Angiotensinogen-targeting double-stranded RNA molecule, modifier thereof and use thereof

Abstract

The present invention belongs to the technical field of nucleic acid molecules. Provided are an angiotensinogen-targeting double-stranded RNA molecule, a modifier thereof and the use thereof. The technical problem to be solved is how to effectively inhibit the expression of an AGT gene. According to the new AGT-targeting double-stranded RNA molecule and the modifier thereof, both in vivo and in vitro experiments show that the double-stranded RNA molecule and the modifier thereof can effectively inhibit the expression of an AGT gene. This demonstrates that the double-stranded RNA molecule and the modifier thereof have a significant druggability and application value in the field of diseases associated with abnormal AGT gene expression, such as hypertension.

Description

Double-stranded RNA molecules targeting angiotensinogen, their modifications, and applications Technical Field

[0001] This invention belongs to the field of nucleic acid technology, specifically relating to double-stranded RNA molecules that target angiotensinogen, their modifications, and applications.

[0002] Cross-references to related applications

[0003] This invention claims priority to Chinese patent application No. 202411043231.0, filed on July 31, 2024, the entire contents of which are incorporated herein by reference. Background Technology

[0004] Angiotensinogen (AGT), also known as SERPINA8 or ANHU, is encoded by the AGT gene and primarily produced by the liver. It is a rate-limiting substrate of the renin-angiotensin system (RAS) and a precursor of angiotensin peptides. Under the influence of active renin in plasma, AGT is cleaved into angiotensin I, which is subsequently converted into angiotensin II by circulating and locally expressed angiotensin-converting enzyme (ACE). Angiotensin II is the most important bioactive substance in the renin-angiotensin-aldosterone system (RAAS). Through binding to the angiotensin II type 1 receptor (AT1R), it leads to arterial vasoconstriction and adrenal cortical aldosterone secretion, thus playing a crucial role in blood pressure regulation. Excessive production of angiotensin II or overstimulation of AT1R, leading to RAAS system dysfunction, will cause hypertension. Numerous studies have shown that polymorphisms in the AGT gene are closely related to the body's ability to regulate blood pressure, and association studies in the Han Chinese population have shown that polymorphisms at the AGT M235T site are associated with the occurrence of essential hypertension (ER).

[0005] Hypertension is a common cardiovascular disease worldwide, with a global prevalence of 10% to 20%. It can lead to complications affecting the cerebrovascular, cardiac, and renal systems and is a major risk factor for various diseases, disorders, and conditions (such as stroke, coronary artery disease, chronic kidney disease, myocardial infarction, heart failure, aneurysm, peripheral artery disease, heart injury, and other cardiovascular-related diseases). Currently, there are five main classes of drugs for treating hypertension: diuretics, beta-blockers, calcium channel blockers, angiotensin-converting enzyme inhibitors, and angiotensin II receptor blockers. Despite the wide variety of antihypertensive drugs available, more than two-thirds of subjects cannot achieve blood pressure control with a single antihypertensive drug and require two or more different classes. This further reduces the number of subjects with controlled blood pressure due to increased adherence and side effects with increased medication use.

[0006] Invention Overview

[0007] The technical problem to be solved by this application is how to effectively inhibit AGT gene expression, thereby providing drugs for the prevention or treatment of diseases caused by abnormal AGT gene expression.

[0008] To address the aforementioned technical problems, this application provides a double-stranded RNA molecule modification, wherein the double-stranded RNA modification is hcAGT-363M1GVP, hcAGT-358M1GVP, hcAGT-358M1, hcAGT-363M1, or hcAGT-363M34GVP; the double-stranded RNA modification comprises a sense strand and an antisense strand, the sequences of which are shown below:

[0009] (1) hcAGT-363M1GVP, Justice Chain: CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm-GalNAc (Justice Chain No. NO:1787); Antisense Chain: VPGmsAfsCmUmCmAfUmUmAmGmAmAmGmAfAmAfAmGmGmsUmsGm (Antisense Chain No. NO:1788);

[0010] (2) hcAGT-358M1GVP, Justice Chain: UmsCmsCmCmAmCmCfUfUfUmUmCmUmUmCmUmAmAmUm-GalNAc (Justice Chain No. NO: 1779); Antisense Chain: VPAmsUfsUmAmGmAfAmGmAmAmAmGmGfUmGfGmGmAmsGmsAm (Antisense Chain No. NO: 1780);

[0011] (3) hcAGT-358M1, Justice Chain: UmsCmsCmCmAmCmCfUfUfUmUmCmUmUmCmUmAmAmUm (Justice Chain No. NO: 1595); Antisense Chain: AmsUfsUmAmGmAfAmGmAmAmAmGmGfUmGfGmGmAmsGmsAm (Antisense Chain No. NO: 1596);

[0012] (4) hcAGT-363M1, Justice Chain: CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm (Justice Chain No. NO: 1605); Antisense Chain: GmsAfsCmUmCmAfUmUmAmGmAmAmGmAfAmAfAmGmGmsUmsGm (Antisense Chain No. NO: 1606);

[0013] (5) hcAGT-363M34GVP, Justice Chain: CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm-GALNAC (Justice Chain No. NO:1801); Antisense Chain: VPGmsAfsCmUfC(d)AmT(d)UfAmGfAmAmGmAfAmAfAmGfGmsUmsGm (Antisense Chain No. NO:1802);

[0014] Af represents 2'-fluoroadenosine-3'-phosphate, Afs represents 2'-fluoroadenosine-3'-thiophosphate, Am represents 2'-methoxyadenosine-3'-phosphate (2'-methoxy-modified adenine ribonucleotide), Ams represents 2'-methoxyadenosine-3'-thiophosphate, and VPAms represents 5'-(E)-vinyl-2'-methoxyadenosine-3'-thiophosphate.

[0015] Cf represents 2'-fluorocytidine-3'-phosphate, Cm represents 2'-methoxycytidine-3'-phosphate, Cms represents 2'-methoxycytidine-3'-thiophosphate, and C(d) represents 2'-deoxycytidine-3'-phosphate.

[0016] Gf represents 2'-fluoroguanosine-3'-phosphate, Gm represents 2'-methoxyguanosine-3'-phosphate, Gms represents 2'-methoxyguanosine-3'-thiophosphate, and VPGms represents 5'-(E)-vinyl-2'-methoxyguanosine-3'-thiophosphate.

[0017] T(d) represents 2'-deoxythymidine-3'-phosphate, Uf represents 2'-fluorouridine-3'-phosphate, Ufs represents 2'-fluorouridine-3'-thiophosphate, Um represents 2'-methoxyuridine-3'-phosphate, and Ums represents 2'-methoxyuridine-3'-thiophosphate.

[0018] GalNAc represents N-acetylgalactosamine. The presence of GalNAc in the positive strand indicates that the 3' end of the positive strand of the siRNA is linked to the ligand GalNAc via a phosphate ester group to form an siRNA conjugate, the structure of which is shown in formula (18).

[0019] The modified nucleotides are linked together by 5'-3'-phosphodiester bonds or by thiophosphate diester bonds.

[0020] The double-stranded RNA molecule modification targets the AGT gene and can effectively inhibit AGT gene expression.

[0021] This application also provides a double-stranded RNA molecule, which may be any one of 440 siRNAs, wherein the siRNA includes a sense strand and an antisense strand that at least partially form a double-stranded region, and the sense strand includes a nucleotide sequence that is any odd-numbered sequence from sequence 1 to sequence 880 in the sequence listing.

[0022] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 15-30 bp.

[0023] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 23-27 bp.

[0024] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 21-23 bp.

[0025] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 19-21 bp.

[0026] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 17-25 bp.

[0027] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 17-23 bp.

[0028] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 17-19 bp.

[0029] In this application, the length of the double-stranded region of the double-stranded RNA molecule can be 19 bp.

[0030] In this application, the length of the sense strand in the double-stranded RNA molecule is no more than 30 nucleotides, and / or the length of the antisense strand is no more than 30 nucleotides.

[0031] In this application, each strand (sense strand and antisense strand) of the double-stranded RNA molecule has 15-30 nucleotides.

[0032] In this application, each strand (sense strand and antisense strand) of the double-stranded RNA molecule has 19-30 nucleotides.

[0033] In this application, the length of the sense strand in the double-stranded RNA molecule is no more than 19 nucleotides, and / or the length of the antisense strand is no more than 21 nucleotides.

[0034] In this application, in the double-stranded RNA molecule, at least one of the sense strand and the antisense strand contains a 3' overhang with at least one nucleotide, or at least one of the strands contains a 3' overhang with at least two nucleotides.

[0035] In this application, the antisense strand of the double-stranded RNA molecule comprises a nucleotide sequence that is any even-numbered sequence from sequence 1 to sequence 880 in the sequence listing.

[0036] In this application, in the double-stranded RNA molecule, the nucleotide sequence of the sense strand of the 440 siRNAs can be any odd-numbered sequence from sequence 1 to sequence 880 in the sequence listing, or a sequence having more than 90% identity with any odd-numbered sequence, and / or, the nucleotide sequence of the antisense strand can be any even-numbered sequence from sequence 1 to sequence 880 in the sequence listing, or a sequence having more than 90% identity with any even-numbered sequence.

[0037] The nucleotide sequence number of the sense strand of the 440 siRNAs can be n, and the nucleotide sequence number of the antisense strand of the 440 siRNAs can be n+1, where n can be any odd number from 1 to 880.

[0038] The nucleotide sequences of the positive strand of the 440 siRNAs also include sequences that have more than 90% identity with any of the odd-numbered sequences shown in Sequence 1 to Sequence 880 of the Sequence Listing;

[0039] The nucleotide sequences of the antisense strands of the 440 siRNAs also include sequences that have more than 90% identity with any of the even-numbered sequences shown in Sequence 1 to Sequence 880 of the Sequence Listing.

[0040] This application also provides double-stranded RNA molecule modifiers, which can be compounds containing modified nucleotides obtained by modifying at least one nucleotide of the double-stranded RNA molecule.

[0041] In this application, at least one nucleotide in the sense or antisense strand of the double-stranded RNA molecule modification may be a modified nucleotide.

[0042] In this application, the modified nucleotide in the double-stranded RNA molecule modification can be a compound formed by replacing the 2' hydroxyl group of the ribosyl group of the nucleotide with other groups, or a compound formed by modifying the thiophosphate group of the nucleotide, or a compound formed by modifying the bases on the nucleotide.

