Dsrna agent for inhibiting angiotensinogen expression, derivative thereof, and use thereof

Abstract

A dsRNA agent for inhibiting angiotensinogen expression, a derivative thereof, and a use thereof. A corresponding dsRNA is designed for angiotensinogen (AGT), and is conjugated with Gal-NAc to effectively deliver the dsRNA to the liver, so as to interfere with AGT mRNA in the liver, thereby effectively reducing the synthesis and secretion of AGT. The provided dsRNA can significantly inhibit the expression of AGT mRNA in cells, effectively reduce AGT protein levels, has a long duration of action, and can be used for the preparation of a drug for treating hypertension.

Description

dsRNA agents and their derivatives for inhibiting angiotensinogen expression and their applications Technical Field

[0001] This invention pertains to RNA interference technology, specifically to angiotensinogen, and more specifically to dsRNA agents and their derivatives for inhibiting angiotensinogen expression and their applications. Background Technology

[0002] RNA interference (RNAi) is a molecular biological phenomenon of gene silencing induced by double-stranded RNA. Its mechanism involves inhibiting gene expression by blocking the transcription or translation of specific genes. When a double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into a cell, the mRNA degrades, leading to gene silencing. Small interfering RNAs (siRNAs), with a length of 20-25 nt, can trigger RNAi, specifically downregulating or shutting down the expression of specific genes. They are highly efficient, easy to synthesize, and easy to manipulate, making this technology widely used in exploring gene function and in gene therapy for infectious diseases and malignant tumors.

[0003] N-acetylgalactosamine (GalNAc) is a monosaccharide that recognizes the sialic acid glycoprotein receptor, which is highly expressed in hepatocytes. Using GalNAc derivatives, such as divalent or trivalent branched linkers, attached to the 3' end of the positive strand of siRNA can promote siRNA specific targeting to liver tissue, thereby improving its bioavailability and reducing dosage and side effects.

[0004] Hypertension is one of the most common chronic diseases. According to relevant Chinese guidelines, the blood pressure cutoff for the diagnosis of hypertension is ≥140 / 90 mmHg, and blood pressure in the range of 120-139 / 80-89 mmHg is defined as prehypertension. The pathogenesis of hypertension is complex, and blood pressure regulation is mainly affected by cardiac output and peripheral resistance. Sympathetic nervous system excitation and excessive sodium intake can lead to increased cardiac output; decreased elasticity and increased stiffness of large arteries, as well as activation of the renin-angiotensin-aldosterone system (RAAS), can all increase vascular resistance, all of which can lead to elevated blood pressure. Angiotensinogen (AGT) is a glycoprotein synthesized by the liver and is a rate-limiting substrate of the RAAS system. Angiotensinogen is converted into angiotensin I under the action of renin. Specifically, when the body loses blood or kidney disease leads to a decrease in circulating blood volume and renal blood flow, it can promote the secretion of renin (an acidic protease) by the juxtaglomerular cells of the juxtaglomerular apparatus. Once renin enters the bloodstream, it hydrolyzes angiotensinogen (an alpha globulin) produced by the liver into angiotensin I (a decapeptide). As angiotensin I flows through the pulmonary circulation, it is hydrolyzed into angiotensin II (an octapeptide) by enzymes in the lungs. Some angiotensin II is further hydrolyzed into angiotensin III (a hecapeptide) by angiotensinase A in plasma and tissue fluid. Angiotensin II regulates blood pressure and is a key component of the renin-angiotensin system. It constricts peripheral arterioles and veins, raising blood pressure, and stimulates the adrenal cortex to secrete hormones such as aldosterone, promoting the reabsorption of sodium and water by the kidneys, further increasing blood volume and maintaining electrolyte balance. In conclusion, angiotensinogen plays a crucial role in blood pressure regulation and fluid balance in the human body.

[0005] The prior art CN119040325A discloses a dual-targeting siRNA agent, which includes two different siRNAs or pharmaceutically acceptable salts thereof targeting two different genes. The two different siRNAs or their salts are linked by a pharmaceutically acceptable ligand. The siRNAs are dsRNAs composed of a sense strand and an antisense strand. The two different genes are selected from two of angiotensinogen (AGT), proprotein convertase subtilisin 9, and human angiopoietin-like protein 3. This agent can be used to prepare drugs for treating hypertension.

[0006] Commonly used antihypertensive drugs include six classes: diuretics, calcium channel blockers (CCBs), angiotensin-converting enzyme inhibitors (ACEIs), angiotensin receptor blockers (ARBs), beta-blockers, and alpha-blockers. Including siRNA agents, currently available antihypertensive drugs face safety and tolerability issues, and their effects are short-lived. There is an urgent need to develop new, safe, sustained-release, and effective antihypertensive drugs to provide more choices and opportunities for hypertensive patients. Summary of the Invention

[0007] This invention addresses the problems existing in the prior art by providing a dsRNA agent for inhibiting angiotensinogen expression, its derivatives, and their applications. This invention designs corresponding dsRNAs targeting angiotensinogen (AGT), and through coupling with GalNAc, effectively delivers the dsRNAs to the liver, interfering with AGT mRNA in the liver and effectively reducing cellular AGT expression.

[0008] Terminology Explanation:

[0009] The term "treatment" refers to the desired therapeutic effect when it relates to a disease or condition. Exemplary therapeutic effects include: delaying the onset of at least one symptom associated with the disease or reducing at least one symptom associated with the disease, positively influencing (e.g., reducing or delaying the onset) clinical markers associated with the disease, and slowing or reversing the progression of the disease.

[0010] The term "therapeutic effective amount" refers to the amount of a substance, as described, that effectively produces the desired therapeutic effect given a reasonable benefit / risk ratio applicable to any medical condition. For example, a "therapeutic effective amount" is an amount that effectively reduces or alleviates the occurrence of one or more clinical markers or symptoms associated with the disease or condition being treated, or an amount that effectively alters or reverses the course of a disease.

[0011] The term "object" refers to an animal, such as mammals, including non-primates (e.g., cattle, pigs, horses, cats, dogs, rats, and mice) and primates (e.g., monkeys represented by cynomolgous monkeys, chimpanzees, and humans), such as humans. In some embodiments, the object is a patient whose hypertension is refractory or unresponsive to current treatments. In some embodiments, the object is livestock (e.g., horses, cattle, pigs, etc.) or pets (e.g., cats, dogs, etc.). In some embodiments, the object is a human.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0013] On one hand, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent or a salt thereof for inhibiting angiotensinogen (AGT) expression, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region by base pairing, wherein the sense strand is selected from SEQ ID NO.1-102 or its modified sequence, and the antisense strand is selected from SEQ ID NO.106-207 or its modified sequence.

[0014] Furthermore, the dsRNA agent or its salt is used to treat or as an adjunct to the treatment of hypertension.

[0015] Preferably, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.

[0016] Preferably, at least one nucleotide in the sense strand or the antisense strand is a nucleotide analog or a nucleotide with a hydroxyl group modified at the 2' position of the ribosyl group; the nucleotide analog includes isonucleotides, LNA (Locked Nucleic Acid), ENA (2'-O,4'-C-Ethylene-bridged Nucleic Acid), cEt-BNA (Constrained Ethyl-Bridged Nucleic Acid), UNA (Unlocked Nucleic Acid), or GNA (Glycol Nucleic Acid). Acid); the nucleotides whose hydroxyl group at the 2' position of the ribosyl group is modified include nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl, 2'-O-dimethylaminoethyl, 2'-O-dimethylaminopropyl, T0-dimethylaminoethoxyethyl, or 2'-ON-methylacetamide.

[0017] Preferably, at least one phosphate group in the sense chain or the antisense chain is a phosphate group with a modifying group.

[0018] Preferably, the sense chain is selected from the modification sequences shown in SEQ ID NO.211-233, and the antisense chain is selected from the modification sequences shown in SEQ ID NO.235-257; wherein m represents 2'-O-methyl substitution modification, f represents 2'-fluorination modification, and s represents thiosclerosis modification.

