Recombinant HPV16 e6e7 adenovirus, vaccine thereof, method for preparing same, and use thereof
Patent Information
- Application Number
- PCT/CN2025/078481
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-02-21
- Publication Date
- 2026-08-27
Smart Images

Figure CN2025078481_27082026_PF_FP_ABST
Abstract
Description
Recombinant HPV16 E6E7 adenovirus and its vaccine, preparation method and application Technical Field
[0001] This invention belongs to the field of cancer immunotherapy technology, specifically involving recombinant HPV16 E6E7 adenovirus and its vaccine, preparation method and application. Background Technology
[0002] Human papillomavirus (HPV) is considered one of the most common sexually transmitted viruses, infecting the skin and mucous membranes. Currently, 15 types of high-risk HPV have been identified as being associated with the occurrence and development of cervical cancer, with HPV16 and HPV18 accounting for nearly 70% of cervical cancers. While the incidence of cervical cancer has declined dramatically due to widespread screening and prevention, the incidence of head and neck squamous cell carcinoma in the United States continues to rise and is projected to surpass that of cervical cancer. Notably, oropharyngeal squamous cell carcinoma, a specific type of head and neck squamous cell carcinoma, has been found to be associated with persistent infection with high-risk HPV. Furthermore, nearly 70% of oropharyngeal squamous cell carcinomas are caused by HPV, especially HPV16. In addition, approximately 90% of anal cancers are also caused by persistent infection with high-risk HPV types. Therefore, persistent high-risk HPV infection can lead to a variety of cancers, including head and neck squamous cell carcinoma, cervical cancer, and anal cancer, as well as less common vulvar cancer, penile cancer, and vaginal cancer.
[0003] Cancer immunotherapy aims to trigger a host immune response to fight tumor cells. Several immunotherapies have been developed to stimulate both innate and adaptive immunity within the tumor microenvironment. Among these, cytotoxic CD8... + T lymphocytes (CTLs) are considered the most effective killer cells. CTL activation primarily relies on antigen-presenting cells such as macrophages and dendritic cells, which present tumor-associated antigens to immature T cells in a process known as cross-presentation. Once activated, CTLs eliminate tumor cells by secreting cytokines such as interferon-γ (IFNγ) and tumor necrosis factor-α (TNFα) and releasing cytotoxic granules, thereby achieving the effects of preventing and treating tumors. Therefore, based on cancer immunotherapy, various types of tumor vaccines have been widely developed and are undergoing clinical trials.
[0004] Persistent HPV16 infection can cause high-grade intraepithelial neoplasia, which can then develop into tumors. HPV16 oncoproteins E6 and E7 play crucial roles in tumor development, progression, and metastasis. E6 and E7 trigger cancer by promoting cell proliferation, preventing apoptosis, enhancing cell migration, suppressing cellular immune responses, and disrupting cellular metabolic homeostasis.
[0005] It is evident that tumor vaccines targeting HPV16 E6E7, based on cancer immunotherapy, hold great potential for tumor prevention and treatment. Currently, Gardasil, Cervarix, and Gardasil-9 are all marketed HPV vaccines, demonstrating good efficacy in preventing HPV-induced tumors, especially cervical cancer. Therapeutic vaccines for HPV-induced tumors have been extensively developed, such as ADXS11-001, TA-HPV, and PRGN-2009. Although they are in various phases of clinical trials, none have yet been successfully marketed and widely used. Therefore, developing a safe, effective, and long-lasting HPV vaccine is of great significance for the prevention, treatment, and prognosis of HPV-induced tumors. Summary of the Invention
[0006] In order to develop more safe, effective and long-lasting HPV vaccines, this invention provides a recombinant HPV16 E6E7 adenovirus vaccine, its preparation method and application.
[0007] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows:
[0008] In a first aspect, the present invention provides a recombinant HPV16 E6E7 adenovirus, the expressed antigen of which contains the HPV16 E6E7 antigen sequence and the HR1 and HR2 segments of the SARS-CoV-2 virus.
[0009] Furthermore, the amino acid sequence of the HPV16 E6E7 antigen is as shown in SEQ ID No.1, or has more than 80% homology with SEQ ID No.1 and has the same or similar biological activities.
[0010] Furthermore, the nucleotide sequence of the HPV16 E6E7 antigen is shown in SEQ ID No. 2.
[0011] SEQ ID No. 1: Amino acid sequence of HPV16 E6E7 antigen
[0012] SEQ ID No. 2: Nucleotide sequence of HPV16 E6E7 antigen
[0013] Furthermore, the amino acid sequences of the HR1 and HR2 segments of the SARS-CoV-2 virus are as shown in SEQ ID No. 3, or have more than 80% homology with SEQ ID No. 3 and have the same or similar biological activities.
[0014] Furthermore, the nucleotide sequences of the HR1 and HR2 segments of the SARS-CoV-2 virus are shown in SEQ ID No. 4.
[0015] SEQ ID No. 3: Amino acid sequences of the HR1 and HR2 segments of the SARS-CoV-2 virus.
[0016] SEQ ID No. 4: Nucleotide sequences of the HR1 and HR2 segments of the SARS-CoV-2 virus.
[0017] Preferably, the amino acid sequence of the expression antigen of the recombinant HPV16 E6E7 adenovirus is shown in SEQ ID No. 5.
