Strains and methods for production of heme-containing proteins
Genetic engineering of fungal and yeast cells with ALAS protein mutations and optimized promoter systems enhances the production of heme-containing proteins and tetrapyrroles, addressing low titer limitations and achieving up to 350% yield improvements.
Patent Information
- Application Number
- AU2026205176
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2026-06-30
- Publication Date
- 2026-07-16
Smart Images

Figure 00000070_0000 
Figure 00000093_0000
Abstract
Description
140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of an ALAS protein can be increased by at least 5% (e g., at least 6%, 7%, 8%, 9%, 10%, 10 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%. 200%, 220%, 240%, 250%. or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM. In some embodiments, provided herein are methods comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a 15 mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of an ALAS protein can be increased by at least 5% (e.g.. at least 6%, 7%, 8%. 9%, 10%, 15%, 20%, 25%. 30%, 40%. 50%. 60%, 70%. 80%, 90%. 100%. 120%, 140%. 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein 20 composing a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of an ALAS protein can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%. 30%, 40%, 50%. 60%, 70%, 80%, 90%, 100%. 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not 25 comprise a mutation in a first HRM and a mutation in a second HRM. Provided herein are methods of producing a tetrapyrrole or a derivative thereof. Also provided herein are methods of producing a tetrapyrrole or a derivative thereof using any of the cells (e.g., fungal cells, such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methylotrophic yeast cells))described herein. Also provided herein are methods of producing 30 a tetrapyrrole or a derivative thereof using any of the nucleic acid constructs described herein. In some embodiments, provided herein are methods of producing a tetrapyrrole or a derivative thereof comprising expressing a first nucleic acid construct comprising a 2026205176 30 Jun 2026 nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM In some embodiments, the titer of a tetrapyrrole or a derivative thereof can be increased by at least 5% (e.g.. at least 10%, 20%. 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%. 340%, 350%, 5 or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of a tetrapyrrole or a derivative thereof can be increased by at least 5% (e.g.. at least 10%, 20%. 30%, 40%. 50%, 60%. 70%, 80%. 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, 10 or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM. In some embodiments, provided herein are methods of producing a tetrapyrrole or a derivative thereof comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein composing a mutation in a first HRM and a second mutation in a second HRM. In some 15 embodiments, the titer of a tetrapyrrole or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%. 40%, 50%. 60%, 70%. 80%, 90%, 100%. 120%, 140%, 150%, 160%. 180%, 200%, 220%, 240%. 250%. 280%. 300%, 320%, 340%. 350%. or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in 20 a second HRM. In some embodiments, the titer of a tetrapyrrole or a derivative thereof can be increased by at least 5% (e.g.. at least 10%. 20%, 30%. 40%. 50%, 60%. 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM and a mutation 25 in a second HRM. In some embodiments, a tetrapyrrole or a derivative thereof is a chlorin (e g., a chlorophyll) or a derivative thereof. In some embodiments, a tetrapyrrole or a derivative thereof is a precorrin, a co-precorrin. a comn (e.g., vitamin B12), or a derivative thereof. In some embodiments, a tetrapyrrole or a derivative thereof is a porphyrin or a derivative thereof. In some embodiments, a tetrapyrrole or a derivative thereof is a heme or a 30 derivative thereof. In some embodiments, a tetrapyrrole or a derivative thereof is heme B. In some embodiments, a tetrapyrrole or a derivative thereof is a metabolic product of heme (e.g., bilirubin or a derivative thereof)- 2026205176 30 Jun 2026 Provided herein are methods of producing an intermediate of the heme biosynthesis pathway, a heme (e.g., heme B, heme o. heme a. heme c), a corrin (e.g., Vitamin B12). a chlorophyll, or a derivative thereof. Also provided herein are methods of producing an intermediate of the heme biosy nthesis pathway, a heme, a corrin. a chlorophyll, or a 5 derivative thereof using any of the cells (e g., fungal cells, such as Aspergillus cells. Trichoderma cells, or yeast cells (e.g.. methylotrophic yeast cells))described herein. Also provided herein are methods of producing an intermediate of the heme biosynthesis pathway, a heme, a corrin. a chlorophyll, or a derivative thereof using any of the nucleic acid constructs described herein. In some embodiments, provided herein are methods of producing 10 an intermediate of the heme biosynthesis pathway, a heme, a corrin. a chlorophyll, or a derivative thereof comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of an intermediate of the heme biosynthesis pathway, a heme, a corrin. a chlorophyll, or a derivative thereof can be increased by at least 5% (e.g., at least 15 10%, 20%. 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%. 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%. 280%. 300%, 320%, 340%, 350%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of an intermediate of the heme biosynthesis pathway, a heme, a corrin, a chlorophyll, or 20 a derivative thereof can be increased by at least 5% (e.g.. at least 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%, 90%, 100%. 120%. 140%, 150%, 160%, 180%, 200%. 220%. 240%. 250%, 280%, 300%, 320%, 340%. 350%. or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM. In some embodiments, provided herein are methods of producing an intermediate of the 25 heme biosynthesis pathway, a heme, a corrin. a chlorophyll, or a derivative thereof comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein composing a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of an intermediate of the heme biosynthesis pathway, a heme, a corrin. a chlorophyll, or a derivative thereof can be increased by at least 5% (e.g., at 30 least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence 2026205176 30 Jun 2026 encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of an intermediate of the heme biosynthesis pathway, a heme, a comn, a chlorophyll, or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%. 50%, 60%, 70%. 80%, 90%. 100%. 120%, 140%, 150%, 160%, 5 180%, 200%, 220%, 240%, 250%. 280%. 300%, 320%, 340%, 350%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM and a mutation in a second HRM. In some embodiments, an intermediate of the heme biosynthesis pathway, a heme, or a derivative thereof is a heme. In some embodiments, an intermediate of the heme biosynthesis pathway, a heme, or a 10 derivative thereof is heme B. Provided herein are methods of producing a heme (e.g., heme B, heme o, heme a, heme c) or a derivative thereof. Also provided herein are methods of producing a heme or derivative thereof using any of the cells (e.g., fungal cells, such as, Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methylotrophic yeast cells)) described herein. Also 15 provided herein are methods of producing a heme or derivative thereof using any of the nucleic acid constructs described herein. In some embodiments, provided herein are methods of producing a heme or derivative thereof comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of a heme or derivative thereof can be increased by at 20 least 5% (e.g.. at least 10%, 20%, 30%, 40%, 50%, 60%. 70%, 80%, 90%, 100%, 120%, 140%. 150%, 160%, 180%, 200%. 220%. 240%. 250%, 280%, 300%. 320%. 340%, 350%. or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of a heme or derivative thereof can be increased by at least 5% 25 (e.g.. at least 10%, 20%, 30%, 40%, 50%. 60%, 70%. 80%, 90%. 100%. 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM. In some embodiments, provided herein are methods of producing a heme or derivative thereof comprising expressing a first nucleic acid 30 construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of a heme or derivative thereof can be increased by at least 5% (e.g.. at least 10%, 20%, 30%, 2026205176 30 Jun 2026 40%, 50%. 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some 5 embodiments, the titer of a heme or derivative thereof can be increased by at least 5% (e g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%. 150%, 160%, 180%, 200%, 220%, 240%, 250%. 280%. 