[0019] Preferably, the dsRNA sequence is selected from one of the following dsRNA sequences:

[0020] A) YJH-014B-1861m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.229: fU-s-mG-s-fU-mG-fA-mA-fA-fC-fA-mA-fA-mA-fA-mA-fG-mU-fG-mU-fG-mU-fU, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.253: mA-s-fA-s-mC-fA-mC-fU-mU-mU-fU-mU-mU-mG-mU-fU-mU-fC-mA-fC-mA-s-mA-s-mA;

[0021] B) YJH-014B-1867m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.231: fA-s-mC-s-fA-mA-fA-mA-fA-fA-fG-mU-fG-mU-fU-mC-fC-mC-fU-mU-fU, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.255: mA-s-fA-s-mA-fG-mG-fG-mA-mC-fA-mC-mU-mU-fU-mU-fU-mU-fG-mU-s-mU-s-mU;

[0022] C) YJH-014B-1882m2, whose sense strand nucleotide sequence is shown in SEQ ID NO.233: fC-s-mU-s-fU-mU-fU-mC-fA-fA-fG-mU-fU-mG-fA-mG-fA-mA-fC-mA-fA, and whose antisense strand nucleotide sequence is shown in SEQ ID NO.257: mU-s-fU-s-mG-fU-mU-fC-mU-fC-mA-fA-mC-mU-mU-fG-mA-fA-mA-mG-s-mG-s-mG-s-mG;

[0023] Where mA, mG, mC, and mU are 2'-O-methyl modified A, G, C, and U, respectively; fA, fG, fC, and fU are 2'-fluorine modified A, G, C, and U, respectively; and s represents thiophosphate linkage.

[0024] Preferably, the dsRNA agent or its salt further includes a ligand.

[0025] Preferably, the ligand is conjugated to the 3' end of the positive strand of the dsRNA agent or its salt.

[0026] Preferably, the ligand includes monoclonal antibodies, biclonal antibodies, monosaccharides, polysaccharides, and cationic polymers.

[0027] Preferably, the ligand is N-acetylgalactosamine (GalNAc) or a derivative thereof.

[0028] Preferably, the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, or trivalent branching junction.

[0029] Preferably, the ligand has the following structural formula:

[0030] Preferably, the ligand is L96, and L96 is N-[tris(GalNAc-alkyl)-amide-decanoyl]-4-hydroxyprolyl.

[0031] Preferably, the dsRNA agent or its salt is conjugated to the ligand as shown in the following formula:

[0032] Where X is O or S.

[0033] Preferably, X is O.

[0034] On the other hand, the present invention provides a cell comprising the above-described dsRNA agent or a salt thereof.

[0035] Furthermore, the cells are used to treat or assist in the treatment of hypertension.

[0036] On the other hand, the present invention provides a pharmaceutical composition for inhibiting the expression of a gene encoding AGT, the pharmaceutical composition comprising the above-mentioned dsRNA agent or a salt thereof.

[0037] Furthermore, the pharmaceutical composition is used to treat or as an adjunct treatment for hypertension.

[0038] On the other hand, the present invention provides a kit comprising the above-described dsRNA agent or a salt thereof, or comprising the above-described pharmaceutical composition.

[0039] Furthermore, the kit is used for the treatment or adjunctive treatment of hypertension.

[0040] On the other hand, the present invention provides the use of the above-mentioned dsRNA agent or its salt, or the above-mentioned pharmaceutical composition, or the above-mentioned kit in the preparation of a drug for inhibiting AGT expression in cells or a drug for treating hypertension.

[0041] In another aspect, the present invention provides a method for treating or adjunctive treating hypertension, comprising the steps of: administering a therapeutically effective amount of a dsRNA agent or a salt thereof to a subject, a cell containing the dsRNA agent or a salt thereof, and a pharmaceutical composition containing the aforementioned dsRNA agent or a salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region by base pairing, the sense strand being selected from SEQ ID NO. 1-102 or a modified sequence thereof, and the antisense strand being selected from SEQ ID NO. 106-207 or a modified sequence thereof.

[0042] Furthermore, in the method for treating or adjuvant treatment of hypertension, the dsRNA agent or its salt treats or adjuvantly treats hypertension by inhibiting AGT expression or inhibiting the expression of the gene encoding AGT. Compared with the prior art, the present invention has the following beneficial effects:

[0043] 1. This invention designs corresponding dsRNAs for angiotensinogen (AGT) and delivers them to the liver by coupling with GalNAc, thereby interfering with AGT mRNA in the liver and effectively reducing AGT synthesis and secretion.

[0044] 2. The dsRNA provided by this invention can significantly inhibit the expression of AGT mRNA in cells, effectively reduce the content of AGT protein, and has a long duration of action. It can be used to prepare drugs for treating hypertension. Attached Figure Description

[0045] Figure 1 shows the protein inhibition efficiency in hAGT mouse serum 7 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 5. Compared with the Blank group (no drug administration group), after t-test analysis, ** represents a highly significant difference (P < 0.01), *** represents an extremely significant difference (P < 0.001), and no * represents no significant difference. Each dot in the bar chart represents the value of a parallel experiment, with n = 6 parallel animals per group.

[0046] Figure 2 shows the protein inhibition efficiency in hAGT mouse serum 14 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 5. Compared with the Blank group, after t-test analysis, *** represents extremely significant difference (P < 0.001), and no * represents no significant difference. The position of each dot in the bar chart represents the value of the parallel experiment, and the number of parallel animals in each group is n = 5.

[0047] Figure 3 shows the knockdown efficiency of AGT mRNA in the liver of hAGT mice 14 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 5. Compared with the Blank group, after t-test analysis, *** represents extremely significant difference (P < 0.001), and no * represents no significant difference. The position of each dot in the bar chart represents the value of the parallel experiment, and the number of parallel animals in each group is n = 6.

[0048] Figure 4 shows the knockdown efficiency of AGT mRNA in the liver of hAGT mice 7 days after administration of the m1-modified and m2-modified sequences in Example 6. Compared with the Blank group, after t-test analysis, ** represents a highly significant difference (P < 0.01), *** represents an extremely significant difference (P < 0.001), and no * represents no significant difference. The position of each dot in the bar chart represents the value of the parallel experiment, and the number of parallel animals in each group is n = 4.

[0049] Figure 5 shows the knockdown efficiency of AGT mRNA in the liver of hAGT mice 7 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 7; ** represents a highly significant difference compared to the Blank group, as analyzed by t-test (P < 0.05).

[0050] <0.01), *** indicates a highly significant difference (P<0.001); each dot in the bar chart represents the value of a parallel experiment, and the number of parallel animals in each group is n=3.

[0051] Figure 6 shows the protein inhibition efficiency in hAGT mouse serum 7 days after administration of the GalNAc-conjugated siRNA modified sequence in Example 8. Compared with the Blank group, after t-test analysis, * represents a significant difference (P < 0.05), ** represents a highly significant difference (P < 0.01), and *** represents an extremely significant difference (P < 0.001). Each dot in the bar chart represents the value of a parallel experiment, with n = 3 parallel animals per group.

[0052] Figure 7 shows the knockdown effect of the GalNAc-coupled siRNA modified sequence in primary monkey hepatocytes in Example 9; where, compared with the Blank group, after t-test analysis, ** represents a highly significant difference (P < 0.01); the position of each dot in the bar chart represents the value of the parallel experiment, and the number of replicates n = 3.

[0053] Figure 8 shows the knockdown effect of the GalNAc-coupled siRNA modified sequence in human primary hepatocytes in Example 10; compared with the Blank group, after t-test analysis, ** represents a highly significant difference (P < 0.01), and *** represents an extremely significant difference (P < 0.001); the position of each dot in the bar chart represents the value of the parallel experiment, and the number of replicates n = 3.

[0054] Figure 9 shows the long-term blood pressure reduction results of the GalNAc-coupled siRNA modified sequence in the hAGT humanized mouse hypertension model after 28 days in Example 11. The number of parallel animals in each group is n=3; where MBP refers to mean blood pressure, that is, the average blood pressure measured over 24 hours.