[0018] Preferably, the nucleotide sequence of the expression antigen of the recombinant HPV16 E6E7 adenovirus is shown in SEQ ID No. 6.
[0019] SEQ ID No. 5: Amino acid sequence of the recombinant HPV16 E6E7 adenovirus expression antigen of the present invention.
[0020] SEQ ID No. 6: Nucleotide sequence of the recombinant HPV16 E6E7 adenovirus expression antigen of the present invention.
[0021] Furthermore, the HPV16 E6E7 antigen forms a trimer structure with the HR1 and HR2 segments of the SARS-CoV-2 virus.
[0022] Secondly, the present invention provides an adenovirus vector containing the nucleic acid sequence of the expression antigen of the recombinant HPV16 E6E7 adenovirus.
[0023] Furthermore, the adenovirus vector is selected from human Ad5 vector, Ad35 vector, or Ad26 vector, or / and chimpanzee AdC68 vector, AdC7 vector, or ChAdOx1 vector.
[0024] Preferably, it is selected from human type 5 replication-defective adenovirus with combined deletions of E1 and E3.
[0025] Thirdly, the present invention provides a method for preparing the above-mentioned recombinant HPV16 E6E7 adenovirus, which includes the following steps: synthesizing the HPV16 E6E7-HR gene, constructing an adenovirus shuttle plasmid containing the HPV16 E6E7-HR gene using molecular cloning technology, co-transfecting the shuttle plasmid with the backbone plasmid of the AdMax adenovirus system into host cells to package the recombinant adenovirus, obtaining a replication-defective recombinant adenovirus, and then expanding culture and purifying it.
[0026] In the above preparation method:
[0027] Furthermore, the nucleotide sequence of the HPV16 E6E7-HR gene is shown in SEQ ID No. 6.
[0028] Furthermore, the adenovirus uses a vector selected from human Ad5 vector, Ad35 vector, or Ad26 vector, or / and chimpanzee AdC68 vector, AdC7 vector, or ChAdOx1 vector.
[0029] Preferably, it is selected from human type 5 replication-defective adenovirus with combined deletions of E1 and E3.
[0030] Furthermore, the shuttle plasmid is selected from at least one of pDC516, pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pShuttle, pShuttle-CMV, pCTAP-Shuttle series plasmids, pNTAP-Shuttle series plasmids, pAdTrack, pAdTrack-CMV, pacAd5 series plasmids, pHBAd series plasmids, or pXC1 plasmid.
[0031] Furthermore, the backbone plasmid is selected from at least one of pBHGfrtdelE13FLP, pBHGloxdelE13cre, pAdEasy-1, pAdEasy-2, pBHGE3i, or pBHGE10i.
[0032] Furthermore, the host cell is selected from at least one of HEK293, PER.C6, HeLa, A549, or HT-1080.
[0033] Fourthly, the present invention provides a recombinant HPV16 E6E7 adenovirus vaccine containing the aforementioned recombinant HPV16 E6E7 adenovirus or adenovirus vector.
[0034] Furthermore, the recombinant HPV16 E6E7 adenovirus vaccine is available in the form of an injection, nasal drops, spray, or inhaler.
[0035] Preferably, the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection, or intraperitoneal injection.
[0036] Fifthly, the present invention provides a pharmaceutical composition comprising the above-mentioned recombinant HPV16 E6E7 adenovirus, adenovirus vector or vaccine, and other antitumor drugs.
[0037] In a sixth aspect, the present invention provides a combination drug that administers, separately or simultaneously, the aforementioned recombinant HPV16 E6E7 adenovirus, adenovirus vector, or vaccine, along with other antitumor drugs.
[0038] Furthermore, the other antitumor drugs are selected from at least one of cisplatin, paclitaxel, carboplatin, topotecan, bevacizumab, cetuximab, pembrolizumab, nivolumab, medroxyprogesterone acetate, or 5-fluorouracil (5-FU).
[0039] Preferably, the other antitumor drugs are cisplatin and paclitaxel.
[0040] Furthermore, the dosage form of the pharmaceutical composition or combination of drugs is an injection, nasal drops, spray, or inhaler.
[0041] Preferably, the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection, or intraperitoneal injection.
[0042] In a sixth aspect, the present invention provides the use of the above-mentioned recombinant HPV16 E6E7 adenovirus, adenovirus vector, recombinant HPV16E6E7 adenovirus vaccine, pharmaceutical composition, or combination of drugs in the prevention and / or treatment of tumors caused by HPV infection.
[0043] Furthermore, the tumor includes at least one of cervical cancer, head and neck squamous cell carcinoma, anal cancer, vulvar cancer, vaginal cancer, or penile cancer.
[0044] Preferably, the head and neck squamous cell carcinoma includes oropharyngeal squamous cell carcinoma, hypopharyngeal squamous cell carcinoma, and laryngeal squamous cell carcinoma.