[0043] In this application, the modified nucleotide in the double-stranded RNA molecule modification is selected from at least one of the following: 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, nucleotides containing thiophosphate groups, deoxynucleotides, 2'-deoxynucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-... -O-allyl- modified nucleotides, 2'-C-alkyl- modified nucleotides, 2'-hydroxy- modified nucleotides, 2'-methoxyethyl- modified nucleotides, 2'-O-alkyl- modified nucleotides, morpholinyl nucleotides, aminophosphates, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing methylphosphate groups, nucleotides containing 5'-phosphate groups, and nucleotides containing 5'-phosphate mimics.

[0044] In this application, the modified nucleotide in the double-stranded RNA molecule modification can be any one of a1)-a4).

[0045] a1) 2'-methoxy modified nucleotides; a2) 2'-fluoro modified nucleotides; a3) 2'-methoxy modified and 5'-(E)-vinyl phosphate modified nucleotides; a4) 2'-deoxy modified nucleotides.

[0046] In this application, the sense strand of the double-stranded RNA molecule modification includes B1) and / or the antisense strand includes any one of C1)-C3).

[0047] B1) contains the modified nucleotides described in a1) and a2);

[0048] C1) contains the modified nucleotides described in a1) and a2);

[0049] C2) contains the modified nucleotides described in a1)-a3);

[0050] C3) contains the modified nucleotides described in a1)-a4).

[0051] In this application, the sense strand of the modified double-stranded RNA molecule contains the modified nucleotide as described in B1), and the antisense strand of the modified double-stranded RNA molecule contains the modified nucleotide as described in C1); or,

[0052] The sense strand of the modified double-stranded RNA molecule contains the modified nucleotides described in B1), and the antisense strand of the modified double-stranded RNA molecule contains the modified nucleotides described in C2); or,

[0053] The sense strand of the modified double-stranded RNA molecule contains the modified nucleotides described in B1), and the antisense strand of the modified double-stranded RNA molecule contains the modified nucleotides described in C3).

[0054] In this application, the double-stranded RNA molecule modification further includes linking the modified nucleotides via thiophosphate groups.

[0055] In this application, the double-stranded RNA molecule modification includes any one, two, three, four, five, or six of the following:

[0056] A 2'-methoxy-modified nucleotide, wherein the 2'-methoxy-modified nucleotide is located in the antisense and sense strands of the modified double-stranded RNA molecule, and wherein, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1-6 and 10-19 of the sense strand are 2'-methoxy-modified nucleotides; and at least the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are 2'-methoxy-modified nucleotides.

[0057] In this application, the double-stranded RNA molecule modification further includes nucleotides modified by 2'-fluorination, wherein the nucleotides modified by 2'-fluorination are located in the antisense strand and the sense strand of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 7, 8, and 9 of the sense strand are nucleotides modified by 2'-fluorination, and at least the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are nucleotides modified by 2'-fluorination;

[0058] In this application, in the double-stranded RNA molecule modification, the nucleotides at least at position 1 and position 2, and position 2 and position 3 of the sense strand are linked by phosphate thioester groups in the direction from the 5' end to the 3' end, and the nucleotides at least at position 1 and position 2, position 2 and position 3, position 19 and position 20, and position 20 and position 21 of the antisense strand are linked by phosphate thioester groups.

[0059] or,

[0060] The double-stranded RNA molecule modification comprises nucleotides modified with 2'-methoxy groups, wherein the 2'-methoxy-modified nucleotides are located in the antisense and sense strands of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1-4, 6, and 10-19 of the sense strand are nucleotides modified with 2'-methoxy groups; and at least the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups.

[0061] In this application, the double-stranded RNA molecule modification further includes nucleotides modified by 2'-fluorination, wherein the nucleotides modified by 2'-fluorination are located in the antisense strand and the sense strand of the double-stranded RNA molecule modification, and wherein, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 5, 7, 8, and 9 of the sense strand are nucleotides modified by 2'-fluorination, and at least the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are nucleotides modified by 2'-fluorination;

[0062] In this application, in the double-stranded RNA molecule modification, the nucleotides at least at position 1 and position 2, and position 2 and position 3 of the sense strand are linked by phosphate thioester groups in the direction from the 5' end to the 3' end, and the nucleotides at least at position 1 and position 2, position 2 and position 3, position 19 and position 20, and position 20 and position 21 of the antisense strand are linked by phosphate thioester groups.

[0063] or,

[0064] The double-stranded RNA molecule modification comprises nucleotides modified with 2'-methoxy groups, wherein the 2'-methoxy-modified nucleotides are located in the antisense and sense strands of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1-6 and 10-19 of the sense strand are nucleotides modified with 2'-methoxy groups; and at least the nucleotides at positions 1, 3-4, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups.

[0065] In this application, the double-stranded RNA molecule modification further includes nucleotides modified by 2'-fluorination, wherein the nucleotides modified by 2'-fluorination are located in the antisense strand and the sense strand of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 7, 8, and 9 of the sense strand are nucleotides modified by 2'-fluorination, and at least the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are nucleotides modified by 2'-fluorination;

[0066] In this application, the double-stranded RNA molecule modification further includes 2'-deoxy modified nucleotides, wherein the 2'-deoxy modified nucleotides are deoxynucleotides, and in the antisense strand of the double-stranded RNA molecule modification, at least 5 nucleotides of the antisense strand are 2'-deoxy modified nucleotides in the direction from the 5' end to the 3' end.

[0067] In this application, in the double-stranded RNA molecule modification, the nucleotides at least at position 1 and position 2, and position 2 and position 3 of the sense strand are linked by phosphate thioester groups in the direction from the 5' end to the 3' end, and the nucleotides at least at position 1 and position 2, position 2 and position 3, position 19 and position 20, and position 20 and position 21 of the antisense strand are linked by phosphate thioester groups.

[0068] or,

[0069] The double-stranded RNA molecule modification comprises nucleotides modified with 2'-methoxy groups, wherein the 2'-methoxy-modified nucleotides are located in the antisense and sense strands of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1-6 and 10-19 of the sense strand are nucleotides modified with 2'-methoxy groups; and at least the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups.

[0070] In this application, the double-stranded RNA molecule modification further includes nucleotides modified by 2'-fluorination, wherein the nucleotides modified by 2'-fluorination are located in the antisense strand and the sense strand of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 7, 8, and 9 of the sense strand are nucleotides modified by 2'-fluorination, and at least the nucleotides at positions 2, 14, and 16 of the antisense strand are nucleotides modified by 2'-fluorination;

[0071] In this application, the double-stranded RNA molecule modification further includes a 2'-deoxy modified nucleotide, wherein the 2'-deoxy modified nucleotide is a deoxynucleotide, and in the antisense strand of the double-stranded RNA molecule modification, at least the 6th position of the antisense strand is a 2'-deoxy modified nucleotide in the direction from the 5' end to the 3' end.

[0072] In this application, in the double-stranded RNA molecule modification, the nucleotides at least at position 1 and position 2, and position 2 and position 3 of the sense strand are linked by phosphate thioester groups in the direction from the 5' end to the 3' end, and the nucleotides at least at position 1 and position 2, position 2 and position 3, position 19 and position 20, and position 20 and position 21 of the antisense strand are linked by phosphate thioester groups.

[0073] or,

[0074] The double-stranded RNA molecule modification comprises nucleotides modified with 2'-methoxy groups, wherein the 2'-methoxy-modified nucleotides are located in the antisense and sense strands of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1-6 and 10-19 of the sense strand are nucleotides modified with 2'-methoxy groups; and at least the nucleotides at positions 1, 3-4, 6, 8-11, 13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups.

[0075] In this application, the double-stranded RNA molecule modification further includes nucleotides modified by 2'-fluorination, wherein the nucleotides modified by 2'-fluorination are located in the antisense strand and the sense strand of the double-stranded RNA molecule modification, and wherein, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 7, 8, and 9 of the sense strand are nucleotides modified by 2'-fluorination, and at least the nucleotides at positions 14 and 16 of the antisense strand are nucleotides modified by 2'-fluorination.

[0076] In this application, the double-stranded RNA molecule modification further includes 2'-deoxy modified nucleotides, wherein the 2'-deoxy modified nucleotides are in the antisense strand of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 2, 5, 7, and 12 of the antisense strand are 2'-deoxy modified nucleotides.

[0077] In this application, in the double-stranded RNA molecule modification, the nucleotides at least at position 1 and position 2, and position 2 and position 3 of the sense strand are linked by phosphate thioester groups in the direction from the 5' end to the 3' end, and the nucleotides at least at position 1 and position 2, position 2 and position 3, position 19 and position 20, and position 20 and position 21 of the antisense strand are linked by phosphate thioester groups.

[0078] or,

[0079] The double-stranded RNA molecule modification comprises nucleotides modified with 2'-methoxy groups, wherein the 2'-methoxy-modified nucleotides are located in the antisense and sense strands of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1-6 and 10-19 of the sense strand are nucleotides modified with 2'-methoxy groups; and at least the nucleotides at positions 1, 3, 6, 9, 11-13, 15, 17, and 19-21 of the antisense strand are nucleotides modified with 2'-methoxy groups.

[0080] In this application, the double-stranded RNA molecule modification further includes nucleotides modified by 2'-fluorination, wherein the nucleotides modified by 2'-fluorination are located in the antisense strand and the sense strand of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 7, 8, and 9 of the sense strand are nucleotides modified by 2'-fluorination, and at least the nucleotides at positions 2, 4, 8, 10, 14, 16, and 18 of the antisense strand are nucleotides modified by 2'-fluorination.

[0081] In this application, the double-stranded RNA molecule modification further includes 2'-deoxy modified nucleotides, wherein the 2'-deoxy modified nucleotides are in the antisense strand of the double-stranded RNA molecule modification, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 5 and 7 of the antisense strand are 2'-deoxy modified nucleotides.

[0082] In this application, in the double-stranded RNA molecule modification, at least the nucleotides at positions 1 and 2, and positions 2 and 3 of the sense strand are linked by phosphate thioester groups in the direction from the 5' end to the 3' end, and at least the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 of the antisense strand are linked by phosphate thioester groups.

[0083] In this application, the modified nucleotide at the 5' end of the antisense strand of the double-stranded RNA molecule modifier may be a compound obtained by further modifying the 5' end of the antisense strand of the double-stranded RNA molecule modifier with 5'-(E)-vinyl phosphate.

[0084] In this application, the positive strand 3' end of the double-stranded RNA molecule modification is coupled with a ligand.

[0085] In this application, the modified nucleotide at the 3' end of the positive strand of the double-stranded RNA molecule can be a compound formed by linking the 3'-terminal nucleotide with a ligand, and the ligand can be one or more GalNAcs attached using divalent or trivalent branched linkers. The structural diagram of the compound is shown in formula (18).