[0055] Figure 10 shows the long-term blood pressure reduction results of different doses of GalNAc-coupled siRNA modified sequence in the hAGT humanized mouse hypertension model after 28 days in Example 12. The number of parallel animals in each group was n=5; the mean arterial pressure is the average blood pressure measured over 24 hours.

[0056] Figure 11 shows the results of knockdown of long-acting hAGT mRNA in a humanized mouse hypertension model of hAGT at different doses of GalNAc-coupled siRNA modification sequence after 28 days in Example 12. Among them, after one-way ANOVA analysis, **** represents extremely significant difference (P < 0.0001). The position of each dot in the bar chart represents the value of the parallel experiment, and the number of parallel animals in each group is n = 5.

[0057] Figure 12 shows the results of long-term hAGT protein knockdown in a humanized mouse hypertension model of hAGT at different doses of GalNAc-coupled siRNA modified sequence in Example 12 after 28 days. Among them, after one-way ANOVA analysis, **** represents extremely significant difference (P < 0.0001). The position of each dot in the bar chart represents the value of the parallel experiment, and the number of parallel animals in each group is n = 5.

[0058] Figure 13 shows the knockdown effect of GalNAc coupled with different modified sequences of siRNA in Example 13. Compared with the NC group, after t-test analysis, ** represents a highly significant difference (P < 0.01), and *** represents an extremely significant difference (P < 0.001). The position of each dot in the bar chart represents the value of the parallel experiment, and the number of replicates n = 3.

[0059] Figure 14 shows the comparison of the knockdown effect of GalNAc-coupled siRNA modified sequence and Yangshen in Example 14. After t-test analysis, *** represents a highly significant difference (P < 0.001). The position of each dot in the bar chart represents the value of the parallel experiment, and the number of replicates n = 3.

[0060] Figure 15 shows the long-term knockdown effect of the GalNAc-coupled sequence on AGT protein in a cynomolgus monkey hypertension model for up to 90 days in Example 15, with n = 4 parallel animals per group.

[0061] Figure 16 shows the long-term knockdown effect of the GalNAc-coupled sequence on AGT mRNA for up to 90 days in the knockdown evaluation of the cynomolgus monkey hypertension model in Example 15, with n=4 parallel animals in each group.

[0062] Figure 17 shows the long-term antihypertensive effect of the GalNAc coupled sequence in Example 16 in a cynomolgus monkey hypertension model for up to 60 days. The number of parallel animals in each group was n=4, where the mean arterial pressure is the average value of blood pressure measured over 24 hours. Detailed Implementation

[0063] Unless otherwise specified, all raw materials used in this invention are commercially available products and their sources are not specifically limited.

[0064] In the following embodiments,

[0065] In the siRNA modified sequence, mA, mG, mC, and mU are 2'-O-methyl modified A, G, C, and U, respectively; fA, fG, fC, and fU are 2'-fluorine modified A, G, C, and U, respectively; and s is a thiophosphate linker.

[0066] “m1” refers to the following dsRNA modification method:

[0067] The positive chain 5'-3': nucleotide 1 2'-fluorinated, nucleotide 2 2'-O-methyl substituted, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated;

[0068] Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, nucleotide 2 2'-fluorination, nucleotide 3 2'-O-methyl substitution, nucleotide 4 2'-fluorination, nucleotide 5 2'-O-methyl substitution, nucleotide 6 2'-fluorination, nucleotide 7 2'-O-methyl substitution, nucleotide 8 2'-fluorination, nucleotide 9 2'-O-methyl substitution, nucleotide 10 2'-fluorination, nucleotide 11 2'-O-methyl substitution, nucleotide 1 2. Nucleotide 2'-O-methyl substitution, 13. Nucleotide 2'-O-methyl substitution, 14. Nucleotide 2'-fluorination, 15. Nucleotide 2'-O-methyl substitution, 16. Nucleotide 2'-fluorination, 17. Nucleotide 2'-O-methyl substitution, 18. Nucleotide 2'-fluorination, 19. Nucleotide 2'-O-methyl substitution, thiophosphate backbone, 20. Nucleotide 2'-fluorination, thiophosphate backbone, 21. Nucleotide 2'-O-methyl substitution.

[0069] “m2” refers to the following dsRNA modification method:

[0070] The positive chain 5'-3': nucleotide 1 2'-fluorinated, thiophosphate backbone, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated;

[0071] Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, thiophosphate backbone; nucleotide 2 2'-fluorination, thiophosphate backbone; nucleotide 3 2'-O-methyl substitution; nucleotide 4 2'-fluorination; nucleotide 5 2'-O-methyl substitution; nucleotide 6 2'-fluorination; nucleotide 7 2'-O-methyl substitution; nucleotide 8 2'-fluorination; nucleotide 9 2'-O-methyl substitution; nucleotide 10 2'-fluorination; nucleotide 11 2'-O-methyl substitution. Substitution of nucleotide 12, 2'-O-methyl substitution of nucleotide 13, 2'-O-methyl substitution of nucleotide 14, 2'-fluorination of nucleotide 15, 2'-O-methyl substitution of nucleotide 16, 2'-fluorination of nucleotide 17, 2'-O-methyl substitution of nucleotide 18, 2'-fluorination of nucleotide 19, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 20, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 21, 2'-O-methyl substitution of nucleotide 22.

[0072] “m3” refers to the following dsRNA modification:

[0073] The positive chain 5'-3': nucleotide 1 2'-O-methyl substitution, thiophosphate backbone, nucleotide 2 2'-O-methyl substitution, thiophosphate backbone, nucleotide 3 2'-O-methyl substitution, nucleotide 4 2'-O-methyl substitution, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substitution, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substitution, nucleotide 11 2'-O-methyl substitution, nucleotide 12 2'-O-methyl substitution, nucleotide 13 2'-O-methyl substitution, nucleotide 14 2'-O-methyl substitution, nucleotide 15 2'-O-methyl substitution, nucleotide 16 2'-O-methyl substitution, nucleotide 17 2'-O-methyl substitution, nucleotide 18 2'-O-methyl substitution, nucleotide 19 2'-O-methyl substitution;

[0074] Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, thiophosphate backbone; nucleotide 2 2'-fluorination, thiophosphate backbone; nucleotide 3 2'-O-methyl substitution; nucleotide 4 2'-O-methyl substitution; nucleotide 5 2'-O-methyl substitution; nucleotide 6 2'-fluorination; nucleotide 7 2'-O-methyl substitution; nucleotide 8 2'-O-methyl substitution; nucleotide 9 2'-O-methyl substitution; nucleotide 10 2'-O-methyl substitution; nucleotide 11 2'-O-methyl substitution. -O-methyl substitution, nucleotide 12 2'-O-methyl substitution, nucleotide 13 2'-O-methyl substitution, nucleotide 14 2'-fluorinated, nucleotide 15 2'-O-methyl substitution, nucleotide 16 2'-fluorinated, nucleotide 17 2'-O-methyl substitution, nucleotide 18 2'-O-methyl substitution, nucleotide 19 2'-O-methyl substitution, phosphate thioester backbone, nucleotide 20 2'-O-methyl substitution, phosphate thioester backbone, nucleotide 21 2'-O-methyl substitution.