[0045] Beneficial Effects: This invention, based on the HPV16 E6E7 target, develops a recombinant HPV16 E6E7 adenovirus vaccine for the prevention and treatment of various tumors caused by HPV infection, including squamous cell carcinoma of the head and neck, cervical cancer, and anal cancer. The vaccine contains the HPV16 E6E7 antigen sequence and the HR1 and HR2 segments of the SARS-CoV-2 virus. Animal experiments have demonstrated that the recombinant HPV16 E6E7 adenovirus vaccine effectively activates the cellular immune response in mice, exhibiting good preventive and therapeutic effects in both the mEERL orthotopic tumor model and the TC-1 subcutaneous tumor model, significantly improving the survival rate of tumor-bearing mice. Furthermore, its combination with cisplatin / paclitaxel showed significant therapeutic effects in the TC-1 subcutaneous tumor treatment model. Therefore, the recombinant HPV16 E6E7 adenovirus vaccine of this invention provides a promising candidate vaccine for translational research on the treatment and prevention of HPV-induced tumors. Attached Figure Description
[0046] Figure 1 shows the tumor growth curves of the recombinant HPV16 E6E7 adenovirus vaccine (with HR) and the HPV16 E6E7 adenovirus vaccine (without HR) in Example 2.
[0047] Figure 2 shows the evaluation results of the cellular immune response induced by the recombinant HPV16 E6E7 adenovirus vaccine (containing HR) in Example 3; A) Peripheral blood mononuclear cells of mice immunized with the recombinant HPV16 E6E7 adenovirus group (containing HR), control group, and adenovirus empty vector group; B) Peripheral blood mononuclear cells of mice immunized with the E6 tetramer positive CD8+ cells; C) Peripheral blood mononuclear cells of mice immunized with the E7 tetramer positive CD8+ cells; D) Peripheral blood mononuclear cells of mice immunized with the E7 tetramer positive CD8+ cells; E) Peripheral blood mononuclear cells of mice immunized with the CD69+CD4+ cells; F) Peripheral blood mononuclear cells of mice immunized with the CD69+CD8+ cells.
[0048] Figure 3 shows the evaluation results of the cellular immune response induced by the recombinant HPV16 E6E7 adenovirus vaccine (containing HR) in Example 3; A) the proportion of central memory CD8+ cells in spleen cells of mice immunized with the recombinant HPV16 E6E7 adenovirus group (containing HR), control group, and adenovirus empty vector group; B) the proportion of effector memory CD8+ cells in spleen cells; C) the proportion of interferon-γ CD8+ cells secreting after stimulation with the E6 peptide library; D) the proportion of interferon-γ CD8+ cells secreting after stimulation with the E7 peptide library; E) the proportion of tumor necrosis factor α CD8+ cells secreting after stimulation with the E7 peptide library; F) statistical analysis of interferon-γ spot count.
[0049] Figure 4 shows an ELISPOT (Enzyme-Linked ImmunoSpot) assay image after stimulation with the E7 peptide library in Example 3.
[0050] Figure 5 shows the survival curve of the recombinant HPV16 E6E7 adenovirus vaccine (containing HR) in Example 4 in the mEERL in situ tumor treatment model.
[0051] Figure 6 shows the antitumor effect of the recombinant HPV16 E6E7 adenovirus vaccine (containing HR) in the TC-1 subcutaneous tumor treatment model in Example 5: control group, adenovirus empty group, and recombinant HPV16 E6E7 adenovirus group (containing HR) mice A) tumor growth curve; B) tumor weight; C) survival curve.
[0052] Figure 7 shows the antitumor effect of the recombinant HPV16 E6E7 adenovirus vaccine (containing HR) in Example 5 in the TC-1 subcutaneous tumor treatment model; A) Peripheral blood mononuclear cells E6 tetramer-positive CD8+ cells; B) Peripheral blood mononuclear cells E7 tetramer-positive CD8+ cells; C) Spleen cells E6 tetramer-positive CD8+ cells; D) Spleen cells E7 tetramer-positive CD8+ cells; E) Proportion of myeloid-derived immunosuppressive cells in tumor cells; F) Proportion of M2 macrophages in tumor cells.
[0053] Figure 8 shows the antitumor effect of the recombinant HPV16 E6E7 adenovirus vaccine (containing HR) in Example 6 in the TC-1 subcutaneous tumor prevention model: A) Tumor growth curve; B) Tumor weight; C) Survival curve; D) Tumor growth curve; E) Survival curve in the control group, the adenovirus empty vector group, and the recombinant HPV16 E6E7 adenovirus group (containing HR) in the TC-1 re-challenge tumor model.
[0054] Figure 9 shows the tumor growth curve of the recombinant HPV16 E6E7 adenovirus vaccine (containing HR) combined with cisplatin / paclitaxel in the TC-1 subcutaneous tumor treatment model in Example 7.
[0055] Figure 10 shows the specific sequence information of the HPV16 E6 and E7 peptide libraries.
[0056] Data are expressed as mean ± SEM. Statistical differences: *P≤0.05, **P≤0.01, ***P≤0.001 and ****P≤0.0001. Detailed Implementation
[0057] To make the technical problems, solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with the embodiments. Unless otherwise defined herein, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by those skilled in the art.
[0058] The terms “comprising,” “including,” “having,” “containing,” or “involving,” and their other variations herein, are inclusive or open-ended and do not exclude other elements or method steps not listed. Those skilled in the art will understand that the foregoing term “comprising” encompasses the meaning of “consisting of.”
[0059] In this invention, the terms "a," "an," "at least one," and "one or more" are used interchangeably. When a lower and upper limit of a numerical range is disclosed, any numerical value falling within that range and any included range are specifically disclosed. In particular, each range of values disclosed herein (in the form of "about a to b," or equivalently, "approximately a to b," or equivalently, "about ab") should be understood to represent each numerical value and range encompassed within a wider range.