300%, 320%, 340%, 350%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM and a mutation in a second HRM. In some embodiments, 10 a heme or a derivative thereof is heme B. Provided herein are methods of producing a heme-binding protein. Also provided herein are methods of producing a heme-binding protein using any of the cells (e.g.. fungal cells, such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methylotrophic yeast cells))described herein. Also provided herein are methods of producing a heme-binding 15 protein using any of the nucleic acid constructs described herein. In some embodiments, provided herein are methods comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, provided herein are methods comprising 20 expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, provided herein are methods comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a 25 mutation in a second HRM and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, provided herein are methods comprising expressing a first nucleic acid construct composing a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM and expressing a second nucleic acid construct comprising a 30 nucleotide sequence encoding a heme-binding protein. In some embodiments of any of the methods described herein, the methods allow for an increase in the titer of a heme-binding protein. In some embodiments, the titer of a heme-binding protein can be increased by at least 2026205176 30 Jun 2026 5% (eg., at least 6%. 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%. 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the 5 titer of a heme-binding protein can be increased by at least 5% (e g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM. In some embodiments, the titer of a heme-binding protein can be increased by at least 5% 10 (eg., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%. 45%, 50%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of a heme-binding protein can be increased by at least 15 5% (e g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%. 22%, 23%, 24%, 25%, 30%, 35%, 40%. 45%, 50%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM and a mutation in a second HRM. Provided herein are methods of producing a tetrapyrrole-binding protein. Also 20 provided herein are methods of producing a tetrapyrrole-binding protein using any of the cells (e.g.. fungal cells, such as Aspergillus cells. Trichoderma cells, or yeast cells (eg., methylotrophic yeast cells)) described herein. Also provided herein are methods of producing a tetrapyrrole-binding protein using any of the nucleic acid constructs descnbed herein. In some embodiments, provided herein are methods comprising expressing a first 25 nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and expressing a second nucleic acid construct composing a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, provided herein are methods comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a 30 mutation in a first HRM and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, provided herein are methods comprising expressing a first nucleic acid construct comprising a 2026205176 30 Jun 2026 nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, provided herein are methods comprising expressing a first nucleic acid construct comprising a 5 nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments of any of the methods described herein, the methods allow for an increase in the titer of a tetrapyrrole-binding protein. In some embodiments, the titer of a telrapyrrole-binding protein can be 10 increased by at least 5% (e.g.. at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%. 18%, 19%, 20%. 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of a tetrapyrrole-binding protein can be increased by at least 5% 15 (e g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, I 7%, 18%, 19%, 20%, 21%. 22%, 23%, 24%, 25%, 30%, 35%, 40%. 45%, 50%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM. In some embodiments, the titer of a tetrapyrrole-binding protein can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%. 12%, 13%, 20 14%, 15%. 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of a tetrapyrrole-binding protein can be increased by at least 5% (e.g.. at least 6%, 7%, 8%. 9%, 10%, 11%, 25 12%, 13%. 14%, 15%, 16%. 17%, 18%. 19%, 20%. 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%. 50%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not compose a mutation in a first HRM and a mutation in a second HRM. In some embodiments, a tetrapyrrole is a chlorin (e.g., a chlorophyll) or a derivative thereof. In some embodiments, a letrapyrrole is a precorrin. a co-precorrin. a corrin 30 (e g., vitamin B12), or a derivative thereof. In some embodiments, a tetrapyrrole is a porphyrin or a derivative thereof. In some embodiments, a tetrapyrrole is a heme or a 2026205176 30 Jun 2026 derivative thereof. In some embodiments, a tetrapyrrole is heme B. In some embodiments, a tetrapyrrole is a metabolic product of heme (e.g., bilirubin or a derivative thereof) As used herein, a "corresponding method” is a method that is essentially identical to a reference method in all ways except for the identified difference. For example, a 5 corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM and a mutation in a second HRM would be the same in all aspects (e.g.. genetic makeup of cell, temperature and time of culture, and so forth), except that the corresponding method would express a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM and a mutation in a second HRM. 10 Genetically engineering a cell (e.g., fungal cell, such as an Aspergillus cell, a Trichoderma cell, or ayeast cell (e.g.. a methylotrophic yeast cell)) typically includes introducing a recombinant nucleic acid molecule (also called a nucleic acid construct) into the cell. As described herein, a recombinant nucleic acid molecule typically includes an exogenous nucleic acid that encodes a protein (e.g., a protein involved in heme biosynthesis, 15 a heme-binding protein, or a transcription factor) operably linked to at least one promoter element (e g., an inducible or constitutive promoter element). In some embodiments, a recombinant nucleic acid molecule can include a linear sequence of two or more proteincoding sequences operably linked to the same or separate promoter elements (e g., a first promoter operably linked to a first nucleic acid encoding a first protein and a second 20 promoter operably linked to a second nucleic acid encoding a second protein, or a promoter operably linked to a first nucleic acid encoding a first protein and a second nucleic acid encoding a second protein). In some cases, a recombinant nucleic acid molecule including at least one promoter operably linked to a nucleotide sequence encoding a protein can be called a cassette. 25 A recombinant nucleic acid can include expression elements. Expression elements include nucleic acid sequences that direct and regulate expression of nucleic acid coding sequences. One example of an expression element is a promoter sequence. Expression elements also can include introns, enhancer sequences, response elements, or inducible elements that modulate expression of a nucleic acid. Expression elements can be of bacterial. 30 yeast, insect, mammalian, or viral origin, and vectors can contain a combination of elements from different origins. 2026205176 30 Jun 2026 Nucleic acids can be detected using any number of amplification techniques (see, e.g., PCR Primer: A Laboratory Manual. 1995. Dieffenbach & Dveksler. Eds.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Patent Nos. 4,683,195; 4,683.202; 4.800.159; and 4,965.188) with an appropriate pair of oligonucleotides (e.g., 5 primers). A number of modifications to the original PCR method have been developed and can be used to detect selected nucleic acids. Methanol utilization is ty pically initiated by the conversion of methanol to formaldehyde by the action of alcohol oxidase. Pichia pastoris contains two genes for alcohol oxidases, AOX1 and AOX2. Strains with reduced alcohol oxidase activity 10 ("methanol utilization slow” or MutS strains) can produce more of a recombinant protein expressed from the AOX1 promoter than strains that do not have reduced alcohol oxidase activity. Strains mutated in both AOX genes and completely lacking alcohol oxidase activity cannot metabolize methanol, but can still be induced for expression from the AOX1 promoter by methanol. These strains retain the ability to use other carbon sources for growth, but still 15 express heterologous proteins from the AOX1 promoter upon the addition of methanol. Because these strains do not metabolize methanol ("methanol utilization minus" or Mut-strains). much less methanol is required for induction of protein expression, and strains carrying these mutations avoid issues related to methanol feeding in large-scale fermentations. See, for example, Chiruvolu et al., 1997, Enzyme Microb. Technol., 21:277 20 83. Suitable transcription factors, and nucleic acids encoding transcription factors (e.g., exogenous nucleic acids encoding transcription factors), include, for example. Mxrl from a P. pastoris. A representative K. pastoris Mxrl nucleic acid sequence can be found, for example, in GenBank Accession No. DQ395124, while a representative K. pastoris Mxrl protein 25 sequence can be found, for example, in GenBank Accession No. ABD57365. In some embodiments, the transcription factor is a Mitl sequence from K phaffii (see. for example, UniParc Accession No. UPI0001A4D18B). Suitable transcription factors also can be found in Hansenulapolymorpha (e.g., the Adri sequence; see, for example, GenBank Accession No. AEOI02000005. bases 858873 to 862352. for the nucleic acid sequence and GenBank 30 Accession No. ESX01253 for the amino acid sequence) and Candida boidinii (e g., the Trm 1 sequence; see, for example, GenBank Accession No. AB365355 for the nucleic acid sequence and GenBank Accession No. BAF99700 for the amino acid sequence; and Trm2 sequence; 2026205176 30 Jun 2026 see. for example. Gen Bank Accession No. AB548760 for the nucleic acid sequence and GenBank Accession No. BAJ07608 for the amino acid sequence). Transcription factors such as Mxrl may be normally expressed at low levels. In some embodiments, it is desirable to place an exogenous nucleic acid (e.g.. a transcription factor) 5 under control of a promoter that is inducible. Methanol-regulated transcription factors in Pichia can bind to an AOX1 promoter and act cooperatively with Mxrl to activate transcription from an A0X1 promoter. In some embodiments, two methanol-regulated transcription factors (e.g., Mxrl and Mill) can be operably linked to a methanol inducible promoter element. 