[0086] In this application, the double-stranded RNA molecule modification can be any one of 478 modifications, and the nucleotide sequence of the sense strand of the 478 modifications includes any odd-numbered sequence from NO:881 to NO:1835; the nucleotide sequence of the antisense strand of the 478 modifications includes any even-numbered sequence from NO:882 to NO:1836.

[0087] The sense strand number of the 478 siRNAs can be n, and the antisense strand number of the 478 modifiers can be n+1, where n can be any odd number from 881 to 1835.

[0088] This application also provides the use of the described double-stranded RNA molecule or the modified double-stranded RNA molecule in any of the following:

[0089] D1) Application in the preparation of compositions that inhibit angiotensinogen (AGT) gene expression;

[0090] Application of D2 in inhibiting angiotensinogen (AGT) gene expression;

[0091] Application of D3 in the treatment of diseases related to angiotensinogen (AGT) gene targets;

[0092] Application of D4 in the preparation of compositions for treating diseases related to the angiotensinogen (AGT) gene target.

[0093] This application also provides a composition for inhibiting angiotensinogen (AGT) gene expression, the composition comprising the double-stranded RNA molecule or a modified double-stranded RNA molecule.

[0094] In this application, the composition further includes a pharmaceutically acceptable carrier.

[0095] The composition may be a pharmaceutical composition or a kit.

[0096] The pharmaceutical composition described above also comprises an unbuffered solution.

[0097] The unbuffered solution in the pharmaceutical composition described above may be physiological saline or water.

[0098] The pharmaceutical composition described above also includes a buffer solution.

[0099] The buffer solution in the pharmaceutical composition described above comprises acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof.

[0100] The buffer solution in the pharmaceutical composition described above may be phosphate-buffered saline (PBS).

[0101] This application also provides a cell comprising the double-stranded RNA molecule, the double-stranded RNA molecule modification, and / or the composition described herein.

[0102] This application also provides a method for treating AGT gene target-related diseases, the method comprising administering an effective dose of an AGT inhibitor to a subject suffering from an AGT gene target-related disease, said AGT inhibitor being the double-stranded RNA molecule, said double-stranded RNA molecule modification and / or said composition.

[0103] This application also provides a method for treating hypertension, the method comprising administering an effective dose of an AGT inhibitor to a subject suffering from hypertension, said AGT inhibitor being the double-stranded RNA molecule, said double-stranded RNA molecule modification, and / or said composition.

[0104] This application also provides a method for inhibiting the expression of angiotensinogen (AGT) gene in cells, the method comprising:

[0105] (a) Contact the cells with an effective dose of an AGT inhibitor, wherein the AGT inhibitor may be the double-stranded RNA molecule, a modified double-stranded RNA molecule, and / or the composition thereof.

[0106] (b) Maintain the cells produced in step (a) for a period of time sufficient to allow for the degradation of the angiotensinogen (AGT) gene mRNA transcript, thereby suppressing AGT gene expression in the cells.

[0107] In this application, the method is described in a manner in which the cell is located within the subject.

[0108] In the method described in this application, the subject may be a human.

[0109] In the method described in this application, the subject suffers from AGT-related disease.

[0110] In this application, the method wherein the expression of the angiotensinogen (AGT) gene is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100%.

[0111] The substance, which can be used as a drug, is also protected under this invention. The substance is the above-mentioned double-stranded RNA molecule modification, the above-mentioned double-stranded RNA molecule, or / and the above-mentioned combination.

[0112] The aforementioned AGT inhibitor is used for the prevention and / or treatment of diseases related to the AGT gene target.

[0113] A pharmaceutical composition comprising an effective amount of the AGT inhibitor for the prevention and / or treatment of diseases related to the AGT gene target.

[0114] In this application, the AGT gene target-related diseases can be diseases caused by abnormal AGT gene expression.

[0115] In this application, the disease caused by abnormal AGT gene expression may be a disease caused by upregulation of AGT gene expression.

[0116] In this application, the diseases caused by the upregulation of the AGT gene include, but are not limited to, hypertension, essential hypertension, electrolyte imbalance, preeclampsia, and renal tubular developmental disorders.

[0117] In this application, the pharmaceutically acceptable carrier may be an excipient, stabilizer, suspending agent, or diluent, as is well known to those skilled in the art.

[0118] In the siRNA preparation methods referred to in this application, unless otherwise specified, nucleoside monomer refers to the modified or unmodified RNA phosphoramidites (sometimes RNA phosphoramidites are also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA to be prepared. Phosphoramidite solid-phase synthesis can be any method known to those skilled in the art for siRNA synthesis. All nucleoside monomers used in this application are commercially available.

[0119] In this application, the positive strand of the double-stranded RNA molecule is conjugated to a ligand attached to the 3' end, wherein the ligand may be one or more GalNAc derivatives attached using a divalent or trivalent branched linker.

[0120] The siRNA conjugate formed by GalNAc and double-stranded RNA molecules in this application has the structure shown in formula (18).

[0121] It is worth noting that all raw materials used in this application are ordinary commercially available products, and their sources are not specifically limited.

[0122] Compared with the prior art, the beneficial technical effects achieved by this application are as follows:

[0123] This application provides novel double-stranded RNA molecules targeting AGT and their modifications. In vitro and in vivo experiments demonstrate that the provided double-stranded RNA molecules and their modifications can effectively inhibit AGT gene expression. This indicates that the provided double-stranded RNA molecules and their modifications have significant drug development potential and application value in diseases with abnormal AGT gene expression, such as hypertension. Attached Figure Description

[0124] Figure 1 shows the results of the activity experiment of the modified siRNA in cynomolgus monkeys. Embodiments of the present invention

[0125] I. Terminology in this invention

[0126] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0127] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0128] In the following examples, "modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosyl group with another group, or a nucleotide whose bases are modified bases. "Methoxy-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group. "Fluoro-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine, and "non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosyl group with a non-fluorine group. "Nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid, but whose structure differs from cytosine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides.

[0129] In one embodiment of this application, "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0130] In one embodiment of this application, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art. These nucleotides may be selected from one of the following: 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0131] In one embodiment of this application, the 2'-alkoxy modified nucleotide may be a 2'-methoxy (2'-OMe) modified nucleotide, as shown in formula (2), i.e., methoxy modified; the 2'-substituted alkoxy modified nucleotide may be, for example, a 2'-methoxyethyl (2'-MOE) modified nucleotide, as shown in formula (3); the 2'-amino (2'-NH2) modified nucleotide is shown in formula (4); and the 2'-deoxynucleotide (DNA) is shown in formula (5).

[0132] In one embodiment of this application, the nucleotide analogue refers to a group that can replace a nucleotide in nucleic acid, but whose structure is different from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.

[0133] In one embodiment of this application, the nucleotide analog may be an isonucleotide, a bridged nucleotide, or an acyclic nucleotide.

[0134] In one embodiment of this application, the bridged nucleic acid (BNA) refers to a restricted or inaccessible nucleotide. The BNA may contain a bridging structure with a "fixed" C3'-endoglucan condensation, such as a five-membered ring, a six-membered ring, or a seven-membered ring. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide.

[0135] In one embodiment of this application, the BNA may be an LNA, an ENA, a cET BNA, etc., wherein an LNA is shown in equation (6), an ENA is shown in equation (7), and a cET BNA is shown in equation (8):

[0136] In one embodiment of this application, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA may be phosphate ester groups with modifying groups.

[0137] In one embodiment of this application, the phosphate ester group with the modifying group may be a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.

[0138] In one embodiment of this application, the phosphate group having the modifying group may be a thiophosphate group having the structure shown in formula (9). In one embodiment of this application, the nucleotide linked to the thiophosphate group is shown in formula (10), and the thiophosphate group linkage is present at least at one of the following positions: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination thereof.

[0139] In one embodiment of this application, the VP-modified nucleotide may be vinyl phosphate modified. In one embodiment of this application, the nucleotide modified by VP and methoxy groups, i.e., the nucleotide modified by 5'-(E)-vinyl-2'-methoxy phosphate group (5'-(E)-VP-2'-OMe), is shown in formula (11); in one embodiment of this application, the nucleotide modified by VP, methoxy groups, and thiophosphate groups, i.e., the nucleotide modified by 5'-PS (i.e., the nucleotide modified by 5'-(E)-vinyl-2'-methoxy thiophosphate group), is shown in formula (12).

[0140] In one embodiment of the present invention, GNA represents diol nucleic acid, which is a polymer similar to DNA or RNA, but with a different "backbone" composed of repeating glycerol units linked by phosphodiester bonds. The structure of A (GNA) is shown in Formula (13), the structure of G (GNA) is shown in Formula (14), the structure of C (GNA) is shown in Formula (15), the structure of U (GNA) is shown in Formula (16), and the structure of T (GNA) is shown in Formula (17).

[0141] In the following examples, uppercase letters C, G, U, and A represent four types of ribonucleotides. Lowercase letter m indicates that the nucleotide adjacent to the left of lowercase letter m is 2'-methoxy modified. Lowercase letter f indicates that the nucleotide adjacent to the left of lowercase letter f is 2'-fluorinated modified. Lowercase letter s indicates that the two nucleotides adjacent to the left and right of lowercase letter s are linked by a thiophosphate group. Lowercase letter ms indicates that the nucleotide adjacent to the left of letter ms is a 2'-methoxy modified nucleotide, and this 2'-methoxy modified nucleotide is linked to the nucleotide adjacent to the right of ms by a thiophosphate group. Lowercase letter fs indicates that the nucleotide adjacent to the left of letter fs is a 2'-fluorinated nucleotide, and this 2'-fluorinated nucleotide is linked to the nucleotide adjacent to the right of fs by a thiophosphate group. (d) indicates that the ribonucleotide adjacent to its left is a deoxyribonucleotide; when the ribonucleotide adjacent to its left is uracil ribonucleotide, thymine deoxyribonucleotide is used instead of uracil ribonucleotide. (GNA) indicates that the ribonucleotide adjacent to it on the left is a ribonucleotide modified with GNA. When the ribonucleotide adjacent to it on the left is uracil ribonucleotide, thymine deoxyribonucleotide is used instead of uracil ribonucleotide. VP indicates that the nucleotide adjacent to it on the right is modified with vinyl phosphate.