[0075] “m4” refers to the following dsRNA modification method:

[0076] The positive chain 5'-3': nucleotide 1 is 2'-fluorinated, nucleotide 2 is 2'-O-methyl substituted, nucleotide 3 is 2'-fluorinated, nucleotide 4 is 2'-O-methyl substituted, nucleotide 5 is 2'-fluorinated, nucleotide 6 is 2'-O-methyl substituted, nucleotide 7 is 2'-O-methyl substituted, nucleotide 8 is 2'-O-methyl substituted, nucleotide 9 is 2'-O-methyl substituted, nucleotide 10 is 2'-O-methyl substituted, nucleotide 11 is 2'-O-methyl substituted, nucleotide 12 is 2'-O-methyl substituted, nucleotide 13 is 2'-O-methyl substituted, nucleotide 14 is 2'-O-methyl substituted, nucleotide 15 is 2'-O-methyl substituted, nucleotide 16 is 2'-O-methyl substituted, nucleotide 17 is 2'-O-methyl substituted, nucleotide 18 is 2'-O-methyl substituted, nucleotide 19 is 2'-O-methyl substituted;

[0077] Antisense strand 5'-3': nucleotide 1 2'-O-methyl substitution, nucleotide 2 2'-O-methyl substitution, nucleotide 3 2'-O-methyl substitution, nucleotide 4 2'-O-methyl substitution, nucleotide 5 2'-O-methyl substitution, nucleotide 6 2'-O-methyl substitution, nucleotide 7 2'-O-methyl substitution, nucleotide 8 2'-fluorinated, nucleotide 9 2'-O-methyl substitution, nucleotide 10 2'-O-methyl substitution, nucleotide 11 2'-O -Methyl substitution, 12th nucleotide 2'-O-methyl substitution, 13th nucleotide 2'-O-methyl substitution, 14th nucleotide 2'-O-methyl substitution, 15th nucleotide 2'-O-methyl substitution, 16th nucleotide 2'-O-methyl substitution, 17th nucleotide 2'-O-methyl substitution, 18th nucleotide 2'-O-methyl substitution, 19th nucleotide 2'-O-methyl substitution, 20th nucleotide 2'-O-methyl substitution, 21st nucleotide 2'-O-methyl substitution.

[0078] “m5” refers to the following dsRNA modification method:

[0079] The positive chain 5'-3': nucleotide 1 2'-fluorinated, thiophosphate backbone, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated;

[0080] Antisense strand 5'-3': nucleotide 1: 2'-O-methyl substitution, phosphate thioester backbone; nucleotide 2: LNA modification, phosphate thioester backbone; nucleotide 3: 2'-O-methyl substitution; nucleotide 4: 2'-fluorination; nucleotide 5: LNA modification; nucleotide 6: 2'-fluorination; nucleotide 7: 2'-O-methyl substitution; nucleotide 8: 2'-fluorination; nucleotide 9: 2'-O-methyl substitution; nucleotide 10: 2'-fluorination; nucleotide 11: 2'-O-methyl substitution. The 12th nucleotide is 2'-O-methyl substituted, the 13th nucleotide is 2'-O-methyl substituted, the 14th nucleotide is 2'-fluorinated, the 15th nucleotide is 2'-O-methyl substituted, the 16th nucleotide is 2'-fluorinated, the 17th nucleotide is 2'-O-methyl substituted, the 18th nucleotide is 2'-fluorinated, the 19th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, the 20th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, and the 21st nucleotide is 2'-O-methyl substituted.

[0081] “m6” refers to the following dsRNA modification:

[0082] The positive chain 5'-3': nucleotide 1 2'-fluorinated, thiophosphate backbone, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-fluorinated, nucleotide 8 2'-fluorinated, nucleotide 9 2'-fluorinated, nucleotide 10 2'-O-methyl substituted, nucleotide 11 2'-fluorinated, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated;

[0083] Antisense strand 5'-3': nucleotide 1: 2'-O-methyl substitution, thiophosphate backbone; nucleotide 2: GNA modification, thiophosphate backbone; nucleotide 3: 2'-O-methyl substitution; nucleotide 4: 2'-fluorination; nucleotide 5: GNA modification; nucleotide 6: 2'-fluorination; nucleotide 7: 2'-O-methyl substitution; nucleotide 8: 2'-fluorination; nucleotide 9: 2'-O-methyl substitution; nucleotide 10: 2'-fluorination; nucleotide 11: 2'-O-methyl substitution. The 12th nucleotide is 2'-O-methyl substituted, the 13th nucleotide is 2'-O-methyl substituted, the 14th nucleotide is 2'-fluorinated, the 15th nucleotide is 2'-O-methyl substituted, the 16th nucleotide is 2'-fluorinated, the 17th nucleotide is 2'-O-methyl substituted, the 18th nucleotide is 2'-fluorinated, the 19th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, the 20th nucleotide is 2'-O-methyl substituted, the thiophosphate backbone, and the 21st nucleotide is 2'-O-methyl substituted.

[0084] “m7” refers to the following dsRNA modification method:

[0085] The positive chain 5'-3': nucleotide 1 2'-fluorinated, nucleotide 2 2'-O-methyl substituted, thiophosphate backbone, nucleotide 3 2'-fluorinated, nucleotide 4 2'-O-methyl substituted, nucleotide 5 2'-fluorinated, nucleotide 6 2'-O-methyl substituted, nucleotide 7 2'-O-methyl substituted, nucleotide 8 2'-O-methyl substituted, nucleotide 9 2'-O-methyl substituted, thiophosphate backbone, nucleotide 10 2'-O-methyl substituted, thiophosphate backbone, nucleotide 11 2'-fluorinated, thiophosphate backbone, nucleotide 12 2'-O-methyl substituted, nucleotide 13 2'-fluorinated, nucleotide 14 2'-O-methyl substituted, nucleotide 15 2'-fluorinated, nucleotide 16 2'-O-methyl substituted, nucleotide 17 2'-fluorinated, nucleotide 18 2'-O-methyl substituted, nucleotide 19 2'-fluorinated;

[0086] Antisense strand 5'-3': 2'-O-methyl substitution of nucleotide 1, 2'-O-methyl substitution of nucleotide 2, 2'-O-methyl substitution of nucleotide 3, 2'-O-methyl substitution of nucleotide 4, 2'-O-methyl substitution of nucleotide 5, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 2'-O-methyl substitution of nucleotide 6, 2'-O-methyl substitution of nucleotide thiophosphate backbone, 2'-O-methyl substitution of nucleotide 7, 2'-O-methyl substitution of nucleotide 8, 2'-O-methyl substitution of nucleotide 9, 2'-Fluoride of nucleotide 10 The substitutions are as follows: nucleotide 11, nucleotide 12, nucleotide 13, nucleotide 14, nucleotide 15, nucleotide 16, nucleotide 2'-fluorinated, nucleotide 17, nucleotide 18, nucleotide 19, nucleotide 20, and nucleotide 21.

[0087] In the nomenclature of siRNA, L96 represents that the 3' end of the positive strand of the siRNA is coupled with L96, which is N-[tris(GalNAc-alkyl)-amide-decanoyl]-4-hydroxyprolyl.

[0088] Example 1: Screening for the effect of siRNA naked sequence knockdown

[0089] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.

[0090] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA (dsRNA) mixture: The sequences shown in Table 1 were used, with NC serving as the negative control. The remaining sequences were derived from human AGT mRNA (NM_001382817.3 in the NCBI database; see Table 1 for specific locations). 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.

[0091] Table 1. Description of siRNA sequences Note: NA indicates that NC is a negative control and is not derived from NM_001382817.3.

[0092] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0093] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.

[0094] 5) Prepare the qPCR system on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), and 0.4 μl hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG) to each well. Dilute 100 ng of RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles. The results of siRNA naked sequence screening are shown in Table 2.

[0095] Table 2. Effects of siRNA naked sequence knockdown

[0096] Example 2: Screening for the knockdown effect of GalNAc coupling modification sequences

[0097] 2.1 GalNAc Coupling

[0098] Next, we modified the siRNA to improve its stability in vivo and in vitro, enhance its activity against the target, and reduce its activity against non-target sites. Unless otherwise stated, L96 delivery was used for both in vivo and in vitro screening of single-target sequences to more accurately reflect the effects of liver-targeting siRNA. The siRNA was conjugated to L96 at the 3' end of the sense strand. The modified sequences of the sense and antisense strands of the siRNA are shown in Table 3, and the sequences after conjugation with L96 are shown in Table 4. L96 is N-[tris(GalNAc-alkyl)-amide-decanoyl]-4-hydroxyprolyl, and its structure after conjugation with siRNA is shown below:

[0099] Where X is O.