10 There are a number of inducible promoters that can be used when genetically engineering cells (e.g.. fungal cells such ns Aspergillus, Trichoderma cells, or yeast cells (e.g.. methylotrophic yeast cells)). Suitable methanol inducible promoters include pAOXl. (e.g., a pAOXl such as the promoter for A?, pastoris AOXl (see, for example, the promoter for GenBank Accession No. U96967.1) or a promoter described in U.S. Provisional Patent 15 Application No. 62 / 835,338, filed April 17, 2019, incorporated herein by reference in its entirety), as well as other methanol-inducible promoters, or promoter elements therefrom. These include, without limitation, a pAOX2 promoter (e.g.. from K. phaffli or K. pastoris (see, for example, GenBank Accession No. X79871.1)), an alcohol oxidase (AOD1) promoter from, e.g., Candida hoidinii (see. for example, GenBank Accession No. E06147.1), the 20 alcohol oxidase (MOX) promoter from Hansenula polymorpha (see, for example, GenBank Accession No. AJ313360.1), the MOD 1 or MOD2 promoter from Pichia methanolica (see, for example, Raymond et al., 1998, Yeast, 14:11-23; and Nakagawa et al., 1999, Yeast, 15:1223-30), the DBAS promoter from P. pastoris (see. for example, the promoter for GenBank Accession No. FJ752551) or a promoter element therefrom, the formaldehyde 25 dehydrogenase (FLD1) promoter from K. pastoris (see. for example. GenBank Accession No. KJ755994.1), or the PEX8 promoter from P pastoris (see. for example. Kranthi et al., 2010, Yeast. 27:705-11). Typically, these promoters can be induced by methanol. Suitable constitutive promoters and constitutive promoter elements include, without limitation, the P. pastoris promoter (or a portion thereof) from the transcriptional elongation factor EF-la gene 30 (TEF1), which is strongly transcribed in a constitutive manner. Other suitable constitutive promoters (or promoter elements therefrom) also can be used, including, without limitation, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter from K. pastoris (see, 2026205176 30 Jun 2026 for example, the promoter for GenBank Accession No. U62648.1). the promoter from the potential glycosyl phosphatidyl inositol (GPI)-anchored protein. GCW14p (PASchrl-4 0586) from K. phaffii (see. for example, the promoter for GenBank Accession No. XM 002490678), and the promoter from the 3-phosphoglycerate kinase gene (PGK.1) from 5 K. pastoris (see. for example. GenBank Accession No. AY288296). It will be appreciated that a choice of promoter may be influenced by the expression system. For example, for expression in K. phaffii, a K. phaffii promoter might be chosen, while for expression in C. boidinii, a C. boidinii promoter might be chosen. However, in some cases, a promoter from one organism (e.g.. K. phaffii) may be appropriate to be used in another organism (e.g., C. 10 boidinii or K. pastoris). Further, it is noted that a combination of inducible (e g., methanolinducible) and constitutive promoters (or promoter elements therefrom) can be combined to further increase the expression of any of the nucleic acids operably linked thereto. Any of the encoded proteins as described herein can be operably linked to an inducible promoter element (e.g., a methanol-inducible promoter element) or a constitutive 15 promoter element. Inducible promoters and elements therefrom are discussed above. Constitutive promoters and constitutive promoter elements are known in the art. For example, a commonly used constitutive promoter from P. pastoris is the promoter, or a portion thereof, from the transcriptional elongation factor EF-la gene (TEF1). which is strongly transcribed in a constitutive manner. Other constitutive promoters, or promoter 20 elements therefrom, however, can be used, including, without limitation, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter from AT. pastoris (see. for example, the promoter for GenBank Accession No. U62648.1). the promoter from the potential glycosyl phosphatidyl inositol (GPI)-anchored protein. GCWl4p (PASchrl-4 0586), from AL phaffii (see. for example, the promoter for GenBank Accession No. XM 002490678), or the 25 promoter from the 3-phosphoglycerate kinase gene (PGKl) from K. pastoris (see. for example, the promoter for GenBank Accession No. AY288296). In some embodiments, any of the cells (e.g.. fungal cell, such as an Aspergillus cell, a Trichoderma cell, or a yeast cell (e.g.. a methylotrophic yeast cell)) herein can further include a third nucleic acid construct comprising a nucleotide sequence encoding a third protein 30 operably linked to the first promoter element, the second promoter element, or a third promoter element. In some embodiments, any of the cells (e.g., fungal cell, such as an Aspergillus cell, a Trichoderma cell, or a yeast cell (e.g., a methylotrophic yeast cell)) herein 2026205176 30 Jun 2026 can further include a fourth nucleic acid construct comprising a nucleotide sequence encoding a fourth protein operably linked to the first promoter element, the second promoter element, the third promoter element, or a fourth promoter element. In some embodiments, the third protein can be a transcription factor. In some embodiments, the fourth protein can be a 5 transcription factor. In some embodiments, any of the promoter elements herein (e.g., a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element) can contain one or more recognition sequences for a transcription factor. Therefore, in some embodiments, a feedback loop may be constructed such that the transcription factor drives the expression of additional copies of the transcription factor, as well as the expression 10 of one or more of an ALAS and a heme-binding protein. In some embodiments, a transcription factor can be Mxrl (see. e.g.. U.S. Patent No. 9,938,327. which is incorporated by reference in its entirety). In some embodiments, a third protein can be a protein involved in heme biosynthesis. In some embodiments, a fourth protein can be a protein involved in heme biosynthesis. In some embodiments, a protein involved in heme biosynthesis can be 15 selected from the group consisting of 3-aminolevulinic acid dehydratase (ALAD). porphobilinogen deaminase (PBGD). uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D). coprotoporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX). and'or ferrochelatase (FC). In some embodiments, a protein involved in heme biosynthesis can be selected from the group 20 consisting of 6-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD). uroporphyrinogen III synthase (UPG3S). uroporphyrinogen III decarboxylase (UPG3D). coprotoporphyrinogen oxidase (COPROX). and'or protoporphyrinogen IX oxidase (PROTOX) Previous studies in Saccharomyces cerevisiae identified ALA dehydratase and 25 porphobilinogen deaminase as rate limiting enzymes in heme biosynthesis (see. for example, Hoffman et al., 2003. Biochem. Biophys. Res. Commun., 310(4): 1247-53). However, heterologous expression of individual heme enzymes in P. pastoris from the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter failed to overcome limitations associated with the expression of a recombinant protein containing a heme (see Kramer et al., 2015, Microb. 30 Cell Fact., 13; 14:4). Expression of a recombinant heme containing protein in P. pasloris can be achieved by co-expressing one or more enzymes of the heme biosynthetic pathway from methanol-inducible promoters, although it would be appreciated that one or more of the genes 2026205176 30 Jun 2026 invok ed in the heme biosynthetic pathway could be expressed from one or more constitutive promoters (see, e g., U.S. Patent No. 9,938,327, which is incorporated by reference in its entirety). In addition, it is noted that a first nucleic acid encoding a first protein (e.g.. an ALAS 5 protein) operably linked to a promoter element as described herein can be physically separate from a second nucleic acid encoding a second protein (e g., a heme-binding protein) operably linked to a promoter element (that is. the first and second nucleic acids can be completely separate molecules). Alternatively, a first nucleic acid encoding a first protein operably linked to a promoter element and a second nucleic acid encoding a second protein operably 10 linked to a promoter element can be included in the same nucleic acid construct. In some embodiments, a first nucleic acid encoding a first protein operably linked to a promoter element can be contiguous with a second nucleic acid encoding a second protein operably linked to a promoter element. It would be appreciated by a skilled artisan that, if the second nucleic acid molecule encoding a second protein is contiguous with the first nucleic acid 15 encoding a protein of interest, a