[0142] Af represents 2'-fluoroadenosine-3'-phosphate (a 2'-fluoro-modified adenine ribonucleotide). Afs represents 2'-fluoroadenosine-3'-thiophosphate (a 2'-fluoro and 3'-thiophosphate-modified adenine ribonucleotide). Am represents 2'-methoxyadenosine-3'-phosphate (a 2'-methoxy-modified adenine ribonucleotide). Ams represents 2'-methoxyadenosine-3'-thiophosphate (a 2'-methoxy and 3'-thiophosphate-modified adenine ribonucleotide). A(d) represents 2'-deoxyadenosine-3'-phosphate (a 2'-deoxy-modified adenine ribonucleotide). A(d)s represents 2'-deoxyadenosine-3'-thiophosphate (a 2'-deoxy-modified and 3'-thiophosphate-modified adenine ribonucleotide). VPAms stands for 5'-(E)-vinyl-2'-methoxyadenosine-3'-thiophosphate.

[0143] Cf represents 2'-fluorocytidine-3'-phosphate (2'-fluoro-modified cytosine ribonucleotide). Cfs represents 2'-fluorocytidine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified cytosine ribonucleotide). Cm represents 2'-methoxycytidine-3'-phosphate (2'-methoxy-modified cytosine ribonucleotide). Cms represents 2'-methoxycytidine-3'-thiophosphate (2'-methoxy and 3'-thiophosphate-modified cytosine ribonucleotide). C(d) represents 2'-deoxycytidine-3'-phosphate (2'-deoxy-modified cytosine ribonucleotide). VPCms represents 5'-(E)-vinyl-2'-methoxycytidine-3'-thiophosphate.

[0144] Gf represents 2'-fluoroguanosine-3'-phosphate (2'-fluoro-modified guanine ribonucleotide). Gfs represents 2'-fluoroguanosine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified guanine ribonucleotide). Gm represents 2'-methoxyguanosine-3'-phosphate (2'-methoxy-modified guanine ribonucleotide). Gms represents 2'-methoxyguanosine-3'-thiophosphate (2'-methoxy and 3'-thiophosphate-modified guanine ribonucleotide). G(d) represents 2'-deoxyguanosine-3'-phosphate (2'-deoxy-modified guanine ribonucleotide). G(d)s represents 2'-deoxyguanosine-3'-thiophosphate (2'-deoxy-modified and 3'-thiophosphate-modified guanine ribonucleotide). VPGms represents 5'-(E)-vinyl-2'-methoxyguanosine-3'-thiophosphate.

[0145] T(GNA) represents thymidine-glycol nucleic acid (GNA). T(d) represents 2'-deoxythymidine-3'-phosphate (2'-deoxy-modified uracil ribonucleotide). Uf represents 2'-fluorouridine-3'-phosphate (2'-fluoro-modified uracil ribonucleotide). Ufs represents 2'-fluorouridine-3'-thiophosphate (2'-fluoro- and 3'-thiophosphate-modified uracil ribonucleotide). Um represents 2'-methoxyuridine-3'-phosphate (2'-methoxy-modified uracil ribonucleotide). Ums represents 2'-methoxyuridine-3'-thiophosphate (2'-methoxy- and 3'-thiophosphate-modified uracil ribonucleotide). VPUms represents 5'-(E)-vinyl-2'-methoxyuridine-3'-thiophosphate.

[0146] GalNAc represents N-acetylgalactosamine. The presence of GalNAc in the positive strand indicates that the 3' end of the positive strand of the siRNA is connected to the ligand GalNAc via a phosphate group to form an siRNA conjugate, the structure of which is shown in formula (18).

[0147] The modified nucleotides mentioned above are linked together by 5'-3'-phosphodiester bonds (when there is a thiomodification (represented by "s"), two adjacent nucleotides are linked by a phosphothiodiester bond).

[0148] In the following examples, the terms "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the strand can be inferred from the sequence of its complementary strand.

[0149] In the following embodiments, "coupling" refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, "coupling compound" refers to a compound formed by the covalent connection between these chemical parts. In this application, "siRNA conjugate" refers to a compound formed by the covalent attachment of one or more chemical parts with specific functions to siRNA. "siRNA conjugate" should be understood, depending on the context, as a general term for multiple siRNA conjugates or a siRNA conjugate represented by a specific chemical formula. In the context of this disclosure, "coupling molecule" should be understood as a specific compound that can be reactively coupled to siRNA to ultimately form the siRNA conjugate of this disclosure.

[0150] In the following examples, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined below. Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and / or inherently unstable.

[0151] The phrase “pharmaceutically acceptable” used in conjunction with the compositions described herein refers to the molecular entities and other components of such compositions that are physiologically tolerable and typically do not produce adverse effects when administered to mammals (e.g., humans). Preferably, the term “pharmaceutically acceptable” means listed in recognized pharmacopoeias for use in mammals, and more particularly for use in humans.

[0152] In the following embodiments, the terms “treatment,” “relief,” or “improvement” may be used interchangeably herein. These terms refer to methods of achieving beneficial or desired outcomes, including but not limited to therapeutic benefits. A “therapeutic benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a therapeutic benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be suffering from the underlying disorder.

[0153] The term “treat” or “treatment” refers to therapeutic treatment in which the aim is to slow or alleviate undesirable physiological changes or disease, or to provide a beneficial or desired clinical outcome during treatment. Beneficial or desired clinical outcomes include symptom reduction, disease severity reduction, disease state stabilization (i.e., cessation of worsening), delay or slowing of disease progression, improvement or mitigation of disease state, and / or remission (whether partial or complete, and whether detectable or undetectable). “Treatment” can also mean prolonged survival compared to the expected survival of a subject without treatment. Subjects requiring treatment include those who already have undesirable physiological changes or disease, and those who are predisposed to developing such changes or disease. Treatment may involve therapeutic agents, also referred to herein as “medicaments” or “medication,” which may be designed to help achieve the beneficial or desired clinical outcome of interest through their action. Therapeutic agents or medications can be administered to subjects via many routes, including at least intravenous and oral routes. The term “intravenous” in relation to the administration of a therapeutic agent or medication means administration of said therapeutic agent or medication into one or more veins. The term “oral” in relation to the administration of a therapeutic agent or drug means that the therapeutic agent or drug is administered via the oral cavity, such as through the mouth.

[0154] In the following examples, "prevention" and "protection" are used interchangeably. These terms refer to methods of obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a "preventive benefit," the composition may be given to a subject at risk of developing a specific disease, or to a subject who reports one or more pathological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0155] In this invention, "subject" includes a person who is being treated or prevented from having a disease. The methods described herein can be used to treat animal subjects belonging to any classification. Examples of such animals include mammals. Mammals include, but are not limited to, rodents such as mice and hamsters, and lagomorphs such as rabbits. Mammals can be carnivores, including felines (cats) and canines (dogs). Mammals can be artiodactyla, including bovines (cattle) and suidae (pigs), or perissodactyla, including equines (horses). Mammals can be primates, ceboids, or simoids (monkeys) or hominids.

[0156] The term "effective" when applied to dosage or amount refers to an amount of compound or pharmaceutical composition sufficient to produce the desired activity when administered to a subject in need. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include the amount of each ingredient that would be effective if administered alone. The exact amount required will vary depending on the subject, including their species, age and general condition, the severity of the condition being treated, one or more specific medications being used, the mode of administration, etc.

[0157] The term "therapeutic effective dose" generally refers to the dosage of a drug used to (i) treat or prevent a particular disease, condition, or disorder; (ii) reduce, improve, or eliminate one or more symptoms of a particular disease, condition, or disorder; or (iii) prevent or delay the onset of one or more symptoms of a particular disease, condition, or disorder described herein. A therapeutic effective dose can be determined by testing in a known in vitro or in vivo (e.g., animal model) system.

[0158] II. Implementation Examples

[0159] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0160] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0161] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0162] The following examples use GraphPad Prism statistical software to process the data, and the experimental results are expressed as mean ± standard deviation.

[0163] The following embodiments are provided to better understand this application and are not limited to the preferred embodiments described herein. They do not constitute a limitation on the content and scope of protection of this application. Any product that is the same as or similar to this application, derived by anyone under the guidance of this application or by combining features of this application with other prior art, falls within the scope of protection of this application.

[0164] In the following embodiments, the AGT gene sequence refers to the mRNA gene sequence shown with GenBank accession number (NCBI Reference Sequence) NM_001382817.3 (human), NM_001384479.1 (human), XM_015443695.2 (cynomolgus monkey), XM_045391832.1 (cynomolgus monkey), XM_045391833.1 (cynomolgus monkey), XM_045391834.1 (cynomolgus monkey), NM_001416312.1 (mouse), NM_007428.4 (mouse), or NM_134432.2 (rat). Unless otherwise specified, the term "target gene" as used in this disclosure refers to the gene that transcribes the aforementioned AGT mRNA, and the term "target mRNA" refers to the aforementioned AGT mRNA.

[0165] For any experimental steps or conditions not specified in the following examples, the procedures or conditions described in the literature in this field can be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.

[0166] In the following examples, particularly in describing methods for preparing siRNA, pharmaceutical compositions, or siRNA conjugates of this disclosure, unless otherwise specified, a nucleoside monomer refers to a modified or unmodified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this disclosure are commercially available.

[0167] Unless otherwise specified, the reagents and culture media used in the following examples are all commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are all performed in accordance with the methods described in Molecular Biology (4th Edition) (Alexander McLennan et al., 2019).

[0168] The experimental cells involved in the following examples were Hep3B and HepG2, purchased from the Chinese Academy of Sciences Cell Bank; the culture conditions were 87% MEM + 10% FBS + 1% PS (penicillin-streptomycin solution (double antibiotic), 100×) + 1% sodium pyruvate + 1% NEAA.

[0169] The experimental animals were male C57BL / 6J-hAGT humanized mice, purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. at 4-6 weeks and 6-8 weeks of age. All experimental animals were housed in the SPF-grade animal facility of Suzhou Jima Gene Co., Ltd. Animals were kept under a 12-hour light-dark cycle and had free access to food and water. Experiments began after one week of acclimatization. The use and handling of experimental animals complied with the animal welfare requirements of the Animal Management Committee of Suzhou Jima Gene Co., Ltd.

[0170] The siRNAs involved in the following examples are siRNA sequences synthesized via phosphoramide solid-phase synthesis.

[0171] In the examples described below, when transfecting cells with siRNA, siRNA conjugates, or siRNA or siRNA conjugates targeting the AGT gene, Lipofectamine RNAiMAX (purchased from Invitrogen) was used as the transfection reagent. Specific procedures were followed according to the manufacturer's instructions. For qPCR detection, HiScript III RT SuperMix for qPCR (purchased from Vazyme) was used as the reverse transcription reagent. Specific procedures were followed according to the manufacturer's instructions.

