Modified t cells with enhanced therapeutic properties, methods of generating same, and uses thereof
Patent Information
- Application Number
- PCT/US2026/016104
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-06-09
- Filing Date
- 2026-02-20
- Publication Date
- 2026-08-27
Smart Images

Figure US2026016104_27082026_PF_FP_ABST
Abstract
Description
Attorney Docket No.: 078430-545001 WOMODIFIED T CELLS WITH ENHANCED THERAPEUTIC PROPERTIES, METHODS OF GENERATING SAME, AND USES THEREOFSTATEMENT REGARDING FEDERALLY SPONSORED R&D
[0001] This invention was made with Government support under contract R35 CA283888-01 Al awarded by the National Institutes of Health. The Government has certain rights in the invention.CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims the benefit of priority to U.S. Provisional Patent Application Serial No. 63 / 761,768; filed on February 21, 2025; and U.S. Provisional Patent Application Serial No. 63 / 820,519; filed on June 9, 2025. The disclosures of the above-referenced applications are herein expressly incorporated by reference it their entireties, including any drawings.INCORPORATION OF THE SEQUENCE LISTING
[0003] This application contains a Sequence Listing, which is hereby incorporated herein by reference in its entirety. The accompanying Sequence Listing XML file, named “078430-54500 lWO_Sequence Listing_ST26.xml,” was created on February 19, 2026 and is 36,190 bytes in size.BACKGROUND
[0004] In recent years, adoptive transfer of genetically modified immune cells, e.g., T cells, has emerged as a potent therapy for various malignancies. For example, current modalities of adoptive T cell therapies include cells modified to express receptors specific for cancer antigens, such as chimeric antigen receptors (CARs) and high-affinity T cell receptors (TCRs). Upon exposure to the cancer antigen, the modified T cells exhibit cytolytic activity and / or send signals to initiate an immune response against the cancer. In adoptive T cell therapies, modified T cells are generally activated by exposure to the cognate antigen in vitro or ex vivo, expanded, and then administered to the subject, where they proliferate and have anticancer activity. Recent clinical trials using CAR-modified T cells demonstrated marked disease regression in a subset of patients with advanced cancers.Attorney Docket No.: 078430-545001 WO
[0005] However, despite significant advancements, the widespread adoption of T cell therapies for solid tumors faces substantial challenges. For example, it has been reported that CAR T cell potency is often limited, particularly in solid tumors. This is often due to low target antigen density, antigen heterogeneity, and immune suppressive factors in the microenvironment. In addition, the manufacturing of T cells expressing multiple CARs often involves the introduction of multiple CAR constructs, such as through electroporation or multiple vector transductions, which can negatively impact T cell viability and proliferation.
[0006] Thus, new compositions, methods, and strategies are needed for generating improved therapeutic cells, e.g., T cells, for adoptive cell therapy. The presently disclosed aspects and embodiments address these needs and provide other related advantages.SUMMARY
[0007] The present disclosure relates generally to, inter alia, novel compositions and methods for the prevention and / or treatment of various health conditions. In particular, some embodiments of the disclosure relate to the development of engineered immune cells (e.g., T cells) having enhanced therapeutic properties (e.g. potency) for, e.g. , cancer therapy. Some embodiments of the disclosure relate to T cells that have been engineered to include one or more nucleic acid constructs expressing multiple (e.g, two, three, four, five, or more) CARs and further engineered such that expression of one or more genes encoding enhancers of T-cell function is reduced (e.g, inhibited by a knockdown). In some embodiments, the reduction in expression of one or more genes encoding enhancers of T-cell function is achieved by an short hairpin RNA encoded by one or more of the nucleic acid constructs. Some embodiments of the disclosure provide methods for generating a population of recombinant cells (e.g., engineered T cells) with improved therapeutic properties for adoptive T-cell therapy, and pharmaceutical compositions containing such a population of recombinant cells (e.g., engineered T cells) with enhanced therapeutic properties, as well as methods and kits for the prevention and / or treatment of a health condition in subjects in need thereof.
[0008] In one aspect of the disclosure, provided herein are methods for generating recombinant cells (e.g., engineered T cells), the method include introducing into a T cell: (a) a first nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a first polypeptide of interest (POI, e.g., a CAR), a selection marker, a protease cleavage site, and a first shRNAAttorney Docket No.: 078430-545001 WOmodule targeting a first enhancer of T-cell function; and (b) a second nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a second POI (e.g., a CAR), a protease capable of cleaving the protease cleavage site of (a) or a functional portion thereof, and a second shRNA module targeting a second enhancer of T-cell function. Non- limiting exemplary embodiments of the disclosed methods for generating recombinant cells can include one or more of the following features. In some embodiments, the second nucleic acid construct comprises coding sequences for a full-length protease. In some embodiments, the method further includes introducing into the T cell: (c) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third POI (e.g., a CAR), a N-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a C-terminal domain of the protease. In some embodiments, the method further includes introducing into the T cell: (c) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third POI (e.g., a CAR), a C-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a N-terminal domain of the protease. In some embodiments, the protease cleavage site is a viral protease cleavage site. In some embodiments, the viral protease cleavage site is a cleavage site for a potyviral family protease. In some embodiments, the potyviral family protease is Tobacco Etch Virus (TEV) protease, plum pox virus protease (PPVp), soybean mosaic virus protease (SbMVp), sunflower mild mosaic virus protease (SuMMVp), tobacco vein mottling virus protease (TVMVp), or West Nile virus protease (WNVp). In some embodiments, the protease cleavage site is a cleavage site for TEV protease.
[0009] In some embodiments, one or more of the first, second, and third POI is a chimeric antigen receptor (CAR), e.g., first, second, and third CAR, respectively.
[0010] In some embodiments, the methods of the disclosure include introducing into a T cell: (a) a first nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a first POI (e.g., a CAR), a selection marker, a protease cleavage site, and a first shRNA module targeting an enhancer of T-cell function; (b) a second nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a second POI (e.g., a CAR), a N-terminal domain of a protease, and a second shRNA module targeting an enhancer of T-cell function (e.g., a gene whose reduced / decreased expression in T cells results in an enhanced T-cell function); and (c) aAttorney Docket No.: 078430-545001 WOthird nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a third POI (e.g., a CAR), a C-terminal domain of the protease, and a third shRNA module targeting an enhancer of T-cell function, wherein the first, second, and third nucleic acid constructs are each independently optional, and wherein the first, second, and third shRNA modules are each independently optional.
[0011] In some embodiments, the methods of the disclosure further include analyzing cell surface expression of the selection marker in the engineered T cell. In some embodiments, the methods further include selecting the engineered T cell if it exhibits surface expression of the selection marker. In some embodiments, one or more of the first, second, and third nucleic acid constructs are incorporated into one or more expression cassettes or expression vectors. In some embodiments, the first, second, and third nucleic acid constructs are incorporated into separate expression cassettes or expression vectors. In some embodiments, the enhancer of T-cell function is selected from the group consisting of MED 12, FAS, PD1, TGF-BR, TET2, RASA2, PTPN2, TOX, CBLB, JUNB, ZC3H12A, DHX37, FLU, TIGIT, HAVCR2, SOCS1, CCNC, NR4A2, TNFRSF18, CDKN1B, REGNASE-1, NFAT andNR4Al. In some embodiments, the enhancer of T-cell function is selected from the group consisting of MED12, FAS, TGF-BR, TOX, NFAT and SOCS1 In some embodiments, the enhancer of T-cell function is MED12.
[0012] In some embodiments, the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an endoplasmic reticulum localization tag, e.g., retention tag (ER tag). In some embodiments, the ER retention tag is or includes a Tm domain, an ICD, or both, of an ER retention tag of a human ER-resident protein, or a variant Tm and / or ICD thereof which retains the ability to localize a polypeptide to the ER. In some embodiments, the human ER-resident protein is CDGSH iron sulfur domain 2 (CISD2). In some embodiments, the human ER-resident protein is UDP glucuronosyltransferase family 2 member B 17 (UGT2B17). More information regarding retention tags suitable for the compositions and methods of the disclosure can be found in, PCT Publication No. W02021072250A1 and WO2022216866A1, both of which are hereby incorporated by reference for all purposes. In some embodiments, the coding sequence for the ER tag is incorporated at the 3 ’ end of the protein coding region. In some embodiments, the coding sequence for the ER tag is incorporated between the 3’ end of the protein coding region and the 5 ’ end of the shRNA module.Attorney Docket No.: 078430-545001 WO
[0013] In some embodiments, the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an autoproteolytic cleavage sequence. In some embodiments, the autoproteolytic cleavage sequence is derived from porcine teschovirus-1 2A (P2A), calcium-dependent serine endoprotease (furin), foot-and-mouth disease virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), or Flacherie Virus 2A (BmIFV2A). In some embodiments, the autoproteolytic cleavage sequence is derived from P2A.
[0014] In some embodiments of the disclosure, one or more of the first, second, and third shRNA modules comprises at least one, two, or three shRNA sequences. In some embodiments, the first, second, and third shRNA modules are incorporated in the 3 ’ UTR of the first, second, and third nucleic acid constructs, respectively. In some embodiments, the first, second, and third shRNA modules target different enhancers of T-cell function. In some embodiments, the first, second, and third shRNA modules target the same enhancer of T-cell function.
[0015] In some embodiments, the enhancer of T-cell function is MED12. In some embodiments, the first, second, and third shRNA modules comprise different MED 12-targeting sequences. In some embodiments, the first, second, and third shRNA modules comprise the same MED 12-targeting sequence. In some embodiments, the MED 12-targeting sequence comprises or consists of one or more nucleic acid sequences independently selected from the group consisting of SEQ ID NOS: 1-10. In some embodiments, the first, second, and third shRNA modules independently comprise or consists of the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
[0016] In some embodiments of the disclosure, the first, second, and third CARs each comprise: (a) an extracellular domain (ECD) comprising an antigen-binding moiety having a binding affinity for a cell surface antigen; and (b) an intracellular signaling domain (ICD). In some embodiments, the first, second, and third CARs further independently comprise one or more of the following: (i) signal peptide, (ii) a hinge domain, (iii) a transmembrane domain (TMD), (iv) one or more costimulatory domains, and (v) CD32 ICD. In some embodiments, the antigen-binding moiety of the first, second, and third CARs have binding affinity for two or more different cell surface antigens. In some embodiments, the cell surface antigen is selected from the group consisting of B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, WT1, MAGE-A4, PRAME, ROR1, ROR2,Attorney Docket No.: 078430-545001 WOIL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3, and ALK.
[0017] In some embodiments of the disclosure, the one or more costimulatory domains is derived from a protein selected from the group consisting of 4- IBB (CD 137), CD27 (TNFRSF7), CD28, 0X40 (CD134), CD70, LFA-2 (CD2), CD5, ICAM-1 (CD54), LFA-1 (CD1 la / CD18), DAP10, DAP12, and a co-stimulatory inducible T-cell costimulatory (ICOS) protein. In some embodiments, the hinge domain is derived from a protein selected from the group consisting of LFA-1 (CD1 la / CD18), LFA-2 (CD2), CD4, CD5, CD8, CD27 (TNFRSF7), CD28, CD70, 4-1BB, 0X40 (CD134), CD152 (CTLA4), ICOS (CD278), IgGl Fc region, and IgG4 Fc region. In some embodiments, the TMD is derived from a protein selected from a T-cell receptor (TCR) alpha chain, a TCR beta chain, a TCR zeta chain, CD3 epsilon, CD4, CD5, CD8, CD9, CD16, CD22, CD27 (TNFRSF19), CD28, CD33, CD45, CD80, CD83, CD86, CD134, CD137, CD152 (CTLA4), CD154, CD279, and PD-1.
[0018] In some embodiments of the disclosure, the antigen-binding moiety of the first, second, and third CARs is independently selected from a ligand of the cell surface antigen, a full-length antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is a single-chain antibody fragment (scFv), a F(ab), a F(ab'), a Fab'-SH, a F(ab')2, a single domain antibody (sdAb), or a Fv fragment. In some embodiments, the sdAB comprises a VH domain only. In some embodiments, the sdAB comprises a VL domain only.
[0019] In some embodiments, the first CAR comprises: (a) an anti-GPC2 scFv; (b) a CD28 hinge domain; (c) a CD28 TMD; (d) a CD28 costimulatory domain; and (e) a CD3^. In some embodiments, the second CAR comprises: (a) an anti-B7-H3 scFv; (b) a CD8 hinge domain; (c) a CD8 TMD; (d) a 4-1BB costimulatory domain; and (e) a CD3^. In some embodiments, the third CAR comprises: (a) an anti-GD2 scFv; (b) a CD8 hinge domain; (c) a CD8 TMD; (d) a 4-1BB costimulatory domain; and (e) a CD32- In some embodiments, the first, second, and third nucleic acid constructs comprise the sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, respectively.
[0020] In some embodiments of the disclosure, one or more of the first, second, and third nucleic acid constructs is operably and / or independently linked to a promoter sequence. In some embodiments, the promoter is a constitutive promoter or an inducible promoter. In some embodiments, the promoter is a CD4 cell-specific promoter or a CD8 cell-specific promoter. InAttorney Docket No.: 078430-545001 WOsome embodiments, the T cell is a CD8+ T cytotoxic lymphocyte cell or a CD4+ T helper lymphocyte cell. In some embodiments, the CD8+ T cytotoxic lymphocyte cell is selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, bulk CD8+ T cells. In some embodiments, the CD4+ T helper lymphocyte cell is selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells. In some embodiments, the T cell is an exhausted T cell or a non-exhausted T cell. In some embodiments, the T cell is obtained leukapheresis of a sample obtained from a subject. In some embodiments, the T cell is obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs).
[0021] Accordingly, in a related aspect, recombinant cells e.g., engineered T cells) produced by a method disclosed herein are also encompassed within the present disclosure.
[0022] In another aspect of the disclosure, provided herein are recombinant cells (e.g., engineered T cells) comprising: (a) a first nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a first POI (e.g., CAR), a selection marker, a protease cleavage site, and a first shRNA module targeting a first enhancer of T-cell function; and (b) a second nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a second POI (e.g., CAR), a protease capable of cleaving the protease cleavage site of (a) or a functional portion thereof, and a second shRNA module targeting a second enhancer of T-cell function.
[0023] Non-limiting exemplary embodiments of the disclosed recombinant cells can include one or more of the following features. In some embodiments, the second nucleic acid construct comprises coding sequences for a full-length protease. In some embodiments, the recombinant cells further include: (c ) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third CAR, a N-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a C-terminal domain of the protease. In some embodiments, the recombinant cells further include: (c ) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third CAR, a C-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a N-terminal domain of the protease. In some embodiments, the protease cleavage site is a viral protease cleavage site.Attomey Docket No.: 078430-545001 WOIn some embodiments, the viral protease cleavage site is a cleavage site for a potyviral family protease. In some embodiments, the potyviral family protease is Tobacco Etch Virus (TEV) protease, plum pox virus protease (PPVp), soybean mosaic virus protease (SbMVp), sunflower mild mosaic virus protease (SuMMVp), tobacco vein mottling virus protease (TVMVp), or West Nile virus protease (WNVp). In some embodiments, the protease cleavage site is a cleavage site for TEV protease.
[0024] In some embodiments, the viral protease cleavage site is for a viral protease derived from hepatitis C virus (HCV) nonstructural protein 3 (NS3). In some embodiments, the viral protease cleavage site is for a viral protease that further comprises a cofactor polypeptide derived from HCV nonstructural protein 4A (NS4A). In some embodiments, the viral protease cleavage site is selected from the group consisting of: an NS4A / 4B junction cleavage site, an NS3 / NS4A junction cleavage site, an NS4A / NS4B junction cleavage site, an NS4B / NS5A junction cleavage site, an NS5A / NS5B junction cleavage site, and variants thereof cleavable by the viral protease.
[0025] In some embodiments, the protease cleavage site is a human protease cleavage site. In some embodiments, the human protease cleavage site is a cleavage site for a human protease selected from the group consisting of: a human kallikrein (KLK) protease, human enterokinase protease, human thrombin, a human matrix metalloprotease (MMP), human urokinase-type plasminogen activator receptor (uPAR), human plasmin, and human cathepsin. In some embodiments, the human kallikrein protease is selected from the group consisting of: human KLK3, human KLK4, human KLK6, human KLK8, human KLK11 , human KLK13, human KLK 14, and human KLK15.
[0026] In some embodiments, one or more of the first, second, and third POI is a CAR (e.g., first, second, and third CAR, respectively).
[0027] In some embodiments, the recombinant cells of the disclosure include: (a) a first nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a first POI (e.g., CAR), a N-terminal domain of a protease, and a first shRNA module targeting an enhancer of T-cell function; (b) a second nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a second POI (e.g., CAR), a C-terminal domain of the protease, and a second shRNA module targeting an enhancer of T-cell function; and (c) a third nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a third POI (e.g., CAR), and a selection marker, a protease cleavage site, and a third shRNA module targeting an enhancer of T-Attorney Docket No.: 078430-545001 WOcell function, wherein the first, second, and third shRNA modules are each independently optional.
[0028] In some embodiments, one or more of the first, second, and third nucleic acid constructs are incorporated into one or more expression cassettes or expression vectors. In some embodiments, the first, second, and third nucleic acid constructs are incorporated into separate expression cassettes or expression vectors. In some embodiments, the first, second, and third shRNA modules target one or more enhancers of T-cell function. Non-limiting examples of enhancers of T-cell function include MED12, FAS, PD1, TGF-BR, TET2, RASA2, PTPN2, TOX, CBLB, JUNB, ZC3H12A, DHX37, FLU, TIGIT, HAVCR2, SOCS1, CCNC, NR4A2, TNFRSF18, CDKN1B, REGNASE-1, NFAT andNR4Al. In some embodiments, the enhancer of T-cell function is selected from the group consisting of MED12, FAS, TGF-BR, TOX, NFAT and SOCS1 In some embodiments, the enhancer of T-cell function is MED12.