[0060] The terms "HPV16 E6 and E7" refer to two key viral oncoproteins that play a central role in inducing cell carcinogenesis after HPV-16 infection. HPV-16 is a high-risk HPV type closely associated with the development of various cancers, including cervical cancer, head and neck squamous cell carcinoma, and anal cancer. E6 and E7 promote cell proliferation and inhibit apoptosis by interfering with the normal regulatory mechanisms of host cells, thereby leading to cancer development.
[0061] HPV16 E6 and E7 promote cell proliferation, inhibit apoptosis, and induce genomic instability by interfering with key tumor suppressor pathways such as p53 and pRb, ultimately leading to cancer. They are important targets in HPV-related cancer research and a breakthrough point for developing novel treatments.
[0062] The term "TC-1 cells" refers to lung epithelial cells from C57BL / 6 mice transformed with the HPV-16E6 and E7 oncogenes. These cells express HPV-16E6 and E7 proteins, both of which play important roles in the development of cervical cancer.
[0063] The term "mEERL cells" originates from oral epithelial cells of C57BL / 6 mice, transformed with the HPV-16E6 and E7 oncogenes. It is a cell line commonly used in head and neck cancer research, particularly HPV-associated squamous cell carcinoma of the head and neck.
[0064] The terms "cisplatin" and "paclitaxel" refer to two commonly used chemotherapy drugs. Cisplatin and paclitaxel work synergistically through different mechanisms of action to enhance their killing effect on cancer cells. They are widely used to treat a variety of cancers, including testicular cancer, ovarian cancer, bladder cancer, lung cancer, head and neck cancer, breast cancer, pancreatic cancer, and non-small cell lung cancer.
[0065] The following specific embodiments will be provided to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.
[0066] The main materials used in the following embodiments are as follows:
[0067] The E6 and E7 peptide libraries were synthesized by Wuhan Dangang Biotechnology Co., Ltd.; detailed information about the peptide libraries can be found in Figure 10.
[0068] mEERL cells were purchased from ABM, and TC-1 cells were purchased from Xiamen Yimo Biotechnology Co., Ltd.
[0069] C57BL / 6 mice (6-8 weeks old) were purchased from Beijing Vital River Laboratory Animal Science Co., Ltd. All animal experiments were conducted in accordance with the guidelines assessed and approved by the Ethics Committee of Sichuan University.
[0070] Example 1: Preparation of a recombinant HPV16 E6E7 adenovirus vaccine based on human type 5 replication-defective adenovirus with combined deletions of E1 and E3.
[0071] 1. Obtaining the HPV16 E6E7-HR gene
[0072] The HPV16 E6 stop codon was mutated to express E6 and E7 as a fusion protein. Amino acids 24 and 26 of the HPV16 E7 protein were mutated from C and E to G and G, respectively. The HR1 (916-966aa) and HR2 (1157-1203aa) regions of the SARS-CoV-2 S protein were added to the C-terminus of the E6-E7 fusion protein, resulting in a trimer structure and increased immunogenicity of the antigen. A signal peptide was added or omitted from the E6E7-HR fusion protein (amino acid sequence shown in SEQ ID No. 5) to express it as a secreted or intramembrane protein. The HPV16 E6E7-HR sequence (SEQ ID No. 5) was converted into a nucleotide sequence, and Suzhou Genewiz Technology Co., Ltd. was commissioned to optimize the humanization of the HPV16 E6E7-HR codons, resulting in the synthesis of the HPV16 E6E7-HR gene (nucleotide sequence shown in SEQ ID No. 6). HPV16 E6E7-HR was cloned into the adenovirus shuttle plasmid pDC516 using molecular cloning technology, resulting in the pDC516-E6E7-HR shuttle plasmid.
[0073] The HPV16 E6E7 gene was obtained in the same manner as described above, except that the E6E7 fusion protein (amino acid sequence as shown in SEQ ID No. 1) was directly codon-optimized without adding HR1 and HR2 of the SARS-CoV-2 virus S protein to its C-terminus. The nucleotide sequence of the HPV16 E6E7 gene is shown in SEQ ID No. 2. The HPV16 E6E7 gene was cloned into the adenovirus shuttle plasmid pDC516 using molecular cloning technology to obtain the pDC516-E6E7 shuttle plasmid.
[0074] 2. Packaging of recombinant HPV16 E6E7 adenovirus vaccine
[0075] The constructed pDC516-E6E7-HR or pDC516-E6E7 shuttle plasmids were then co-transfected with the AdMax adenovirus system backbone plasmid pBHGfrtdelE13FLP into HEK293 cells for recombinant adenovirus packaging. The procedure is as follows:
[0076] 1) 8×10 5 HEK293A cells were seeded per well in six-well plates, cultured in high-glucose DMEM + 10% FBS medium, and incubated overnight at 37°C in a cell culture incubator containing 5% CO2.