[0172] The primer and probe sequences involved in the qPCR detection of human AGT mRNA in the following examples are as follows:

[0173] AGT-F(5'-3')GCTGAACCTGCAAAAATTGA(SEQ ID NO:881);

[0174] AGT-R(5'-3')GTTAAGCTGTTGGGTAGACTCTGT (SEQ ID NO:882);

[0175] AGT-P(5'-3')CACCTCCCCCACCCTGATGC(HEX)(SEQ ID NO:883);

[0176] HGAPDH-F(5'-3')CATGAGAAGTATGACAACAGCCT (SEQ ID NO:884);

[0177] HGAPDH-R(5'-3')AGTCCTTCCACGATACCAAAGT (SEQ ID NO:885);

[0178] HGAPDH-P(5'-3')CAATGCCTCCTGCACCACCAA(FAM)(SEQ ID NO:886);

[0179] mGAPDH-F(5'-3')CCTTCATTGACCTCAACTACATGG (SEQ ID NO:887);

[0180] mGAPDH-R(5'-3')CTCGCTCCTGGAAGATGGTG (SEQ ID NO:888);

[0181] mGAPDH-P(5'-3')ATGTTCCAGTATGACTCCACTCACGGCA(FAM)(SEQ ID NO:889);

[0182] Of the primers and probes mentioned above, AGT-P is a DNA probe with a 6-HEX modification at the 5' end, position 1 (C). HGAPDH-P is a DNA probe with a 5' FAM (5-Carboxyfluorescein) modification at the 5' end, position 1 (C). mGAPDH-P is a DNA probe with a 5' FAM (5-Carboxyfluorescein) modification at the 5' end, position 1 (A).

[0183] Example 1: siRNA Design and Synthesis

[0184] The reference transcripts for siRNA design were: human NM_001382817.3, human NM_001384479.1, AGT XM_015443695.2, cynomolgus monkey XM_045391832.1, cynomolgus monkey XM_045391833.1, cynomolgus monkey XM_045391834.1, mouse NM_001416312.1, mouse NM_007428.4, or rat NM_134432.2. siRNAs were designed and synthesized based on these transcripts. Specific siRNA information is shown in Table 1-1, and the modified siRNA sequences are shown in Table 1-2.

[0185] Table 1-1 siRNA IDs and sequences

[0186] In the ST.26 sequence listing, "U" is represented by "T" in the nucleotide sequences of sequence numbers 1 to 880 (i.e., SEQ ID NO:1 to SEQ ID NO:880).

[0187] The sequences hcAGT-1M1 to hcAGT-440M1 are obtained by modifying the sequences hcAGT-1 to hcAGT-440. Following the direction from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of the sense strand are fluorinated nucleotides, and the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are fluorinated nucleotides; the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the sense strand are methoxylated nucleotides, and the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the antisense strand are methoxylated nucleotides; the nucleotides at positions 1 and 2, and 2 and 3 of the sense strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand are linked by thiophosphate groups.

[0188] Table 1-2 Modified siRNAs

[0189] In Table 1-2, uppercase letters C, G, U, and A represent four types of ribonucleotides. Lowercase letter m indicates that the nucleotide adjacent to the left of lowercase letter m has a 2'-methoxy group; lowercase letter f indicates that the nucleotide adjacent to the left of lowercase letter f has a 2'-fluoride group; lowercase letter s indicates that the two nucleotides adjacent to the left and right of lowercase letter s are linked by a thiophosphate group. Lowercase letter ms indicates that the nucleotide adjacent to the left of ms is a 2'-methoxy group, and this 2'-methoxy group is linked to the nucleotide adjacent to the right of ms by a thiophosphate group. Lowercase letter fs indicates that the nucleotide adjacent to the left of fs is a 2'-fluoride group, and this 2'-fluoride group is linked to the nucleotide adjacent to the right of fs by a thiophosphate group.

[0190] Af represents 2'-fluoroadenosine-3'-phosphate (a 2'-fluoro-modified adenine ribonucleotide). Afs represents 2'-fluoroadenosine-3'-thiophosphate (a 2'-fluoro and 3'-thiophosphate-modified adenine ribonucleotide). Am represents 2'-methoxyadenosine-3'-phosphate (a 2'-methoxy-modified adenine ribonucleotide). Ams represents 2'-methoxyadenosine-3'-thiophosphate (a 2'-methoxy-modified and 3'-thiophosphate-modified adenine ribonucleotide).

[0191] Cf represents 2'-fluorocytidine-3'-phosphate (a 2'-fluoro-modified cytosine ribonucleotide). Cfs represents 2'-fluorocytidine-3'-thiophosphate (a 2'-fluoro and 3'-thiophosphate-modified cytosine ribonucleotide). Cm represents 2'-methoxycytidine-3'-phosphate (a 2'-methoxy-modified cytosine ribonucleotide). Cms represents 2'-methoxycytidine-3'-thiophosphate (a 2'-methoxy-modified and 3'-thiophosphate-modified cytosine ribonucleotide).

[0192] Gf represents 2'-fluoroguanosine-3'-phosphate (2'-fluoro-modified guanine ribonucleotide). Gfs represents 2'-fluoroguanosine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified guanine ribonucleotide). Gm represents 2'-methoxyguanosine-3'-phosphate (2'-methoxy-modified guanine ribonucleotide). Gms represents 2'-methoxyguanosine-3'-thiophosphate (2'-methoxy-modified and 3'-thiophosphate-modified guanine ribonucleotide).

[0193] Uf represents 2'-fluorouridine-3'-phosphate (a 2'-fluoro-modified uracil ribonucleotide). Ufs represents 2'-fluorouridine-3'-thiophosphate (a 2'-fluoro and 3'-thiophosphate-modified uracil ribonucleotide). Um represents 2'-methoxyuridine-3'-phosphate (a 2'-methoxy-modified uracil ribonucleotide). Ums represents 2'-methoxyuridine-3'-thiophosphate (a 2'-methoxy-modified and 3'-thiophosphate-modified uracil ribonucleotide).

[0194] The modified nucleotides mentioned above are linked together by 5'-3'-phosphodiester bonds (when there is thiomodification, two adjacent nucleotides are linked by thiophosphodiester bonds).

[0195] Example 2: Detection of the on-target activity of modified siRNA for inhibiting AGT

[0196] Step 1: Use psiCHECK TM -2(Promega TM The plasmid was constructed to detect the insertion sequence shown in Table 2-1. This insertion sequence was derived from the mRNA sequence with GenBank accession number NM_001384479.1. A single copy of the insertion sequence was cloned into psiCHECK. TM Between the Xho I / Not I sites of the -2 plasmid, the name of the detection plasmid and the inserted sequence are shown in Table 2-1.

[0197] Table 2-1 Names of plasmids and inserted sequences used in this application

[0198] Step 2: In a 96-well plate, add 5 μL of siRNA to each well (two final concentrations for each siRNA molecule: 1 nM and 0.1 nM), 12.5 μL of Opti-MEM containing 20 ng of the above detection plasmid, and 32.5 μL of Opti-MEM plus 0.3 μL of Lipofectamine 2000 (Invitrogen, catalog number 11668-019) to each well and incubate at room temperature for 15 minutes. Then, add 50 μL of a solution containing 1 × 10⁻⁶ ng of the above plasmid to each well. 4 Two 293T cells were cultured in DMEM complete medium (purchased from Transgen Biotech, catalog number FI101-01) at 37°C for 24 h for subsequent dual-luciferase assays. Experimental concentrations were performed at 1 nM and 0.1 nM final siRNA concentrations.

[0199] The specific siRNA names and their corresponding detection plasmids are shown in the table below:

[0200] Table 2-2 Correspondence between Somatic Sequence and Detection Plasmid

[0201] Step 3: Dilute the 5× lysis buffer in the Dual Luciferase Assay Kit (Promega, catalog number E2940) to 1× lysis buffer with water. Take the cells obtained in Step 2, discard the supernatant, and wash each well twice with PBS buffer (Hyclone, catalog number SH30256.01). Add 50 μL / well of 1× lysis buffer to each cell plate and lyse at room temperature for 20 min to obtain lysed cell plates. Pipette 30 μL / well of lysis buffer from the lysed cell plates into an opaque 96-well assay plate. Using the Dual Luciferase Assay Kit, follow the product instructions to obtain the numerical results for Firefly luciferase and Renilla luciferase, respectively.

[0202] The luminescence ratio of each well in the ELISA plate was calculated as Renilla / Firefly. The luminescence ratio of each test group or control group was the average of the luminescence ratios of the three culture wells. Using the control group's luminescence ratio as a baseline, the luminescence ratios of each test group were normalized to obtain the ratio R of luminescence ratio (test) / luminescence ratio (control), which represents the expression level of the Renilla reporter gene, i.e., its relative residual activity. The inhibition rate of siRNA was (1-R)×100%. The control group was the MOCK group, which consisted of only interfering reagents without any additional sequence.

[0203] The target activity results are shown in the table below:

[0204] Table 2-3 Results of target activity of modified siRNA

[0205] Example 3: Detection of Cell Viability with Modified siRNA

[0206] Hep3B (human hepatocellular carcinoma cells) and HepG2 (human hepatocellular carcinoma cells) cultured in 10cm culture dishes were routinely trypsinized after 48 hours of passage. The cells were resuspended in complete culture medium, and Hep3B cells were diluted to 3*10⁻⁶. 5 / mL, HepG2 diluted to 6*10 5 siRNA was seeded at a concentration of 50 μL / well in 96-well plates and transfected using Lipofectamine RNAiMAX. The final concentration of siRNA was 1 nM. Three biological replicates were set up for each siRNA. NC, MOCK, and BLANK were set up as controls. The NC group served as a negative control, the MOCK group received only the interfering reagent without any siRNA, and the BLANK group contained only cells.

[0207] The positive strand (5' to 3') of the NC group siRNA:

[0208] CfsAmsCfUmUfAmCfGmCfUmGfAmGfUmAfCmUfUmCfGmAf;

[0209] The antisense strand (5' to 3') of the NC group siRNA:

[0210] UmsCfsGmAfAmGfUmAfCmUfCmAfGmCfGmUfAmAfGmUfGmsAfsUm;

[0211] 48 hours after transfection, the culture medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using the magnetic bead method total RNA extraction kit (Germage-E31008-96) according to the manufacturer's instructions.

[0212] qPCR: Prepare the qPCR reaction system in a 384-well plate according to the table below.