[0029] In some embodiments, the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an endoplasmic reticulum retention tag (ER tag), e.g., an ER localization sequence. In some embodiments, the coding sequence for the ER tag is incorporated at the 3’ end of the protein coding region. In some embodiments, the coding sequence for the ER tag is incorporated between the 3 ’ end of the protein coding region and the 5’ end of the shRNA module. In some embodiments, the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an autoproteolytic cleavage sequence. In some embodiments, the autoproteolytic cleavage sequence is derived from porcine tescho virus- 1 2A (P2A), calcium-dependent serine endoprotease (furin), foot-and-mouth disease virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), or Flacherie Virus 2A (BmIFV2A). In some embodiments, the autoproteolytic cleavage sequence is derived from P2A. In some embodiments, one or more of the first, second, and third shRNA modules comprises at least one, two, or three shRNA sequences. In some embodiments, the first, second, and third shRNA modules are incorporated in the 3 ’ UTR of the first, second, and third nucleic acid constructs, respectively. In some embodiments, the first, second, and third shRNA modules target different enhancers of T-cell function. In some embodiments, the first, second, and third shRNA modules target the same enhancer of T-cell function. In some embodiments, the enhancer of T-cell function is MED 12. In some embodiments, the first, second, and third shRNA modulesAttorney Docket No.: 078430-545001 WOcomprise different MED 12-targ eting sequences. In some embodiments, the first, second, and third shRNA modules comprise the same MED 12-targeting sequence. In some embodiments, the MED12-targeting sequence comprises or consists of one or more nucleic acid sequences independently selected from the group consisting of SEQ ID NOS: 1-10. In some embodiments, the first, second, and third shRNA modules independently comprise or consists of the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
[0030] In some embodiments of the disclosure, the first, second, and third CARs each comprise: (a) an extracellular domain (ECD) comprising an antigen-binding moiety having a binding affinity for a cell surface antigen; and (b) an intracellular signaling domain (ICD). In some embodiments, the first, second, and third CARs further independently comprise one or more of the following: (i) signal peptide, (ii) a hinge domain, (iii) a transmembrane domain (TMD), (iv) one or more costimulatory domains, and (v) CD32 ICD.
[0031] In some embodiments, the antigen-binding moiety of the first, second, and third CARs have binding affinity for two or more different cell surface antigens. Non-limiting examples of cell surface antigens suitable for the compositions and methods of the disclosure include B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, and WT1. Additional cell surface antigens suitable for the compositions and methods of the disclosure include, but are not limited to, MAGE-A4, PRAME, ROR1, ROR2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3and ALK.
[0032] In some embodiments of the disclosure, the first, second, and third CARs further independently comprise one or more costimulatory domains. Non-limiting examples of costimulatory domains suitable for the compositions and methods of the disclosure include those derived from 4- IBB (CD 137), CD27 (TNFRSF7), CD28, 0X40 (CD 134), CD70, LFA-2 (CD2), CD5, ICAM-1 (CD54), LFA-1 (CD1 la / CD18), DAP10, DAP12, and co-stimulatory inducible T-cell costimulatory (ICOS) protein.
[0033] In some embodiments of the disclosure, the first, second, and third CARs further independently comprise a hinge domain. Hinge domains suitable for the compositions and methods of the disclosure include, but are not limited to, those derived from LFA-1Attorney Docket No.: 078430-545001 WO(CD1 la / CD18), LFA-2 (CD2), CD4, CD5, CD8, CD27 (TNFRSF7), CD28, CD70, 4-1BB, 0X40 (CD134), CD152 (CTLA4), ICOS (CD278), IgGl Fc region, and IgG4 Fc region.
[0034] In some embodiments of the disclosure, the first, second, and third CARs further independently comprise a transmembrane domain (TMD). Non-limiting examples of TMDs suitable for the compositions and methods of the disclosure include those derived from T-cell receptor (TCR) alpha chain, TCR beta chain, a TCR zeta chain, CD3 epsilon, CD4, CD5, CD8, CD9, CD16, CD22, CD27 (TNFRSF19), CD28, CD33, CD45, CD80, CD83, CD86, CD134, CD137, CD152 (CTLA4), CD154, CD279, and PD-1.
[0035] In some embodiments, the antigen-binding moiety of the first, second, and third CARs is independently selected from a full-length antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is a single-chain antibody fragment (scFv), a F(ab), a F(ab'), a Fab'-SH, a F(ab')2, a single domain antibody (sdAb), or a Fv fragment. In some embodiments, the sdAB comprises a VH domain only. In some embodiments, the sdAB comprises a VL domain only.
[0036] In some embodiments, the first CAR of the recombinant T cell disclosed herein comprises: (a) an anti-GPC2 scFv; (b) a CD28 hinge domain; (c) a CD28 TMD; (d) a CD28 costimulatory domain; and (e) a CD3 In some embodiments, the second CAR of the recombinant T cell disclosed herein comprises: (a) an anti-B7-H3 scFv; (b) a CD8 hinge domain; (c) a CD8 TMD; (d) a 4- IBB costimulatory domain; and (e) a CD3^ chain. In some embodiments, the third CAR of the recombinant T cell disclosed herein comprises: (a) an anti-GD2 scFv; (b) a CD8 hinge domain; (c) a CD8 TMD; (d) a 4- IBB costimulatory domain; and (e) a CD32 chain. In some embodiments, the first, second, and third nucleic acid constructs comprise the sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, respectively.
[0037] In some embodiments of the disclosure, one or more of the first, second, and third nucleic acid constructs is operably linked to a promoter sequence. In some embodiments of the disclosure, one or more of the first, second, and third nucleic acid constructs is independently linked to a promoter sequence. In some embodiments of the disclosure, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a CD4 cell-specific promoter. In some embodiments, the promoter is a CD8 cell-specific promoter.Attorney Docket No.: 078430-545001 WO
[0038] In some embodiments of the disclosure, the T cell is a CD8+ T cytotoxic lymphocyte cell or a CD4+ T helper lymphocyte cell. In some embodiments, the CD8+ T cytotoxic lymphocyte cell is selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, bulk CD8+ T cells. In some embodiments, the CD4+ T helper lymphocyte cell is selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells.
[0039] In some embodiments of the disclosure, the T cell is an exhausted T cell. In some embodiments, the T cell is a non-exhausted T cell. In some embodiments, the T cell is obtained leukapheresis of a sample obtained from a subject. In some embodiments, the T cell is obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs).
[0040] In another aspect, provided herein are cell cultures including at least one recombinant T cell as disclosed herein, and a culture medium.
[0041] In another aspect, provided herein are pharmaceutical compositions comprising a recombinant T cell as disclosed herein, and a pharmaceutically acceptable carrier.
[0042] In yet another aspect, provided herein are methods for preventing, and / or treating a health condition in a subject in need thereof, comprising administering to the subject a composition comprising one or more of the following: (a) a recombinant T cell as disclosed herein; and (b) a pharmaceutical composition as disclosed herein.
[0043] Non-limiting exemplary embodiments of the methods of the disclosure can include one or more of the following features. In some embodiments, the recombinant T cell is allogeneic relative to the subject. In some embodiments, the recombinant T cell is autologous relative to the subject. In some embodiments, the health condition is a proliferative disorder. In some embodiments, the proliferative disorder is a cancer. In some embodiments, the cancer expresses or overexpresses a cell surface antigen. In some embodiments, the cell surface antigen is selected from the group consisting of B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, WT1, MAGE-A4, PRAME, ROR1, ROR2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3 and ALK.Attorney Docket No.: 078430-545001 WO
[0044] In some embodiments, the cancer expresses or overexpresses the GPC2 antigen (GPC2-positive cancer), GD2-positive cancer, and / or the B7-H3 antigen (B7-H3 -positive cancer). In some embodiments, the B7-H3 -positive cancer is selected from the group consisting of nervous system cancer, cervical cancer, sarcoma, neuroblastoma, melanoma, lung cancer, head and neck cancer, colorectal cancer, pancreatic cancer, gastric cancer, kidney cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, and hepatocellular carcinoma. In some embodiments, the GPC2 -positive cancer is selected from the group consisting of uterine carcinosarcoma (UCS), brain lower grade glioma (LGG), thymoma (THYM), testicular germ cell tumors (TGCT), glioblastoma multiforme (GBM) and skin cutaneous melanoma (SKCM), liver hepatocellular carcinoma (LIHC), uveal melanoma (UVM), kidney chromophobe (KICH), thyroid cancer (THCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), stomach adenocarcinoma (STAD), cholangiocarcinoma (CHOL), adenoid cystic carcinoma (ACC), prostate adenocarcinoma (PRAD), pheochromocytoma and paraganglioma (PCPG), DLBC, lung adenocarcinoma (LUAD), small-cell lung cancer (SCLC), head-neck squamous cell carcinoma (HNSC), pancreatic adenocarcinoma (PAAD), breast cancer (BRCA), mesothelioma (MESO), colon and rectal adenocarcinoma (COAD), rectum adenocarcinoma (READ), esophageal carcinoma (ESCA), ovarian cancer (OV), lung squamous cell carcinoma (LUSC), bladder urothelial carcinoma (BLCA), sarcoma (SARC), or uterine corpus endometrial carcinoma (UCEC). In some embodiments, the GD2-positive cancer is selected from the group consisting of osteosarcoma, liposarcoma, fibrosarcoma, malignant fibrous, histiocytoma, leimyosarcoma, spindle cell sarcoma, brain tumor, small cell lung cancer, HTLV-1 infected T cell leukemia, and retinoblastoma. In some embodiments, the administered composition inhibits tumor growth or metastasis of the GPC2-positive cancer, GD2-positive cancer, and / or the B7-H3-positive cancer in the subject. In some embodiments, the GPC2-positive cancer, GD2-positive cancer, and / or the B7-H3-positive cancer is medulloblastoma, DIPG, neuroblastoma, osteosarcoma, ependymoma, nephroblastoma, retinoblastoma, rhabdomyosarcoma, ATRT, ETMR, germ cell tumor, or adrenocortial cancer. In some embodiments, the GPC2 -positive cancer, GD2-positive cancer, and / or the B7-H3-positive cancer is an adult malignancy or a pediatric cancer. In some embodiments, the pediatric cancer is osteosarcoma, Ewing sarcoma, rhabdomyosarcoma, atypical teratoid rhabdoid tumor,Attorney Docket No.: 078430-545001 WOmedulloblastoma, or neuroblastoma. In some embodiments, the proliferative disorder is a solid tumor. In some embodiments, the tumor is a brain tumor.
[0045] In some embodiments, the administered composition confers an enhanced effector function. Non-limiting examples of effector functions include growth rate (proliferation), cytokine production, target cell inhibition (e.g., anti-cancer cytotoxicity), macrophage activation, maintenance of enhanced effector cell function, NK cell activation, exhaustion resistance, and in vivo persistence (e.g., survival). In some embodiments, the enhanced effector function comprises increased production of interferon gamma (INFy), interleukin-2 (IL-2), and / or tumor-necrosis factor a (TNFa). In some embodiments, the enhanced effector function comprises increased effector memory T cell phenotype. In some embodiments, the composition is administered to the subject individually or as a first therapy in combination with a second therapy. Non-limiting examples of second therapies include chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, and surgery.
[0046] In yet another aspect, provided herein are kits for the prevention, and / or treatment of a health condition in a subject in need thereof, the kit including one or more of the following: (a) a recombinant T cell as disclosed herein; and / or (b) a pharmaceutical composition as disclosed herein.
[0047] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative embodiments and features described herein, further aspects, embodiments, objects and features of the disclosure will become fully apparent from the drawings and the detailed description and the claims.BRIEF DESCRIPTION OF THE DRAWINGS
[0048] FIG. 1: Description of workflow to maximize knock-down efficacy by incorporating shRNAs into the STASH selection platform.
[0049] FIG. 2 are schematic illustrations of the “three-way” and “two-way” cell selection system “STASH select” using a resistance gene or a cell surface antigen as a selection marker. In “two-way” cell selection system (top), two separate nucleic acid constructs are required for cell surface expression of the selection marker. In “three-way” cell selection system (bottom), three separate nucleic acid constructs are required for cell surface expression of the selection marker. Coding sequences for one or more autoproteolytic cleavage sequences P2A derived from porcineAttorney Docket No.: 078430-545001 WOtescho virus- 1 2A, polypeptide of interest (POI) such as a CAR, the shRNA modules targeting one or more enhancers of T-cell function (shRNA A, shRNA B, and shRNA C) are shown. After cleavage, the selection marker was activated (by migrating to the cell surface to be used as a cell surface selection marker). The protease was split into N- and C-terminal fragments (three-way STASH select) or placed as a whole in one vector (two-way STASH select), allowing a three-vector or two- vector AND gate, respectively, with each vector carrying one of the components (the selection marker and necessary fragments of the protease), as described in WO2022216866.
[0050] FIGS.3A-3C schematically summarize the results from experiments performed to screen the shRNAs described in the present disclosure. FIG.3A depicts flow cytometry plot showing CAR expression of vectors incorporating a GD2-CAR and different shRNAs compared to Mock and GD2-CAR vector without shRNA in two donors on Day 10 and Day 14. DN1 and DN2 are Donors #1 and #2, respectively. FIG.3B depicts plots showing MFI of CAR, CD25, and CD39 expression of vectors incorporating a GD2-CAR and different shRNAs compared to Mock and GD2-CAR vector without shRNA in two donors on Day 14. MFI: Mean Fluorescence Intensity. FIG. 3C depicts co-cultures of Nalm6-GD2 including tumor re-challenges with CAR T cells incorporating a GD2-CAR and different shRNAs compared to Mock and GD2-CAR T cell without shRNA in two donors.
[0051] FIG. 4A: GPC2-CAR, B7H3-CAR, and GD2-CAR vectors carrying the selection marker EGFRt suitable for column-based selection, the N-fragment of the TEV protease, and C-fragment of TEV protease, respectively. The amino acid sequences of the GPC2-CAR, B7H3-CAR, and GD2-CAR vectors are provided in the Sequence Listing. (SEA ID NO: 23, 24, and 25, respectively). FIG. 4B depicts schematic illustration of the shRNA cassette added to a B7H3-CAR and GD2-CAR vector carrying the STASH components.
[0052] FIG. 5 depicts flow cytometry plots of CAR expression of different combinations of shRNAs across the different STASH vectors in triple-CAR positive T cells. KD: knockdown construct.
[0053] FIG. 6 depicts the assessments of CD25 and CD39 positive T cells of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0054] FIG. 7 depicts co-cultures of a mixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively) including a tumor re-challenge in the indicated effector / targetAttorney Docket No.: 078430-545001 WOratios with Mock T cells and selected triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0055] FIG. 8 depicts the normalized gene expression of MED 12 as assessed by qPCR of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0056] FIG. 9 depicts a schematic illustration of the used CAR vectors and the assessment of cell counts of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0057] FIG. 10 depicts co-cultures of a mixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively) including tumor re-challenges with Mock T cells, non-shRNA triple-CAR positive T cells, a mixed population (1 : 1 : 1) of single CAR-positive T cells, cotransduced CAR T cells without selection, and selected triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors of a first donor.
[0058] FIG. 11 depicts co-cultures of a mixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively) including tumor re-challenges with Mock T cells, non-shRNA triple-CAR positive T cells, a mixed population (1 : 1 : 1) of single CAR-positive T cells, cotransduced CAR T cells without selection, and selected triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors of a second donor.
[0059] FIG. 12 depicts flow cytometry plots of CAR expression of different combinations of shRNAs across the different STASH vectors in triple-CAR positive T cells vs controls after the re-challenges described in FIG. 10 and FIG. 11.
[0060] FIG. 13 schematically summarizes the results from the assessments of CD25 and CD39 positive T cells and the cell counts of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors vs controls after the re-challenges described in FIG. 10 and FIG. 11.
[0061] FIG. 14 depicts the experimental design of the in vivo experiment shown in FIG. 12 comparing the in vivo efficacy of different doses of MED 12 knockdown triple-CAR positive T cells against GPC2, GD2 and B7H3 co-expressing Nalm6 and a re-challenge with a mixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively).Attorney Docket No.: 078430-545001 WO
[0062] FIG. 15 schematically summarizes the results from the in vivo quantification of the luminescence signal of tumor cells (firefly luciferase) across the different doses described in FIG. 14.
[0063] FIG. 16 schematically summarizes the results from the in vivo quantification of the luminescence signal of single mice's tumor cells (firefly luciferase) of dose level 1 described in FIG. 14 and FIG. 15.FIG. 17A depicts (upper panel) the experimental design of the in vivo experiment comparing the in vivo efficacy of Mock T cells, unselected (“us”) and selected (“s”) triple-CAR T cells as well as MED 12 knockdown selected triple-CAR T cells against GPC2, GD2 and B7H3 co-expressing Nalm6. Blood was drawn on Day 12 and analyzed for CD45-positive cells by flow cytometry (lower left panel). The Kaplan-Meier survival plot is depicted in the lower right panel. FIG. 17B schematically summarizes the results from the in vivo quantification of the luminescence signal of tumor cells (firefly luciferase) across the different groups.DETAILED DESCRIPTION OF THE DISCLOSURE
[0064] Provided herein are, inter alia, novel compositions and methods for the prevention and / or treatment of various health conditions. In particular, some aspects and embodiments of the disclosure relates to the development of engineered immune cells (e.g. , T cells) having enhanced therapeutic properties (e.g., potency) for, e.g., cancer therapy. Some embodiments of the disclosure relate to the development of multi-specific CAR T cell products for clinical use, where T cells are engineered to include one or more nucleic acid constructs expressing multiple CARs and further engineered such that expression of one or more genes encoding enhancers of T-cell function is reduced (e.g., down-regulated, inhibited, or knockdown). In some embodiments, the reduction in expression of one or more genes encoding enhancers of T-cell function is achieved by an short hairpin RNA module encoded by one or more of the nucleic acid constructs.
[0065] As described in greater detail below, an mIR-30-based knockdown module was incorporated into a CAR vector allowing the downregulation of a target gene (e.g., MED 12) while maintaining high expression of the CAR. As framework the optimized microRNA backbone described in Fellmann, Christof, et al., Cell reports 5.6, 2013: 1704-1713 (which is herein incorporated by reference) was used and shRNAs targeting MED12 (Huang et al., Cell,Attorney Docket No.: 078430-545001 WOVol. 151, Issue 5; p937-950; November 21, 2012) were incorporated into that backbone. The mIR-30 framework was placed in the 3 ’UTR region of different CAR vectors. In some embodiments of the disclosure, the mIR-30 framework does not require a separate promoter and is approximately 150-bp long. In these instances, the shRNA module does not require dedicated promoter and allows for concatenation of multiple shRNAs in a single strand.