[0100] Table 3. Description of modified siRNA sequences Note: mA, mG, mC, and mU are 2'-O-methyl modified A, G, C, and U, respectively; fA, fG, fC, and fU are 2'-fluorine modified A, G, C, and U, respectively; s represents thiophosphate linkage.

[0101] Table 4. Description of GalNAc-modified siRNA sequences

[0102] 2.2 Knockdown Experiment

[0103] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.

[0104] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The sense and antisense strand sequences of the siRNA are shown in Table 4. 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.

[0105] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0106] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.

[0107] 5) Prepare the qPCR system and perform the reaction on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), and 0.4 μl hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG) to each well. Dilute 100 ng of RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles. The inhibition rate of each L96-coupled siRNA against ATG mRNA is shown in Table 5.

[0108] Table 5. Inhibition results of GalNAc-modified siRNA

[0109] Example 3: IC50 of GalNAc-modified siRNA in HepG2 cells 50 filter

[0110] The method of modifying siRNA with GalNAc in this embodiment is the same as that in Example 2.

[0111] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.

[0112] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The siRNA sequences are shown in Table 6. The above siRNA solution was mixed with the LipoRNAiMAX (invitrogen) solution to prepare a stock solution, which was then incubated at room temperature for 5 minutes. Then, the stock solutions of each siRNA were serially diluted.

[0113] Table 6. Description of GalNAc-coupled modified siRNA sequences

[0114] 3) Add 50 μl of the corresponding siRNA mixture to each well, so that the incubation concentrations of each siRNA are 50 nM, 10 nM, 2 nM, 0.4 nM, 0.08 nM and 0.016 nM respectively.

[0115] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.

[0116] 5) Prepare the qPCR system on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104), and 0.4 μl hYJH-014 2PR (SEQ ID NO.209) to each well. Dilute 100 ng RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles. The IC50 of each L96-coupled siRNA was calculated. 50 See Table 7.

[0117] Table 7 IC50 of GalNAc-modified siRNA 50

[0118] Example 4: Inhibition rate of GalNAc-conjugated siRNA on HepG2 AGT synthesis

[0119] The method of modifying siRNA with GalNAc in this embodiment is the same as that in Example 2.

[0120] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.

[0121] 2) Preparation of the LipoRNAiMAX (Invitrogen) and siRNA mixture. The siRNA sequences are shown in Table 8. Dilute 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (Invitrogen) separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). Then mix the siRNA solution with the LipoRNAiMAX (Invitrogen) solution and incubate at room temperature for 5 minutes.

[0122] Table 8. Description of GalNAc-coupled modified siRNA sequences

[0123] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0124] 4) Replace with fresh complete culture medium 48 hours after transfection, and continue culturing for another 24 hours before collecting the culture medium from each well.

[0125] 5) The AGT protein in the cell culture medium of each group was detected using the human AGT ELISA kit and compared with the group corresponding to the NC sequence. The inhibition rate of each sequence was calculated. The inhibition rate of AGT expression in HepG2 cells by L96-coupled siRNA is shown in Table 9.

[0126] Table 9. Inhibition rate of GalNAc-coupled siRNA on AGT expression in HepG2 cells.

[0127] Example 5: mRNA knockdown and protein inhibition efficiency of GalNAc-coupled modification sequence in hAGT humanized mice

[0128] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0129] In vivo evaluation of siRNAs screened from in vitro studies was performed in hAGT humanized mice. The selected sequences are shown in Table 10. The pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in mice after subcutaneous injection of the siRNAs.

[0130] Table 10. Description of GalNAc-modified siRNA sequences

[0131] 1) Evaluation of protein inhibition efficiency

[0132] Each GalNAc-conjugated siRNA was administered as a single subcutaneous dose (3 mg / kg) on ​​day 1 of the experiment. Whole blood samples from hAGT-humanized mice were collected on days 7 and 14 post-administration. After blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. AGT protein levels in serum samples from each group were detected using a human AGT ELISA kit (Lianke Biotechnology).

[0133] As shown in Figures 1 and 2, the L96-conjugated siRNAs (YJH-014B-830m1-L96, YJH-014B-896m1-L96, YJH-014B-964m1-L96, YJH-014B-1337m1-L96, YJH-014B-1882m2-L96, YJH-014B-ALN) Subcutaneous injection of m1-L96 (3 mg / kg) resulted in the following inhibitory effects on serum AGT protein in humanized hAGT mice: 3.5%, 17.3%, 16.0%, 20.4%, 77.3%, and 83.5% on day 7, and 5.4%, 3.0%, 5.0%, 0%, 71.6%, and 81.2% on day 14. The Blank group was the untreated group. These results indicate that subcutaneous injection of sequences YJH-014B-1882m2-L96 and YJH-014B-ALN m1-L96 significantly reduced the downregulation of serum hAGT protein in mice.

[0134] 2) Evaluation of AGT mRNA knockdown efficiency

[0135] Liver samples from hAGT-humanized mice were collected on day 14 after drug administration, and the AGT mRNA level in all samples was analyzed by RT-qPCR. The liver tissue of hAGT-humanized mice was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and incubation at room temperature for 2-3 minutes, centrifugation was performed. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in the correct order, and total RNA was extracted using the BSC69 program. PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The primers were the same as in Example 2, hYJH-014 2PF and hYJH-014 2PR.

[0136] As shown in Figure 3, L96-conjugated siRNAs (YJH-014B-830m1-L96, YJH-014B-896m1-L96, YJH-014B-964m1-L96, YJH-014B-1337m1-L96, YJH-014B-1882m2-L96, YJH-014B-ALN m1-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on hAGT humanized mouse AGT mRNA of 2%, 6%, 0%, 3.5%, 13%, 83%, and 93% respectively on day 14 after administration. The Blank group was the untreated group. The results showed that, after subcutaneous injection, the knockdown of liver mRNA on day 14 of each sequence was consistent with the downregulation efficiency of serum AGT protein. Sequences YJH-014B-1882m2-L96 and YJH-014B-ALN m1-L96 had better knockdown efficiency for AGT mRNA.

[0137] Example 6: Comparison of knockdown effects of m1 and m2 modified sequences in the livers of hAGT humanized mice

[0138] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0139] The m1 and m2 modified sequences in Table 11 were evaluated in hAGT humanized mice.

[0140] Table 11 Description of GalNAc-modified siRNA sequences

[0141] Liver samples from hAGT-humanized mice were collected on day 7 after drug administration, and the AGT mRNA level in all samples was analyzed by RT-qPCR. Liver tissue from hAGT-humanized mice was lysed using lysis buffer (BioFlux), and chloroform (purchased from MREDA) was added for extraction. After vortexing and incubation at room temperature for 2-3 minutes, the mixture was centrifuged. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in order, and total RNA was extracted using the BSC69 program.

[0142] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The reaction primers were the same as in Example 2, namely hYJH-014 2PF and hYJH-014 2PR.

[0143] As shown in Figure 4, L96-conjugated siRNAs (YJH-014B-964m1-L96, YJH-014B-964m2-L96, YJH-014B-1882m1-L96, YJH-014B-1882m2-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on AGT mRNA in hAGT humanized mice on day 7 of 14.5%, 50.5%, 41.25%, and 80.5%, respectively. The Blank group was the untreated group. These results indicate that the sequences modified using the m2 method have better pharmacological efficacy in vivo than those modified using the m1 method.

[0144] Example 7: Knockdown effect of GalNAc-coupled modification sequence in the liver of hAGT humanized mice

[0145] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0146] In vivo evaluation of siRNAs screened from in vitro studies was performed in hAGT humanized mice. The selected sequences are shown in Table 12. The pharmacodynamic activities of the following GalNAc-conjugated siRNAs targeting AGT were analyzed in mice after subcutaneous injection of the siRNAs.

