclerosis, thrombosis, cardiovascular disease, and aortic stenosis.
31. A double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, the base sequence of the sense strand being as shown in SEQ ID NO:91, the base sequence of the antisense strand being as shown in SEQ ID NO:92, and the structures of the sense strand and antisense strand of the dsRNA molecule being as described in any one of (a) to (c): (a) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (b) A meaningful chain contains a structure with the following: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (c) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; in, The sense or antisense strand structures defined in any of (a)-(c) above are oriented from 5' to 3' from left to right. Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
32. The dsRNA molecule of claim 31 or its stereoisomers, solvates, isotopic derivatives, or pharmaceutically acceptable salts thereof, wherein the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the third nucleotide of the sense strand of the dsRNA molecule is ... The 2nd and 3rd nucleotides from the 5' end are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester; Preferably, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester.
33. The dsRNA molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt according to any one of claims 31-32, wherein: The sense chain has the structure shown in SEQ ID NO:111, and the antisense chain has the structure shown in SEQ ID NO:112; or The sense chain has the structure shown in SEQ ID NO:113, and the antisense chain has the structure shown in SEQ ID NO:112; or The sense chain has the structure shown in SEQ ID NO:114, and the antisense chain has the structure shown in SEQ ID NO:
115.
34. The dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt according to any one of claims 31-33, wherein the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes. Optionally, the ligand is a GalNac derivative or a GalNac polymer; For example, the ligand has the structure shown in Formula I or Formula II: in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
35. The dsRNA molecule of any one of claims 31-34 or a stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
36. A pharmaceutical composition comprising a dsRNA molecule or a stereoisomer thereof, a solvate, an isotope derivative or a pharmaceutically acceptable salt according to any one of claims 31 to 35, and a pharmaceutically acceptable carrier.
37. The pharmaceutical composition according to claim 36 for the prevention and / or treatment of diseases mediated by PCSK9 expression; Optionally, the disease includes cardiovascular disease or oncological disease, wherein the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia, and the oncological disease is selected from PCSK9-related melanoma or metastatic liver cancer.
38. Use of the dsRNA molecule of any one of claims 31 to 35 or its stereoisomers, solvates, isotopic derivatives or pharmaceutically acceptable salts in the preparation of a medicament for the prevention and / or treatment of diseases mediated by PCSK9 expression; Optionally, the disease includes cardiovascular disease or oncological disease, wherein the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia, and the oncological disease is selected from PCSK9-related melanoma or metastatic liver cancer.
39. A method for preventing and / or treating a PCSK9-mediated disease in a subject, the method comprising administering to a subject in need a therapeutically or preventively effective amount of a dsRNA molecule or stereoisomer thereof, solvate, isotope derivative or pharmaceutically acceptable salt or pharmaceutical composition of claim 36 according to any one of claims 31 to 35. The diseases include cardiovascular diseases or neoplastic diseases, wherein the cardiovascular diseases are selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia, and the neoplastic diseases are selected from PCSK9-related melanoma or metastatic liver cancer.
40. A double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt thereof that inhibits the expression of the angiopoietin-like protein 3 (ANGPTL3) gene via RNAi, said double-stranded RNA molecule comprising a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, said sense strand having the base sequence shown in SEQ ID NO:93, said antisense strand having the base sequence shown in SEQ ID NO:94, and said dsRNA molecule having the structures of the sense strand and antisense strand as described in any one of (a) to (c): (a) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (b) A meaningful chain contains a structure with the following: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (c) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; in, The sense or antisense strand structures defined in any of (a)-(c) above are oriented from 5' to 3' from left to right. Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
41. The dsRNA molecule of claim 40, or its stereoisomers, solvates, isotopic derivatives, or pharmaceutically acceptable salts thereof, wherein the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the third nucleotide of the sense strand of the dsRNA molecule is ... The 2nd and 3rd nucleotides from the 5' end are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester; Preferably, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester.
42. The dsRNA molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt according to any one of claims 40-41, wherein: The sense chain has the structure shown in SEQ ID NO:116, and the antisense chain has the structure shown in SEQ ID NO:117; or The sense chain has the structure shown in SEQ ID NO:118, and the antisense chain has the structure shown in SEQ ID NO:117; or The sense chain has the structure shown in SEQ ID NO:119, and the antisense chain has the structure shown in SEQ ID NO:
120.
43. The dsRNA molecule of any one of claims 40-42 or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts thereof, wherein the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes. Optionally, the ligand is a GalNac derivative or a GalNac polymer; For example, the ligand has the structure shown in Formula I or Formula II: in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
44. The dsRNA molecule of any one of claims 40-43 or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts thereof, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
45. A pharmaceutical composition comprising a dsRNA molecule or a stereoisomer thereof, a solvate, an isotope derivative or a pharmaceutically acceptable salt according to any one of claims 40 to 44, and a pharmaceutically acceptable carrier.
46. The pharmaceutical composition according to claim 45, used for the prevention and / or treatment of dyslipidemia and / or cardiovascular disease; Optionally, the dyslipidemia and / or cardiovascular disease is selected from hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis, homozygous and heterozygous familial hypercholesterolemia, and statin-resistant hypercholesterolemia.