[0066] The compositions and methods disclose herein have several advantages and improvements over existing methods of engineering T cells for enhanced therapeutic efficacy. In particular, the strategy described herein allows engineering enhanced multi-specific CAR T cells without the need for electroporation and CRISPR-mediated knock-out (KO) techniques. This is because in the context of multi-specific CARs that require selection, there is no selection method for multi-targeting KO cells and electroporation before or after triple (or double, quadruple, and so on) transduction with viral vectors has a deleterious effect on T cell viability and proliferation. The low yield and mixed populations, would be a strong deterrent to mix these two approaches. Therefore, the incorporation of the shRNA into the STASH platform as disclosed herein brilliantly overcomes these two limitations, which increases the manufacturability of CAR T cells products in the context of multi-specific CARs that require selection.
[0067] The methods disclose herein build on and combine downregulating expression of one or more enhancers of T cell functions e.g., MED 12) with a streamlined miR-30 based knockdown approach in CAR T cells. For example, the MED 12 knockdown approach allows to overcome the limitations of increased tonic signaling in multi-specific CAR T cells without cell loss in the manufacturing process. The generation of multi-specific CAR-T cells with multiple vectors could exacerbate tonic signaling and increase the propensity for CAR-T cell exhaustion owing to increase total CAR expression. The MED 12 knockdown module acts to counter the dysfunction caused by tonic signaling.
[0068] Two-way and three-way cell selection systems, sometimes referred to as “STASH select” systems, have been reported previously by virtue of the selection marker being “stashed” intracellularly in the absence of the desired combination of nucleic acid constructs (e.g., expression constructs, expression cassettes, or expression vectors) being present in the cell. In these systems, two or more separate nucleic acid constructs (e.g, expression constructs, expression cassettes, or expression vectors) encoding the components of the selection system and the presence of these separate nucleic acid constructs (e.g. , expression constructs, expressionAttorney Docket No.: 078430-545001 WOconstructs, expression cassettes, or expression vectors) are required for cell surface expression of the selection marker. More detailed information regarding the “STASH select” system, including suitable selection markers and ER retention tags can be found in PCT Publication Nos.W02021072250A1 and WO2022216866A1, both of which are hereby incorporated by reference in their entirety. In some embodiments of the present disclosure, the selection marker comprises or is a truncated receptor. In some embodiments, the truncated receptor is truncated epidermal growth factor receptor (EGFRt), a truncated nerve growth factor receptor (NGFRt), a truncated CD 19 (CD19t), or a truncated CD20 (CD20t). In some embodiments, the selection marker comprises or is truncated EGFR (or “EGFRt”) (adapted from Labanieh et al., 2018, Nature Biomedical Engineering 2:377-391), which is hereby incorporated by reference for all purposes.
[0069] Furthermore, in some embodiments of the present disclosure, the methods of generating recombinant cells disclosed herein do not require dedicated promoter and allow for concatenation of multiple shRNAs in a single strand, and thus lead to small footprint and increased adaptability to any manufacturing pipeline.
[0070] Accordingly, the use of shRNA technology to enhance CAR-T cell function as disclosed herein is compatible with other selection platforms, due to the small footprint and adaptability to any manufacturing pipeline where DNA cargo is used and electroporation is not an option.DEFINITIONS
[0071] Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this disclosure pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.
[0072] The singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, includingAttorney Docket No.: 078430-545001 WOmixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A,” “B,” “A or B,” and “A and B.”
[0073] The terms “cell,” “cell culture,” “cell line,” refer not only to the particular subject cell, cell culture, or cell line but also to the progeny or potential progeny of such a cell, cell culture, or cell line, without regard to the number of transfers, or passages in culture. It should be understood that not all progeny are exactly identical to the parental cell. This is because certain modifications may occur in succeeding generations due to either mutation (e.g., deliberate or inadvertent mutations) or environmental influences (e.g. , methylation or other epigenetic modifications), such that progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein, so long as the progeny retain the same functionality as that of the originally cell, cell culture, or cell line.
[0074] The term “construct” refers to a recombinant molecule, e.g., recombinant nucleic acid or polypeptide, including one or more isolated nucleic acid sequences or amino acid sequences from heterologous sources. For example, polypeptide constructs can be chimeric polypeptide molecules in which two or more amino acid sequences of different origin are operably linked to one another in a single polypeptide construct. Similarly, nucleic acid constructs can be chimeric nucleic acid molecules in which two or more nucleic acid sequences of different origin are assembled into a single nucleic acid molecule. Thus, representative nucleic acid constructs include any constructs that contain (1) nucleic acid sequences, including regulatory and coding sequences that are not found adjoined to one another in nature (e.g., at least one of the nucleotide sequences is heterologous with respect to at least one of its other nucleotide sequences), or (2) sequences encoding parts of functional RNA molecules or proteins not naturally adjoined, or (3) parts of promoters that are not naturally adjoined. Representative nucleic acid constructs can include expression constructs, expression cassettes, and expression vectors and the like.Representative nucleic acid constructs can include any recombinant nucleic acid molecules, linear or circular, single-stranded or double-stranded DNA or RNA nucleic acid molecules, derived from any source, such as a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, capable of genomic integration or autonomous replication, comprising a nucleic acid molecule where one or more nucleic acid sequences have been operably linked. Nucleic acid constructs of the present disclosure can include the necessary elements to direct expression of a nucleic acid sequence of interest that is also contained in theAttorney Docket No.: 078430-545001 WOconstruct. Such elements may include control elements such as a promoter that is operably linked to (so as to direct transcription of) the nucleic acid sequence of interest, and optionally includes a polyadenylation sequence.
[0075] The term “effective amount”, “therapeutically effective amount”, or “pharmaceutically effective amount” of a subject recombinant polypeptide of the disclosure generally refers to an amount sufficient for a composition to accomplish a stated purpose relative to the absence of the composition (e.g. , achieve the effect for which it is administered, treat a disease, reduce a signaling pathway, or reduce one or more symptoms of a disease or health condition). An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). The exact amount of a composition including a “therapeutically effective amount” will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
[0076] The terms “nucleic acid” and “polynucleotide” can be used interchangeably herein, and refer to both RNA and DNA molecules, including nucleic acids comprising cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. A nucleic acid can be double-stranded or single-stranded (e.g., a sense strand or an antisense strand). A nucleic acid can contain unconventional or modified nucleotides. The terms “polynucleotide sequence” and “nucleic acid sequence” as used herein interchangeably refer to the sequence of a polynucleotide molecule. The nomenclature for nucleotide bases as set forth in 37 CFR §1.822 is used herein.
[0077] The term “operably linked”, as used herein, denotes a physical or functional linkage between two or more elements, e.g., polypeptide sequences or polynucleotide sequences, which permits them to operate in their intended fashion. For example, an operably linkage between a polynucleotide of interest and a regulatory sequence (for example, a promoter) is functional link that allows for expression of the polynucleotide of interest. In this sense, the term “operablyAttorney Docket No.: 078430-545001 WOlinked” refers to the positioning of a regulatory region and a coding sequence to be transcribed so that the regulatory region is effective for regulating transcription or translation of the coding sequence of interest. Thus, a promoter is in operable linkage with a nucleic acid sequence if it can mediate transcription of the nucleic acid sequence. It should be understood that, operably linked elements may be contiguous or non-contiguous. In the context of a polypeptide, “operably linked” refers to a physical linkage (e.g. , directly or indirectly linked) between amino acid sequences (e.g. , different segments, modules, or domains) to provide for a described activity of the polypeptide. In the present disclosure, various segments, region, or domains of the recombinant polypeptides of the disclosure may be operably linked to retain proper folding, processing, targeting, expression, binding, and other functional properties of the recombinant polypeptides in the cell. Unless stated otherwise, various modules, domains, and segments of the recombinant polypeptides of the disclosure are operably linked to each other. Operably linked modules, domains, and segments of the recombinant polypeptides of the disclosure may be contiguous or non-contiguous (e.g, linked to one another through a linker).
[0078] The term “pharmaceutically acceptable excipient” as used herein refers to any suitable substance that provides a pharmaceutically acceptable carrier, additive or diluent for administration of a compound(s) of interest to a subject. As such, “pharmaceutically acceptable excipient” can encompass substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable additives, and pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically acceptable carrier” includes, but is not limited to, saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds (e.g., antibiotics and additional therapeutic agents) can also be incorporated into the compositions.
[0079] The term “recombinant” when used with reference to a cell, a nucleic acid, a protein, or a vector, indicates that the cell, nucleic acid, protein or vector has been altered or produced through human intervention such as, for example, has been modified (e.g, engineered) by or is the result of laboratory methods. Thus, for example, recombinant proteins and nucleic acids include proteins and nucleic acids produced by laboratory methods. Recombinant proteins can include amino acid residues not found within the native (non-recombinant or wild-type) form of the protein or can be include amino acid residues that have been modified, e.g. , labeled. The termAttorney Docket No.: 078430-545001 WOcan include any modifications to the peptide, protein, or nucleic acid sequence. Such modifications may include the following: any chemical modifications of the peptide, protein or nucleic acid sequence, including of one or more amino acids, deoxyribonucleotides, or ribonucleotides; addition, deletion, and / or substitution of one or more of amino acids in the peptide or protein; creation of a fusion protein, e.g., a fusion protein comprising an antibody fragment; and addition, deletion, and / or substitution of one or more of nucleic acids in the nucleic acid sequence. The term ’’recombinant” when used in reference to a cell is not intended to include naturally-occurring cells but encompass cells that have been engineered / modified to include or express a polypeptide or nucleic acid that would not be present in the cell if it was not engineered / modified.
[0080] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0081] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. If the degree of approximation is not otherwise clear from the context, “about” means either within plus or minus 10% of the provided value, or rounded to the nearest significant figure, in all cases inclusive of the provided value. In some embodiments, the term “about” indicates the designated value ± up to 10%, up to ± 5%, or up to ± 1%.
[0082] Whenever the term “no more than,” “less than,” or “less than or equal to” precedes the first numerical value in a series of two or more numerical values, the term “no more than,” “less than,” or “less than or equal to” applies to each of the numerical values in that series ofAttorney Docket No.: 078430-545001 WOnumerical values. For example, less than or equal to 3, 2, or 1 is equivalent to less than or equal to 3, less than or equal to 2, or less than or equal to 1.
[0083] Headings, e.g., (a), (b), (i) etc., are presented merely for ease of reading the specification and claims. The use of headings in the specification or claims does not require the steps or elements be performed in alphabetical or numerical order or the order in which they are presented.
[0084] It is understood that aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments. As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by.” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of’ excludes any elements, steps, or ingredients not specified in the claimed composition or method. As used herein, “consisting essentially of’ does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation herein of the term “comprising,” particularly in a description of components of a composition or in a description of steps of a method, is understood to encompass those compositions and methods consisting essentially of and consisting of the recited components or steps.
[0085] Use of ordinal terms such as “first”, “second”, “third”, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements. Similarly, the use of these terms in the specification does not by itself connote any required priority, precedence, or order.
[0086] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of theAttorney Docket No.: 078430-545001 WOvarious embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub combination was individually and explicitly disclosed herein.METHODS OF PREPARING ENGINEERED T CELLS
[0087] As described in greater detail below, some aspects and embodiments of the present disclosure relates to the development of engineered immune cells, e.g., engineered T cells, having enhanced therapeutic properties (e.g., potency) for, e.g., cancer therapy. In some embodiments, the T cells are engineered to include one or more nucleic acid constructs expressing multiple CARs and further engineered such that expression of one or more genes encoding enhancers of T-cell function is reduced (e.g., inhibited or knockdown). In particular, the nucleic acid constructs, expression cassettes, and / or expression vectors as disclosed herein can be introduced into a host cell, such as, for example, a human T lymphocyte, to produce a recombinant cell (e.g., engineered T cell) containing the nucleic acid constructs, expression cassettes, and / or expression vectors. Introduction of the nucleic acid constructs, expression cassettes, and / or expression vectors of the disclosure into cells can be achieved by methods known to those skilled in the art.
[0088] Accordingly, in one aspect of the disclosure, provided herein are methods for generating (e.g., preparing or making) a recombinant cell, e.g., a recombinant T cell. In some embodiments, the methods include introducing into a T cell: (a) a first nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a first polypeptide of interest (POI, e.g., CAR), a selection marker, a protease cleavage site, and a first shRNA module targeting a first enhancer of T-cell function; and (b) a second nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a second POI (e.g., CAR), a protease capable of cleaving the protease cleavage site of (a) or a functional portion thereof, and a second shRNA module targeting a second enhancer of T-cell function.
[0089] In some embodiments, the methods of the disclosure include introducing into a T cell: (a) a first nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a first POI (e.g., CAR), a selection marker, a protease cleavage site; and a first shRNA module targeting an enhancer of T-cell function; (b) a second nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a second POI (e.g., CAR), a N-terminal domain of a protease capable of cleaving the protease cleavage site of (a), and a second shRNA moduleAttorney Docket No.: 078430-545001 WOtargeting an enhancer of T-cell function; and (c) a third nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a third POI (e.g., CAR), a C-terminal domain of the protease, and a third shRNA module targeting an enhancer of T-cell function, wherein the first, second, and third nucleic acid constructs are each independently optional, and wherein the first, second, and third shRNA modules are each independently optional.
[0090] As described in greater detailed below, the selection systems described in the present disclosure, e.g., “three-way” and “two-way” cell selection systems “STASH select” use a resistance gene or a cell surface antigen as a selection marker. These selection systems are referred to as “STASH select” systems by virtue of the selection marker being “stashed” intracellularly in the absence of the desired combination of nucleic acid constructs (e.g., expression constructs, expression cassettes, or expression vectors) being present in the cell. The two or more expression constructs are “separate”, meaning that none of the two or more of nucleic acid constructs (e.g, expression constructs, expression cassettes, or expression vectors) are part of the same polynucleotide molecule (e.g. , expression constructs, expression cassettes, or expression vectors). When the desired combination of nucleic acid constructs is present in the cell, thereby providing a protease capable of cleaving the protease cleavage site, the selection marker is cleaved from the ER tag and traffics to the surface of the cell, such that the cell comprising the desired multiple genetic modifications exhibits cell surface expression of the selection marker. The “STASH select” selection systems of the present disclosure are modular and include configurations such that the delivery to the cell of two or more of separate nucleic acid constructs (each of which may provide a desired genetic modification, e.g, transgene, targeted gene knockout, knockdown, and / or the like) is required to provide the protease activity necessary for cell surface expression of the selection marker. More detailed information regarding “STASH select” systems can be found in, for example, More detailed information regarding the “STASH select” systems, including suitable selection markers can be found in, for example, PCT Publication Nos. W02021072250A1 and WO2022216866A1, both of which are hereby incorporated by reference in their entirety.
[0091] Non-limiting exemplary embodiments of the disclosed methods for generating recombinant cells can include one or more of the following features. In some embodiments, the second nucleic acid construct comprises coding sequences for a full-length TEV protease. In some embodiments, the coding sequences for the N-terminal and C-terminal domains of the TEVAttorney Docket No.: 078430-545001 WOprotease are incorporated into a single nucleotide construct. In this instance, the N-terminal and C-terminal domains may be operably linked to one another directly or via a polypeptide linker. In some embodiments, the TEV protease cleavage site comprises or is ENLYFQS (SEQ ID NO: 17).
[0092] In some embodiments, the method further includes introducing into the T cell: (c ) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third POI (e.g., a CAR), a N-terminal domain of the protease (e.g., TEV protease) , and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a C-terminal domain of the protease (e.g., TEV protease). In some embodiments, the method further includes introducing into the T cell: (c ) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third POI (e.g., a CAR), a C-terminal domain of the protease (e.g., TEV protease), and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a N-terminal domain of the protease (e.g., TEV protease). In some embodiments, one or more of the first, second, and third POI is a CAR (e.g., first, second, and third CAR, respectively).
[0093] In some embodiments, the STASH select components are arranged as follows: Two-vector STASH system: (a) a first nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a first polypeptide of interest (POI; e.g., CAR), a selection marker, a protease cleavage site, and an endoplasmic reticulum (ER) localization tag (wherein the selection marker is positioned 5' of the protease cleavage site and the ER localization tag is positioned 3' of the protease cleavage site, thereby supporting ER-localized processing of an expressed product), and a first shRNA module targeting a first enhancer of T-cell function; and (b) a second nucleic acid construct comprising coding sequences for a second POI (e.g., CAR), a protease capable of cleaving the protease cleavage site (e.g., a TEV protease) or a functional portion thereof operably linked to an ER localization tag (thereby promoting ER localization of the protease), and a second shRNA module targeting a second enhancer of T-cell function. In some embodiments, three-vector STASH system is similar to the above vector STASH system, with a third nucleic acid construct as described herein in the specifications.
[0094] In some embodiments, one or more of the first, second, and third nucleic acid constructs are incorporated into one or more expression cassettes or expression vectors. In someAttorney Docket No.: 078430-545001 WOembodiments, the first, second, and third nucleic acid constructs are incorporated into separate expression cassettes or expression vectors. In some embodiments, the enhancer of T-cell function is selected from the group consisting of MED 12, FAS, PD1, TGF-BR, TET2, RASA2, PTPN2, TOX, CBLB, JUNB, ZC3H12A, DHX37, FLU, TIGIT, HAVCR2, SOCS1, CCNC, NR4A2, TNFRSF18, CDKN1B, REGNASE-1, NFAT andNR4Al. In some embodiments, the enhancer of T-cell function is selected from the group consisting of MED12, FAS, TGF-BR, TOX, NFAT and SOCS1. In some embodiments, the enhancer of T-cell function is MED12. In some embodiments, the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an endoplasmic reticulum retention tag (ER tag), e.g., an ER localization sequence. In some embodiments, the coding sequence for the ER tag is incorporated at the 3’ end of the protein coding region. In some embodiments, the coding sequence for the ER tag is incorporated between the 3 ’ end of the protein coding region and the 5 ’ end of the shRNA module. In some embodiments, the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an autoproteolytic cleavage sequence. In some embodiments, the autoproteolytic cleavage sequence is derived from porcine tescho virus- 1 2A (P2A), calciumdependent serine endoprotease (furin), foot-and-mouth disease virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), or Flacherie Virus 2A (BmIFV2A). In some embodiments, the autoproteolytic cleavage sequence is derived from P2A.