single promoter, or promoter element therefrom, can be used to drive transcription of both or all of the genes (e.g., the nucleic acid encoding the first protein as well as the second protein). Methods of introducing nucleic acids into cells (e.g., fungal cells, such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methylotrophic yeast cells))are known in the art. 20 and include, w ithout limitation, transduction, electroporation, biolistic particle delivery, and chemical transformation. In addition, methods of culturing cells (e g., fungal cells, such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g.. methylotrophic yeast cells))are known in the art. See, for example. Pichia Protocols. Methods In Molecular Biology, 389, Cregg. Ed., 2007, 2nd Ed.. 25 Humana Press. Inc. Under some circumstances, it may be desirable to introduce or add methanol to the culture media, although, as demonstrated herein, methanol is not required to obtain efficient expression at high levels of one or more proteins of interest. Under some circumstances (e.g.. when one or more nucleic acids encoding enzyme(s) involved in heme biosy nthesis are expressed), it may be desirable to supplement the culture media w ith iron or 30 a pharmaceutically or metabolically acceptable (or GRAS) salt thereof. The recombinant nucleic acid molecules described herein can be stablv integrated into the genome of the cell (e.g., the fungal cell, such as Aspergillus cell, Trichoderma cell, or 2026205176 30 Jun 2026 yeast cell (e g., the melhylotrophic yeast cell)), or can be extrachromosomally expressed from a replication-competent plasmid. Methods of achieving both are known and used in the art. The methods provided herein also can include purifying the expressed protein. As used herein, an "enriched"' protein is a protein that accounts for at least 5% (e.g., at least 6%, 5 7%, 8%, 9%, 10%, 15%, 20%, 25%. 30%, 35%, 40%. 45%, 50%, 55%, 60%. or more) by dry weight, of the mass of the production cell (e g., fungal cell, such as Aspergillus cell. Trichoderma cell, or yeast cell (e.g., methylotrophic yeast cell)), or at least 10% (e.g.. at least 15%, 20%. 25%, 30%, 35%, 40%, 45%, 50%, 55%. 60%, 65%, 70%, 75%, 80%. 90%, 95%, or 99%) by dry weight, the mass of the production cell lysate (e.g., excluding cell wall or 10 membrane material). As used herein, a "purified” protein is a protein that has been separated or purified from cellular components that naturally accompany it. Typically, the protein is considered “purified” when it is at least 60% (e.g., at least 65%, 70% 75%, 80%. 85%, 90%, 95%, or 99%) by dry weight, free from the proteins and naturally occurring molecules with which it is naturally associated. 15 As used herein, nucleic acids can include DNA and RNA. and includes nucleic acids that contain one or more nucleotide analogs or backbone modifications. A nucleic acid can be single stranded or double stranded, which usually depends upon its intended use. Also provided are nucleic acids and polypeptides that differ from a given sequence. Nucleic acids and polypeptides can have at least 50% sequence identity’ (e.g., at least 55%, 60%, 65%, 70%, 20 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%, 98%, or 99% sequence identity) to a given nucleic acid or polypeptide sequence In calculating percent sequence identity, two sequences are aligned and the number of identical matches of nucleotides or amino acid residues between the two sequences is 25 determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identify value. It will be appreciated that the length of the aligned region can be a portion of one or both sequences up to the full-length size of the shortest sequence. It also will be appreciated that a single sequence can align with more than 30 one other sequence and hence, can have different percent sequence identity values over each aligned region. 2026205176 30 Jun 2026 The alignment of two or more sequences to determine percent sequence identity can be performed using the computer program ClustalW and default parameters, which allows alignments of nucleic acid or polypeptide sequences to be earned out across their entire length (global alignment). Chenna et al.. 2003. Nucleic Acids Res., 31(13):3497-500. 5 ClustalW calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities and differences can be determined. Gaps of one or more residues can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast painvise alignment of nucleic acid sequences, the default parameters can be used (i.e., word size: 2; window size: 4; scoring method: percentage; 10 number of top diagonals: 4; and gap penalty: 5); for an alignment of multiple nucleic acid sequences, the following parameters can be used: gap opening penalty: 10.0; gap extension penalty': 5.0, and weight transitions: yes. For fast painvise alignment of polypeptide sequences, the following parameters can be used: word size: 1; w indow size: 5; scoring method: percentage; number of top diagonals: 5; and gap penalty’: 3. For multiple alignment 15 of polypeptide sequences, the following parameters can be used: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: Gly, Pro. Ser. Asn. Asp, Gin. Glu. Arg. and Lys; and residue-specific gap penalties: on. ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher website or at the European Bioinformatics Institute website on the World Wide Web. 20 Changes can be introduced into a nucleic acid molecule, thereby leading to changes in the amino acid sequence of the encoded polypeptide. For example, changes can be introduced into nucleic acid coding sequences using mutagenesis (e g., site-directed mutagenesis. PCR-mediated mutagenesis, transposon mutagenesis, chemical mutagenesis. UV mutagenesis or radiation induced mutagenesis) or by chemically synthesizing a nucleic 25 acid molecule having such changes. Such nucleic acid changes can lead to conservative and / or non-conservative amino acid substitutions at one or more amino acid residues. A “conservative amino acid substitution" is one in which one amino acid residue is replaced with a different amino acid residue having a similar side chain (see. for example. Dayhoff et al., 1978. Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352. which provides 30 frequency tables for amino acid substitutions), and a non-conservative substitution is one in which an amino acid residue is replaced with an amino acid residue that does not have a similar side chain. Nucleic acid and / or polypeptide sequences may be modified as described 2026205176 30 Jun 2026 herein to improve one or more properties such as, without limitation, increased expression (eg., transcription and / or translation), tighter regulation, deregulation, loss of catabolite repression, modified specificity, secretion, thermostability, solvent stability, oxidative stability, protease resistance, catalytic activity, and / or color. 5 As used herein, an ’isolated” nucleic acid molecule is a nucleic acid molecule that is free of sequences that naturally flank one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid molecule is derived (e.g.. a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease digestion). Such an isolated nucleic acid molecule is generally introduced into a vector (e.g., a cloning vector, or 10 an expression vector) for convenience of manipulation or to generate a fusion nucleic acid molecule, discussed in more detail below. In addition, an isolated nucleic acid molecule can include an engineered nucleic acid molecule such as a recombinant or a synthetic nucleic acid molecule. Vectors as described herein can be introduced into a host cell (e.g., fungal cell, such 15 as an Aspergillus cell, a Trichoderma cell, or a yeast cell (e.g., a methylotrophic yeast cell)). As used herein, ‘'host cell” refers to the particular cell into which the nucleic acid is introduced and also includes the progeny of such a cell that carry the vector. A host cell can be any prokaryotic or eukaryotic cell. For example, nucleic acids can be expressed in bacterial cells such as E. coll, or in insect cells, yeast or mammalian cells (such as Chinese 20 hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art. Manx methods for introducing nucleic acids into host cells, both in vivo and in vitro, are well known to those skilled in the art and include, without limitation, electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer. 25 Nucleic acids can be isolated using techniques routine in the art. For example, nucleic acids can be isolated using any method including, without limitation, recombinant nucleic acid technology, and / or the polymerase chain reaction (PCR). General PCR techniques are described, for example in PCR Primer: A Laboratory Manual. Dieffenbach & Dveksler. Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include. 30 for example, restriction enzyme digestion and ligation, which can be used to isolate a nucleic acid. Isolated nucleic acids also can be chemically synthesized, either as a single nucleic acid molecule or as a senes of oligonucleotides. 