[0077] 2) On the second day, change the medium with high-glucose DMEM + 2% FBS. Co-transfect HEK293A cells with the adenovirus backbone plasmid (pBHGfrtdelE13FLP) deleting the E1 and E3 regions and the shuttle plasmid using lipofectamine 3000. The specific steps are as follows: Take 4 μg of the backbone plasmid and 2 μg of the shuttle plasmid from each transfection well, dilute with 125 μL of Opti-MEM medium, and then add 12 μL of P3000 reagent; In a separate 1.5 ml EP tube, dilute 7.5 μL of lipofectamine 3000 with 125 μL of Opti-MEM medium; mix the diluted plasmid and diluted lipofectamine 3000 at a 1:1 ratio, incubate at room temperature for 10-15 minutes, then add to the cells. Continue cell culture, and after the cells reach confluence, passage them in 25 cm⁻¹ cells. 2 In the cell culture flask, observe the signs of cell toxicity daily. Once the cells have filled the bottom of the flask, then transfer them to a 75cm culture medium. 2 In cell culture flasks, cells are collected until obvious plaques appear and most of the cells become diseased and detach from the bottom.
[0078] 3) Collect the cell culture containing the virus, centrifuge at 1200 rpm for 3 minutes, and aspirate the virus-containing supernatant. Resuspend the cell pellet in 1 / 10 of the culture volume of virus-containing supernatant and freeze-thaw it three times in a -80°C freezer and a 37°C water bath. Centrifuge at 3000 rpm for 20 minutes, collect the virus-containing supernatant, and combine it with the aforementioned virus-containing supernatant. This is the adenovirus seed for the vaccine.
[0079] 4) Take 50 μL of vaccine candidate strain seed liquid, add 2 μL of proteinase K, digest at 50℃ for 30 min to release viral genome, use this as template to PCR amplify HPV16 E6E7-HR gene or HPV16 E6E7 gene sequence, and sequence and identify the PCR product after electrophoresis gel recovery.
[0080] The conditions for PCR amplification are as follows:
[0081] Denaturation: 98℃, 2 min; Denaturation: 98℃, 10 s; Annealing: 60℃, 15 s; Extension: 72℃, 55 s; Extension: 72℃, 5 min; Cycle number: 35; Primers for PCR amplification are as follows:
[0082] IM05-F:GAGCTGCGTTCTACGTGGGTATAAG(SEQ ID No.7)
[0083] IM05-R:TCCATCAAACGAGTTGGTGCTCATG(SEQ ID No.8)
[0084] 3. Amplification of recombinant HPV16 E6E7 adenovirus vaccine
[0085] The correctly identified recombinant adenovirus vaccine strain was amplified stepwise in 293-H cells. The specific process is as follows: at an MOI of 3, the strain was amplified at a cell density of 4 × 10⁶ cells. 6 Adenovirus seed was added to a suspension of 293-H cells / ml. After 48-72 hours, the virus culture was collected, and the master virus seed bank and working virus seed bank were prepared using the repeated freeze-thaw method described above. The recombinant adenovirus vaccine was then amplified on a large scale using cell shake flasks or a bioreactor. The virus culture was collected after most cells had become diseased. The bioreactor amplification process for cells and virus is as follows: First, the bioreactor was sterilized, and then cell culture medium was added. When the operating conditions stabilized at 37℃, pH 7.0, DO 50%, and 50-150 rpm, the 293-H cells amplified in the shake flasks were collected and inoculated into the bioreactor at a cell density of 1.0 × 10⁻⁶ cells / ml. 6Cells / ml were added, and cell culture medium was replenished to 10L. The cell culture conditions in the reactor were: temperature 37℃, rotation speed 50-150 rpm, pH 7.15-7.25, DO 30-50%. Samples were taken daily to detect glucose concentration, cell density, and cell morphology. When the cell density in the bioreactor reached 1.0-5.0 × 10⁶ cells / ml... 6 When the cell count / ml is 1, the bioreactor is inoculated with recombinant adenovirus vaccine seed, with an MOI of 5-30. After inoculation, samples are taken daily to detect glucose concentration, virus titer in culture supernatant and cell pellet, and cell morphology. When the cell viability is 60-70%, the culture is terminated, and virus lysis buffer is added to the bioreactor to a final concentration of 0.05%-1%. The mixture is lysed at 37℃ for 2-4 hours using Tween 80, and then the virus solution is collected.
[0086] 4. Purification of recombinant HPV16 E6E7 adenovirus vaccine
[0087] The collected virus was purified using cesium chloride ultracentrifugation or ion exchange chromatography, as detailed below:
[0088] (1) Cesium chloride ultracentrifugation purification of recombinant HPV16 E6E7 adenovirus vaccine
[0089] Centrifuge the collected virus culture at 1200g for 10 minutes, aspirate the virus-containing culture supernatant, resuspend the cell pellet in 1 / 10 of the culture volume of virus-containing supernatant, freeze and thaw repeatedly three times in a -80℃ freezer and a 37℃ water bath, centrifuge at 3000rpm for 10-20 minutes, and aspirate the supernatant. The virus-containing culture supernatant was concentrated 10-fold using a 100K-300K ultrafiltration membrane. Two cesium chloride solutions were prepared: 1.4 g / ml cesium chloride solution (53 g cesium chloride + 87 ml 10 mM Tris-HCl, pH 7.9) and 1.2 g / ml cesium chloride solution (26.8 g cesium chloride + 92 ml 10 mM Tris-HCl, pH 7.9). 8 ml of the 1.4 g / ml cesium chloride solution was slowly added to an ultrafiltration tube, followed by a gentle addition of 6 ml of the 1.2 g / ml cesium chloride solution. Finally, 20 ml of the virus-containing supernatant was added to the top of the discontinuous gradient. The mixture was balanced and centrifuged at 100,000 × g for 90 minutes at 4°C. After centrifugation, the blue virus band was aspirated using a syringe, dialyzed to remove cesium chloride, and then stored at -80°C.