[0147] Table 12 Description of GalNAc-modified siRNA sequences

[0148] Each GalNAc-conjugated siRNA was administered as a single subcutaneous dose (3 mg / kg) on ​​day 1 of the experiment. Liver samples from hAGT-humanized mice were collected on day 7 after administration, and AGT mRNA levels in all samples were analyzed by RT-qPCR. Liver tissue from hAGT-humanized mice was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and incubation at room temperature for 2–3 minutes, the mixture was centrifuged. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in the correct order, and total RNA was extracted using the BSC69 program.

[0149] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The reaction primers were the same as in Example 2, namely hYJH-014 2PF and hYJH-014 2PR.

[0150] As shown in Figure 5, L96-conjugated siRNAs (YJH-014B-896m2-L96, YJH-014B-1337m2-L96, YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, YJH-014B-1882m2-L96, YJH-014B-ALN m1-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on AGT mRNA in hAGT humanized mice of 54%, 48%, 78%, 81%, 86%, and 94%, respectively, after 7 days of administration. The Blank group was the untreated group. The results indicate that subcutaneous injection of GalNAc-conjugated siRNAs can downregulate AGT mRNA expression.

[0151] Example 8: Protein inhibitory effect of GalNAc-coupled modification sequence in the serum of hAGT humanized mice

[0152] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0153] In vivo evaluation of siRNAs screened from in vitro studies was performed in hAGT humanized mice. The selected sequences are shown in Table 13. The pharmacodynamic activities of the following GalNAc-conjugated siRNAs targeting AGT were analyzed in mice after subcutaneous injection of the siRNAs.

[0154] Table 13. Description of GalNAc-modified siRNA sequences

[0155] Each GalNAc-conjugated siRNA was administered as a single subcutaneous dose (3 mg / kg) on ​​day 1 of the experiment. Whole blood samples were collected from mice on day 7 after administration. After blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. AGT protein levels in serum samples from each group were detected using a human AGT ELISA kit.

[0156] As shown in Figure 6, L96-conjugated siRNAs (YJH-014B-896m2-L96, YJH-014B-1337m2-L96, YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, YJH-014B-1882m2-L96, YJH-014B-ALN m1-L96) administered as a single subcutaneous injection at a dose of 3 mg / kg showed inhibitory effects on serum AGT protein in humanized hAGT mice of 37%, 41%, 70%, 71%, 74%, and 82%, respectively, after 7 days of administration. The Blank group was the untreated group. The results indicate that subcutaneous injection of GalNAc-conjugated siRNA can downregulate serum hAGT protein in mice.

[0157] Example 9: Knockdown effect of GalNAc-coupled modification sequence in primary monkey hepatocytes

[0158] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0159] 1) Resuscitate primary monkey hepatocytes (purchased from Miaoshun Biotechnology Co., Ltd.), collect cells by centrifugation, resuspend cells in plating medium, count cells using a hemocytometer, and then add 500,000 cells to each well of a 24-well cell culture plate for culture.

[0160] 2) Transfect with GalNAc coupling modification sequences, using the sequences shown in Table 14.

[0161] Table 14. Description of GalNAc-coupled modified siRNA sequences

[0162] 3) Add 500 nM of the corresponding group's siRNA solution to each well.

[0163] 4) After culturing for 72 hours, discard the culture medium and extract the cell RNA.

[0164] 5) Prepare the qPCR system on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104), and 0.4 μl hYJH-014 2PR (SEQ ID NO.209) to each well. Dilute 100 ng RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles.

[0165] As shown in Figure 7, among the L96-conjugated siRNAs, YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, YJH-014B-1882m2-L96, and YJH-014B-ALN m1-L96 exhibited inhibitory effects of 79%, 87%, 56%, and 89% respectively in primary monkey hepatocytes. The Blank group was the untreated group. The results indicate that each siRNA had a significant inhibitory effect in primary monkey hepatocytes.

[0166] Example 10: Knockdown effect of GalNAc-coupled modification sequence in human primary hepatocytes

[0167] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0168] 1) Resuscitate human primary hepatocytes (purchased from Livo Biotechnology (Shenzhen) Co., Ltd.), collect cells by centrifugation, resuspend cells in plating medium, count cells using a hemocytometer, and then add 500,000 cells to each well of a 12-well cell culture plate for culture.

[0169] 2) Transfect with GalNAc coupling modification sequences, using the sequences shown in Table 14.

[0170] 3) Add 500 nM of the corresponding group's siRNA solution to each well.

[0171] 4) After culturing for 72 hours, discard the culture medium and extract the cell RNA.

[0172] 5) Prepare the qPCR system on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl hYJH-014 2PF (SEQ ID NO.104), and 0.4 μl hYJH-014 2PR (SEQ ID NO.209) to each well. Dilute 100 ng RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles.

[0173] As shown in Figure 8, among the L96-conjugated siRNAs, YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, YJH-014B-1882m2-L96, and YJH-014B-ALN m1-L96 exhibited inhibitory effects of 57%, 65%, 61%, and 67% in human primary hepatocytes, respectively. The Blank group was the untreated group. The results indicate that each siRNA had a significant inhibitory effect in human primary hepatocytes.

[0174] Example 11: Duration of efficacy of GalNAc-coupled sequences in a humanized hAGT mouse model of hypertension

[0175] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0176] The durability of siRNA efficacy was evaluated in a humanized hAGT mouse model of hypertension, using sequences from Table 15. Following subcutaneous injection of siRNA, the pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in mice.

[0177] Table 15. Description of GalNAc-modified siRNA sequences

[0178] 1) Modeling was performed 14 days before administration. Mice were intravenously injected with AAV-hRENIN to induce hypertension, while the control group was given blank AAV vector. Each GalNAc-conjugated siRNA was administered at one dose concentration (20 mg / kg) via a single subcutaneous injection on the first day of the experiment.

[0179] 2) Systolic blood pressure, diastolic blood pressure, and mean arterial pressure of mice in each group were measured on days -15, -1, 7, 14, 21, and 28 after the start of the experiment.

[0180] As shown in Figure 9, subcutaneous injection of 20 mg / kg of L96-conjugated siRNAs (YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, YJH-014B-1882m2-L96, YJH-014B-ALN m1-L96) can effectively reduce blood pressure levels in hAGT humanized hypertensive model mice for 28 days. The Blank group (blank group) consisted of healthy mice, while the Model group consisted of hypertensive model mice that did not receive the drug.

[0181] Example 12: Evaluation of the efficacy of multiple-dose administration of GalNAc-coupled sequences in a humanized hAGT mouse model of hypertension. The method of modifying siRNA with GalNAc in this example is the same as in Example 2.

[0182] The efficacy of siRNA was evaluated using multiple doses in a humanized hAGT mouse model of hypertension, using sequences listed in Table 16. Following subcutaneous injection of siRNA, the pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in mice.

[0183] Table 16. Description of GalNAc-modified siRNA sequences

[0184] 1) Modeling was performed 21 days before drug administration. Mice were intravenously injected with AAV-hRENIN to induce hypertension, while the control group was given blank AAV vector. GalNAc-conjugated siRNA was administered at three concentrations (5 mg / kg, 10 mg / kg, and 20 mg / kg) via single subcutaneous injection on day 1 of the experiment.

[0185] 2) On days D-2, D7, D14, D21 and D28 after the start of the experiment, the systolic blood pressure, diastolic blood pressure and mean arterial pressure of each group of mice were measured.

[0186] As shown in Figure 10, different doses of YJH-014-1882-m2 can effectively lower blood pressure, with 20 mpk showing the best effect. YJH-014-1882-m2 at 10 mpk can achieve the same blood pressure lowering effect as 20 mpk after 28 days of administration. There is a dose-dependent relationship between YJH-014 and the blood pressure lowering effect. The Blank group (blank group) consists of healthy mice, and the Model group consists of hypertensive model mice that are not given any medication.

[0187] 3) On day 29 after drug administration, liver samples from hAGT humanized mice were collected, and the AGT mRNA level in all samples was analyzed by RT-qPCR. The hAGT humanized mouse liver tissue was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and mixing, the mixture was incubated at room temperature for 2-3 minutes, centrifuged, and the supernatant was transferred to a well plate and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the well plates were arranged in order, and total RNA was extracted using the BSC69 program.