[0095] In some embodiments of the disclosure, one or more of the first, second, and third shRNA modules comprises at least one, two, or three shRNA sequences. In some embodiments, the first, second, and third shRNA modules are incorporated in the 3 ’ UTR of the first, second, and third nucleic acid constructs, respectively. In some embodiments, the first, second, and third shRNA modules target different enhancers of T-cell function. In some embodiments, the first, second, and third shRNA modules target the same enhancer of T-cell function.
[0096] In some embodiments, the enhancer of T-cell function is MED12. In some embodiments, the first, second, and third shRNA modules comprise different MED 12-targeting sequences. In some embodiments, the first, second, and third shRNA modules comprise the same MED 12-targeting sequence. In some embodiments, the MED 12-targeting sequence comprises or consists of one or more nucleic acid sequences independently selected from the group consistingAttorney Docket No.: 078430-545001 WOof SEQ ID NOS: 1-10. In some embodiments, the first, second, and third shRNA modules independently comprise or consists of the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
[0097] In some embodiments of the disclosure, one or more of the first, second, and third shRNA modules is absent. In some embodiments, one or more of the first, second, and third shRNA module is absent. In some embodiments, the first and second shRNA module are absent. In some embodiments, the second and third shRNA module are absent. In some embodiments, the first and third shRNA module are absent. In some embodiments, the first, second, and third shRNA modules are all absent. In some embodiments, the first, second, and third shRNA modules are all present. In some embodiments of the disclosure, the first, second, and third CARs each comprise: (a) an extracellular domain (ECD) comprising an antigen-binding moiety having a binding affinity for a cell surface antigen; and (b) an intracellular signaling domain (ICD). In some embodiments, the first, second, and third CARs further independently comprise one or more of the following: (i) signal peptide, (ii) a hinge domain, (iii) a transmembrane domain (TMD), (iv) one or more costimulatory domains, and (v) CD32 ICD. In some embodiments, the antigen-binding moiety of the first, second, and third CARs have binding affinity for two or more different cell surface antigens. In some embodiments, the cell surface antigen is selected from the group consisting of B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, WT1, MAGE-A4, PRAME, ROR1, ROR2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3 and ALK. In some embodiments, the cell surface antigen is B7-H3. In some embodiments, the cell surface antigen is GPC2. In some embodiments, the cell surface antigen is GD2.
[0098] In some embodiments of the disclosure, the one or more costimulatory domains is derived from a protein selected from the group consisting of 4- IBB (CD 137), CD27 (TNFRSF7), CD28, 0X40 (CD134), CD70, LFA-2 (CD2), CD5, ICAM-1 (CD54), LFA-1 (CD1 la / CD18), DAP10, DAP12, and a co-stimulatory inducible T-cell costimulatory (ICOS) protein. In some embodiments, the hinge domain is derived from a protein selected from the group consisting of LFA-1 (CD1 la / CD18), LFA-2 (CD2), CD4, CD5, CD8, CD27 (TNFRSF7), CD28, CD70, 4-1BB, 0X40 (CD134), CD152 (CTLA4), ICOS (CD278), IgGl Fc region, and IgG4 Fc region. In some embodiments, the TMD is derived from a protein selected from a T-cellAttorney Docket No.: 078430-545001 WOreceptor (TCR) alpha chain, a TCR beta chain, a TCR zeta chain, CD3 epsilon, CD4, CD5, CD8, CD9, CD16, CD22, CD27 (TNFRSF19), CD28, CD33, CD45, CD80, CD83, CD86, CD134, CD137, CD152 (CTLA4), CD154, CD279, and PD-1.
[0099] In some embodiments of the disclosure, the antigen-binding moiety of the first, second, and third CARs is independently selected from a ligand of the cell surface antigen, a full-length antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is a single-chain antibody fragment (scFv), a F(ab), a F(ab'), a Fab'-SH, a F(ab')2, a single domain antibody (sdAb), or a Fv fragment. In some embodiments, the sdAB comprises a VH domain only. In some embodiments, the sdAB comprises a VL domain only.
[0100] In some embodiments, the first CAR comprises: (a) an anti-GPC2 scFv; (b) a CD28 hinge domain; (c) a CD28 TMD; (d) a CD28 costimulatory domain; and (e) a CD3^. In some embodiments, the second CAR comprises: (a) an anti-B7-H3 scFv; (b) a CD8 hinge domain; (c) a CD8 TMD; (d) a 4-1BB costimulatory domain; and (e) a CD3^. In some embodiments, the third CAR comprises: (a) an anti-GD2 scFv; (b) a CD8 hinge domain; (c) a CD8 TMD; (d) a 4-1BB costimulatory domain; and (e) a CD3 In some embodiments, the first, second, and third nucleic acid constructs comprise the sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, respectively.
[0101] In some embodiments of the disclosure, one or more of the first, second, and third nucleic acid constructs is operably and / or independently linked to a promoter sequence. In some embodiments, the promoter is a constitutive promoter or an inducible promoter. In some embodiments, the promoter is a CD4 cell-specific promoter or a CD8 cell-specific promoter.
[0102] A variety of suitable approaches and conditions for the delivery of nucleic acid constructs to T cells are known. According to some embodiments, the two or more separate nucleic acid constructs are delivered to cells of the population of cells by transduction, microinjection, transfection, lipofection, heat-shock, electroporation, gene gun, DEAE-dextran-mediated transfer, and / or the like. In come embodiments, the two or more separate expression constructs are introduced into cells of the population of cells by AAV transduction. The AAV vector may comprise ITRs from AAV2, and a serotype from any one of AAV 1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV 10. In some embodiments, the AAV vector comprises ITRs from AAV2 and a serotype from AAV6. In some embodiments, the nucleic acid constructs (e.g., expression constructs, expression cassettes, or expression vectors)Attorney Docket No.: 078430-545001 WOencoding the CARs are introduced into the cell (e.g., a T cell) by lentiviral or retroviral transduction. The lentiviral vector backbone may be derived from HIV-1 , HIV-2, visna- maedi virus (VMV) virus, caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), or simian immunodeficiency virus (SIV). The lentiviral vector may be integration competent or an integrase deficient lentiviral vector (TDLV). In one embodiment, IDLV vectors including an HIV-based vector backbone (e.g., HIV cis-acting sequence elements) are employed.
[0103] In some embodiments, upon delivery of the two or more separate nucleic acid constructs (e.g. , expression constructs, expression cassettes, or expression vectors) to cells of the population of cells, one or more of the nucleic acid constructs are episomal (e.g., extra-chromosomal), where by “episome” or “episomal” is meant a polynucleotide that replicates independently of the cell’s chromosomal DNA. A non-limiting example of an episome that may be employed in the present methods is a plasmid.
[0104] In some embodiments, upon delivery of the two or more separate nucleic acid constructs to cells of the population of cells, one or more of the nucleic acid constructs integrates into the genome of the cell. In some embodiments, one or more of the nucleic acid constructs are adapted for site-specific integration into the genome. For example, a nucleic acid construct may be adapted for site-specific integration into the genome, where the site-specific integration inactivates a target gene within the genome of the cell. By way of example, the site-specific integration may knock-out the target gene by knock-in of the nucleic acid construct. Any suitable approach for site-specific gene editing and functional integration may be employed. Functional integration of a nucleic acid construct may be achieved through various means, including through the use of integrating vectors, including viral and non-viral vectors. In some instances, a retroviral vector, e.g., a lentiviral vector, may be employed. In some embodiments, a non-retroviral integrating vector may be employed. An integrating vector may be contacted with the cells in a suitable transduction medium, at a suitable concentration (or multiplicity of infection), and for a suitable time for the vector to infect the target cells, facilitating functional integration of the nucleic acid construct. Non-limiting examples of useful viral vectors include retroviral vectors, lentiviral vectors, adenoviral (Ad) vectors, adeno-associated virus (AAV) vectors, hybrid Ad- AAV vector systems, and the like.Attorney Docket No.: 078430-545001 WO
[0105] Strategies for site-specific integration that find use in the methods of the present disclosure include those that employ homologous recombination, nonhomologous end-joining (NHEJ), and / or the like. Such strategies may employ a non-naturally occurring or engineered nuclease, including, but not limited to, zinc-ringer nucleases (ZNFs), meganucleases, transcription activator-like effector nucleases (TALENs)), or a CRISPR-Cas system. Eukaryotic cells utilize two distinct DNA repair mechanisms in response to DNA double strand breaks (DSBs): Homologous recombination (HR) and nonhomologous end-joining (NHEJ).Mechanistically, HR is an error-free DNA repair mechanism because it requires a homologous template to repair the damaged DNA strand. Because of its homology-based mechanism, HR has been used as a tool to site-specifically engineer the genome. Gene targeting by HR requires the use of two homology arms that flank the transgene / target site of interest. HR efficiency can be increased by the introduction of DSBs at the target site using specific rare-cutting endonucleases. The discovery of this phenomenon prompted the development of methods to create site-specific DSBs in the genome of different species. Various chimeric enzymes have been designed for this purpose over the last decade, namely ZFNs, meganucleases, and TALENs. ZFNs are modular chimeric proteins that contain a ZF-based DNA binding domain (DBD) and a Fokl nuclease domain. DBD is usually composed of three ZF domains, each with 3- base pair specificity; the Fokl nuclease domain provides a DNA nicking activity, which is targeted by two flanking ZFNs. Owing to the modular nature of the DBD, any site in a genome could be targeted. TALENs are similar to ZFNs except that the DBD is derived from transcription activator like effectors (TALEs). The TALE DBD is modular, and it is composed of 34- residue repeats, and its DNA specificity is determined by the number and order of repeats. Each repeat binds a single nucleotide in the target sequence through only two residues.
[0106] The methods of the present disclosure may be performed on any T cell or population of T cells of interest. For examples, the T cell populations may include one or any combination of naive T cells (TN), cytotoxic T cells (TCTL), memory T cells (TMEM), T memory stem cells (TSCM), central memory T cells (TCM), effector memory T cells (TEM), tissue resident memory T cells (TRM), effector T cells (TEFF), regulatory T cells (TREG), helper T cells, CD4+ T cells, CD8+ T cells, virus-specific T cells, alpha beta T cells (Tap), gamma delta T cells (Tys). In some embodiments, the T cell is a CD8+ T cytotoxic lymphocyte cell or a CD4+ T helper lymphocyte cell. In some embodiments, the CD8+ T cytotoxic lymphocyte cell is selected from the groupAttorney Docket No.: 078430-545001 WOconsisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, bulk CD8+ T cells. In some embodiments, the CD4+ T helper lymphocyte cell is selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells. In some embodiments, the T cell is an exhausted T cell or a non-exhausted T cell. In some embodiments, the T cell is obtained leukapheresis of a sample obtained from a subject. In some embodiments, the T cell is obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs).
[0107] Accordingly, in a related aspect, recombinant cells (e.g., engineered T cells) produced by a method disclosed herein are also encompassed within the present disclosure. In some embodiments, a cell culture of the disclosure includes at least one recombinant cell as disclosed herein, and a culture medium. Generally, the culture medium can be any one of suitable culture media for the cell cultures described herein. In some embodiments, the recombinant cell is engineered to expresses multiple CARs as described herein, and further engineered such that expression of one or more genes encoding enhancers of T-cell function is reduced. Methods and systems suitable for generating and maintaining cell cultures are known in the art.COMPOSITIONS OF THE DISCLOSURE
[0108] As described in greater detail below, one aspect of the present disclosure relates to the development of engineered immune cells, e.g., engineered T cells, having enhanced therapeutic properties (e.g., potency) for, e.g., cancer therapy. In some embodiments, the T cells are engineered to include one or more nucleic acid constructs expressing multiple CARs and further engineered such that expression of one or more genes encoding enhancers of T-cell function is reduced (e.g., inhibited or knockdown). In a related aspect, some embodiments of the disclosure relate to a cell culture including at least one recombinant cell as disclosed herein, and a culture medium. Some other embodiments of the disclosure relate to pharmaceutical compositions including one or more of the engineered T cells and / or cell cultures as described herein.Engineered T cells
[0109] In one aspect, some embodiments of the disclosure provide engineered immune cells, e.g. , engineered T cells that have been engineered for enhancement of therapeutic properties (e.g. , potency). In some embodiments of the disclosure, the recombinant cells include: (a) a firstAttorney Docket No.: 078430-545001 WOnucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a first polypeptide of interest (POI, e.g., CAR), a selection marker, a protease cleavage site, and a first shRNA module targeting a first enhancer of T-cell function; and (b) a second nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a second POI (e.g., CAR), a protease capable of cleaving the protease cleavage site (e.g., a TEV protease) or a functional portion thereof, and a second shRNA module targeting a second enhancer of T-cell function.
[0110] Non-limiting exemplary embodiments of the disclosed recombinant cells can include one or more of the following features. In some embodiments, the second nucleic acid construct comprises coding sequences for a full-length protease (e.g., TEV protease). In some embodiments, the recombinant cells further include: (c ) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third POI (e.g., CAR), a N-terminal domain of the protease (e.g., TEV protease), and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a C-terminal domain of the protease (e.g., TEV protease). In some embodiments, the recombinant cells further include: (c ) a third nucleic acid construct comprising, in the 5' to 3' direction, coding sequences for a third POI (e.g., CAR), a C-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; and wherein the second nucleic acid construct comprises coding sequences for a N-terminal domain of the protease.[OHl] In some embodiments, the recombinant cells of the disclosure include: (a) a first nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a first POI (e.g., CAR), a N-terminal domain of a protease (e.g., TEV protease), and a first shRNA module targeting an enhancer of T-cell function (e.g., a gene whose reduced / decreased expression in T cells results in an enhanced T-cell function); (b) a second nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a second POI (e.g., CAR), a C-terminal domain of the protease (e.g., TEV protease), and a second shRNA module targeting an enhancer of T-cell function; and (c) a third nucleic acid construct comprising, in the 5’ to 3’ direction, coding sequences for a third POI (e.g., CAR), a selection marker, a protease cleavage site (e.g., TEV protease cleavage site), and; and a third shRNA module targeting an enhancer of T-cell function, wherein the first, second, and third shRNA modules are each independently optional.
[0112] In some embodiments, one or more of the first, second, and third nucleic acid constructs are incorporated into one or more expression cassettes or expression vectors. In someAttorney Docket No.: 078430-545001 WOembodiments, the first, second, and third nucleic acid constructs are incorporated into separate expression constructs, expression cassettes, or expression vectors. Accordingly, some embodiments of the disclosure relate to expression cassettes and expression vectors including one or more nucleic acid constructs as disclosed herein. It will be understood that an expression cassette generally includes a construct of genetic material that contains coding sequences and enough regulatory information to direct proper transcription and / or translation of the coding sequences in a recipient cell, in vivo and / or ex vivo. Generally, the expression cassette can be inserted into a vector for targeting to a desired host cell and / or into a subject. As such, in some embodiments, an expression cassette of the disclosure include coding sequence(s) for one or more nucleic acid constructs as disclosed herein, which is operably linked to expression control elements, such as a promoter, and optionally, any or a combination of other nucleic acid sequences that affect the transcription or translation of the coding sequence(s).
[0113] In some embodiments, nucleic acid constructs are incorporated into “expression constructs” which can be circular or linear polynucleotides (a polymer composed of naturally-occurring and / or non-naturally-occurring nucleotides) comprising a region that encodes a component of the cell selection system (e.g, a fusion protein comprising a selection marker, a protein localization tag, and a protease cleavage site; and / or a protein required for cell surface expression of the selection marker) operably linked to a suitable promoter, e.g., a constitutive or inducible promoter. In some embodiments, expression of the cell selection system component is under the control of one or more exogenous (including heterologous) regulatory elements, e.g., promoter, enhancer, etc., present in the expression construct, and operably linked to the region encoding the cell selection system component, prior to contacting with the population of cells. In some embodiments, expression of the cell selection system component may be controlled by one or more endogenous regulatory elements, e.g., promoter, enhancer, etc., at or near a genomic locus into which the expression construct is inserted.
[0114] In some embodiments, the recombinant nucleic acids of the disclosure can be incorporated into an expression vector. It will be understood by one skilled in the art that the term “vector” generally refers to a recombinant polynucleotide construct designed for transfer between host cells, and that can be used for the purpose of transformation, e.g., the introduction of heterologous nucleic acids into a host cell. As such, in some embodiments, the vector can be a plasmid, phage, DNA vector, RNA vector, or cosmid, into which another nucleic acid segmentAttorney Docket No.: 078430-545001 WOcan be inserted so as to bring about the replication of the inserted segment. In some embodiments, the expression vector can be an integrating vector. Accordingly, also provided herein are vectors, plasmids or viruses containing one or more of the nucleic acid constructs disclosed herein. The nucleic acid constructs described herein can be contained within a vector that is capable of directing their expression in, for example, a cell that has been transduced with the vector. Suitable vectors for use in eukaryotic and prokaryotic cells are known in the art and are commercially available or readily prepared by a skilled artisan. Additional vectors can also be found, for example, in Ausubel, F. M., et al. , Current Protocols in Molecular Biology, (Current Protocol, 1994) and Sambrook et al., "Molecular Cloning: A Laboratory Manual '' 2nd ED. (1989).
[0115] It should be understood that not all vectors and expression control sequences will function equally well to express the nucleic acid sequences described herein. Neither will all hosts function equally well with the same expression system. However, one of skill in the art can make a selection among these vectors, expression control sequences and hosts without undue experimentation. For example, in selecting a vector, the host must be considered because the vector must replicate in it. The vector’s copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. For example, vectors that can be used include those that allow the DNA encoding the multivalent polypeptides and multivalent antibodies of the present disclosure to be amplified in copy number. Such amplifiable vectors are known in the art.