2026205176 30 Jun 2026 Polypeptides can be purified from natural sources (eg., a biological sample) by known methods such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography. A polypeptide also can be purified, for example, by expressing a nucleic acid in an expression vector In addition, a purified polypeptide can be obtained by chemical 5 synthesis. The extent of purity of a polypeptide can be measured using any appropriate method, e.g.. column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. A construct or vector containing a nucleic acid (e.g., a nucleic acid that encodes a polypeptide) also is provided. Constructs or vectors, including expression constructs or vectors, are commercially available or can be produced by recombinant DNA techniques 10 routine in the art. A construct or vector containing a nucleic acid can have expression elements operably linked to such a nucleic acid, and further can include sequences such as those encoding a selectable marker (e.g., an antibiotic resistance gene). A construct or vector containing a nucleic acid can encode a chimeric or fusion polypeptide (i.e., a polypeptide operatively linked to a heterologous polypeptide, which can be at either the N-terminus or C- 15 terminus of the polypeptide). Representative heterologous polypeptides include those that can be used in purification of the encoded polypeptide (e.g., 6xHis tag. glutathione S-transferase (GST)). Nucleic acids also can be detected using hybridization. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989. Molecular Cloning: A 20 Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory- Press, Cold Spring Harbor. NY; Sections 7.37-7.57,9.47-9.57, 11.7-11.8, and 11.45-11.57). Sambrook el al. discloses suitable Southern blot conditions for oligonucleotide probes less than about 100 nucleotides (Sections 11.45-11.46). The Tm between a sequence that is less than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Section 11.46. 25 Sambrook el al. additionally discloses Southern blot conditions for oligonucleotide probes greater than about 100 nucleotides (see Sections 9.47-9.54). The Tm betyveen a sequence greater than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Sections 9.50-9.51 of Sambrook et al. The conditions under which membranes containing nucleic acids are prehybri dized 30 and hybridized, as well as the conditions under which membranes containing nucleic acids are washed to remove excess and non-specifically bound probe, can play a significant role in the stringency of the hybridization. Such hybridizations and yvashes can be performed, yvhere 2026205176 30 Jun 2026 appropriate, under moderate or high stringency conditions. For example, washing conditions can be made more stnngent by decreasing the salt concentration in the wash solutions and / or by increasing the temperature at which the w ashes are performed. Simply by way of example, high stringency conditions typically include a wash of the membranes in 0.2X SSC 5 at 65’C. In addition, interpreting the amount of hybridization can be affected, for example, by the specific activity of the labeled oligonucleotide probe, by the number of probe-binding sites on the template nucleic acid to which the probe has hybridized, and by the amount of exposure of an autoradiograph or other detection medium. It will be readily appreciated by 10 those of ordinary skill in the art that although any number of hybridization and washing conditions can be used to examine hybridization of a probe nucleic acid molecule to immobilized target nucleic acids, it is more important to examine hybridization of a probe to target nucleic acids under identical hybridization, washing, and exposure conditions. Preferably, the target nucleic acids are on the same membrane. 15 A nucleic acid molecule is deemed to hybridize to a nucleic acid but not to another nucleic acid if hybridization to a nucleic acid is at least 5-fold (e.g.. at least 6-fold. 7-fold. 8fold. 9-fold. I O-fold. 20-fold. 50-fold, or 100-fold) greater than hybridization to another nucleic acid. The amount of hybridization can be quantitated directly on a membrane or from an autoradiograph using, for example, a Phosphorlmager or a Densitometer (Molecular 20 Dynamics, Sunnyvale, CA). Polypeptides can be detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme linked immunosorbent assays (ELISAs). Western blots, immunoprecipitations and immunofluorescence. An antibody can be polyclonal or monoclonal. An antibody having specific binding affinity for a polypeptide can be generated 25 using methods well known in the art. The antibody can be attached to a solid support such as a microliter plate using methods known in the art. In the presence of a polypeptide, an antibody-polypeptide complex is formed. Detection (e.g.. of an amplification product, a hybridization complex, or a polypeptide) is usually accomplished using detectable labels. The term “label'’ is intended to 30 encompass the use of direct labels as well as indirect labels. Detectable labels include enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. 2026205176 30 Jun 2026 Methods are described herein that can be used to generate a strain that lacks sequences for selection (i.e.. that lacks a selectable marker). These methods include using a circular plasmid DNA vector and a linear DNA sequence; the circular plasmid DNA vector contains a selection marker and an origin of DNA replication (also known as an 5 autonomously replicating sequence (ARS)). and the linear DNA sequence contains sequences for integration into the genome (e.g.. the Pichia genome) by homologous recombination. The linear DNA molecule additionally can include nucleic acid sequences encoding one or more proteins of interest such as, without limitation, an ALAS, a heme-binding protein, or a third protein (e.g., a transcription factor or a protein involved in heme biosynthesis). 10 Cells (e.g., Pichia cells) can be transformed with both DNA molecules and the transformants selected by the presence of the selectable marker on the circular plasmid. Transformants then can be screened for integration of the linear DNA molecule into the genome using, for example. PCR. Once transformants with the correct integration of the marker-free linear DNA molecule are identified, the cells can be grown in the absence of 15 selection for the circular plasmid. Because the marker-bearing plasmid is not stably maintained in the absence of selection, the plasmid is lost, often very quickly, after selection is relaxed. The resulting strain carries the integrated linear DNA in the absence of heterologous sequences for selection. Therefore, this approach can be used to construct strains (eg., Pichia strains) that lack a selectable marker (e.g., a heterologous selection 20 marker) with little to no impact on recombinant protein yield. In accordance with the present disclosure, there may be employed conventional molecular biology, microbiology, biochemical, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. The materials and 25 methods of the disclosure will be further described in the following examples, which do not limit the scope of the methods and compositions of matter described in the claims. The materials and methods of the disclosure will be further described in the follow ing examples, which do not limit the scope the claims. 30 Exemplary Embodiments Embodiment 1 is a cell comprising: 2026205176 30 Jun 2026 a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an ami nolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme responsive motif (HRM). and wherein the ALAS comprises a mutation in the first HRMi and 5 a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. wherein the second exogenous nucleic acid construct comprising a nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element. 10 Embodiment 2 is the cell of embodiment I. wherein the cell is a fungal cell. Embodiment 3 is the cell of embodiment 2, w herein the cell is on Aspergillus or Trichodertna cell. Embodiment 4 is the cell of any one of embodiments l-3, wherein the cell is a yeast cell. 15 Embodiment 5 is the cell of embodiment 4, wherein the yeast cell is a methylotrophic yeast cell. Embodiment 6 is the cell of embodiment 5, wherein the methylotrophic yeast cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. Embodiment 7 is the cell of any one of embodiments 5-6, wherein the methylotrophic 20 yeast cell is a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymerpha cell. Embodiment X is the cell of any one of embodiments 5-7. wherein the methylotrophic yeast cell is a Pichia pastoris cell. Embodiment 9 is the cell of any one of embodiments 1-8. w herein the mutation in the 25 first HRM is a mutation from a cysteine to a different amino acid. Embodiment 10 is the cell of any one of embodiments 1-9. wherein the ALAS protein composes a second HRM. and wherein the ALAS protein comprises a mutation in the second HRM. Embodiment 11 is the cell of embodiment 10. w herein the mutation in the second 30 HRM is a mutation from a cysteine to a different amino acid 2026205176 30 Jun 2026 Embodiment 12 is the cell of embodiment 10 or embodiment 11. wherein the different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM. Embodiment 13 is the cell of embodiment 10 or embodiment 11. wherein the different 5 amino acid is not the same for the mutation in the first HRM and the mutation in the second HRM. Embodiment 14 is the cell of any one of embodiments 10-13. wherein the ALAS protein comprises a third HRM. and wherein the ALAS protein comprises a mutation in the third HRM. 10 Embodiment 15 is the cell of embodiment 14, wherein the mutation in the third HRM is a mutation from a cysteine to a different amino acid. Embodiment 16 is the cell of embodiment 15, wherein the different amino acid is the same for the mutation in the first HRM. the mutation in the second HRM. and the mutation in the third HRM. 15 Embodiment 17 is the cell of any one of embodiments 9-16. wherein the different amino acid is selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, glutamic acid, aspartic acid, phenylalanine, tryptophan, tyrosine, and valine. 