[0188] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles. The reaction primers were the same as in Example 2, namely hYJH-014 2PF and hYJH-014 2PR.

[0189] As shown in Figure 11, YJH-014B-1882m2-L96, administered via single subcutaneous injection at doses of 5 mg / kg, 10 mg / kg, and 20 mg / kg, showed dose-dependent inhibition of AGT mRNA in humanized hypertensive model mice after 28 days of administration, with inhibition rates of 73%, 82%, and 89%, respectively. The Blank group (blank group) consisted of healthy mice, while the Model group consisted of hypertensive model mice that did not receive the drug. The results indicate that subcutaneous injection of GalNAc-conjugated siRNA can dose-dependently downregulate AGT mRNA expression.

[0190] 4) Whole blood samples were collected from hAGT-humanized mice on day 29 after drug administration. After the blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. The hAGT protein level in the serum samples of each group was detected using a human AGT ELISA kit (Lianke Biotechnology).

[0191] As shown in Figure 12, YJH-014B-1882m2-L96, administered via single subcutaneous injection at doses of 5 mg / kg, 10 mg / kg, and 20 mg / kg, respectively, showed dose-dependent inhibition of hAGT protein expression in humanized hypertensive mouse models after 28 days of treatment, with inhibition rates of 73%, 79%, and 82%, respectively. The Blank group (blank group) consisted of healthy mice, while the Model group consisted of hypertensive mice that did not receive the drug. The results indicate that subcutaneous injection of GalNAc-conjugated siRNA can dose-dependently downregulate hAGT protein expression.

[0192] Example 13: Comparison of knockdown effects of GalNAc coupled with different modified sequences

[0193] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0194] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.

[0195] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The sense and antisense strand sequences of the siRNA are shown in Table 17. 10 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.

[0196] Table 17 Description of GalNAc-modified siRNA sequences

[0197] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0198] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.

[0199] 5) Prepare the qPCR system and perform the reaction on ice. Add 1 μl of One Step SYBR Green Mix (Novizan), 10 μl of 2*One Step SYBR Green Mix (Novizan), 0.4 μl of hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), and 0.4 μl of hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG) to each well. Dilute 100 ng of RNA in 8.2 μl of RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles. The inhibition rate of each L96-coupled siRNA against ATG mRNA is shown in Table 18.

[0200] Table 18 Inhibition results of GalNAc coupled with different modified siRNAs

[0201] As shown in Table 18 and Figure 13, L96 coupled with different modified siRNAs, YJH-014B-1882m2-L96, YJH-014B-1882m4-L96, YJH-014B-1882m5-L96, YJH-014B-1882m6-L96, and YJH-014B-1882m7-L96, exhibited inhibitory effects of 93%, 66%, 89%, 29%, and 65%, respectively. The Blank group was the untreated group. The results indicate that the m2 modification method performed best.

[0202] Example 14: Comparison of knockdown effects of GalNAc-modified siRNA and different concentrations of *Gynostemma pentaphyllum*

[0203] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0204] 1) Human liver cancer cells HepG2 (cell bank of Kunming Institute of Cell Bank, Chinese Academy of Sciences) in logarithmic growth phase were digested with trypsin, and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, counted with a hemocytometer, and then 50,000 cells were added to each well of a 24-well cell culture plate for culture.

[0205] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture. The sense and antisense strand sequences of the siRNA are shown in Table 19. 10 nM / well or 1 nM / well of siRNA and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted separately in 25 μl of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (invitrogen) solution and incubated at room temperature for 5 minutes.

[0206] Table 19. Description of GalNAc-modified siRNA sequences

[0207] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0208] 4) After culturing for 48 hours, discard the culture medium and extract the cell RNA.

[0209] 5) Prepare the qPCR system and perform the reaction on ice. Add 1 μl of One Step SYBR Green Mix (Novizan), 10 μl of 2*One Step SYBR Green Mix (Novizan), 0.4 μl of hYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), and 0.4 μl of hYJH-014 2PR (SEQ ID NO.209: TCTTGGCCTGAATTGGAGCAG) to each well. Dilute 100 ng of RNA in 8.2 μl of RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles. The inhibition rate of each L96-coupled siRNA against ATG mRNA is shown in Table 20.

[0210] Table 20 Inhibition results of GalNAc-modified siRNA at different concentrations

[0211] As shown in Table 20 and Figure 14, the L96-conjugated siRNA YJH-014B-1882m2-L96 exhibited 91% and 94% inhibitory effects at 1 nM and 10 nM, respectively. At 1 nM, it was superior to *Gynostemma pentaphyllum* YJH-014B-ALN m1-L96. The Blank group was the untreated group. The results indicate that YJH-014B-1882m2-L96 performed better.

[0212] Example 15: Evaluation of GalNAc-coupled sequence knockdown in a cynomolgus monkey model of hypertension

[0213] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0214] Single-dose knockdown of siRNA was evaluated in a cynomolgus monkey hypertension model, using sequences listed in Table 21. Following subcutaneous injection of siRNA, the blood pressure pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in cynomolgus monkeys.

[0215] Table 21 Description of GalNAc-modified siRNA sequences

[0216] 1) Whole blood samples were collected on day 14 (14 days before administration), and liver tissue samples were obtained by liver biopsy. The expression levels of AGT protein and mRNA were measured and used as baseline data. Each GalNAc-conjugated siRNA test substance was administered as a single subcutaneous dose (3 mg / kg) on ​​day 0.

[0217] 2) Whole blood samples were collected from cynomolgus monkeys on days 14, 21, 28, 35, 42, 60, 75, and 90 after drug administration. After the blood clotted, serum was collected by centrifugation at 3000 rpm for 10 minutes at 4°C. The AGT protein level in the serum samples of each group was detected using a human AGT ELISA kit.

[0218] As shown in Figure 15 and Table 22, L96-conjugated siRNAs (YJH-014B-1861m2-L96, YJH-014B-1867m2-L96, and YJH-014B-1882m2-L96) were administered via a single subcutaneous injection at a dose of 3 mg / kg. Following administration, compared to their respective baselines on D-14, the YJH-014B-1861m2-L96 group showed inhibition of AGT protein in monkey serum starting from D14, reaching a maximum inhibition rate (50.32%) on D21. By D60, AGT levels in monkey serum... The inhibition rate of T protein remained stable at approximately 33%. The YJH-014B-1867m2-L96 group inhibited AGT protein in monkey serum from day 14, reaching a maximum inhibition rate of 37.64% on day 35, and stabilizing at approximately 25% on day 60. The YJH-014B-1882m2-L96 group also inhibited AGT protein in monkey serum from day 14, reaching a maximum inhibition rate of 72.81% on day 28, and stabilizing at approximately 34% on day 75. These results indicate that subcutaneous injection of GalNAc-conjugated siRNA can downregulate AGT protein in cynomolgus monkey serum, with the YJH-014B-1882m2-L96 group showing the best performance.

[0219] Table 22. Inhibition rate of AGT protein in monkey liver at different time points using GalNAc-coupled siRNA.

[0220] 3) Cynomolgus monkey liver samples were collected on days 21, 42, and 90 after drug administration. AGT mRNA levels in all samples were analyzed by RT-qPCR. Cynomolgus monkey liver tissue was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and incubation at room temperature for 2-3 minutes, the mixture was centrifuged. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in the correct order, and total RNA was extracted using the BSC69 program.

[0221] Prepare the qPCR system on ice. Add 1 μl One Step SYBR Green Mix (Novizan), 10 μl 2*One Step SYBR Green Mix (Novizan), 0.4 μl mkYJH-014 2PF (SEQ ID NO.104: ACAATGAGAGTACCTGTGAGCA), and 0.4 μl mkYJH-014 2PR (SEQ ID NO.267: GTGCCAAAGACAGCCGTTGG) to each well. Dilute 100 ng of RNA in 8.2 μl RNase ddH2O (Novizan) and add it to the well. Mix well and place in a qPCR instrument for reaction. PCR reaction conditions: 50℃ for 15 min pre-denaturation, 95℃ for 1 min, 95℃ for 15 sec annealing, 60℃ for 1 min extension, for 39 cycles.