[0116] In some embodiments, the vectors of the disclosure are useful for autonomous replication in a host cell or can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome (e.g., non-episomal mammalian vectors). Expression vectors are capable of directing the expression of coding sequences to which they are operably linked. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids or RNA vectors (e.g., selfreplicating RNA vectors). However, other forms of expression vectors, such as viral vectors (e.g. , replication defective retroviruses, adenoviruses, and adeno-associated viruses) are also included. For example, viral vectors that can be used in the disclosure include, for example, retroviral, adenoviral, lentiviral, and adeno-associated vectors, herpes virus, simian virus 40Attorney Docket No.: 078430-545001 WO(SV40), and bovine papilloma vims vectors (see, for example, Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, N.Y.).
[0117] Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) and other standard molecular biology laboratory manuals.
[0118] The nucleic acid sequences encoding the CARs of the present disclosure can be optimized for expression in the host cell of interest. For example, the G-C content of the sequence can be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Methods for codon optimization are known in the art. Codon usages within the coding sequence of the polypeptide constructs disclosed herein (e.g. , CAR constructs) can be optimized to enhance expression in the host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons within the coding sequence have been optimized for expression in a host cell.
[0119] In selecting an expression control sequence, a variety of factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the actual DNA sequence encoding the subject CARs, particularly as regards potential secondary structures. Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the DNA sequences of this disclosure, their secretion characteristics, their ability to fold the polypeptides correctly, their fermentation or culture requirements, and the ease of purification of the products coded for by the DNA sequences.
[0120] In some embodiments of the disclosure, the nucleic acid constructs, expression cassettes, and / or expression vectors as disclosed herein can be introduced into a host cell, such as, for example, a human T lymphocyte, to produce a recombinant cell (e.g. , engineered T cell) containing the nucleic acid constructs, expression cassettes, and / or expression vectors.Introduction of the nucleic acid constructs, expression cassettes, and / or expression vectors of the disclosure into cells can be achieved by methods known to those skilled in the art such as, for example, viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology,Attorney Docket No.: 078430-545001 WOcalcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.
[0121] In some embodiments, the first, second, and third shRNA modules target one or more enhancers of T-cell function. Non-limiting examples of enhancers of T-cell function include MED12, FAS, PD1, TGF-BR, TET2, RASA2, PTPN2, TOX, CBLB, JUNB, ZC3H12A, DHX37, FLU, TIGIT, HAVCR2, SOCS1, CCNC,NR4A2, TNFRSF18, CDKN1B, REGNASE-1, NFAT and NR4A1. In some embodiments, the enhancer of T-cell function is selected from the group consisting of MED12, FAS, TGF-BR, TOX, NFAT and SOCS1. In some embodiments, the enhancer of T-cell function is MED 12. In some embodiments, the first, second, and third nucleic acid constructs each further comprise a coding sequence for an endoplasmic reticulum retention tag (ER tag) e.g., an ER localization sequence. In some embodiments, the coding sequence for the ER tag is incorporated at the 3 ’ end of the protein coding region. In some embodiments, the ER tag is incorporated between the 3 ’ end of the protein coding region and the 5’ end of the shRNA module. In some embodiments, the selection marker and the protease are expressed and co-localized to the ER. The protease then cuts the cleavage site (which is incorporated between the selection marker and the ER tag), freeing the selection marker from the ER tag so that it can migrate to the surface and be used to select the cells expressing the selection marker and the protease.
[0122] In some embodiments, such an ER retention tag comprises or is the Tm domain, the ICD, or both, or a variant Tm and / or ICD thereof which retains the ability to localize a CAR to the ER. In some embodiments, the human ER-retention tag is derived from UDP glucuronosyltransferase family 2 member B 17 (UGT2B17). In some embodiments, such an ER retention tag comprises or is the Tm domain, the ICD, or both, or a variant Tm and / or ICD thereof which retains the ability to localize a polypeptide to the ER. In some embodiments, such an ER comprises or is the amino acid sequence CFRKLAKTGKKKKRD (SEQ ID NO: 21) or LYKYKSRRSFIDEKKMP (SEQ ID NO: 22). Additional ER tags suitable for the compositions and methods of the disclosure can be found in, for example, PCT Publication Nos.W02021072250A1 and WO2022216866A1, both of which are hereby incorporated by reference. In some embodiments, the CAR may be fused directly to the ER retention tag, or indirectly via one or more domains, e.g., other protein- encoding domain(s), linker(s), and / or the like.Attorney Docket No.: 078430-545001 WO
[0123] In some embodiments, the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an autoproteolytic cleavage sequence. In some embodiments, the autoproteolytic cleavage sequence is derived from porcine teschovirus-1 2A (P2A), calcium-dependent serine endoprotease (furin), foot-and-mouth disease virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), or Flacherie Virus 2A (BmIFV2A). In some embodiments, the autoproteolytic cleavage sequence is derived from P2A.
[0124] In some embodiments, one or more of the first, second, and third shRNA modules comprises at least one, two, or three shRNA sequences. In some embodiments, the first, second, and third shRNA modules are incorporated in the 3 ’ UTR of the first, second, and third nucleic acid constructs, respectively. In some embodiments, the first, second, and third shRNA modules target different enhancers of T-cell function. In some embodiments, the first, second, and third shRNA modules target the same enhancer of T-cell function. In some embodiments, the enhancer of T-cell function is MED12. In some embodiments, the first, second, and third shRNA modules comprise different MED 12-targ eting sequences. In some embodiments, the first, second, and third shRNA modules comprise the same MED 12-targ eting sequence. In some embodiments, the MED12-targeting sequence comprises or consists of one or more nucleic acid sequences independently selected from the group consisting of SEQ ID NOS: 1-10. In some embodiments, the first, second, and third shRNA modules independently comprise or consists of the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
[0125] In some embodiments of the disclosure, the first, second, and third CARs each comprise: (a) an extracellular domain (ECD) comprising an antigen-binding moiety having a binding affinity for a cell surface antigen; and (b) an intracellular signaling domain (ICD). In some embodiments, the first, second, and third CARs further independently comprise one or more of the following: (i) signal peptide, (ii) a hinge domain, (iii) a transmembrane domain (TMD), (iv) one or more costimulatory domains, and (v) CD32 ICD.
[0126] In some embodiments, the antigen-binding moiety of the first, second, and third CARs have binding affinity for two or more different cell surface antigens. Non-limiting examples of cell surface antigens suitable for the compositions and methods of the disclosure include B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands,Attorney Docket No.: 078430-545001 WONY-ESO-1, and WT1. Additional cell surface antigens suitable for the compositions and methods of the disclosure include, but are not limited to, MAGE-A4, PRAME, R0R1, R0R2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3 and ALK.
[0127] In some embodiments of the disclosure, the first, second, and third CARs further independently comprise one or more costimulatory domains. Non-limiting examples of costimulatory domains suitable for the compositions and methods of the disclosure include those derived from 4- IBB (CD 137), CD27 (TNFRSF7), CD28, 0X40 (CD 134), CD70, LFA-2 (CD2), CD5, ICAM-1 (CD54), LFA-1 (CD1 la / CD18), DAP10, DAP12, and co-stimulatory inducible T-cell costimulatory (ICOS) protein.
[0128] In some embodiments of the disclosure, the first, second, and third CARs further independently comprise a hinge domain. Hinge domains suitable for the compositions and methods of the disclosure include, but are not limited to, those derived from LFA-1(CD1 la / CD18), LFA-2 (CD2), CD4, CD5, CD8, CD27 (TNFRSF7), CD28, CD70, 4-1BB, 0X40 (CD134), CD152 (CTLA4), ICOS (CD278), IgGl Fc region, and IgG4 Fc region.
[0129] In some embodiments of the disclosure, the first, second, and third CARs further independently comprise a transmembrane domain (TMD). Non-limiting examples of TMDs suitable for the compositions and methods of the disclosure include those derived from T-cell receptor (TCR) alpha chain, TCR beta chain, a TCR zeta chain, CD3 epsilon, CD4, CD5, CD8, CD9, CD16, CD22, CD27 (TNFRSF19), CD28, CD33, CD45, CD80, CD83, CD86, CD134, CD137, CD152 (CTLA4), CD154, CD279, and PD-1.
[0130] In some embodiments, the antigen-binding moiety of the first, second, and third CARs is independently selected from a full-length antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is a single-chain antibody fragment (scFv), a F(ab), a F(ab'), a Fab'-SH, a F(ab')2, a single domain antibody (sdAb), or a Fv fragment. In some embodiments, the sdAB comprises a VH domain only. In some embodiments, the sdAB comprises a VL domain only.
[0131] In some embodiments, the first CAR of the recombinant T cell disclosed herein comprises: (a) an anti-GPC2 scFv; (b) a CD28 hinge domain; (c) a CD28 TMD; (d) a CD28 costimulatory domain; and (e) a CD3L In some embodiments, the second CAR of the recombinant T cell disclosed herein comprises: (a) an anti-B7-H3 scFv; (b) a CD8 hinge domain;Attorney Docket No.: 078430-545001 WO(c) a CD8 TMD; (d) a 4- IBB costimulatory domain; and (e) a CD3^ chain. In some embodiments, the third CAR of the recombinant T cell disclosed herein comprises: (a) an anti-GD2 scFv; (b) a CD8 hinge domain; (c) a CD8 TMD; (d) a 4- IBB costimulatory domain; and (e) a CD32 chain. In some embodiments, the first, second, and third nucleic acid constructs comprise the sequences of SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, respectively.
[0132] In some embodiments of the disclosure, one or more of the first, second, and third nucleic acid constructs is operably linked to a promoter sequence. In some embodiments of the disclosure, one or more of the first, second, and third nucleic acid constructs is independently linked to a promoter sequence. In some embodiments of the disclosure, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a CD4 cell-specific promoter. In some embodiments, the promoter is a CD8 cell-specific promoter.
[0133] In some embodiments of the disclosure, the T cell is a CD8+ T cytotoxic lymphocyte cell or a CD4+ T helper lymphocyte cell. In some embodiments, the CD8+ T cytotoxic lymphocyte cell is selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, bulk CD8+ T cells. In some embodiments, the CD4+ T helper lymphocyte cell is selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells.
[0134] In some embodiments of the disclosure, the T cell is an exhausted T cell. In some embodiments, the T cell is a non-exhausted T cell. In some embodiments, the T cell is obtained leukapheresis of a sample obtained from a subject. In some embodiments, the T cell is obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs).Pharmaceutical compositions
[0135] The engineered T cells and cell cultures of the disclosure can be incorporated into compositions, including pharmaceutical compositions. Such compositions generally can include one or more engineered T cells and / or cell cultures of the disclosure and a pharmaceutically acceptable excipient, e.g. , a carrier. Accordingly, in one aspect, some embodiments of the disclosure relate to pharmaceutical compositions including a pharmaceutically acceptable excipient and (a) engineered T cells of the disclosure and / or (b) a cell culture of the disclosure.Attorney Docket No.: 078430-545001 WO
[0136] In some embodiments, the pharmaceutical compositions of the disclosure are formulated for the treating, ameliorating a health condition, e.g. , a proliferative disease such as cancer, or for reducing and / or delaying the onset of the health condition (e.g., disease).
[0137] Non-limiting exemplary embodiments of the pharmaceutical compositions described herein can include one or more of the following features. In some embodiments, the composition includes at least one engineered T cell of the disclosure, and a pharmaceutically acceptable excipient. In some embodiments, the at least one engineered T cell exhibits an enhanced effector function when introduced into a subject, as compared to the effector function of control T cells under similar conditions, e.g. , T cells that have not been engineered. Examples of effector functions that are enhanced in the engineered T cells include, but are not limited to growth rate (proliferation), cytokine production, target cell inhibition (e.g., anti-cancer cytotoxicity), macrophage activation, maintenance of enhanced effector cell function, NK cell activation, exhaustion resistance, and in vivo persistence (e.g. , survival). In some embodiments, the enhanced effector function includes increased production of interferon gamma (INFy), interleukin-2 (IL-2), and / or tumor-necrosis factor a (TNFa). In some embodiments, the enhanced effector function includes increased effector memory T cell phenotype.
[0138] In certain embodiments, the pharmaceutical compositions in accordance with some embodiments disclosed herein include cultures of engineered T cells that can be washed, treated, combined, supplemented, or otherwise altered prior to administration to an individual in need thereof. Furthermore, administration can be at varied doses, time intervals or in multiple administrations.
[0139] In certain embodiments, the pharmaceutical compositions in accordance with some embodiments disclosed herein include engineered T cells comprising one, two, three, or more of the nucleic acid constructs of the disclosure.
[0140] The pharmaceutical compositions provided herein can be in any form that allows for the composition to be administered to a subject. In some specific embodiments, the pharmaceutical compositions are suitable for human administration. As used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The carrier can be a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. SalineAttorney Docket No.: 078430-545001 WOsolutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, including injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin. In some embodiments, the pharmaceutical composition is sterilely formulated for administration into an individual. In some embodiments, the individual is a human. One of ordinary skilled in the art will appreciate that the formulation should suit the mode of administration.
[0141] In some embodiments, the pharmaceutical compositions of the present disclosure are formulated to be suitable for the intended route of administration to an individual. For example, the pharmaceutical composition can be formulated to be suitable for parenteral, intraperitoneal, colorectal, intraperitoneal, and intratumoral administration. In some embodiments, the pharmaceutical composition can be formulated for intravenous, oral, intraperitoneal, intratracheal, subcutaneous, intramuscular, topical, or intratumoral administration.
[0142] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™. (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS). In all cases, the composition should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants, e.g., sodium dodecyl sulfate. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be generally to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and / or sodium chloride in the composition. ProlongedAttorney Docket No.: 078430-545001 WOabsorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0143] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
[0144] In some embodiments, the recombinant cells, e.g., engineered T cells, of the disclosure can be formulated for administration to a subject using techniques known to the skilled artisan. For example, formulations comprising populations of engineered T cells can include pharmaceutically acceptable excipient(s). Excipients included in the formulations will have different purposes depending, for example, on the engineered T cells used and the mode of administration. Examples of generally used excipients included, without limitation: saline, buffered saline, dextrose, water- for-inj ection, glycerol, ethanol, and combinations thereof, stabilizing agents, solubilizing agents and surfactants, buffers and preservatives, tonicity agents, bulking agents, and lubricating agents. The formulations comprising engineered T cells can have been prepared and cultured in the absence of non-human components, e.g., in the absence of animal serum. A formulation can include one population of engineered T cells, or more than one, such as two, three, four, five, six or more populations of engineered T cells.
[0145] Formulations comprising population(s) of engineered T cells can be administered to a subject using modes and techniques known to the skilled artisan. Exemplary modes include, but are not limited to, intravenous injection. Other modes include, without limitation, intratumoral, intradermal, subcutaneous (S.C., s.q., sub-Q, Hypo), intramuscular (i.m.), intraperitoneal (i.p.), intra-arterial, intramedullary, intracardiac, intra-articular (joint), intrasynovial (joint fluid area), intracranial, intraspinal, and intrathecal (spinal fluids). Devices useful for parenteral injection of infusion of the formulations can be used to effect such administration.METHODS OF TREATMENT
[0146] Administration of any one of the therapeutic compositions described herein, e.g., recombinant cells (e.g., modified or engineered T cells) and / or pharmaceutical compositions, can be used in the treatment of relevant conditions, such as health disorders and proliferative diseases (e.g., cancer). In some embodiments, the recombinant cells (e.g., modified or engineered T cells)Attorney Docket No.: 078430-545001 WOand / or pharmaceutical compositions as described herein can be incorporated into therapeutic agents for use in methods of treating an individual who has, who is suspected of having, or who may be at high risk for developing one or more relevant health conditions, such as health disorders and proliferative diseases. In some embodiments, the health disorder or proliferative disease is a cancer. In some embodiments, the subject is a mammalian subject. In some embodiments, the individual is a patient under the care of a physician.
[0147] Accordingly, in yet another aspect of the disclosure, provided herein are methods for preventing, and / or treating a health condition in a subject in need thereof, comprising administering to the subject a composition comprising one or more of the following: (a) a recombinant T cell as disclosed herein; and (b) a pharmaceutical composition as disclosed herein.
[0148] Non-limiting exemplary embodiments of the methods of the disclosure can include one or more of the following features. In some embodiments, the recombinant T cell is allogeneic relative to the subject. In some embodiments, the recombinant T cell is autologous relative to the subject. In some embodiments, the health condition is a proliferative disorder. In some embodiments, the proliferative disorder is a cancer. In some embodiments, the cancer expresses or overexpresses a cell surface antigen. In some embodiments, the cell surface antigen is selected from the group consisting of B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, WT1, MAGE-A4, PRAME, ROR1, ROR2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3 and ALK. In some embodiments, the cell surface antigen is B7-H3. In some embodiments, the cell surface antigen is GPC2. In some embodiments, the cell surface antigen is B7-H3. In some embodiments, the cell surface antigen is GD2.
[0149] In some embodiments, the cancer expresses or overexpresses the GPC2 antigen (GPC2-positive cancer), GD2 (GD2-positive cancer), and / or the B7-H3 antigen (B7-H3 -positive cancer). In some embodiments, the B7-H3-positive cancer is selected from the group consisting of nervous system cancer, cervical cancer, sarcoma, neuroblastoma, melanoma, lung cancer, head and neck cancer, colorectal cancer, pancreatic cancer, gastric cancer, kidney cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, and hepatocellular carcinoma. In someAttorney Docket No.: 078430-545001 WOembodiments, the GPC2 -positive cancer is selected from the group consisting of uterine carcinosarcoma (UCS), brain lower grade glioma (LGG), thymoma (THYM), testicular germ cell tumors (TGCT), glioblastoma multiforme (GBM) and skin cutaneous melanoma (SKCM), liver hepatocellular carcinoma (LIHC), uveal melanoma (UVM), kidney chromophobe (KICH), thyroid cancer (THCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), stomach adenocarcinoma (STAD), cholangiocarcinoma (CHOL), adenoid cystic carcinoma (ACC), prostate adenocarcinoma (PRAD), pheochromocytoma and paraganglioma (PCPG), DLBC, lung adenocarcinoma (LUAD), small-cell lung cancer (SCLC), head-neck squamous cell carcinoma (HNSC), pancreatic adenocarcinoma (PAAD), breast cancer (BRCA), mesothelioma (MESO), colon and rectal adenocarcinoma (COAD), rectum adenocarcinoma (READ), esophageal carcinoma (ESCA), ovarian cancer (OV), lung squamous cell carcinoma (LUSC), bladder urothelial carcinoma (BLCA), sarcoma (SARC), or uterine corpus endometrial carcinoma (UCEC). In some embodiments, the GD2-positive cancer is selected from the group consisting of osteosarcoma, liposarcoma, fibrosarcoma, malignant fibrous, histiocytoma, leimyosarcoma, spindle cell sarcoma, brain tumor, small cell lung cancer, HTLV-1 infected T cell leukemia, and retinoblastoma.