[0213] Table 3-1 qPCR reaction system

[0214] exist Quantitative real-time PCR was performed. To calculate the relative fold change, the ΔΔCt method was used to analyze the data, and the analysis was standardized for the MOCK group (i.e., the control group in the formula).

[0215] ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group)

[0216] ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group)

[0217] ΔCt(test group) = ΔCt(test group) - ΔCt(control group average)

[0218] ΔCt(control group) = ΔCt(control group) - ΔCt(control group average)

[0219] Using the control group as a baseline, the expression level of AGT mRNA in the test group was normalized, and the AGT mRNA expression level in the control group was defined as 100%.

[0220] The relative expression level of AGT mRNA in the test group was 2. -ΔΔCt (Test group) × 100%.

[0221] For the same test group siRNA, the average relative expression level of AGT mRNA at each concentration is the arithmetic mean of the relative expression levels of the three culture wells at that concentration.

[0222] The inhibition rate of siRNA on AGT mRNA expression was calculated using the following equation: Inhibition rate = (1 - relative expression level of AGT mRNA in the test group) × 100%.

[0223] The inhibitory effects of different siRNAs on Hep3B and HepG2 cells are shown in the table below:

[0224] Table 3-2 Summary of the inhibition rate of modified siRNA on endogenous AGT mRNA in Hep3B cell line

[0225] Table 3-3 Summary of the inhibition rate of modified siRNA on endogenous AGT mRNA in HepG2 cell line

[0226] The inhibition rate of 440 modified siRNAs against endogenous AGT mRNA at a single concentration (1 nM) was tested in Hep3B and HepG2 cell lines. 163 modified siRNAs were then screened for triple concentration testing at 1 nM, 0.1 nM, and 0.01 nM. The procedure was the same as the single concentration test, except that the final concentrations of the siRNAs were 0.01 nM, 0.1 nM, and 1 nM, respectively. The results are shown in the table below.

[0227] Table 3-4 Results of siRNA inhibition rate of endogenous AGT mRNA in Hep3B cell line

[0228] Table 3-5 Results of siRNA inhibition rate on endogenous AGT mRNA in HEPG2 cell line

[0229] In summary, the inhibition rates of 163 modified siRNAs against endogenous AGT mRNA at three concentrations (1 nM, 0.1 nM, and 0.01 nM) were tested in Hep3B and HepG2 cell lines, and 28 siRNAs with good inhibitory effects were screened out. These 28 selected siRNAs were then further modified in different ways, and their in vivo activity was tested in mice.

[0230] Example 4: In vivo activity of modified siRNA

[0231] The siRNAs used in this embodiment are shown in Table 4-1. The modified siRNA information in Table 4-1 is obtained by modifying the siRNAs in Table 1-1 according to the modification patterns in Table 4-4.

[0232] Table 4-1 Modification sequences in this embodiment

[0233] Table 4-4 Modification methods of siRNA

[0234] In Tables 4-1 and 4-4, uppercase letters C, G, U, and A represent four types of ribonucleotides. Lowercase letter m indicates that the nucleotide adjacent to the left of lowercase letter m has a 2'-methoxy group. Lowercase letter f indicates that the nucleotide adjacent to the left of lowercase letter f has a 2'-fluoride group. Lowercase letter s indicates that the two nucleotides adjacent to the left and right of lowercase letter s are linked by a thiophosphate group. Lowercase letter ms indicates that the nucleotide adjacent to the left of ms is a 2'-methoxy group, and this 2'-methoxy group is linked to the nucleotide adjacent to the right of ms by a thiophosphate group. Lowercase letter fs indicates that the nucleotide adjacent to the left of fs is a 2'-fluoride group, and this 2'-fluoride group is linked to the nucleotide adjacent to the right of fs by a thiophosphate group. (d) indicates that the ribonucleotide adjacent to its left is a deoxyribonucleotide. When the ribonucleotide adjacent to its left is uracil, thymine deoxyribonucleotide is used instead of uracil. (GNA) indicates that the ribonucleotide adjacent to its left is a ribonucleotide modified with GNA. When the ribonucleotide adjacent to its left is uracil, thymine deoxyribonucleotide is used instead of uracil. VP indicates that the nucleotide adjacent to the right of this letter is modified with vinyl phosphate.

[0235] Af represents 2'-fluoroadenosine-3'-phosphate (a 2'-fluoro-modified adenine ribonucleotide). Afs represents 2'-fluoroadenosine-3'-thiophosphate (a 2'-fluoro and 3'-thiophosphate-modified adenine ribonucleotide). Am represents 2'-methoxyadenosine-3'-phosphate (a 2'-methoxy-modified adenine ribonucleotide). Ams represents 2'-methoxyadenosine-3'-thiophosphate (a 2'-methoxy and 3'-thiophosphate-modified adenine ribonucleotide). A(d) represents 2'-deoxyadenosine-3'-phosphate (a 2'-deoxy-modified adenine ribonucleotide). A(d)s represents 2'-deoxyadenosine-3'-thiophosphate (a 2'-deoxy-modified and 3'-thiophosphate-modified adenine ribonucleotide). VPAms stands for 5'-(E)-vinyl-2'-methoxyadenosine-3'-thiophosphate.

[0236] Cf represents 2'-fluorocytidine-3'-phosphate (2'-fluoro-modified cytosine ribonucleotide). Cfs represents 2'-fluorocytidine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified cytosine ribonucleotide). Cm represents 2'-methoxycytidine-3'-phosphate (2'-methoxy-modified cytosine ribonucleotide). Cms represents 2'-methoxycytidine-3'-thiophosphate (2'-methoxy and 3'-thiophosphate-modified cytosine ribonucleotide). C(d) represents 2'-deoxycytidine-3'-phosphate (2'-deoxy-modified cytosine ribonucleotide). VPCms represents 5'-(E)-vinyl-2'-methoxycytidine-3'-thiophosphate.

[0237] Gf represents 2'-fluoroguanosine-3'-phosphate (2'-fluoro-modified guanine ribonucleotide). Gfs represents 2'-fluoroguanosine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified guanine ribonucleotide). Gm represents 2'-methoxyguanosine-3'-phosphate (2'-methoxy-modified guanine ribonucleotide). Gms represents 2'-methoxyguanosine-3'-thiophosphate (2'-methoxy and 3'-thiophosphate-modified guanine ribonucleotide). G(d) represents 2'-deoxyguanosine-3'-phosphate (2'-deoxy-modified guanine ribonucleotide). G(d)s represents 2'-deoxyguanosine-3'-thiophosphate (2'-deoxy-modified and 3'-thiophosphate-modified guanine ribonucleotide). VPGms represents 5'-(E)-vinyl-2'-methoxyguanosine-3'-thiophosphate.

[0238] T(GNA) represents thymidine-glycol nucleic acid (GNA). T(d) represents 2'-deoxythymidine-3'-phosphate (2'-deoxy-modified uracil ribonucleotide). Uf represents 2'-fluorouridine-3'-phosphate (2'-fluoro-modified uracil ribonucleotide). Ufs represents 2'-fluorouridine-3'-thiophosphate (2'-fluoro- and 3'-thiophosphate-modified uracil ribonucleotide). Um represents 2'-methoxyuridine-3'-phosphate (2'-methoxy-modified uracil ribonucleotide). Ums represents 2'-methoxyuridine-3'-thiophosphate (2'-methoxy- and 3'-thiophosphate-modified uracil ribonucleotide). VPUms represents 5'-(E)-vinyl-2'-methoxyuridine-3'-thiophosphate.

[0239] GalNAc represents N-acetylgalactosamine. The presence of GalNAc in the positive strand indicates that the 3' end of the positive strand of the siRNA is connected to the ligand GalNAc via a phosphate group to form an siRNA conjugate, the structure of which is shown in formula (18).

[0240] The modified nucleotides mentioned above are linked together by 5'-3'-phosphodiester bonds (when there is thiomodification, two adjacent nucleotides are linked by thiophosphodiester bonds).

[0241] Male C57BL / 6J-hAGT humanized mice (8-10 weeks old) were randomly divided into groups of three based on body weight. Serum was collected one day prior to drug administration as baseline (AGT content 100%). Animals then received a single subcutaneous injection of either 1 mg / kg or 3 mg / kg of the modified siRNA drug, with saline as a control. Blood was collected from the humanized mice on days 13, 27, 34, 41, 48, 55, and 62 post-administration. Human AGT protein levels were measured using a human angiotensinogen-specific ELISA kit according to the manufacturer's instructions (IBL America #27412). Data are expressed as a percentage of baseline values ​​and presented as mean plus standard deviation.

[0242] Table 4-2 Human AGT protein levels after a single subcutaneous administration of 1 mg / kg siRNA drug

[0243] Table 4-3 Human AGT protein levels after a single subcutaneous administration of 3 mg / kg siRNA

[0244] Example 5: In vitro activity of modified siRNA

[0245] The in vitro activity of the modified siRNA was tested according to the method in Example 3, with the only difference being that the final concentrations of the modified siRNA were 3.0 nM, 1.0 nM, 0.33 nM, 0.11 nM, 0.037 nM, 0.0123 nM, 0.0041 nM, 0.00137 nM, 0.000457 nM, and 0.000152 nM. The measured IC50 values ​​are shown in the table below.

[0246] Table 5-1 Results of in vitro activity assay of modified siRNA

[0247] Example 6: In vivo activity of modified siRNA

[0248] Male C57BL / 6J-hAGT humanized mice (8-10 weeks old) were randomly divided into groups of 3 mice each according to their body weight. Each group received a single subcutaneous injection of a modified siRNA drug at a dose of 1 mg / kg or 0.5 mg / kg, with saline as a control. Liver cells were collected from the humanized mice on day 28 after drug administration, and the expression level of human AGT mRNA was detected by qPCR.

[0249] Table 6-1 Results of qPCR detection of AGT mRNA expression levels

[0250] Example 7: In vivo activity of modified siRNA

[0251] In vivo experiments were conducted on male cynomolgus monkeys by Suzhou Fangda New Drug Development Co., Ltd. Three monkeys per group received a single subcutaneous injection of a modified siRNA drug at a dose of 3 mg / kg. Serum samples were collected weekly before administration (day 0) and on days 7 (D7), 14 (D14), 21 (D21), 28 (D28), 35 (D35), 42 (D42), 49 (D49), 56 (D56), 63 (D63), 70 (D70), 77 (D77), 84 (D84), and 91 (D91) to measure AGT protein expression levels. AGT protein levels in cynomolgus monkeys were measured using an ELISA kit specific to human angiotensinogen according to the manufacturer's instructions (IBL America #27412). Serum samples were collected before administration as a baseline (AGT content 100%). Data are expressed as a percentage of baseline values ​​and presented as mean + standard deviation. Results are shown in Figure 1.