[0090] (2) Ion exchange chromatography purification of recombinant HPV16 E6E7 adenovirus vaccine
[0091] Collect viral cultures and lyse them with 0.05%–1% Tween 20 at 37°C for 2–4 hours. Clarify the lysed cultures by filtering through 1.2 μm and 0.45 μm capsule filters. Concentrate the samples 10-fold using a tangential flow membrane with a molecular weight of 100–300 kDa. Then wash the samples with 10 volumes of wash buffer (50 mM Tris–HCl, 2 mM MgCl2, 0–500 mM NaCl, pH 8.0) and collect the washed samples. Add nuclease to the washed samples to a final concentration of 10–50 U / ml and digest at 37°C for 1–3 hours. Then digest the samples using Q Sepharose XL, Source 30Q, or Source... Anion exchange chromatography was performed using 15Q packing material, following these steps: Equilibrate the column with buffer at a flow rate of 20 ml / min for 5 column volumes. After equilibration, load the sample at a flow rate of 10 ml / min. After loading, equilibrate the buffer to the conductivity level. Elute the sample using a linear gradient elution: from 100% low-salt buffer to 100% high-salt buffer, 10V elution volume, and a flow rate of 10 ml / min. Collect each elution peak. After elution, regenerate the column with 2M NaCl buffer for 5–10 column volumes at a flow rate of 20 ml / min. Collect the viral peak. Subsequently, the eluted viral sample is subjected to buffer replacement via dialysis or tangential flow filtration.
[0092] The recombinant HPV16 E6E7 adenovirus vaccine obtained by HPV16 E6E7-HR gene recombination is defined as "recombinant HPV16 E6E7 adenovirus vaccine (including HR)", and the recombinant HPV16 E6E7 adenovirus vaccine obtained by HPV16 E6E7 gene recombination is defined as "HPV16 E6E7 adenovirus vaccine (excluding HR)". Animal experiments are used to verify its efficacy.
[0093] Example 2: Tumor Therapy Assay of Recombinant HPV16 E6E7 Adenovirus Vaccine
[0094] To compare the efficacy of recombinant HPV16 E6E7 adenovirus vaccine (containing HR) and HPV16 E6E7 adenovirus vaccine (without HR) in tumor cell therapy, 6-8 week old female C57BL / 6 mice were subcutaneously injected with 2×10⁻⁶ vaccines on the right back on day 0. 5 TC-1 cells. On day 3 after tumor cell inoculation, mice were randomly divided into four groups. Each group received PBS, an adenovirus empty vector, recombinant HPV16 E6E7 adenovirus vaccine (containing HR), or HPV16 E6E7 adenovirus vaccine (without HR), respectively (5 × 10⁻⁶ cells). 5(VP / animal, intramuscular injection). Tumor growth was monitored starting on day 5, with tumor volume measured every 3 days. As shown in Figure 1, compared with the HPV16 E6E7 adenovirus group (without HR), the recombinant HPV16 E6E7 adenovirus group (with HR) significantly slowed tumor growth.
[0095] Example 3: Evaluation of cellular immune response induced by recombinant HPV16 E6E7 adenovirus vaccine
[0096] To evaluate the cellular immune response induced by the recombinant HPV16 E6E7 adenovirus vaccine (containing HR), 6-8 week old female C57BL / 6 mice were randomly divided into three groups on day 0. The mice were administered PBS, adenovirus empty vector, and recombinant HPV16 E6E7 adenovirus vaccine (containing HR) (5 × 10⁻⁶ mcg / mL), respectively. 5 VP / mouse, intramuscular injection). Mice were sacrificed on day 7, and cellular immune responses were assessed. Compared with the PBS control group and the adenovirus empty vector group, the recombinant HPV16 E6E7 adenovirus group (containing HR) significantly increased E6 tetramer-positive and E7 tetramer-positive CD8+ in peripheral blood mononuclear cells and spleen cells. + Cell proportions are shown in Figures 2A, B, C, and D. As shown in Figures 2E and F, the recombinant HPV16 E6E7 adenovirus vaccine can also significantly enhance activated CD4+. + CD8 + T cell ratio (CD69) + CD4 + CD69 + CD8 + In addition, central memory T cells (CD44) + CD62L + CD8 + ) and effector memory T cells (CD44) + CD62L - CD8 + The proportion of ) also increased significantly (Figure 3A, B). The extracted mouse spleen cells from each group were processed at 1.5 × 10⁻⁶. 6 Cells were densely seeded in 12-well plates overnight and stimulated with E6 peptide libraries (4 μg / ml) and E7 peptide libraries (2 μg / ml), respectively. Six hours before cell collection, brefeldin A was added to each well at a concentration of 1 μg / ml. After cell collection, extracellular and intracellular staining was performed. Flow cytometry analysis showed that mice in the recombinant HPV16 E6E7 adenovirus group secreted IFNγCD8 after stimulation with the E6 peptide library. + The proportion of cells was significantly increased (Figure 3C); after stimulation with the E7 peptide library, mice in the recombinant HPV16 E6E7 adenovirus group secreted IFNγ, TNFα, and CD8. + The proportion of cells was significantly increased (Figures 3D and E). The extracted mouse spleen cells from each group were processed at 1.5 × 10⁻⁶ cells / mL.5 The cells were densely seeded in ELISPOT plates, stimulated with an E7 peptide library (2 μg / ml), and incubated for 12–48 hours. As shown in Figure 4, mice in the recombinant HPV16 E6E7 adenovirus group secreted IFNγCD8. + The cell ratio and the ability to secrete IFNγ were significantly improved, which was confirmed by statistical analysis of the results in Figure 4 (Figure 3F).