[0150] In some embodiments, the administered composition inhibits tumor growth or metastasis of the GPC2-positive cancer, GD2-positive cancer, and / or the B7-H3-positive cancer in the subject. In some embodiments, the GPC2-positive cancer, GD2-positive cancer, and / or the B7-H3 -positive cancer is an adult malignancy or a pediatric cancer. In some embodiments, the pediatric cancer is osteosarcoma, Ewing sarcoma, rhabdomyosarcoma, atypical teratoid rhabdoid tumor, medulloblastoma, or neuroblastoma. In some embodiments, the proliferative disorder is a solid tumor. In some embodiments, the tumor is a brain tumor.
[0151] In some embodiments, the administered composition confers an enhanced effector function. Non-limiting examples of effector functions include growth rate (proliferation), cytokine production, target cell inhibition (e.g., anti-cancer cytotoxicity), macrophage activation, maintenance of enhanced effector cell function, NK cell activation, exhaustion resistance, and in vivo persistence (e.g., survival). In some embodiments, the enhanced effector function includes increased production of interferon gamma (INFy), interleukin-2 (IL-2), and / or tumor-necrosis factor a (TNFa). In some embodiments, the enhanced effector function includes increased effector memory T cell phenotype. In some embodiments, the composition is administered to theAttorney Docket No.: 078430-545001 WOsubject individually or as a first therapy in combination with a second therapy. Non-limiting examples of second therapies include chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, and surgery.Administration of recombinant T cells
[0152] In some embodiments, the methods of the disclosure involve administering an effective amount or number of the recombinant cells (e.g. , modified or engineered T cells) provided herein to a subject in need thereof. This administering step can be accomplished using any method of implantation delivery in the art. For example, the recombinant cells (e.g., modified or engineered T cells) can be infused directly in the subject’s bloodstream or otherwise administered to the subject.
[0153] In some embodiments, the methods disclosed herein include administering, which term is used interchangeably with the terms “introducing,” implanting,” and “transplanting,” recombinant cells (e.g., modified or engineered T cells) into an individual, by a method or route that results in at least partial localization of the introduced cells at a desired site such that a desired effect(s) is / are produced. The recombinant cells (e.g., modified or engineered T cells), or their differentiated progeny can be administered by any appropriate route that results in delivery to a desired location in the individual where at least a portion of the administered cells or components of the cells remain viable. The period of viability of the cells after administration to a subject can be as short as a few hours, e.g., twenty- four hours, to a few days, to as long as several years, or even the lifetime of the individual, e.g., long-term engraftment.
[0154] When provided prophylactically, the recombinant cells (e.g., modified or engineered T cells), described herein can be administered to a subject in advance of any symptom of a disease or health condition to be treated. Accordingly, in some embodiments the prophylactic administration of a recombinant T cell population prevents the occurrence of symptoms of the disease or health condition.
[0155] When provided therapeutically in some embodiments, recombinant cells (e.g., modified or engineered T cells) are provided at (or after) the onset of a symptom or indication of a disease or health condition, e.g., upon the onset of disease or health condition.
[0156] For use in the various embodiments described herein, an effective amount of recombinant cells (e.g., modified or engineered T cells), as disclosed herein, can be at least 102Attorney Docket No.: 078430-545001 WOcells, at least 5x102cells, at least 103cells, at least 5x103cells, at least 104cells, at least 5x104cells, at least 105cells, at least 2 x 105cells, at least 3 x 105cells, at least 4 105cells, at least 5x105cells, at least 6x105cells, at least 7x105cells, at least 8x105cells, at least 9x105cells, at least I x IO6cells, at least 2 x 106cells, at least 3x106cells, at least 4x106cells, at least 5x106cells, at least 6x106cells, at least 7x106cells, at least 8x106cells, at least 9x106cells, or multiples thereof.
[0157] In some embodiments, the recombinant T cells, are non-autologous to the subject in need of treatment. In some embodiments, the adoptive cell therapy is an allogeneic adoptive cell therapy. For example, in some embodiments, the recombinant T cells, are allogeneic to the subject in need of treatment. In an allogeneic adoptive cell therapy, the recombinant cells, e.g., recombinant T cells, are not derived from the individual receiving the adoptive cell therapy. Allogeneic cell therapy generally refers to a therapy whereby the individual (donor) who provides the immune cells is a different individual (of the same species) than the individual receiving the cell therapy. For example, a population of engineered cells being administered to an individual is derived from one more unrelated donors, or from one or more non-identical siblings. Accordingly, the recombinant T cells can be derived from one or more donors or can be obtained from an autologous source. In some embodiments, the recombinant T cells are expanded in culture prior to administration to a subject in need thereof.
[0158] In some embodiments, the delivery of a cell composition (e.g., a composition including a plurality of recombinant T cells according to any of the cells described herein) into a subject by a method or route results in at least partial localization of the cell composition at a desired site. A composition including recombinant T cells, can be administered by any appropriate route that results in effective treatment in the subject, e.g., administration results in delivery to a desired location in the subject where at least a portion of the composition delivered, e.g., at least 1x104cells, is delivered to the desired site for a period of time. Exemplary modes of suitable administration include injection, infusion, and instillation. “Injection” includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrastemal injection and infusion. In some embodiments, the route is intravenous. For the delivery of cells, delivery by injection or infusion is often considered a standard mode of administration.Attorney Docket No.: 078430-545001 WO
[0159] In some embodiments, the recombinant T cells, are administered systemically, e.g., via infusion or injection. For example, a population of recombinant T cells as described herein are administered other than directly into a target site, tissue, or organ, such that it enters, the subject’s circulatory system and, thus, is subject to metabolism and other similar biological processes.
[0160] The efficacy of a treatment including any of the recombinant cells and compositions provided herein for the prevention or treatment of a disease or health condition can be determined by a skilled clinician. However, one skilled in the art will appreciate that a prevention or treatment is considered effective if any one or all of the signs or symptoms or markers of disease are improved or ameliorated. Efficacy can also be measured by failure of a subject to worsen as assessed by decreased hospitalization or need for medical interventions (e.g. , progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in a subject or an animal (some non-limiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.
[0161] Measurement of the degree of efficacy is based on parameters selected with regard to the disease being treated and the symptoms experienced. In general, a parameter is selected that is known or accepted as correlating with the degree or severity of the disease, such as a parameter accepted or used in the medical community. For example, in the treatment of a solid cancer, suitable parameters can include reduction in the number and / or size of metastases, number of months of progression-free survival, overall survival, stage or grade of the disease, the rate of disease progression, the reduction in diagnostic biomarkers (for example without limitation, a reduction in circulating tumor DNA or RNA, a reduction in circulating cell-free tumor DNA or RNA, and the like), and combinations thereof. It will be understood that the effective dose and the degree of efficacy will generally be determined with relation to a single subject and / or a group or population of subjects. Therapeutic methods of the disclosure reduce symptoms and / or disease severity and / or disease biomarkers by at least about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100%.Attorney Docket No.: 078430-545001 WO
[0162] As discussed above, a therapeutically effective amount of a pharmaceutical composition can be an amount of the pharmaceutical composition that is sufficient to promote a particular beneficial effect when administered to a subject, such as one who has, is suspected of having, or is at risk for a disease or health condition. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the development of a symptom of the disease or health condition, alter the course of a symptom of the disease or health condition (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease or health condition. It is understood that for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.Additional therapies
[0163] As discussed above, any one of the compositions as disclosed herein, e.g., recombinant cells (e.g., engineered T cells) and / or pharmaceutical compositions, can be administered to a subject in need thereof as a single therapy (e.g., monotherapy). In addition or alternatively, in some embodiments of the disclosure, one or more of the recombinant cells (e.g, engineered T cells), recombinant nucleic acids, and / or pharmaceutical compositions described herein can be administered to the subject in combination with one or more additional (e.g., supplementary) therapies, e.g., at least one, two, three, four, or five additional therapies.
[0164] Administration “in combination with” one or more additional therapies includes simultaneous (concurrent) and consecutive administration in any order. Suitable therapies to be administered in combination with the compositions of the disclosure include, but are not limited to chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, targeted therapy, and surgery. Other suitable therapies include therapeutic agents such as chemotherapeutics, anti-cancer agents, and anti-cancer therapies.
[0165] Accordingly, in some embodiments, a composition according to the present disclosure is administered to the subject individually as a single therapy (monotherapy) or as a first therapy in combination with at least one additional therapies (e.g. , second therapy). In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, targeted therapy, and surgery. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy or surgery. In some embodiments, the first therapy and the second therapy are administered concomitantly. InAttorney Docket No.: 078430-545001 WOsome embodiments, the first therapy is administered at the same time as the second therapy. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy is administered before and / or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in rotation. In some embodiments, the first therapy and the second therapy are administered together in a single formulation.KITS
[0166] Also provided herein are kits for the practice of a method described herein. A kit can include one or more of the recombinant cells (e.g., engineered T cells), cell cultures, and pharmaceutical compositions as provided herein. For examples, provided herein, in some embodiments, are kits that include one or more recombinant T cells of the disclosure. In some embodiments, provided herein are kits that include one or more pharmaceutical compositions of the disclosure. In some embodiments, the kits of disclosure further include written instructions for making the recombinant T cells and / or pharmaceutical compositions of the disclosure and using the same.
[0167] In some embodiments, the kits of the disclosure further include one or more means useful for the administration of any one of the provided recombinant cells (e.g. , engineered T cells), cell cultures, and pharmaceutical compositions to an individual. For example, in some embodiments, the kits of the disclosure further include one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) used to administer one any of the provided recombinant cells (e.g., engineered T cells) and pharmaceutical compositions to a subject in need thereof. In some embodiments, a kit can have one or more additional therapeutic agents that can be administered simultaneously or sequentially with the other kit components for a desired purpose, e.g., for modulating an activity of a cell, inhibiting a target cancer cell, diagnosing, preventing, or treating a health condition in a subject in need thereof.
[0168] For example, any of the above-described kits can further include one or more additional reagents, where such additional reagents can be selected from: dilution buffers; reconstitution solutions, wash buffers, control reagents, control expression vectors, negative control T-cell populations, positive control T-cell populations, reagents for ex vivo production of the T-cell populations.Attorney Docket No.: 078430-545001 WO
[0169] In some other examples, any of the above-described kits can further include one or more additional reagents, where such additional reagents can be selected from: dilution buffers; reconstitution solutions, wash buffers, control reagents, control expression vectors, negative control cells, positive control cells, reagents suitable for in vitro, ex vivo, and / or in vivo production of the recombinant cells (e.g., engineered T cells) and / or pharmaceutical compositions as disclosed herein.
[0170] In some embodiments, the components of a kit can be in separate containers. In some other embodiments, the components of a kit can be combined in a single container. For example, in some embodiments of the disclosure, the kit includes one or more of the provided recombinant cells (e.g. , engineered T cells) and pharmaceutical compositions as described herein in one container (e.g. , in a sterile glass or plastic vial) and a further therapeutic agent in another container (e.g. , in a sterile glass or plastic vial).
[0171] In some embodiments, a kit can further include instructions for using the components of the kit to practice the methods disclosed herein. For example, the kit can include a package insert including information concerning the recombinant cells, pharmaceutical compositions, and dosage forms in the kit. Generally, such information aids patients and physicians in using the enclosed pharmaceutical compositions and dosage forms effectively and safely. For example, the following information regarding a combination of the disclosure can be supplied in the insert: pharmacokinetics, pharmacodynamics, clinical studies, efficacy parameters, indications and usage, contraindications, warnings, precautions, adverse reactions, overdosage, proper dosage and administration, how supplied, proper storage conditions, references, manufacturer / distributor information and intellectual property information.
[0172] In some embodiments, a kit can include further instructions for using the components of the kit to practice the methods disclosed herein. The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate, such as paper or plastic, etc. The instructions can be present in the kit as a package insert, in the labeling of the container of the kit or components thereof (e.g., associated with the packaging or sub-packaging), etc. The instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, flash drive, etc. In some instances, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g., via the internet), can beAttorney Docket No.: 078430-545001 WOprovided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.
[0173] Each of the aspects and embodiments described herein are capable of being used together, unless excluded either explicitly or clearly from the context of the embodiment or aspect.
[0174] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0175] No admission is made that any reference cited herein constitutes prior art. The discussion of the references states what their authors assert, and the Applicant reserves the right to challenge the accuracy and pertinence of the cited documents. It will be clearly understood that, although a number of information sources, including scientific journal articles, patent documents, and textbooks, are referred to herein; this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0176] The discussion of the general compositions and methods given herein is intended for illustrative purposes only. Other alternative compositions and methods and alternatives will be apparent to those of skill in the art upon review of this disclosure, and are to be included within the spirit and purview of this application.EXAMPLES
[0177] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those skilled in the art. Such techniques are explained fully in the literature, such as Sambrook, J., & Russell, D. W. (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY : Cold Spring Harbor Laboratory and Sambrook, J., & Russel, D. W. (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as “Sambrook”); Ausubel, F. M. (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (including supplements through 2014); Bollag, D. M. et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for GeneAttorney Docket No.: 078430-545001 WOTherapy. San Diego: Academic Press; Kaplitt, M. G. et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, K. B., Ferre, F. & Gibbs, R. (1994). PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, E. A. (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY : Cold Spring Harbor Laboratory Press;Beaucage, S. L. et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY : Wiley, (including supplements through 2014); and Makrides, S. C. (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences B.V., the disclosures of which are incorporated herein by reference.
[0178] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not in any way intended to limit the scope of this disclosure or the claims.EXAMPLE 1Design and construction of a three-way cell selection system “STASH select”
[0179] This Example describes the design and results of experiments performed to develop a “three-way” and “two-way” cell selection system “STASH select” using a cell surface antigen as a selection marker. In “three-way” cell selection system, three separate nucleic acid constructs are required for cell surface expression of the selection marker. In “two-way” cell selection system, two separate nucleic acid constructs are required for cell surface expression of the selection marker.
[0180] FIG. 2 depicts a schematic overview of the two-way STASH select (top) and the three-way STASH select (bottom) platform incorporating shRNA modules. In the two-vector design, each vector encodes a polypeptide of interest (POI) linked via a P2A element to either a STASH selection marker or the STASH protease, each with its own shRNA module. In the three-vector design, the same POI-P2A layout is used, but the protease is split across two vectors as an N-terminal and C-terminal protease fragment, each paired with its own shRNA module, while the selection marker vector carries its own shRNA module. A zoom-in shows the shRNA cassette as an -150 bp miRNA-backbone-based hairpin with 573' miRNA backbone and stem regionsAttorney Docket No.: 078430-545001 WOflanking the shRNA, loop, and guide / passenger sequences, with example targets such as MED 12, FAS, TOX, TGF-BR, and SOCS1.
[0181] The results of experiments performed to screen the shRNA sequences described in the presented disclosure are presented in FIGS.3A-3C. Experimental design: in these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI- 1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Cells were stained and protein surface expression was assessed by flow cytometry on day 10 and day 14. For quantification of killing, 50,000 GFP-positive tumor cells were co-cultured with 25,000 CAR T cells in 200pL RPMI per well without Interleukin-2 in Nunc Edge 96-well plates. The cells were placed in an incubator at 37°C and 5% CO2 and imaged every 4 hours using the IncuCyte Zoom Live-Cell analysis system (Essen BioScience). Total integrated GFP intensity per well was quantified using the built-in software (Essen Bioscience). Values were normalized based on the initial measurement and plotted over time. After 48 - 96 hours CAR T cells were re-challenged with 50,000 GFP-positive tumor cells.
[0182] Presented in FIG. 3A are flow cytometry plots showing CAR expression of vectors incorporating a GD2-CAR and different shRNAs targeting MED 12 compared to Mock and GD2-CAR vector without shRNA in two donors on Day 10 and Day 14. FIG. 3B are plots showing MFI of CAR, CD25 and CD39 expression of vectors incorporating a GD2-CAR and different shRNAs targeting MED 12 compared to Mock and GD2-CAR vector without shRNA in two donors on Day 14. FIG. 3C depicts co-cultures of Nalm6-GD2 including tumor re-challenges with CAR T cells incorporating a GD2-CAR and different shRNAs targeting MED 12 compared to Mock and GD2-CAR T cell without shRNA in two donors.
[0183] These results identify shRNA sequences that can be incorporated into CAR vectors without abrogating CAR expression and that result in measurable phenotypic and functional improvements, supporting their selection for subsequent implementation into the STASH-select platform to engineer enhanced multi-functional T cells.
[0184] FIG. 4A schematically illustrates GPC2-CAR, B7H3-CAR and GD2-CAR vectors carrying the selection marker EGFRt suitable for column-based selection, the N-fragment of theAttorney Docket No.: 078430-545001 WOTEV protease, and C-fragment of TEV protease, respectively. FIG. 4B schematically illustrates an exemplary shRNA cassette added to a B7H3-CAR and GD2-CAR vector carrying the STASH components. In these experiments, the shRNA cassette contained a sequence designed to target exon 8 of MED12 (shRNA#4; SEQ ID NO: 1) or exon 5 of MED12 (shRNA#5; SEQ ID NO: 2). The full-length sequence of the shRNA cassettes are also provided in the Sequence Listing (SEQ ID NO: 11 and SEQ ID NO: 12, respectively). Additional sequences targeting MED 12 are provided in the Sequence Listing (SEQ ID NOs: 3-10).