20 Embodiment 18 is the cell of any one of embodiments 9-16. wherein the different amino acid is selected from a nonpolar aliphatic amino acid, an aromatic amino acid, a polar uncharged amino acid, or a positively charged amino acid Embodiment 19 is the cell of embodiment 18. wherein the nonpolar aliphatic amino acid is selected from the group consisting of glycine, proline, alanine, isoleucine, leucine. 25 methionine, and valine. Embodiment 20 is the cell of embodiment 18. wherein the aromatic amino acid is selected from the group consisting of phenylalanine, tryptophan, and tyrosine. Embodiment 21 is the cell of embodiment 18, w herein the polar uncharged amino acid is selected from the group consisting of a polar uncharged amino acid serine, threonine. 30 asparagine, or glutamine. Embodiment 22 is the cell of embodiment 18, wherein the positively charged amino acid is selected from the group consisting of arginine, histidine, and lysine. 2026205176 30 Jun 2026 Embodiment 23 is the cell of any one of embodiments 9-22. wherein the different amino acid is serine. Embodiment 24 is the cell of any one of embodiments 9-22. w herein the different amino acid is alanine. 5 Embodiment 25 is the cell of any one of embodiments 9-22, wherein the different amino acid is phenylalanine. Embodiment 26 is the cell of any one of embodiments 9-22, w herein the different amino acid is histidine. Embodiment 27 is the cell of any one of embodiments 1-26, wherein the first HRM is 10 HRMl. Embodiment 28 is the cell of any one of embodiments 10-27. wherein the second HRM is HRM2. Embodiment 29 is the cell of any one of embodiments 1-26, wherein the first HRM is HRM2. 15 Embodiment 30 is the cell of any one of embodiments 10-27, wherein the second HRM is HRM 1. Embodiment 31 is the cell of any one of embodiments 1-30. wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity- to the nucleic acid sequence in SEQ ID NO: 28. 20 Embodiment 32 is the cell of any one of embodiments 1-30. wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence in SEQ ID NO: 28. Embodiment 33 is the cell of any one of embodiments 1-30. wherein the first exogenous nucleic acid construct comprises the nucleic acid sequence in SEQ ID NO: 30. 25 Embodiment 34 is the cell of any one of embodiments 1-32. wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity- to the amino acid sequence in SEQ ID NO: 29. Embodiment 35 is the cell of any one of embodiments 1-32, wherein the ALAS protein comprises an amino acid sequence having at least 95% sequence identity to the amino 30 acid sequence in SEQ ID NO: 29. Embodiment 36 is the cell of any one of embodiments 1-35. wherein the ALAS protein comprises the amino acid sequence in SEQ ID NO: 31. 2026205176 30 Jun 2026 Embodiment 37 is the cell of any one of embodiments 1-36, wherein the hemebinding protein is selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase. Embodiment 38 is the cell of any one of embodiments 1-36. wherein the heme- 5 binding protein is selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin, an erythrocruorin, aflavohemoglobin, agiobin E, agiobin X, agiobin Y, a hemoglobin, a histoglobin, a leghemoglobin, a myoglobin, a neuroglobin, a non-symbiotic hemoglobin, a protoglobin, and a truncated hemoglobin. Embodiment 39 is the cell of any one of embodiments 1-36, wherein the heme- 10 binding protein is a non-symbiotic hemoglobin. Embodiment 40 is the cell of any one of embodiments I -36, wherein the hemebinding protein is a leghemoglobin. Embodiment 41 is the cell of any one of embodiments I-40, wherein the hemebinding protein comprises an amino acid sequence having at least 90% sequence identity to 15 an amino acid sequence in any one of SEQ ID NOs: 1-27. Embodiment 42 is the cell of any one of embodiments 1-41, further comprising a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is operably linked to the first promoter element, the second promoter element, or a third promoter element. 20 Embodiment 43 is the cell of embodiment 42, wherein the first promoter element comprises a recognition sequence for the transcription factor. Embodiment 44 is the cell of any one of embodiments 42 or 43, wherein the second exogenous nucleic acid construct is operably linked to a second promoter element, and wherein the second promoter element comprises a recognition sequence for the transcription 25 factor. Embodiment 45 is the cell any one of embodiments 42 or 43, w herein the third nucleic acid construct is operably linked to the third promoter element, and wherein the third promoter element comprises a recognition sequence for the transcription factor. Embodiment 46 is the cell of any one of embodiments 1-45, further comprising a 30 fourth nucleic acid construct comprising a nucleotide sequence encoding a protein involved in heme biosynthesis, wherein the fourth nucleic acid construct is operably linked to the first 2026205176 30 Jun 2026 promoter element, the second promoter element, the third promoter element, or a fourth promoter element. Embodiment 47 is the cell of embodiment 46. wherein the protein involved in heme biosynthesis is selected from the group consisting of ALA dehydratase, porphobilinogen 5 deaminase. UPG III synthase, UPG 111 decarboxylase. CPG oxidase. PPG oxidase, and ferrochelatase. Embodiment 48 is the cell of any one of embodiments 1-47, wherein the first exogenous nucleic acid construct is a heterologous nucleic acid construct. Embodiment 49 is the cell of any one of embodiments 1-48. wherein the second 10 exogenous nucleic acid construct is a heterologous nucleic acid construct. Embodiment 50 is the cell of any one of embodiments 1-47, wherein the hemebinding protein is an exogenous heme-binding protein. Embodiment 51 is the cell of any one of embodiments 1-47 or 50, wherein the hemebinding protein is a heterologous heme-binding protein. 15 Embodiment 52 is a method of producing a heme-binding protein in a cell comprising: expressing a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme responsive motif 20 (HRM). and wherein the ALAS comprises a mutation in the first HRM; and expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein, wherein the second exogenous nucleic acid construct comprising a nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element 25 or is operably linked to a second promoter element. Embodiment 53 is the method of 52, wherein the method produces the heme-binding protein in a titer that is at least 5% greater than a corresponding method lacking the first exogenous nucleic acid construct. Embodiment 54 is the method of embodiment 52 or embodiment 53. wherein the 30 method produces the heme-binding protein in a titer that is at least 10% greater than a corresponding method lacking the first exogenous nucleic acid construct. 2026205176 30 Jun 2026 Embodiment 55 is the method of embodiment 52 or embodiment 53, wherein the method produces the heme-binding protein in a titer that is at least 15% greater than a corresponding method lacking the first exogenous nucleic acid construct. Embodiment 56 is the method of embodiment 52 or embodiment 53. wherein the 5 method produces the heme-binding protein in a titer that is al least 20% greater than a corresponding method lacking the first exogenous nucleic acid construct. Embodiment 57 is the method of embodiment 52. w herein the method produces the heme-binding protein in a titer that is at least 5% greater than a corresponding method lacking the mutation in the first HRM. 10 Embodiment 58 is the method of embodiment 52, wherein the method produces the heme-binding protein in a titer that is at least 10% greater than a corresponding method lacking the mutation in the first HRM. Embodiment 59 is the method of embodiment 52, w herein the method produces the heme-binding protein in a titer that is at least 15% greater than a corresponding method 15 lacking the mutation in the first HRM. Embodiment 60 is the method of embodiment 52. w herein the method produces the heme-binding protein in a titer that is at least 20% greater than a corresponding method lacking the mutation in the first HRM. Embodiment 61 is the method of any one of embodiments 52-60, wherein the method 20 is carried out in the absence of added methanol. Embodiment 62 is the method of any one of embodiments 52-61, wherein the cell is a fungal cell Embodiment 63 is the method of embodiment 62. wherein the cell is an Aspergillus or Trichoderma cell 25 Embodiment 64 is the method of any one of embodiments 62-63. wherein the cell is a yeast cell. Embodiment 65 is the method of embodiment 64. wherein the yeast cell is a methylotrophic yeast cell. Embodiment 66 is the method of embodiment 65. w herein the methylotrophic yeast 30 cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. 