[0222] As shown in Figure 16 and Table 23, compared with their respective baselines on D-14, the YJH-014B-1861m2-L96 group showed inhibition of AGT mRNA in monkey liver tissue from D21, reaching a maximum inhibition rate (45.59%) on D42. By D90, the AGT mRNA level in monkey liver tissue returned to baseline. Due to significant differences between groups, there was no significant inhibition compared to D-14. The YJH-014B-1867m2-L96 group showed no significant inhibition from administration to D90. The YJH-014B-1882m2-L96 group showed inhibition of AGT mRNA in monkey liver tissue from D21, reaching a maximum (38.83%) and maintaining it until D42. By D90, the AGT mRNA level in monkey liver tissue essentially returned to baseline. The results indicate that subcutaneous injection of GalNAc-conjugated siRNA can dose-dependently downregulate AGT mRNA expression.

[0223] Table 23 Inhibition rate of AGT mRNA in monkey liver at different time points using GalNAc-coupled siRNA

[0224] Example 16: Duration of Blood Pressure Efficacy of GalNAc Coupled Sequence in a Cynomolgus Monkey Hypertension Model

[0225] The method for modifying siRNA with GalNAc in this implementation is the same as in Example 2.

[0226] The blood pressure efficacy of single-dose siRNA administration was evaluated in a cynomolgus monkey hypertension model, using sequences from Table 24. Following subcutaneous injection of siRNA, the blood pressure pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting AGT was analyzed in cynomolgus monkeys.

[0227] Table 24. Description of GalNAc-modified siRNA sequences

[0228] 1) The GalNAc-conjugated siRNA was administered at a dose concentration of 3 mg / kg via a single subcutaneous injection on day D0 of the experiment.

[0229] 2) After the start of the experiment, the systolic blood pressure, diastolic blood pressure, and mean arterial pressure of each group of cynomolgus monkeys were measured on day 1 before drug administration (D-1), and on days 2, 7, 21, 42, and 60 after drug administration.

[0230] As shown in Figure 17, after a single subcutaneous injection of L96-conjugated siRNAs (YJH-014B-1882m2-L96 and YJH-014B-ALN m1-L96) at a dose of 3 mg / kg, compared with D-1, the blood pressure of cynomolgus monkeys decreased over time after a single dose. Among them, YJH-014B-1882m2-L96 was superior to YJH-014B-ALN m1-L96, indicating that YJH-014B-1882m2-L96 had the best antihypertensive effect.

[0231] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent or salt thereof for inhibiting expression of angiotensinogen (AGT), characterized in that, The dsRNA agent comprises a sense strand selected from SEQ ID NO. 1-102 or a modified sequence thereof and an antisense strand selected from SEQ ID NO. 106-207 or a modified sequence thereof, which form a double-stranded region by base pairing.

2. The dsRNA agent or salt thereof of claim 1, wherein At least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.

3. The dsRNA agent or salt thereof of claim 2, wherein At least one nucleotide in the sense strand or the antisense strand is a nucleotide analog or a nucleotide with a modified 2' position of ribosyl; the nucleotide analog includes an iso-nucleotide, LNA, ENA, cEt-BNA, UNA or GNA; the nucleotide with a modified 2' position of ribosyl includes a 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl, 2'-O-dimethylaminoethyl, 2'-O-dimethylaminopropyl, T-O-dimethylaminoethoxyethyl or 2'-O-N-methylacetamido modified nucleotide.

4. The dsRNA agent or salt thereof of claim 2, wherein At least one phosphate group in the sense strand or the antisense strand is a phosphate group with a modification group.

5. The dsRNA agent or salt thereof of claim 3 or 4, wherein, The sense strand is selected from the modified sequences shown in SEQ ID NO. 211-233, and the antisense strand is selected from the modified sequences shown in SEQ ID NO. 235-257; wherein m represents a 2'-O-methyl substitution modification, f represents a 2' fluoro modification, and s represents a thio backbone modification.

6. The dsRNA agent or salt thereof of claim 5, wherein The sequence of the dsRNA is selected from one of the following sequences of dsRNAs: A) YJH-014B-1861m2, the nucleotide sequence of the sense strand is shown in SEQ ID NO. 229: fU-s-mG-s-fU-mG-fA-mA-fA-fC-fA-fA-mA-fA-mA-fA-mA-fG-mU-fG-m U-fU, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 253: mA-s-fA-s-mC-fA-mC-fU-mU-fU-mU-mG-mU-fU-mU-fC-m A-fC-mA-s-mA-s-mA; B) YJH-014B-1867m2, the nucleotide sequence of the sense strand is shown in SEQ ID NO. 231: fA-s-mC-s-fA-mA-fA-mA-fA-fA-fG- mU-fG-mU-fU-mC-fC-mC-fU-mU-fU, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO 255: mA-s-fA-s-mA-fG-mG-fG-mA-fA-mC-f A-mC-mU-mU-fU-mU-fU-mU-fG-mU-s- mU-s-mU; ​ C) YJH-014B-1882m2, whose sense strand nucleotide sequence is shown as SEQ ID NO. 233: fC-s-mU-s-fU-mU-fU-mC-fA-fA-fG-mU-fU-mG-fA-mG-fA-mA-fC-mA-fA, and its antisense strand nucleotide sequence is shown as SEQ ID NO. 257: mU-s-fU-s-mG-fU-mU-fC-mU-fC-mA-fA-mC-mU-mU-fG-mA-fA-mA-fA-mG-s-mG-s-mG; wherein mA, mG, mC and mU are 2'-O-methyl-modified A, G, C and U, respectively; fA, fG, fC and fU are 2'-fluoro-modified A, G, C and U, respectively; and s is a phosphorothioate linkage.

7. The dsRNA agent or salt thereof of claim 1, wherein The dsRNA agent or salt thereof further comprises a ligand.

8. The dsRNA agent or salt thereof of claim 7, wherein The ligand is conjugated to the 3' end of the sense strand of the dsRNA agent or salt thereof.

9. The dsRNA agent or salt thereof of claim 7 or 8, wherein, The ligand comprises a single antibody, a double antibody, a monosaccharide, a polysaccharide, and a cationic polymer.

10. The dsRNA agent or salt thereof of claim 9, wherein The ligand is N-acetylgalactosamine (GalNAc) or a derivative thereof.

11. The dsRNA agent or salt thereof of claim 10, wherein, The ligand is one or more GalNAc derivatives attached via a monovalent, divalent or trivalent branched linker.

12. The dsRNA agent or salt thereof of claim 11, wherein, The ligand contains the following structural formula:

13. The dsRNA agent or salt thereof of claim 12, wherein The ligand is L96, which is N-[tris(GalNAc-alkyl)-amidodecanoyl]-4-hydroxyprolinol.

14. The dsRNA agent or salt thereof of claim 13, wherein, The dsRNA agent or salt thereof is conjugated to the ligand as shown in the following formula: wherein X is O or S.

15. The dsRNA agent or salt thereof of claim 14, wherein The X is O.

16. A cell, comprising: The cell comprises the dsRNA agent or salt thereof of any one of claims 1-15.

17. A pharmaceutical composition for inhibiting expression of a gene encoding AGT, characterized by, The pharmaceutical composition comprises the dsRNA agent or salt thereof of any one of claims 1-15.

18. A kit comprising, The kit comprises the dsRNA agent or salt thereof of any one of claims 1-15, or the pharmaceutical composition of claim 17.

19. Use of the dsRNA agent or salt thereof of any one of claims 1-15, or the use of the pharmaceutical composition of claim 17, or the use of the kit of claim 18, in the manufacture of a medicament for inhibiting the expression of AGT in a cell or in the manufacture of a medicament for treating hypertension.

Images