[0185] After cleavage, the selection marker was activated (EGFRt by migrating to the cell surface to be used as a cell surface selection marker or the resistance gene by ceasing its degradation). The TEV protease was split into N- and C-terminal fragments, allowing a three-vector AND gate with each vector carrying one of the components (selection marker, N-fragment of TEV protease, and C-fragment of the TEV protease, respectively).
[0186] Subsequently, flow cytometry experiments were carried out to assess the expression of the surface marker based on the vectors present in the cell. FIG. 5 depicts flow cytometry plots of CAR expression of different combinations of shRNAs across the different STASH vectors in triple-CAR positive T cells. In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1:1. T cells were cultured in RPML1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per ml. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were stained and assessed by flow cytometry on day 10.
[0187] The experimental results presented herein illustrate that addition of shRNA in one or two of the STASH backbone vectors, in the context of trispecific CAR-T cells, does not notably alter the level of CAR expression or transduction.EXAMPLE 2In vitro evaluation of triple-CAR positive T cells expressing different combinations of shRNAsAttorney Docket No.: 078430-545001 WO
[0188] This Example describes the design and results of experiments performed to evaluate triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0189] In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI-1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were stained for CD39 and CD25 and assessed by flow cytometry. CD25 is used as read-out of activation and efficient silencing of MED 12, and CD39 as a read-out for CAR-T cell activation / exhaustion. As shown in FIG. 6, silencing of MED 12 with shRNA incorporated in the vector expressing B7H3 CAR, or GD2 or both, results in increased percent of CD25 positive cells, and lower levels of CD39.
[0190] The experimental results presented herein indicates that MED 12 is being effectively silenced and ameliorates CAR-T cell exhaustion. It also indicates that using two shRNAs targeting MED12, one in each vector, is more efficient than just one.EXAMPLE 3Assessment of triple-CAR positive T cells’ potency in ex vivo co-culture assays
[0191] This Example describes results of experiments performed to assess the potency of triple-CAR positive T cells expressing different combinations of shRNAs in ex vivo co-culture assays.
[0192] As illustrated in FIG. 7 are co-cultures of a mixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively) including a tumor re-challenge in the indicated effector / target ratios with Mock T cells and selected triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors. In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI- 1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days toAttorney Docket No.: 078430-545001 WOmaintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were stained and assessed by flow cytometry on day 10. For quantification of killing, 50,000 GFP-positive tumor cells were co-cultured with CAR T cells in different effector / target ratios as indicated in 200 pL RPMI per well without Interleukin-2 (as described above) in Nunc Edge 96-well plates. The cells were placed in an incubator at 37°C and 5% CO2 and imaged every 3 hours using the IncuCyte Zoom Live-Cell analysis system (Essen BioScience). Total integrated GFP intensity per well was quantified using the built-in software (Essen Bioscience). Values were normalized based on the initial measurement and plotted over time. For tumor re-challenge experiments, cells were counted after clearing the tumor and again co-cultured with 50,000 GFP-positive tumor cells in fresh media in the indicated E / T ratios.
[0193] The experimental results presented herein illustrate that MED 12 knockdown (KD) T cells show more effective control of tumor cells especially in the context of tumor rechallenges, indicating exhaustion resistance.EXAMPLE 4Evaluation of MED 12 expression in T cells expressing STASH vectors
[0194] This Example describes results of experiments performed to evaluate MED 12 expression as assessed by qPCR of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0195] In these experiments, RNA was extracted using the RNeasy Plus Kits (Qiagen) according to manufacturers’ instructions. Complementary DNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific). Quantitative PCR was performed using PowerUp™ SYBR® Green Master Mix (ThermoFisher Scientific) on a BioRad CFX thermocycler using CFX Manager software. Target gene expression was analyzed using primer sets specific for MED 12 and 18S rRNA as a reference controlusing the following primer sets (5’ to 3’): 18S-F GCAGAATCCACGCCAGTACAAG (SEQ ID NO: 13), 18S-R GCTTGTTGTCCAGACCATTGG (SEQ ID NO: 14), MED12-F GCTGCTCCTCTAACAATGGCAC (SEQ ID NO: 15), MED12-R TCTTCCAGGAGCAAACACTG (SEQ ID NO: 16). Gene expression was normalized to the mean of non-shRNA control using the 2AACt method.Attorney Docket No.: 078430-545001 WO
[0196] Depicted in FIG. 8 is the normalized gene expression of MED 12 as assessed by qPCR of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors
[0197] The experimental results presented herein illustrate that MED 12 KD CAR T cells exhibit decreased MED 12 gene expression indicating an effective knockdown of the gene.EXAMPLE 5Cell proliferation of T cells expressing STASH vectors
[0198] This Example describes results of experiments performed to assess the proliferation of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0199] In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI-1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6, and cells were grown until day 11 with assessments of cell counts on the indicated time points. Depicted in FIG.9 are a schematic illustration of the used CAR vectors and the assessment of cell counts of triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors.
[0200] The experimental results presented herein illustrate that MED 12 KD CAR T cells show increased proliferative capacity compared to non-MED 12 KD T cells indicating a more favorable cell state associated with enhanced expansion and potentially improved therapeutic function of KD cells.EXAMPLE 6Further assessment of triple-CAR positive T cells’ potency in ex vivo co-culture assays
[0201] This Example describes results of experiments performed to further assess the potency of triple-CAR positive T cells expressing different combinations of shRNAs in ex vivo co-culture assays.Attorney Docket No.: 078430-545001 WO
[0202] In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI-1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were stained and assessed by flow cytometry on day 10. For quantification of killing, 50,000 GFP -positive tumor cells were co-cultured with CAR T cells in different effector / target ratios as indicated in 200 pL RPMI per well without Interleukin-2 (as described above) in Nunc Edge 96-well plates. The cells were placed in an incubator at 37°C and 5% CO2 and imaged every 4 hours using the IncuCyte Zoom Live-Cell analysis system (Essen BioScience). Total integrated GFP intensity per well was quantified using the built-in software (Essen Bioscience). Values were normalized based on the initial measurement and plotted over time. For tumor re-challenge experiments, cells were counted after clearing the tumor and again co-cultured with 50,000 GFP -positive tumor cells in fresh media in the indicated E / T ratios.
[0203] As shown in FIG. 10 are co-cultures of a mixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively) including tumor re-challenges with Mock T cells, non-shRNA triple-CAR positive T cells, a mixed population (1 : 1 : 1) of single CAR-positive T cells, co-transduced CAR T cells without selection, and selected triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors of a first donor.
[0204] The experimental results presented herein illustrate that MED 12 KD T cells show enhanced control of tumor cells especially in the context of multiple tumor rechallenges compared to relevant controls, indicating increased exhaustion resistance and therapeutic function.
[0205] As shown in FIG. 11 are co-cultures of a mixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively) including tumor re-challenges with Mock T cells, non-shRNA triple-CAR positive T cells, a mixed population (1 : 1 : 1) of single CAR-positive T cells, co-transduced CAR T cells without selection, and selected triple-CAR positive T cells expressing different combinations of shRNAs across the different STASH vectors of a second donor.Attorney Docket No.: 078430-545001 WO
[0206] The experimental results presented herein illustrate that MED 12 KD CAR T cells show enhanced control of tumor cells especially in the context of multiple tumor rechallenges compared to relevant controls in a second donor, indicating a donor-independent effect.EXAMPLE 7Expression of triple-CAR positive T cells after re-challenges
[0207] This Example describes results of experiments performed to evaluate CAR expression of different combinations of shRNAs across the different STASH vectors in triple-CAR positive T cells vs controls after the re-challenges described in FIG. 10 and FIG. 11 described in Example 6 above.
[0208] In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI-1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were stained and assessed by flow cytometry after the rechallenges. As shown in FIG. 12 are Flow cytometry plots of CAR expression of different combinations of shRNAs across the different STASH vectors in triple-CAR positive T cells vs controls after the re-challenges described in FIG. 10 and FIG. 11.
[0209] The experimental results presented herein illustrate that MED 12 KD CAR T cells show high expression of both GD2 and the B7H3 CARs indicating a survival advantage of cells expressing high levels of MED 12 shRNA modules despite the typically deleterious effects of these two CARs on T cells. In contrast, the control conditions show reduced expression of GD2 and B7H3 CARs, likely due to exhaustion-driven limitations on expansion and other associated negative effects.EXAMPLE 8Phenotype and cell proliferation of T cells expressing STASH vectors
[0210] This Example describes results of experiments performed to assess the phenotype and proliferation of triple-CAR positive T cells expressing different combinations of shRNAs acrossAttorney Docket No.: 078430-545001 WOthe different STASH vectors after the re-challenges described in FIG. 10 and FIG. 11 described in Example 6 above.
[0211] In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI-1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were counted and stained for CD39 and CD25 and assessed by flow cytometry after the re-challenges described in FIG. 10 and FIG. 11 described in Example 6 above. CD25 is used as read-out of activation and efficient silencing of MED 12, and CD39 as a read-out for CAR-T cells exhaustion. As shown in FIG. 13, silencing of MED 12 with shRNA incorporated in the vector expressing B7H3 CAR, or GD2 or both, results in increased percent of CD25 positive cells, and lower levels of CD39 with greater expansion of MED 12 KD CAR T cells.EXAMPLE 9In vivo efficacy of T cells expressing STASH vectors
[0212] This Example describes the results of experiments performed to assess in vivo efficacy of different doses of MED 12 knockdown triple-CAR positive T cells.
[0213] In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI-1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were stained and assessed by flow cytometry on day 10 before injection.
[0214] As shown in FIG. 14 is the experimental design of the in vivo experiment shown in FIG. 15 comparing the in vivo efficacy of different doses of MED 12 knockdown triple-CAR positive T cells against GPC2, GD2 and B7H3 co-expressing Nalm6 and a re-challenge with aAttorney Docket No.: 078430-545001 WOmixed (1:1:1) Nalm6 population (expressing GPC2, GD2, or B7-H3, respectively). As shown in FIG. 15 is the in vivo quantification of the luminescence signal of tumor cells (firefly luciferase) across the different doses described in FIG. 14.
[0215] As shown in FIG. 16 is the in vivo quantification of the luminescence signal of single mice's tumor cells (firefly luciferase) of dose level 1 described in FIG. 14 and FIG. 15.
[0216] The experimental results described herein illustrate that MED 12 KD CAR T cells show dose-dependent tumor control in a challenging xenograft model, notably even the lowest dose of 1 Mio CAR T cells achieved tumor control indicating high potency of MED 12 KD CAR T cells. Re-challenge with a mixed population of Nalm6 expressing GPC2, GD2, or B7H3 resulted in tumor control in at least one of the mice, indicating increased resistance to exhaustion of the engineered CAR T cells.
[0217] Subsequently, additional experiments were performed to compare the in vivo efficacy of Mock T cells, unselected and selected triple-CAR T cells as well as MED 12 knockdown selected triple-CAR T cells against GPC2, GD2 and B7H3 co-expressing Nalm6.
[0218] In these experiments, T cells were rapidly thawed in a water bath (day 0), counted, and activated using CD3 / CD28 beads at a beads / T cell ratio of 1 : 1. T cells were cultured in RPMI-1640 medium (supplemented with 10% FCS, 10 mmol / L HEPES, 2 mmol / L L-glutamine, 100 U / mL penicillin, and 100 pg / mL streptomycin). The cells were transduced on day 2 or 3 and were passaged every 2 to 3 days to maintain a density between 0.3 and 2 million cells per mL. Beads were removed on day 4 or 5. Column-based selection of EGFRt positive T cells was conducted on day 5 or day 6. Cells were stained and assessed by flow cytometry on day 10 before injection. FIG. 17A depicts (upper panel) the experimental design of these in vivo experiment. Blood was drawn on Day 12 and analyzed for CD45-positive cells by flow cytometry (lower left panel). The Kaplan-Meier survival plot is depicted in the lower right panel.FIG. 17B depicts the in vivo quantification of the luminescence signal of tumor cells (firefly luciferase) across the different groups.
[0219] As shown in FIG. 17A, blood collected on day 12 and analyzed by flow cytometry for CD45-positive cells (lower left panel) demonstrates greater in vivo expansion of the MED 12 knockdown selected triple-CAR T cells relative to the control groups. Consistent with this enhanced expansion, the Kaplan-Meier survival analysis (lower right panel) shows significantly prolonged survival in mice treated with MED 12 knockdown selected triple-CAR T cells versusAttorney Docket No.: 078430-545001 WOcontrols, indicating improved persistence and therapeutic potency. In addition, FIG. 17B shows longitudinal total Nalm6 firefly luciferase signal, with the MED 12 knockdown selected tripleCAR T cells providing improved tumor control throughout the experiment compared to the other treatment groups.
[0220] While particular alternatives of the present disclosure have been disclosed, it is to be understood that various modifications and combinations are possible and are contemplated within the true spirit and scope of the appended claims. There is no intention, therefore, of limitations to the exact abstract and disclosure herein presented.
Claims
Attorney Docket No.: 078430-545001 WOCLAIMS WHAT IS CLAIMED IS:
1. A method for generating an engineered T cell with enhanced effector function, the method comprising introducing into a T cell:(a) a first nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a first polypeptide of interest (POI), a selection marker, a protease cleavage site, and a first shRNA module targeting a first enhancer of T-cell function;(b) a second nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a second POI, a protease capable of cleaving the cleavage site in (a) or a functional portion thereof, and a second shRNA module targeting a second enhancer of T-cell function.
2. The method of claim 1, wherein the second nucleic acid construct comprises coding sequences for a full-length protease.
3. The method of claim 1, wherein the method further comprises introducing into the T cell:(c ) a third nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a third POI, a N-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; andfurther wherein the second nucleic acid construct comprises coding sequences for a C- terminal domain of the protease.
4. The method of claim 1, further comprising introducing into the T cell:(c ) a third nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a third POI, a C-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; andfurther wherein the second nucleic acid construct comprises coding sequences for a N- terminal domain of the protease5. The method of claim of any one of claims 1^4, wherein the protease cleavage site is a viral protease cleavage site.Attorney Docket No.: 078430-545001 WO6. The method of claim 5, wherein the viral protease cleavage site is a cleavage site for a potyviral family protease.
7. The method of claim 6, wherein the potyviral family protease is Tobacco Etch Virus (TEV) protease, plum pox virus protease (PPVp), soybean mosaic virus protease (SbMVp), sunflower mild mosaic virus protease (SuMMVp), tobacco vein mottling virus protease (TVMVp), or West Nile virus protease (WNVp).
8. The method of claim 7, wherein the viral protease cleavage site is a TEV protease cleavage site.
9. The method of claim of any one of claims 1-8, wherein one or more of the first, second, and third POI is a chimeric antigen receptor (CAR).
10. The method of any one of claims 1-9, further comprising analyzing cell surface expression of the selection marker in the engineered T cell.
11. The method of any one of claims 1-10, wherein one or more of the first, second, and third nucleic acid constructs are incorporated into one or more expression cassettes or expression vectors.
12. The method of any one of claims 1-11, wherein the enhancer of T-cell function is selected from the group consisting of MED12, FAS, PD1, TGF-BR, TET2, RASA2, PTPN2, TOX, CBLB, JUNB, ZC3H12A, DHX37, FLU, TIGIT, HAVCR2, SOCS1, CCNC,NR4A2, TNFRSF18, CDKN1B, REGNASE-1, NFAT andNR4Al.
13. The method of any one of claims 1-12, wherein the enhancer of T-cell function is selected from the group consisting of MED 12, FAS, TGF-BR, TOX, NFAT and SOCS1.
14. The method of any one of claims 1-13, wherein the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an endoplasmic reticulum retention tag (ER tag).
15. The method of claim 14, wherein the coding sequence for the ER tag is incorporated at the 3’ end of the protein coding region..Attorney Docket No.: 078430-545001 WO16. The method of any one of claims 14-15, wherein the ER tag is incorporated between the 3 ’ end of the protein coding region and the 5’ end of the shRNA module.
17. The method of any one of claims 1-15, wherein the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an autoproteolytic cleavage sequence.
18. The method of claim 17, wherein the autoproteolytic cleavage sequence is derived from porcine teschovirus-1 2A (P2A), calcium-dependent serine endoprotease (furin), foot-and-mouth disease virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), or Flacherie Virus 2A (BmIFV2A).
19. The method of any one of claims 1-18, wherein one or more of the first, second, and third shRNA modules comprises at least one, two, or three shRNA sequences.
20. The method of any one of claims 1-19, wherein the first, second, and third shRNA modules are incorporated in the 3 ’ UTR of the first, second, and third nucleic acid constructs, respectively.
21. The method of any one of claims 1-20, wherein the first, second, and third shRNA modules target different enhancers of T-cell function.
22. The method of any one of claims 1-21, wherein the first, second, and third shRNA modules target the same enhancer of T-cell function.
23. The method of any one of claims 1-22, wherein the enhancer of T-cell function is MED12.
24. The method of claim 23 , wherein the first, second, and third shRNA modules comprise different MED 12 -targeting sequences.
25. The method of claim 24, wherein the first, second, and third shRNA modules comprise the same MED 12-targeting sequence.Attorney Docket No.: 078430-545001 WO26. The method of any one of 23-25, wherein the MED12-targeting sequence comprises or consists of one or more nucleic acid sequences independently selected from the group consisting ofSEQ ID NOS: 1-10.
27. The method of any one of 23-26, wherein the first, second, and third shRNA modules independently comprise or consists of the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
28. The method of any one of 1-28, wherein the first, second, and third CARs each comprise:(a) an extracellular domain (ECD) comprising an antigen-binding moiety having a binding affinity for a cell surface antigen; and(b) an intracellular signaling domain (ICD).
29. The method of claim 28, wherein the first, second, and third CARs further independently comprise one or more of the following: (i) signal peptide, (ii) a hinge domain, (iii) a transmembrane domain (TMD), (iv) one or more costimulatory domains, and (v) CD32 ICD.