2026205176 30 Jun 2026 Embodiment 67 is the method or any one of embodiments 65-66, wherein the methylotrophic yeast cell is aPichia methanolica cell. aPichiapastoris cell, a Candida boidinii cell, or a Hanscnula polymorpha cell. Embodiment 68 is the method of any one of embodiments 51-53. wherein the 5 methylotrophic yeast cell is a Pichiapastoris cell. Embodiment 69 is the method of any one of embodiments 52-68. wherein the mutation in the first HRM is a mutation from a cysteine to a different amino acid. Embodiment 70 is the method of any one of embodiments 52-69. wherein the ALAS protein comprises a second HRM, and wherein the ALAS protein comprises a mutation in the 10 second HRM. Embodiment 71 is the method of embodiment 70, w herein the method produces the heme-binding protein in a titer that is at least 5% greater than a corresponding method lacking the mutations in the first HRM and second HRM. Embodiment 72 is the method of embodiment 70, wherein the method produces the 15 heme-binding protein in a titer that is at least 10% greater than a corresponding method lacking the mutations in the first HRM and second HRM. Embodiment 73 is the method of embodiment 70, wherein the method produces the heme-binding protein in a titer that is at least 15% greater than a corresponding method lacking the mutations in the first HRM and second HRM. 20 Embodiment 74 is the method of embodiment 70, wherein the method produces the heme-binding protein in a titer that is at least 20% greater than a corresponding method lacking the mutations in the first HRM and second HRM Embodiment 75 is the method of any one of embodiments 70-74. w'herein the mutation in the second HRM is a mutation from a cysteine to a different amino acid. 25 Embodiment 76 is the method of any one of embodiments 70-75. wherein the different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM. Embodiment 77 is the method of any one of embodiments 70-75, wherein the different amino acid is not the same for the mutation in the first HRM and the mutation in the 30 second HRM. 2026205176 30 Jun 2026 Embodiment 78 is the cell of any one of embodiments 70-77. wherein the ALAS protein comprises a third HRM. and wherein the ALAS protein comprises a mutation in the third H RM. Embodiment 79 is the cell of embodiment 78. wherein the mutation in the third HRM 5 is a mutation from a cysteine to a different amino acid. Embodiment 80 is the cell of embodiment 79, wherein the different amino acid is the same for the mutation in the first HRM. the mutation in the second HRM. and the mutation in the third HRM. Embodiment 81 is the method any one of embodiments 69-80, wherein the different 10 amino acid is selected from the group consisting of arginine, histidine, lysine, senne, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, aspartic acid, glutamic acid, phenylalanine, tryptophan, tyrosine, and valine. Embodiment 82 is the method of any one of embodiments 69-80, wherein the 15 different amino acid is selected from a nonpolar aliphatic amino acid, an aromatic amino acid, a polar uncharged amino acid, or a positively charged amino acid. Embodiment 83 is the method of embodiment 82, wherein the nonpolar aliphatic amino acid is selected from the group consisting of glycine, proline, alanine, isoleucine, leucine, methionine, and valine. 20 Embodiment 84 is the method of embodiment 82, wherein the aromatic amino acid is selected from the group consisting of phenylalanine, tryptophan, and tyrosine. Embodiment 85 is the cell of embodiment 82. wherein the polar uncharged amino acid is selected from the group consisting of a polar uncharged amino acid senne, threonine, asparagine, or glutamine. 25 Embodiment 86 is the method of embodiment 82. wherein the positively charged amino acid is selected from the group consisting of arginine, histidine, and lysine. Embodiment 87 is the method of any one of embodiments 69-86, w’herein the different amino acid is serine. Embodiment 88 is the method of any one of embodiments 69-86. w herein the 30 different amino acid is alanine. Embodiment 89 is the method of any one of embodiments 69-86, w’herein the different amino acid is phenylalanine. 2026205176 30 Jun 2026 Embodiment 90 is the method or any one of embodiments 69-86, wherein the different amino acid is histidine. Embodiment 91 is the cell of any one of embodiments 52-90. wherein the first HRM is HRM1 5 Embodiment 92 is the cell of any one of embodiments 70-91. wherein the second HRM is HRM2. Embodiment 93 is the cell of any one of embodiments 52-90. wherein the first HRM is HRM2 Embodiment 94 is the cell of any one of embodiments 70-91. wherein the second 10 HRM is HRMI. Embodiment 95 is the method of any one of embodiments 52-94. wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence in SEQ ID NO: 28. Embodiment 96 is the method of any one of embodiments 52-95, wherein the first 15 exogenous nucleic acid construct comprises a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence in SEQ ID NO: 28. Embodiment 97 is the method of any one of embodiments 52-96, wherein the first exogenous nucleic acid construct comprises the nucleic acid sequence in SEQ ID NO: 30. Embodiment 98 is the method of any one of embodiments 52-97, wherein the ALAS 20 protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence in SEQ ID NO: 29. Embodiment 99 is the method of any one of embodiments 52-98. wherein the ALAS protein comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence in SEQ ID NO: 29. 25 Embodiment 100 is the method of any one of embodiments 52-99. wherein the ALAS protein comprises the amino acid sequence in SEQ ID NO: 31 Embodiment 101 is the method of any one of embodiments 52-100, wherein the heme-binding protein is selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase. 30 Embodiment 102 is the method of any one of embodiments 52-100, wherein the heme-binding protein is selected from the group consisting of an androglobin, a chlorocruorin, a cytoglobin. an erythrocruorin, a flavohemoglobin. agiobin E, agiobin X. a 2026205176 30 Jun 2026 globin Y. a hemoglobin, a histoglobin. a leghemoglobin, a myoglobin, a neuroglobin, a non-symbiotic hemoglobin, a protoglobin, and a truncated hemoglobin. Embodiment 103 is the method of any one of embodiments 52-100, wherein the heme-binding protein is a non-symbiotic hemoglobin. 5 Embodiment 104 is the method of any one of embodiments 52-100, wherein the heme-binding protein is a leghemoglobin. Embodiment 105 is the method of any one of embodiments 52-100, wherein the heterologous heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to an amino acid sequence in any one of SEQ ID NOs: 1-27. 10 Embodiment 106 is the method of any one of embodiments 52-105, further comprising expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is operably linked to the first promoter element, the second promoter element, or a third promoter element. Embodiment 107 is the method of embodiment 106, wherein the first promoter 15 element comprises a recognition sequence for the transcription factor. Embodiment 108 is the method of embodiment 107, wherein the second exogenous nucleic acid construct is operably linked to a second promoter element, and wherein the second promoter element comprises a recognition sequence for the transcription factor. Embodiment 109 is the method of any one of embodiments 107-108, wherein the 20 third nucleic acid construct is operably linked to the third promoter element, and wherein the third promoter element comprises a recognition sequence for the transcription factor. Embodiment 110 is the method of any one of embodiments 52-109, further comprising expressing a fourth nucleic acid construct comprising a nucleotide sequence encoding a protein involved in heme biosynthesis, wherein the fourth nucleic acid construct is 25 operably linked to the first promoter element, the second promoter element, the third promoter element, or a fourth promoter element. Embodiment 111 is the method of embodiment 110, wherein the protein involved in heme biosynthesis is selected from the group consisting of ALA dehydratase, porphobilinogen deaminase. UPG III synthase. UPG III decarboxylase, CPG oxidase. PPG 30 oxidase, and ferrochelatase. Embodiment 112 is the method of any one of embodiments 52-1 11, wherein the first exogenous nucleic acid construct is a heterologous nucleic acid construct. 2026205176 30 Jun 2026 Embodiment 113 is the method of any one of embodiments 52-112, wherein the second exogenous nucleic acid construct is a heterologous nucleic acid construct. Embodiment 114 is the method of any one of embodiments 52-113, wherein the heme-binding protein is an exogenous heme-binding protein. 5 Embodiment 115 is the method of any one of embodiments 52-111 or 114. wherein the heme-binding protein is a heterologous heme-binding protein. EXAMPLES 10 Example I Polymerase Chain Reaction Genes of interest were amplified from genomic DNA or plasmid DNA templates using Phusion High-fidelity PCR master mix (New England Biolabs, Cat #M053l), 0.6 pM 15 each of forward and reverse primers and 10-50 ng of template DNA. The reaction conditions were as follows: 1 cycle Initial Denaturation 98°C Imin 25 cycles Denaturation 98°C 10 sec Annealing 60°C 20 sec Extension 72T 30 sec per kb 1 cycle Final Extension 72°C 5 min Hold 4°C Forever 20 Pichia pastoris ALAS gene (KEGG identifier PAS_chr2-1 0716, which can be accessed at the Kyoto Encyclopedia of Genes and Genomes (KEGG) w ebsite) was amplified using primers (ATGGAGTTTGTCGCCCGTCAG; SEQ ID NO: 65) and (CTACAATCTGACTCCTGATGAGGTTTC; SEQ ID NO: 66) from genomic DNA. In the examples. wlALAS denotes this native sequence of ALAS (SEQ ID NO: 28). 