[0252] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, any changes, uses, or improvements to the invention are intended to include, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Industrial applicability

[0253] This application provides novel double-stranded RNA molecules targeting AGT and their modifications. In vitro and in vivo experiments demonstrate that the provided double-stranded RNA molecules and their modifications can effectively inhibit AGT gene expression. This indicates that the provided double-stranded RNA molecules and their modifications have significant drug development potential and application value in diseases with abnormal AGT gene expression, such as hypertension.

Claims

1. A modification of a double-stranded RNA molecule, characterized in that, The double-stranded RNA modifier is hcAGT-363M1GVP, hcAGT-358M1GVP, hcAGT-358M1, hcAGT-363M1 or hcAGT-363M34GVP; the double-stranded RNA modifier comprises a sense strand and an antisense strand, and the sense strand and the antisense strand are respectively as follows: (1) hcAGT-363M1GVP, sense strand: CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm-GalNAc (sense strand NO: 1787); antisense strand: VPGmsAfsCmUmCmAfUmUmAmGmAmAmGmAfAmAfAmGmGmsUmsGm (antisense strand NO: 1788); (2) hcAGT-358M1GVP, sense strand: UmsCmsCmCmAmCmCfUfUfUmUmCmUmUmCmUmAmAmUm-GalNAc (sense strand NO: 1779); antisense strand: VPAmsUfsUmAmGmAfAmGmAmAmAmAmGmGfUmGfGmGmAmsGmsAm (antisense strand NO: 1780); (3) hcAGT-358M1, sense strand: UmsCmsCmCmAmCmCfUfUfUmUmCmUmUmCmUmAmAmUm (sense strand NO: 1595); antisense strand: AmsUfsUmAmGmAfAmGmAmAmAmAmGmGfUmGfGmGmAmsGmsAm (antisense strand NO: 1596); (4) hcAGT-363M1, sense strand: CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm (sense strand NO: 1605); antisense strand: GmsAfsCmUmCmAfUmUmAmGmAmAmGmAfAmAfAmGmGmsUmsGm (antisense strand NO: 1606); (5) hcAGT-363M34GVP, sense strand: CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm-GALNAC (sense strand NO: 1801); antisense strand: VPGmsAfsCmUfC(d)AmT(d)UfAmGfAmAmGmAfAmAfAmGfGmsUmsGm (antisense strand NO: 1802); Af represents 2'-fluoroadenosine-3'-phosphate, Afs represents 2'-fluoroadenosine-3'-thiophosphate, Am represents 2'-methoxyadenosine-3'-phosphate (2'-methoxy-modified adenine ribonucleotide). Ams represents 2'-methoxyadenosine-3'-thiophosphate, VPAms represents 5'-(E)-vinyl-2'-methoxyadenosine-3'-thiophosphate, Cf represents 2'-fluorocytidine-3'-phosphonate, Cm represents 2'-methoxy cytidine-3'-phosphonate, Cms represents 2'-methoxy cytidine-3'-phosphorothioate, C(d) represents 2'-deoxycytidine-3'-phosphonate, Gf represents 2'-fluoroguanosine-3'-phosphonate, Gm represents 2'-methoxy guanosine-3'-phosphonate, Gms represents 2'-methoxy guanosine-3'-phosphorothioate, VPGms represents 5'-(E)-vinyl-2'-methoxy guanosine-3'-phosphorothioate, T(d) represents 2'-deoxythymidine-3'-phosphonate, Uf represents 2'-fluorouridine-3'-phosphonate, Ufs represents 2'-fluorouridine-3'-phosphorothioate, Um represents 2'-methoxy uridine-3'-phosphonate, Ums represents 2'-methoxy uridine-3'-phosphorothioate, GalNAc represents N-acetylgalactosamine, and the presence of GalNAc in the sense strand indicates that the siRNA conjugate is formed by connecting the 3' end of the sense strand of the siRNA with the ligand GalNAc through a phosphate group.

2. A double-stranded RNA molecule characterized in that, The double-stranded RNA molecule is any one of 440 siRNAs, the siRNA comprising a sense strand and an antisense strand forming at least in part a double-stranded region, the sense strand comprising a nucleotide sequence being any odd-numbered sequence in the sequence 1 to the sequence 880 in the sequence listing.

3. The double stranded RNA molecule of claim 2, wherein The double-stranded region has a length of 15-30 bp.

4. The double stranded RNA molecule of claim 3 or 4, wherein, The sense strand has a length of no more than 30 nucleotides, and / or the antisense strand has a length of no more than 30 nucleotides.

5. The double stranded RNA molecule of any one of claims 2-5, wherein, The sense strand has a length of no more than 19 nucleotides, and / or the antisense strand has a length of no more than 21 nucleotides.

6. The double stranded RNA molecule of any one of claims 2-5, wherein, At least one of the sense strand and the antisense strand comprises a 3' overhang of at least 1 nucleotide, or at least one of the sense strand and the antisense strand comprises a 3' overhang of at least 2 nucleotides.

7. The double-stranded RNA molecule of any one of claims 2-6, wherein, The antisense strand comprises a nucleotide sequence being any even-numbered sequence in the sequence 1 to the sequence 880 in the sequence listing.

8. The double-stranded RNA molecule of any one of claims 2-7, wherein, The sense strand of the 440 siRNAs has a nucleotide sequence being any odd-numbered sequence in the sequence 1 to the sequence 880 in the sequence listing or a sequence having more than 90% identity to the odd-numbered sequence, and / or the antisense strand has a nucleotide sequence being any even-numbered sequence in the sequence 1 to the sequence 880 in the sequence listing or a sequence having more than 90% identity to the even-numbered sequence.

9. A double-stranded RNA molecule modification, characterized in that, The double-stranded RNA molecule modifier is a compound containing a modified nucleotide obtained by modifying at least one nucleotide of the double-stranded RNA molecule of any one of claims 2-8.

10. The modification of a double stranded RNA molecule according to claim 9, wherein At least one nucleotide in the sense strand or the antisense strand of the double-stranded RNA molecule modifier is a modified nucleotide.

11. The modification of a double-stranded RNA molecule according to claim 9 or 10, characterized in that, The modified nucleotide is a compound in which the 2' position hydroxyl group of ribose of a nucleotide is replaced by another group, or a compound in which a phosphonate group of a nucleotide is modified, or a compound in which a base of a nucleotide is modified.

12. The modification of a double-stranded RNA molecule according to any one of claims 9 to 11, characterized in that, the modified nucleotides are selected from at least one of the group consisting of 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymine (dT) nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, non-locked nucleotides, configuration restricted nucleotides, restricted ethyl nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxyl-modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides comprising non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, glycerol nucleotides (GNA), unlinked nucleotides (UNA), nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphate groups, and nucleotides comprising 5'-phosphate mimics.

13. The modification of a double-stranded RNA molecule according to any one of claims 9 to 12, characterized in that, the modified nucleotides are any one of a1) to a4), a1) 2'-methoxy modified nucleotides; a2) 2'-fluoro modified nucleotides; a3) 2'-methoxy modified and 5'-(E)-vinylphosphate modified nucleotides; a4) 2'-deoxy modified nucleotides.

14. The modification of a double stranded RNA molecule according to claim 13, wherein, the sense strand of the double stranded RNA molecule modification comprises B1) and / or, the antisense strand of the double stranded RNA molecule modification comprises any one of C1) to C3), B1) contains the modified nucleotides of a1) and a2); C1) contains the modified nucleotides of a1) and a2); C2) contains the modified nucleotides of a1) to a3); C3) contains the modified nucleotides of a1) to a4).

15. The modification of a double stranded RNA molecule according to claim 14, wherein the double stranded RNA molecule modification further comprises that the modified nucleotides are connected by phosphorothioate groups.