30. The method of any one of claims 28-29, wherein the antigen-binding moiety of the first, second, and third CARs have binding affinity for two or more different cell surface antigens.
31. The method of any one of claims 28-30, wherein the cell surface antigen is selected from the group consisting of B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, WT1, MAGE-A4, PRAME, ROR1, ROR2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3 and ALK.
32. The method of claims 29-31 , wherein the one or more costimulatory domains is derived from a protein selected from the group consisting of 4-1BB (CD137), CD27 (TNFRSF7), CD28, 0X40 (CD 134), CD70, LFA-2 (CD2), CD5, ICAM-1 (CD54), LFA-1 (CDlla / CD18), DAP 10, DAP 12, and a co-stimulatory inducible T-cell costimulatory (ICOS) protein.
33. The method of any one of claims 29-32, wherein the hinge domain is derived from a protein selected from the group consisting of LFA-1 (CD1 la / CD18), LFA-2 (CD2), CD4, CD5,Attorney Docket No.: 078430-545001 WOCD8, CD27 (TNFRSF7), CD28, CD70, 4-1BB, 0X40 (CD134), CD152 (CTLA4), ICOS (CD278), IgGl Fc region, and IgG4 Fc region.
34. The method of any one of claims 29-33, wherein the TMD is derived from a protein selected from a T-cell receptor (TCR) alpha chain, a TCR beta chain, a TCR zeta chain, CD3 epsilon, CD4, CD5, CD8, CD9, CD16, CD22, CD27 (TNFRSF19), CD28, CD33, CD45, CD80, CD83, CD86, CD134, CD137, CD152 (CTLA4), CD154, CD279, and PD-1.
35. The method of any one of claims 29-34, wherein the antigen-binding moiety of the first, second, and third CARs is independently selected from a ligand of the cell surface antigen, a full-length antibody or an antigen-binding fragment thereof.
36. The method of claim 35, wherein the antigen-binding fragment is a single-chain antibody fragment (scFv), a F(ab), a F(ab'), a Fab'-SH, a F(ab')2, a single domain antibody (sdAb), or a Fv fragment.
37. The method of any one of claims 5-36, wherein the first CAR comprises:(a) an anti-GPC2 scFv;(b) a CD28 hinge domain;(c) a CD28 TMD;(d) a CD28 costimulatory domain; and(e) a CD338. The method of any one of claims 5-37, wherein the second CAR comprises:(a) an anti-B7-H3 scFv;(b) a CD8 hinge domain;(c) a CD8 TMD;(d) a 4- IBB costimulatory domain; and(e) a CD339. The method of any one of claims 5-38, wherein the third CAR comprises:(a) an anti-GD2 scFv;(b) a CD8 hinge domain;(c) a CD8 TMD;Attorney Docket No.: 078430-545001 WO(d) a 4- IBB costimulatory domain; and(e) a CD340. The method of any one of claims 1-39, wherein one or more of the first, second, and third nucleic acid constructs is operably and / or independently linked to a promoter sequence.
41. The method of claim 40, wherein the promoter is a constitutive promoter or an inducible promoter.
42. The method of any one of claims 40 41 , wherein the promoter is a CD4 cell-specific promoter or a CD8 cell-specific promoter.
43. The method of any one of claims 1-42, wherein the T cell is a CD8+ T cytotoxic lymphocyte cell or a CD4+ T helper lymphocyte cell.
44. The method of claim 43, wherein the CD8+ T cytotoxic lymphocyte cell is selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, bulk CD8+ T cells.
45. The method of claim 43, wherein the CD4+ T helper lymphocyte cell is selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells.
46. The method of any one of claims 1-45, wherein the T cell is an exhausted T cell or a nonexhausted T cell.
47. The method of any one of claims 1-46, wherein the T cell is obtained leukapheresis of a sample obtained from a subject.
48. The method of claims 1-47, wherein the T cell is obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs).
49. An engineered T cell produced by a method according to any one of claims 1-48.
50. An engineered T cell comprising:Attorney Docket No.: 078430-545001 WO(a) a first nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a first polypeptide of interest (POI), a selection marker, a protease cleavage site, and a first shRNA module targeting a first enhancer of T-cell function;(b) a second nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a second POI, a protease capable of cleaving the cleavage site in (a) or a functional portion thereof, and a second shRNA module targeting a second enhancer of T-cell function.
51. The engineered T cell of claim 50, wherein the engineered T cell further comprises:(c ) a third nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a third POI, a N-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; andFurther wherein the second nucleic acid construct comprises coding sequences for a C- terminal domain of the protease.
52. The engineered T cell of claim 50, wherein the engineered T cell further comprises:(c ) a third nucleic acid construct comprising, in the 5 ’ to 3 ’ direction, coding sequences for a third POI, a C-terminal domain of the protease, and a third shRNA module targeting a third enhancer of T-cell function; andfurther wherein the second nucleic acid construct comprises coding sequences for a N- terminal domain of the protease.
53. The engineered T cell of any one of claims 50-52, the protease cleavage site is a viral protease cleavage site.
54. The engineered T cell of claim 53, wherein the viral protease cleavage site is a cleavage site for a potyviral family protease.
55. The engineered T cell of claim 54, wherein the potyviral family protease is Tobacco Etch Virus (TEV) protease, plum pox virus protease (PPVp), soybean mosaic virus protease (SbMVp), sunflower mild mosaic virus protease (SuMMVp), tobacco vein mottling virus protease (TVMVp), or West Nile virus protease (WNVp).Attorney Docket No.: 078430-545001 WO56. The engineered T cell of claim 55, wherein the viral protease cleavage site is a TEV protease cleavage site.
57. The engineered T cell of claim of any one of claims 50-56, wherein one or more of the first, second, and third POI is a chimeric antigen receptor (CAR).
58. The engineered T cell of any one of claims 50-52, wherein one or more of the first, second, and third nucleic acid constructs are incorporated into one or more expression cassettes or expression vectors.
59. The engineered T cell of any one of claims 50-51, wherein the enhancer of T-cell function is selected from the group consisting of MED 12, FAS, PD1, TGF-BR, TET2, RASA2, PTPN2, TOX, CBLB, JUNB, ZC3H12A, DHX37, FLU, TIGIT, HAVCR2, SOCS1, CCNC, NR4A2, TNFRSF18, CDKN1B, REGNASE-1, NFAT andNR4Al.
60. The engineered T cell of any one of claims 50-59, wherein the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an endoplasmic reticulum retention tag (ER tag).
61. The engineered T cell any one of 50-60, wherein the first, second, and / or third nucleic acid constructs each further comprise a coding sequence for an autoproteolytic cleavage sequence.
62. The engineered T cell of claim 61, wherein the autoproteolytic cleavage sequence is derived from porcine teschovirus- 1 2A (P2A), calcium-dependent serine endoprotease (furin), foot-and-mouth disease virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), or Flacherie Virus 2A (BmfFV2A).
63. The engineered T cell of any one of claims 50-62, wherein one or more of the first, second, and third shRNA modules comprises at least one, two, or three shRNA sequences.
64. The engineered T cell of any one of claims 50-63, wherein the first, second, and third shRNA modules are incorporated in the 3 ’ UTR of the first, second, and third nucleic acid constructs, respectively.Attorney Docket No.: 078430-545001 WO65. The engineered T cell of any one of claims 50-63, wherein the first, second, and third shRNA modules target different enhancers of T-cell function.
66. The engineered T cell of any one of claims 50-65, wherein the first, second, and third shRNA modules target the same enhancer of T-cell function.
67. The engineered T cell of claim 66, wherein the enhancer of T-cell function is MED12.
68. The engineered T cell of claim 67, wherein the first, second, and third shRNA modules comprise different MED 12-targ eting sequences.
69. The engineered T cell of claim 67, wherein the first, second, and third shRNA modules comprise the same MED 12-targ eting sequence.
70. The engineered T cell of any one of 67-69, wherein the MED12-targeting sequence comprises or consists of one or more nucleic acid sequences independently selected from the group consisting of SEQ ID NOS: 1-10.
71. The engineered T cell of any one of 67-69, wherein the first, second, and third shRNA modules independently comprise or consists of the sequence of SEQ ID NO: 11 or SEQ ID NO: 12.
72. The engineered T cell of any one of claims 50-71, wherein the first, second, and third CARs each comprise:(c) an extracellular domain (ECD) comprising an antigen-binding moiety having a binding affinity for a cell surface antigen; and(d) an intracellular signaling domain (1CD).
73. The engineered T cell of claim 72, wherein the first, second, and third CARs further independently comprise one or more of the following: (i) signal peptide, (ii) a hinge domain, (iii) a transmembrane domain (TMD), (iv) one or more costimulatory domains, and (v) CD321CD.
74. The engineered T cell of any one of claims 72-73, wherein the antigen-binding moiety of the first, second, and third CARs have binding affinity for two or more different cell surface antigens.Attorney Docket No.: 078430-545001 WO75. The engineered T cell of any one of claims 72-74, wherein the cell surface antigen is selected from the group consisting of B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, WT1, MAGE-A4, PRAME, R0R1, R0R2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3 and ALK.
76. The engineered T cell of any one of claims 72-75, wherein the one or more costimulatory domains is derived from a protein selected from the group consisting of 4- IBB (CD 137), CD27 (TNFRSF7), CD28, 0X40 (CD134), CD70, LFA-2 (CD2), CD5, ICAM-1 (CD54), LFA-1 (CD1 la / CD18), DAP10, DAP12, and a co-stimulatory inducible T-cell costimulatory (ICOS) protein.
77. The engineered T cell of any one of claims 72-76, wherein the hinge domain is derived from a protein selected from the group consisting of LFA-1 (CD1 la / CD18), LFA-2 (CD2), CD4, CD5, CD8, CD27 (TNFRSF7), CD28, CD70, 4-1BB, 0X40 (CD134), CD152 (CTLA4), ICOS (CD278), IgGl Fc region, and IgG4 Fc region.
78. The engineered T cell of any one of claims 72-77, wherein the TMD is derived from a protein selected from a T-cell receptor (TCR) alpha chain, a TCR beta chain, a TCR zeta chain, CD3 epsilon, CD4, CD5, CD8, CD9, CD16, CD22, CD27 (TNFRSF19), CD28, CD33, CD45, CD80, CD83, CD86, CD134, CD137, CD152 (CTLA4), CD154, CD279, and PD-1.
79. The engineered T cell of any one of claims 72-78, wherein the antigen-binding moiety of the first, second, and third CARs is independently selected from a full-length antibody or an antigen-binding fragment thereof.
80. The engineered T cell of claim 79, wherein the antigen-binding fragment is a single-chain antibody fragment (scFv), a F(ab), a F(ab'), a Fab'-SH, a F(ab')2, a single domain antibody (sdAb), or a Fv fragment.
81. The engineered T cell of any one of claims 53-80, wherein the first CAR comprises:(a) an anti-GPC2 scFv;(b) a CD28 hinge domain;Attorney Docket No.: 078430-545001 WO(c) a CD28 TMD;(d) a CD28 costimulatory domain; and(e) a CD382. The engineered T cell of any one of claims 53-81, wherein the second CAR comprises:(b) an anti-B7-H3 scFv;(b) a CD8 hinge domain;(c) a CD8 TMD;(d) a 4- IBB costimulatory domain; and(e) a CD383. The engineered T cell of any one of claims 53-82, wherein the third CAR comprises:(a) an anti-GD2 scFv;(b) a CD8 hinge domain;(c) a CD8 TMD;(d) a 4- IBB costimulatory domain; and(e) a CD384. The engineered T cell of any one of claims 53-83, wherein one or more of the first, second, and third nucleic acid constructs is operably and / or independently linked to a promoter sequence.
85. The engineered T cell of claim 84, wherein the promoter is a constitutive promoter or an inducible promoter.
86. The engineered T cell of any one of claims 84-85, wherein the promoter is a CD4 cellspecific promoter or a CD8 cell-specific promoter.
87. The engineered T cell of any one of claims 50-86, wherein the T cell is a CD8+ T cytotoxic lymphocyte cell or a CD4+ T helper lymphocyte cell.
88. The engineered T cell of claim 87, wherein the CD8+ T cytotoxic lymphocyte cell is selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, bulk CD8+ T cells.Attorney Docket No.: 078430-545001 WO89. The engineered T cell of claim 87, wherein the CD4+ T helper lymphocyte cell is selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells.
90. The engineered T cell of any one of claims 50-89, wherein the T cell is an exhausted T cell or a non-exhausted T cell.
91. The engineered T cell of any one of claims 50-90, wherein the T cell is obtained leukapheresis of a sample obtained from a subject.
92. The engineered T cell of claims 50-90, wherein the T cell is obtained from tumor infiltrating lymphocytes (TILs) or peripheral blood mononuclear cells (PBMCs).
93. A cell culture comprising at least one engineered T cell according to any one of claims 49- 92, and a culture medium.
94. A pharmaceutical composition comprising an engineered T cell according to any one claims 49-92, and a pharmaceutically acceptable carrier.
95. A method for preventing, and / or treating a health condition in a subject in need thereof, comprising administering to the subject a composition comprising one or more of the following:(a) an engineered T cell according to any one of claims 49-92; and(b) a pharmaceutical composition according to claim 94.
96. The method of claim 95, wherein the engineered T cell is allogeneic relative to the subject.
97. The method of claim 95, wherein the engineered T cell is autologous relative to the subject.
98. The method of any one of claims 95-97, wherein the health condition is a proliferative disorder.
99. The method of claim 98, wherein the proliferative disorder is a cancer.Attorney Docket No.: 078430-545001 WO100. The method of claim 99, wherein the cancer expresses or overexpresses a cell surface antigen.
101. The method of claim 100, wherein the cell surface antigen is selected from the group consisting of B7-H3, GPC2, GD2, CD19, CD20, BCMA, CD22, CD30, CD33, CD38, CD70, CD123, CD138, EGFR / EGFRvIII, HER2, Mesothelin, PSMA, MUC1 , MUC16, Claudin 18.2, GPC3, NKG2D ligands, NY-ESO-1, WT1, MAGE-A4, PRAME, ROR1, ROR2, IL13Ra2, FRa, CEA, FAP, Lewis Y, CD44v6, CD171, CD47, CD5, CD52, CDH171, CAIX, PSCA, STEAP1, NCAM1, EphA2, Claudin 3, Claudin 6, DLL3 and ALK.
102. The method of any one of claims 99-101, wherein the cancer expresses or overexpresses the GPC2 antigen (GPC2 -positive cancer), GD2 (GD2-positive cancer), and / or the B7-H3 antigen (B7-H3 -positive cancer).
103. The method of claim 102, wherein the B7-H3-positive cancer is selected from the group consisting of nervous system cancer, cervical cancer, sarcoma, neuroblastoma, melanoma, lung cancer, head and neck cancer, colorectal cancer, pancreatic cancer, gastric cancer, kidney cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, and hepatocellular carcinoma.
104. The method of claim 102, wherein the GPC2 -positive cancer is selected from the group consisting of uterine carcinosarcoma (UCS), brain lower grade glioma (LGG), thymoma (THYM), testicular germ cell tumors (TGCT), glioblastoma multiforme (GBM) and skin cutaneous melanoma (SKCM), liver hepatocellular carcinoma (LIHC), uveal melanoma (UVM), kidney chromophobe (KICH), thyroid cancer (THCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), stomach adenocarcinoma (STAD), cholangiocarcinoma (CHOL), adenoid cystic carcinoma (ACC), prostate adenocarcinoma (PRAD), pheochromocytoma and paraganglioma (PCPG), DLBC, lung adenocarcinoma (LUAD), small-cell lung cancer (SCLC), head-neck squamous cell carcinoma (HNSC), pancreatic adenocarcinoma (PAAD), breast cancer (BRCA), mesothelioma (MESO), colon and rectal adenocarcinoma (COAD), rectum adenocarcinoma (READ), esophageal carcinoma (ESCA), ovarian cancer (OV), lung squamous cell carcinoma (LUSC), bladder urothelial carcinoma (BLCA), sarcoma (SARC), or uterine corpus endometrial carcinoma (UCEC).Attorney Docket No.: 078430-545001 WO105. The method of claim 102, wherein the GD2-positive cancer is selected from the group consisting of osteosarcoma, liposarcoma, fibrosarcoma, malignant fibrous, histiocytoma, leimyosarcoma, spindle cell sarcoma, brain tumor, small cell lung cancer, HTLV-1 infected T cell leukemia, and retinoblastoma.
106. The method of any one of claims 102-105, wherein the administered composition inhibits tumor growth or metastasis of the GPC2-positive cancer, GD2-positive cancer, and / or the B7-H3-positive cancer in the subject.
107. The method of any one of claims 102-106, wherein the GPC2-positive cancer GD2-positive cancer, and / or the B7-H3 -positive cancer is an adult malignancy or a pediatric cancer.
108. The method of claim 107, wherein the pediatric cancer is osteosarcoma, Ewing sarcoma, rhabdomyosarcoma, atypical teratoid rhabdoid tumor, medulloblastoma, or neuroblastoma.
109. The method of any one of claims 98-106, wherein the proliferative disorder is a solid tumor.
110. The method of claim 109, wherein the tumor is a brain tumor.
111. The method of any one of claims 95-110, wherein the administered composition confers an enhanced effector function selected from the group consisting of growth rate (proliferation), cytokine production, target cell inhibition (e.g., anti-cancer cytotoxicity), macrophage activation, maintenance of enhanced effector cell function, NK cell activation, exhaustion resistance, and in vivo persistence (e.g., survival).
112. The method of claim 111, wherein the enhanced effector function comprises increased production of interferon gamma (INFy), interleukin-2 (IL-2), and / or tumor-necrosis factor a (TNFa).
113. The method of any one of claims 111-112, wherein the enhanced effector function comprises increased effector memory T cell phenotype.
114. The method of any one of claims 95-113, wherein the composition is administered to the subject individually or as a first therapy in combination with a second therapy, wherein theAttorney Docket No.: 078430-545001 WOsecond therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, or surgery.
115. A kit for the prevention and / or treatment of a health condition in a subject in need thereof, the kit comprising one or more of the following:(a) an engineered T cell according to any one of claims 49-92; and(b) a pharmaceutical composition according to claim 94.