[0097] Example 4: Antitumor effect of recombinant HPV16 E6E7 adenovirus vaccine in mEERL in situ carcinoma model
[0098] To evaluate the use of recombinant HPV16 E6E7 adenovirus vaccine (including HR) after nasal immunization for oropharyngeal HPV16... + After immunization with the HPV16 E6E7 adenovirus vaccine, tumor cells can produce cytotoxic T lymphocytes specific to HPV16 E6E7, which can target and kill HPV16. + Tumor, here " + "This refers to the treatment effect of a positive result," with 50 μL of 4 × 10⁻⁶ solution administered on day 0. 4 mEERL cells were suspended in PBS and placed on the base of the tongue of 6-8 week old C57BL / 6 mice. On day 4, the mice were divided into three groups, and administered PBS, an empty adenovirus vector, or a recombinant HPV16 E6E7 adenovirus vaccine (containing HR) (1.0 × 10⁻⁶ cells) on days 4 and 17, respectively. 10 VP / mouse (immunized by intranasal drops), and the growth of mice was closely monitored. As shown in Figure 5, the recombinant HPV16E6E7 adenovirus nasal spray vaccine has a significant anti-tumor effect and improves the survival rate of mice.
[0099] Example 5: Antitumor effect of recombinant HPV16 E6E7 adenovirus vaccine in a TC-1 subcutaneous tumor treatment model
[0100] To evaluate the therapeutic effect of recombinant HPV16 E6E7 adenovirus vaccine (containing HR) administered intramuscularly for cervical cancer, 6-8 week old female C57BL / 6 mice were subcutaneously injected with 2×10⁻⁶ vaccines on the right back on day 0. 5 TC-1 cells. On day 3 after tumor cell inoculation, mice were randomly divided into three groups. Each group received PBS, an adenovirus empty vector, or a recombinant HPV16E6E7 adenovirus vaccine (5 × 10⁻⁶ cells / mL), respectively. 5VP / mouse, intramuscular injection), and tumor growth in mice were monitored. The recombinant HPV16 E6E7 adenovirus vaccine (containing HR) significantly delayed tumor growth (Figure 6A) and improved the survival rate of tumor-bearing mice (Figure 5C). Mice were sacrificed on day 21, and tumor tissue was dissected and weighed. The recombinant HPV16 E6E7 adenovirus vaccine significantly reduced tumor weight (Figure 6B). Flow cytometry showed that, compared with the control group and the adenovirus empty vector group, the recombinant HPV16 E6E7 adenovirus vaccine significantly increased the positivity of E6 tetramer and E7 tetramer in peripheral blood mononuclear cells and spleen cells for CD8+. + Cell proportions (Fig. 7A, B, C, D). After preparing tumor cells into single-cell suspensions, tumor microenvironment analysis was performed. The recombinant HPV16 E6E7 adenovirus vaccine significantly reduced the proportion of myeloid-derived immunosuppressive cells and M2 macrophages (Fig. 7E, F).
[0101] Example 6: Antitumor effect of recombinant HPV16 E6E7 adenovirus vaccine in TC-1 subcutaneous tumor prevention model
[0102] To evaluate the efficacy of recombinant HPV16 E6E7 adenovirus vaccine (containing HR) administered intramuscularly for the prevention of cervical cancer, 6-8 week old female C57BL / 6 mice were divided into three groups. On day 0, mice in each group were treated with PBS, adenovirus empty vector, or recombinant HPV16 E6E7 adenovirus vaccine (containing HR) (5 × 10⁻⁶ mcg / mL), respectively. 5 VP / mouse, intramuscular injection), 2×10⁻⁶ mice were subcutaneously injected into the right back of the mouse on day 7. 5 TC-1 cells. Monitoring of tumor growth in mice. Figure 8A shows that the recombinant HPV16 E6E7 adenovirus vaccine has a good preventive effect on tumors and significantly improves the survival rate of mice (Figure 8C). On day 21, tumor tissue was removed from mice and weighed. The recombinant HPV16 E6E7 adenovirus vaccine significantly reduced tumor weight (Figure 8B). On day 100, mice were rechallenged with TC-1 cells. The recombinant HPV16 E6E7 adenovirus vaccine still had a strong and effective immune effect, delaying tumor growth (Figure 8D) and continuously improving the survival rate of mice (Figure 8E).
[0103] Example 7: Antitumor effect of recombinant HPV16 E6E7 adenovirus vaccine combined with cisplatin / paclitaxel in a TC-1 subcutaneous tumor treatment model.