16. The modification of a double stranded RNA molecule according to any one of claims 9 to 15, wherein, the double stranded RNA molecule modification comprises at least one of the following D1) to D6): D1) 2'-methoxy modified nucleotides, the 2'-methoxy modified nucleotides are located in the antisense strand and the sense strand of the double stranded RNA molecule modification, and at least the 1st-6th, 10th-19th nucleotides of the sense strand are 2'-methoxy modified nucleotides in the direction from the 5' end to the 3' end; at least the 1st, 3rd-5th, 7th-13th, 15th, 17th-21st nucleotides of the antisense strand are 2'-methoxy modified nucleotides; the double stranded RNA molecule modification further comprises 2'-fluoro modified nucleotides, the 2'-fluoro modified nucleotides are located in the antisense strand and the sense strand of the double stranded RNA molecule modification, and at least the 7th, 8th, 9th nucleotides of the sense strand are 2'-fluoro modified nucleotides in the direction from the 5' end to the 3' end; at least the 2nd, 6th, 14th, 16th nucleotides of the antisense strand are 2'-fluoro modified nucleotides; In the double-stranded RNA molecule modifier, at least the first and second, the second and third nucleotides of the sense strand are connected by a phosphorothioate group in the direction from the 5' end to the 3' end, and at least the first and second, the second and third, the 19th and 20th, and the 20th and 21st nucleotides of the antisense strand are connected by a phosphorothioate group; D2) The double-stranded RNA molecule modifier comprises 2'-methoxy-modified nucleotides, which are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 1st-4th, 6th, 10th-19th nucleotides of the sense strand are 2'-methoxy-modified nucleotides in the direction from the 5' end to the 3' end; at least the 1st, 3rd-5th, 7th-13th, 15th, 17th-21st nucleotides of the antisense strand are 2'-methoxy-modified nucleotides; The double-stranded RNA molecule modifier further comprises 2'-fluorine-modified nucleotides, which are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 5th, 7th, 8th, 9th nucleotides of the sense strand are 2'-fluorine-modified nucleotides in the direction from the 5' end to the 3' end; at least the 2nd, 6th, 14th, 16th nucleotides of the antisense strand are 2'-fluorine-modified nucleotides; The double-stranded RNA molecule modifier further comprises phosphorothioate group-modified nucleotides, which are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the first and second, the second and third nucleotides of the sense strand are connected by a phosphorothioate group in the direction from the 5' end to the 3' end, and at least the first and second, the second and third, the 19th and 20th, and the 20th and 21st nucleotides of the antisense strand are connected by a phosphorothioate group; D3) The double-stranded RNA molecule modifier comprises 2'-methoxy-modified nucleotides, which are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 1st-6th, 10th-19th nucleotides of the sense strand are 2'-methoxy-modified nucleotides in the direction from the 5' end to the 3' end; at least the 1st, 3rd-4th, 7th-13th, 15th, 17th-21st nucleotides of the antisense strand are 2'-methoxy-modified nucleotides; The double-stranded RNA molecule modifier further comprises 2'-fluorine-modified nucleotides, which are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 7th, 8th, 9th nucleotides of the sense strand are 2'-fluorine-modified nucleotides in the direction from the 5' end to the 3' end; at least the 2nd, 6th, 14th, 16th nucleotides of the antisense strand are 2'-fluorine-modified nucleotides; The double-stranded RNA molecule modifier also comprises 2'-deoxy-modified nucleotides, the 2'-deoxy-modified nucleotides are deoxynucleotides, in the antisense strand of the double-stranded RNA molecule modifier, and at least 5 nucleotides of the antisense strand are 2'-deoxy-modified nucleotides in the direction from the 5' end to the 3' end; The double-stranded RNA molecule modifier also comprises phosphorothioate-modified nucleotides, the phosphorothioate-modified nucleotides are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 1st and 2nd, the 2nd and 3rd nucleotides of the sense strand are connected by phosphorothioate in the direction from the 5' end to the 3' end, and at least the 1st and 2nd, the 2nd and 3rd, the 19th and 20th, the 20th and 21st nucleotides of the antisense strand are connected by phosphorothioate; D4) The double-stranded RNA molecule modifier comprises 2'-methoxy-modified nucleotides, the 2'-methoxy-modified nucleotides are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 1st-6th, 10th-19th nucleotides of the sense strand are 2'-methoxy-modified nucleotides in the direction from the 5' end to the 3' end; at least the 1st, 3rd-5th, 7th-13th, 15th, 17th-21st nucleotides of the antisense strand are 2'-methoxy-modified nucleotides; The double-stranded RNA molecule modifier also comprises 2'-fluorine-modified nucleotides, the 2'-fluorine-modified nucleotides are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 7th, 8th, 9th nucleotides of the sense strand are 2'-fluorine-modified nucleotides in the direction from the 5' end to the 3' end, and at least the 2nd, 14th, 16th nucleotides of the antisense strand are 2'-fluorine-modified nucleotides; The double-stranded RNA molecule modifier also comprises 2'-deoxy-modified nucleotides, the 2'-deoxy-modified nucleotides are deoxynucleotides, in the antisense strand of the double-stranded RNA molecule modifier, and at least the 6th nucleotide of the antisense strand is 2'-deoxy-modified nucleotide in the direction from the 5' end to the 3' end; The double-stranded RNA molecule modifier also comprises phosphorothioate-modified nucleotides, the phosphorothioate-modified nucleotides are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 1st and 2nd, the 2nd and 3rd nucleotides of the sense strand are connected by phosphorothioate in the direction from the 5' end to the 3' end, and at least the 1st and 2nd, the 2nd and 3rd, the 19th and 20th, the 20th and 21st nucleotides of the antisense strand are connected by phosphorothioate; D5) the double-stranded RNA molecule modifier comprises 2'-methoxy modified nucleotides in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and, in the 5' end to 3' end direction, at least the 1st-6th, 10th-19th nucleotides of the sense strand are 2'-methoxy modified nucleotides; at least the 1st, 3rd-4th, 6th, 8th-11th, 13th, 15th, 17th-21st nucleotides of the antisense strand are 2'-methoxy modified nucleotides; the double-stranded RNA molecule modifier further comprises 2'-fluoro modified nucleotides in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and, in the 5' end to 3' end direction, at least the 7th, 8th, 9th nucleotides of the sense strand are 2'-fluoro modified nucleotides, at least the 14th, 16th nucleotides of the antisense strand are 2'-fluoro modified nucleotides; the double-stranded RNA molecule modifier further comprises 2'-deoxy modified nucleotides in the antisense strand of the double-stranded RNA molecule modifier, and, in the 5' end to 3' end direction, at least the 2nd, 5th, 7th, 12th nucleotides of the antisense strand are 2'-deoxy modified nucleotides; the double-stranded RNA molecule modifier further comprises phosphorothioate modified nucleotides in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and, in the 5' end to 3' end direction, at least the 1st and 2nd, 2nd and 3rd nucleotides of the sense strand are connected by phosphorothioate group, at least the 1st and 2nd, 2nd and 3rd, 19th and 20th, 20th and 21st nucleotides of the antisense strand are connected by phosphorothioate group; D6) the double-stranded RNA molecule modifier comprises 2'-methoxy modified nucleotides in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and, in the 5' end to 3' end direction, at least the 1st-6th, 10th-19th nucleotides of the sense strand are 2'-methoxy modified nucleotides; at least the 1st, 3rd, 6th, 9th, 11th-13th, 15th, 17th, 19th-21st nucleotides of the antisense strand are 2'-methoxy modified nucleotides; the double-stranded RNA molecule modifier further comprises 2'-fluoro modified nucleotides in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and, in the 5' end to 3' end direction, at least the 7th, 8th, 9th nucleotides of the sense strand are 2'-fluoro modified nucleotides, at least the 2nd, 4th, 8th, 10th, 14th, 16th, 18th nucleotides of the antisense strand are 2'-fluoro modified nucleotides; The double-stranded RNA molecule modifier further comprises 2'-deoxy-modified nucleotides, which are located in the antisense strand of the double-stranded RNA molecule modifier, and at least the 5th and 7th nucleotides from the 5' end to the 3' end of the antisense strand are 2'-deoxy-modified nucleotides; The double-stranded RNA molecule modifier further comprises phosphorothioate-modified nucleotides, which are located in the antisense strand and the sense strand of the double-stranded RNA molecule modifier, and at least the 1st and 2nd, the 2nd and 3rd, the 19th and 20th, and the 20th and 21st nucleotides from the 5' end to the 3' end of the antisense strand are connected by phosphorothioate, and at least the 1st and 2nd, the 2nd and 3rd nucleotides from the 5' end to the 3' end of the sense strand are connected by phosphorothioate.

17. The modification of a double stranded RNA molecule according to claim 16, wherein The modified nucleotide at the 5' end of the antisense strand of the double-stranded RNA molecule modifier is a compound obtained by 5'-(E)-vinyl phosphate modification of the nucleotide at the 5' end of the antisense strand of the double-stranded RNA molecule modifier.

18. The modification of a double stranded RNA molecule according to claim 17, wherein, The 3' end of the sense strand of the double-stranded RNA molecule modifier is coupled with a ligand.

19. The modification of a double stranded RNA molecule of claim 9 or 10, wherein, The modified nucleotide at the 3' end of the sense strand is a compound formed by connecting the nucleotide at the 3' end with a ligand, and the ligand is one or more GalNAc attached by a divalent or trivalent branched linker.

20. The modification of a double stranded RNA molecule according to any one of claims 9 to 19, wherein, The double-stranded RNA molecule modifier is any one of 478 modifications, and the nucleotide sequence of the sense strand of each of the 478 modifications comprises any odd-numbered sequence in the sense strand numbered NO: 881 to NO: 1835; and the nucleotide sequence of the antisense strand of each of the 478 modifications comprises any even-numbered sequence in the antisense strand numbered NO: 882 to NO: 1836.

21. Use of the double-stranded RNA molecule modifier of claim 1, the double-stranded RNA molecule of any one of claims 2-8, or the double-stranded RNA molecule modifier of any one of claims 9-20 in any one of the following: F1) in the preparation of a composition for inhibiting the expression of an angiotensinogen gene; F2) in the inhibition of the expression of an angiotensinogen gene; F3) in the treatment of a disease related to an angiotensinogen gene target; F4) in the preparation of a composition for treating a disease related to an angiotensinogen gene target.

22. A composition for inhibiting the expression of an angiotensinogen gene, comprising, The composition comprises the double-stranded RNA molecule modifier of claim 1, the double-stranded RNA molecule of any one of claims 2-8, or the double-stranded RNA molecule modifier of any one of claims 9-20.

23. The composition of claim 22, wherein, The composition further comprises a pharmaceutically acceptable carrier.

24. A cell comprising the double-stranded RNA molecule modifier of claim 1, the double-stranded RNA molecule of any one of claims 2-8, the double-stranded RNA molecule modifier of any one of claims 9-20, and / or the composition of claim 22 or 23.

25. A method of treating a disease associated with the AGT gene target, the method comprising administering to a subject having a disease associated with the AGT gene target the double-stranded RNA molecule modification of claim 1, the double-stranded RNA molecule of any one of claims 2-8, the double-stranded RNA molecule modification of any one of claims 9-20, and / or the composition of claim 22 or 23.

26. A method of treating hypertension, characterized by, The method comprises administering to a subject having hypertension an effective amount of the double-stranded RNA molecule modification of claim 1, the double-stranded RNA molecule of any one of claims 2-8, the double-stranded RNA molecule modification of any one of claims 9-20, and / or the composition of claim 22 or 23.

27. A method of inhibiting expression of an angiotensinogen gene in a cell, the method comprising: (a) contacting the cell with an effective amount of an AGT inhibitor, the AGT inhibitor being the double-stranded RNA molecule modification of claim 1, the double-stranded RNA molecule of any one of claims 2-8, the double-stranded RNA molecule modification of any one of claims 9-20, and / or the composition of claim 22 or 23, (b) maintaining the cell resulting from step (a) for a time sufficient to achieve degradation of the mRNA transcript of the angiotensinogen gene to effect inhibition of expression of the AGT gene in the cell.

28. The method of claim 27, wherein, wherein the cell is located within a subject.

29. The method of claim 27, wherein, wherein the subject is a human.

30. The method of claim 29, wherein, wherein the subject is suffering from a disease associated with AGT.

31. The method according to any one of claims 27-30, wherein, wherein the angiotensinogen gene expression is inhibited by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100%.

32. A substance for use as a medicament, characterised in that, The substance is the double-stranded RNA molecule modification of claim 1, the double-stranded RNA molecule of any one of claims 2-8, or the double-stranded RNA molecule modification of any one of claims 9-20.

33. The double-stranded RNA molecule modification of claim 1, the double-stranded RNA molecule of any one of claims 2-8, the double-stranded RNA molecule modification of any one of claims 9-20, and / or the composition of claim 22 or 23 for use in the prophylaxis or / and treatment of hypertension.

34. A pharmaceutical composition comprising a pharmaceutically effective amount of the double-stranded RNA molecule modification of claim 1, the double-stranded RNA molecule of any one of claims 2-8, the double-stranded RNA molecule modification of any one of claims 9-20, and / or the composition of claim 22 or 23 for use in the prophylaxis or / and treatment of hypertension.

Images