47. Use of the dsRNA molecule of any one of claims 40 to 44 or its stereoisomers, solvates, isotopic derivatives or pharmaceutically acceptable salts in the preparation of a medicament for the prevention and / or treatment of dyslipidemia and / or cardiovascular disease; Optionally, the dyslipidemia and / or cardiovascular disease is selected from hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis, homozygous and heterozygous familial hypercholesterolemia, and statin-resistant hypercholesterolemia.
48. A method for preventing and / or treating dyslipidemia and / or cardiovascular disease in a subject, the method comprising administering to a subject in need a therapeutically or preventively effective amount of a dsRNA molecule or stereoisomer thereof, solvate, isotope derivative or pharmaceutically acceptable salt or pharmaceutical composition of claim 45 according to any one of claims 40 to 44. Optionally, the dyslipidemia and / or cardiovascular disease is selected from hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis, homozygous and heterozygous familial hypercholesterolemia, and statin-resistant hypercholesterolemia.
49. A double-stranded RNA (dsRNA) molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof that inhibits coagulation factor XI (FXI) gene expression via RNAi, said double-stranded RNA molecule comprising a sense strand and an antisense strand capable of complementing each other to form a double-stranded region, said sense strand having the base sequence shown in SEQ ID NO:95, said antisense strand having the base sequence shown in SEQ ID NO:96, and said dsRNA molecule having the structures of the sense strand and antisense strand as described in any one of (a) to (c): (a) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (b) A meaningful chain contains a structure with the following: NmNmNmNmNmNmNmNmNmNfNdNfNmNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNdNmNdNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; (c) A sense chain contains a structure with the following: NmNmNmNmNmNmNfNmNfNfNfNfNfNmNmNmNmNmNmNmNmNmNm, and Antisense chains contain structures with the following features: NmNfNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmNmNmNm; in, The sense or antisense strand structures defined in any of (a)-(c) above are oriented from 5' to 3' from left to right. Nm represents a ribonucleotide modified with 2'-O-methyl, Nf represents a ribonucleotide modified with 2'-fluoro, and Nd represents a deoxy-modified ribonucleotide (i.e., the deoxyribonucleotide corresponding to the ribonucleotide). When the base part of N in Nd is A, G, or C, Nd represents a deoxyribonucleotide with the base part of A, G, or C (i.e., Ad, Gd, or Cd). When the base part of N in Nd is U, Nd represents a deoxythymidine nucleotide (i.e., Td).
50. The dsRNA molecule of claim 49 or its stereoisomers, solvates, isotopic derivatives, or pharmaceutically acceptable salts thereof, wherein the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the second and third nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the first and second nucleotides of the sense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the third nucleotide of the sense strand of the dsRNA molecule is ... The 2nd and 3rd nucleotides from the 5' end are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 5' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 1st and 2nd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, and / or the 2nd and 3rd nucleotides from the 3' end of the antisense strand of the dsRNA molecule are linked by a phosphate thioester; Preferably, the first and second nucleotides of the antisense strand of the dsRNA molecule are linked by a phosphate thioester, starting from the 5' end, and the first and second nucleotides of the antisense strand are linked by a phosphate thioester.
51. The dsRNA molecule or its stereoisomer, solvate, isotopic derivative or pharmaceutically acceptable salt according to any one of claims 49-50, wherein: The sense chain has the structure shown in SEQ ID NO:121, and the antisense chain has the structure shown in SEQ ID NO:122; or The sense chain has the structure shown in SEQ ID NO:123, and the antisense chain has the structure shown in SEQ ID NO:122; or The sense chain has the structure shown in SEQ ID NO:124, and the antisense chain has the structure shown in SEQ ID NO:
125.
52. The dsRNA molecule of any one of claims 49-51 or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts thereof, wherein the 3' terminal nucleotide of the sense strand is linked to a ligand designed to improve the uptake efficiency of the dsRNA molecule by hepatocytes. Optionally, the ligand is a GalNac derivative or a GalNac polymer; For example, the ligand has the structure shown in Formula I or Formula II: in This indicates a connection to the 3' end of the sense strand of the dsRNA molecule (optionally, via a thiophosphate bond or a phosphate bond).
53. The dsRNA molecule of any one of claims 49-52 or its stereoisomers, solvates, isotope derivatives or pharmaceutically acceptable salts thereof, wherein the 5' terminal nucleotide of the antisense strand is linked to a 5'-phosphate mimic, such as vinylphosphonate (VP).
54. A pharmaceutical composition comprising a dsRNA molecule or a stereoisomer thereof, a solvate, an isotope derivative or a pharmaceutically acceptable salt according to any one of claims 49 to 53, and a pharmaceutically acceptable carrier.
55. The pharmaceutical composition according to claim 54, used for the prevention and / or treatment of thromboembolic complications or coagulation disorders; Optionally, the thromboembolic complication is preferably one or more of deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
56. Use of the dsRNA molecule or its stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt according to any one of claims 49 to 53 in the preparation of a medicament for the prevention and / or treatment of thromboembolic complications or coagulation disorders; Optionally, the thromboembolic complication is preferably one or more of deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
57. A method for preventing and / or treating thromboembolic complications or coagulation disorders in a subject, the method comprising administering to a subject in need a therapeutic or preventatively effective amount of the dsRNA molecule or stereoisomer thereof, solvate, isotope derivative or pharmaceutically acceptable salt or pharmaceutical composition of claim 54, according to any one of claims 49 to 53. Optionally, the thromboembolic complication is preferably one or more of deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.