[0104] To evaluate the efficacy of recombinant HPV16 E6E7 adenovirus vaccine (containing HR) in combination with cisplatin / paclitaxel for the treatment of cervical cancer, 6-8 week old female C57BL / 6 mice were subcutaneously injected with 2×10⁻⁶ cisplatin / paclitaxel on the right back on day 0. 5TC-1 cells. On day 4 after tumor cell inoculation, cells were randomly divided into 6 groups: control group, adenovirus empty vector group, recombinant HPV16 E6E7 adenovirus group (including HR), cisplatin / paclitaxel group, adenovirus empty vector combined with cisplatin / paclitaxel group, and recombinant HPV16 E6E7 adenovirus (including HR) combined with cisplatin / paclitaxel group. These groups received PBS, adenovirus empty vector, and recombinant HPV16 E6E7 adenovirus vaccine treatments (5 × 10⁻⁶ cells / year) respectively. 5 VP (viral transfusion / animal, intramuscular injection) was administered on days 4 and 11, respectively, along with cisplatin / paclitaxel (cisplatin: 2 mg / kg, paclitaxel: 20 mg / kg, intraperitoneal injection), and tumor growth in mice was monitored. Figure 9 shows that recombinant HPV16E6E7 adenovirus combined with cisplatin / paclitaxel can delay tumor growth in mice and has a certain protective effect.
Claims
1. A recombinant HPV16 E6E7 adenovirus, characterized in that: Its expressed antigen contains the HPV16 E6E7 antigen sequence and the HR1 and HR2 segments of the SARS-CoV-2 virus.
2. The adenovirus according to claim 1, characterized in that: The amino acid sequence of the HPV16 E6E7 antigen is shown in SEQ ID No. 1, or has more than 80% homology with SEQ ID No. 1 and has the same or similar biological activities; preferably, the nucleotide sequence of the HPV16 E6E7 antigen is shown in SEQ ID No.
2.
3. The adenovirus according to claim 1, characterized in that: The amino acid sequences of the HR1 and HR2 segments of the SARS-CoV-2 virus are as shown in SEQ ID No. 3, or have more than 80% homology with SEQ ID No. 3 and have the same or similar biological activities; preferably, the nucleotide sequences of the HR1 and HR2 segments of the SARS-CoV-2 virus are as shown in SEQ ID No.
4.
4. The adenovirus according to claim 1, characterized in that: The amino acid sequence of the expression antigen of the recombinant HPV16 E6E7 adenovirus is shown in SEQ ID No. 5; preferably, the nucleotide sequence of the expression antigen of the recombinant HPV16 E6E7 adenovirus is shown in SEQ ID No.
6.
5. The adenovirus according to claim 1, characterized in that: The HPV16 E6E7 antigen forms a trimer structure with the HR1 and HR2 segments of the SARS-CoV-2 virus.
6. An adenovirus vector, characterized in that: The nucleic acid sequence containing the expression antigen of the recombinant HPV16 E6E7 adenovirus as described in any one of claims 1 to 5.
7. The adenovirus vector according to claim 6, characterized in that: The adenovirus vector is selected from human Ad5 vector, Ad35 vector, or Ad26 vector, or / and chimpanzee AdC68 vector, AdC7 vector, or ChAdOx1 vector; preferably, it is selected from human type 5 replication-defective adenovirus with combined deletion of E1 and E3.
8. The method for preparing recombinant HPV16 E6E7 adenovirus according to any one of claims 1 to 5, characterized in that: Includes the following steps: The HPV16 E6E7-HR gene was synthesized, and an adenovirus shuttle plasmid containing the HPV16 E6E7-HR gene was constructed using molecular cloning technology. The shuttle plasmid and the backbone plasmid of the AdMax adenovirus system were co-transfected into host cells to package recombinant adenoviruses, thereby obtaining replication-defective recombinant adenoviruses. These were then amplified, cultured, and purified.
9. A recombinant HPV16 E6E7 adenovirus vaccine, characterized in that: Contains the recombinant HPV16 E6E7 adenovirus as described in any one of claims 1 to 5 or the adenovirus vector as described in any one of claims 6 to 7.
10. The recombinant HPV16 E6E7 adenovirus vaccine according to claim 9, characterized in that: The recombinant HPV16 E6E7 adenovirus vaccine is available in the form of an injection, nasal drops, spray, or inhaler; preferably, the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection, or intraperitoneal injection.
11. A pharmaceutical composition, characterized in that: Contains the recombinant HPV16 E6E7 adenovirus according to any one of claims 1 to 5, the adenovirus vector according to any one of claims 6 to 7, or the vaccine according to any one of claims 9 to 10, and other antitumor drugs.
12. A combination drug, characterized in that: The recombinant HPV16 E6E7 adenovirus according to any one of claims 1 to 5, the adenovirus vector according to any one of claims 6 to 7, or the vaccine according to any one of claims 9 to 10, and other antitumor drugs are administered separately or simultaneously.
13. The pharmaceutical composition according to claim 11 or the combination drug according to claim 12, characterized in that: The other antitumor drugs are selected from at least one of cisplatin, paclitaxel, carboplatin, topotecan, bevacizumab, cetuximab, pembrolizumab, nivolumab, medroxyprogesterone or 5-fluorouracil; preferably, the other antitumor drugs are cisplatin and paclitaxel.
14. The use of the recombinant HPV16 E6E7 adenovirus according to any one of claims 1 to 5, the adenovirus vector according to any one of claims 6 to 7, the vaccine according to any one of claims 9 to 10, the pharmaceutical composition according to claim 11 or 13, or the combination of drugs according to claim 12 or 13 in the prevention and / or treatment of tumors caused by HPV infection.
15. The application according to claim 14, characterized in that: The tumor includes at least one of cervical cancer, squamous cell carcinoma of the head and neck, anal cancer, vulvar cancer, vaginal cancer, or penile cancer.