25 Example 2 Cloning of ALAS and mutagenesis 2026205176 30 Jun 2026 PCR product was purified using NucleoSpin Gel and PCR Clean-Up (Takara Bio, Cat #740609) and cloned in pCR-Bluntll-TOPO vector using Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, Cat #K280020) following the manufacturer's recommendation. 5 Site directed mutagenesis was carried out on the resulting vector (40 ng of purified plasmid) using two sets of primers (setl: CGTCAGTCCATGAATGCCTCTCCCTTTGTCAGGTCAACTTC, SEQ ID NO: 37 and GAAGTTGACCTGACAAAGGGAGAGGCATTCATGGACTGACG; SEQ ID NO: 38, set2: GCTGCTACTGCTAGTCATTCTCCCGTGGTTGGCCCTG; SEQ ID NO: 39 and io CAGGGCCAACCACGGGAGAATGACTAGCAGTAGCAGC; SEQ ID NO: 40) and QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, Cat #200521) to create mutALAS carrying mutations of cysteine residues at positions 12 and 39 to serine residues (SEQ ID NO: 30). In the Examples. mutALAS specifically denotes these two mutations unless specified otherw ise. The reaction conditions were as follows: 1 cycle Initial Denaturation 95°C Imin 18 cycles Denaturation 95°C 50 sec Annealing 60°C 50 sec Extension 68°C 11 min 1 cycle Final Extension 68°C 7 min Hold 4°C Forever Single cysteine to serine mutation. C12S or C39S was performed by site directed mutagenesis on vector carrying wtALAS using primer setl (SEQ ID NO: 37, SEQ ID NO: 38) and set2 (SEQ ID NO: 39, SEQ ID NO: 40) respectively. 20 Example 3 Construction of ALAS (wild-type or mutated, C12S, C39S) gene integration cassette Integration cassette of wtALAS or mutALAS was designed such that gene integration 25 occurred under the methanol-inducible alcohol oxidase 1 (AOX1) promoter element from Pichiapastoris and before the translation stop signal immediately followed by the transcription terminator sequence from the Pichia pastoris FDH1 gene. The linear constructs 2026205176 30 Jun 2026 contained the 3' half of the promoter element, followed by ALAS gene (wild-ty pe or mutant), followed by the FDH1 transcription terminator. This was immediately followed by the selection cassette containing the pTEF promoter element from^^ya gossypii, the acetamidase gene (amdS) from Aspergillus nidulans and the TEF terminator from Ashbya 5 gossypii. Finally, the construct contained the 5' half of the promoter element (See. eg.. Figure 5) Overlapping PCR was used to create the linear constructs [3'pAOXl-ALAS (wt / mut)-FDHltt-pTEF-amdS-TEFtt-5'pAOXl). Primers Used to Amplify the Linear Constructs: Overlapping PCR ” Primer sequences SEQ ID NO: PCR1 AAACGCTGTCTTGGAACCTAATATGAC 41 GACGGGCGACAAACTCCATCGTTTCGAATAATTAGTTG 42 PCR2 CAACTAATTATTCGAAACGATGGAGTTTGTCGCCCGTCAG 43 AATTAAATACATTTCAACTACAATCTGACTCCTGATGAGGTTTCG 44 PCR3 CCTCATCAGGAGTCAGATTGTAGTTGAAATGTATTTAATTTG 45 AAACTGTCAGTTTTGGGCCATTTG 46 io Individual PCR reaction conditions were performed as indicated above. PCR products were purified using NucleoSpin Gel and PCR Clean-Up (Takara Bio, Cat #740609). The final overlapping PCR product was performed using 0.5 U Platinum Pfx DNA Polymerase (Thermo Fisher Scientific, Cat# 11708039), lx amplification buffer, 0.3 mM dNTPs and 1 15 mM MgCh by mixing the three purified PCR amplicons in an equimolar ratio in a 2-part PCR reaction. The PCR conditions were: Part 1: 1 cycle Initial Denaturation 94°C 2min 15 cycles Denaturation 94°C 15 sec Annealing 58°C 30 sec Extension 68°C 5 min Hold 4°C 20 Following part 1. the reaction mixes were spiked with primers AAACGCTGTCTTGGAACCTAATATGAC (SEQ ID NO: 41) and AAACTGTCAGTTTTGGGCCATTTG (SEQ ID NO: 46) (0.3 uM final concentration) and 1.5U Pfx and continued to part 2. 2026205176 30 Jun 2026 Part 2: 1 cycle Initial Denaturation 94°C 2min 20 cycles Denaturation 94°C 15 sec Annealing 58°C 30 sec Extension 68°C 5 min Hold 4°C Forever Sequences of exemplars mutant nucleic acids (e.g.? SEQ ID NO: 30) and proteins (e.g.? SEQ ID NO: 31) are provided in Figure 7. Expression plasmids of wtALAS and mutALAS were constructed in an autonomous replicating vector (panARS) under a modified pAOXl followed by the transcnption terminator sequence from ihe Pichia pastoris FDHl gene. The s ector conferred resistance to G418 (Geneticin). Cloning of inserts GFP? wtALAS and mutALAS in the vector was performed using Gibson Assembly Master Mix (New England Biolabs, catalog # E26l IL) following manufacturer’s recommendation. Example 4 Preparation of P. pastoris transformation-competent cells Selected strains of P. pastoris (K. phaffli) were grown to mid-exponential grow th phase (~2 OD) in 25 ml YPD medium. Cells svere collected by centrifugation at 930xg for 15 minutes. The cell pellet was resuspended in 2 ml of a solution of 80% YPD and 200 mM HEPES, pH 6.8. 75 pl of 1 M DTT was added. The resuspended cell pellet was mixed at 100 rpm at 30°C for 25 minutes. A 40 ml volume of ice cold, sterile water was added to the suspension, and the cells were collected by centrifugation at 1125*g for 15 minutes and placed on ice. The cell pellet was resuspended in 40 ml ice cold water and collected as before for two additional w ash steps. The cell pellet was then resuspended in 20 ml of ice cold 1 M sorbitol and collected by centrifugation as before. The final cell pellet was suspended in 0.3 ml ice cold, sterile I M sorbitol, aliquoled and frozen al -80° C. 2026205176 30 Jun 2026 Transformation into P. pastoris For genome integration, 100-300 ng of linearized DNA was transformed into 30 pl of electrocompetent P. pastoris cells using a 1 mm gap GenePulser cuvette (Bio-Rad, Cat# 5 1652083) with a GenePulser (Bio-Rad) set al 1.15 kV. I ml of YPD / 1M sorbitol (1:1 vol / vol) was added immediately to the cells. The cells were allowed to recover for 3 h at 30°C with shaking at 100 rpm. 100 pl of the recovery mixture was plated on yeast carbon base plates containing 5mM acetamide (Teknova, Cat#Y5216). Plates were incubated at 30° C for 48 hours. Individual clones were streaked onto yeast carbon base plates containing acetamide to 10 obtain single colonies and the isolated colonies were used to do colony PCR or gDNA prep to confirm gene integration into the chromosome and sequence the integration construct. For plasmid DNA transformation, the same steps were followed as for genome integration except that after electroporation and recovery of cells, 50-100 pl of the recovery mixture was plated on YPD plates containing 300 ug / ml G41X (Geneticin). 15 Example 6 Construction of Strains St2, St3, St5 and St6 A high yielding parent strain (Stl) had pre-existing recombinant ALAS under the 20 methanol-inducible strong promoter pAOXl (alcohol oxidase I) in addition to other pAOXl-driven heme enzymes, the carbon-responsive transcription factor MxRl and multiple copies of LegH A low yielding parent LegH strain (St4) lacked recombinant MxRl, ALAS and other heme enzymes except aminolevulinate dehydratase (ALAD). Competent Stl cells (Table 1; a high LegH titer strain) were transformed with each of 25 the linear cassettes (for wtALAS and mutALAS) and transformants containing the amdS selection cassette were selected based on their ability to grow on agar plates containing acetamide as the sole nitrogen source. The resulting strains (St2 and St3 with integrated cassette for wtALAS and mutALAS respectively, Table 1) were purified, isolated and the presence of pAOXl driven wtALAS or mutALAS was verified by colony PCR and 30 sequencing. Similarly, competent St4 cells (a low LegH titer strain) were transformed with linear cassettes for wtALAS and mutALAS to obtain St5 and St6 respectively. 2026205176 30 Jun 2026 Table 1. Strains with LegH integrated in genome Parent 1 extra copy of recombinant wtALAS added 1 extra copy of recombinant mutALAS added High LegH titer strain (Strain Stl) Strain St2 Strain St3 Low LegH titer strain (Strain St4) Strain St5 Strain St6 Example 7 ALAS gene copy number analysis ALAS gene copy number in different strains was measured by probe-based qPCR. Briefly, genomic DNA (20ng) was amplified with lx PrimeTime gene expression mastermix (Integrated DNA Technologies, Cat# 1055770) and PrimeTime qPCR Probe Assays in a realtime qPCR CFX96 machine (Bio-Rad). qPCR normalization w as performed with respect to actin. A double delta Ct analysis method was followed to calculate the relative copy number of gene of interest betw een strains. Primer and probe sequences w ere: Gene Primer sequence SEQID NO. Probe sequence SEQ ID. NO ALAS GCTCTCCAACAGCAGA GATAC 47 6- FAMAAGCCCAAAZen.CC TCCGACATTGCTA'3IABkF Q 51 GTCC ATACGGATCGGA GAAAC 48 Actin AGC AAC ATC CCTGATT CCG 49 HEX / TCGC CGTAA, ZciiGTI CTTGGTT TAGACGTTC / 3IABkFQ 52 ATGCGTACCTTCAATCC TGG 50 The engineered strains (Table 1) contained identical number of extra ALAS gene copies, either one copy of wtALAS or mutALAS, as measured by qPCR of ALAS normalized to actin levels. Hence, ALAS gene dosage was ruled out for any difference in the phenotype of the resulting strains (e.g., St2 vs St3 and St5 vs St6). 2026205176 30 Jun 2026 PCR detection of heme enzyme, MxR1, LegH and Mb genes Strain characterization was done by PCR for pAOXl-driven recombinant heme biogenesis pathway enzyme. MxRl and LegH genes. Forward primer sequence for PCR was 5 TAGCGCAGTCTCTCTATCGCTTC (SEQ ID NO: 53) specific to pAOXl. Reverse primer was specific to each gene of interest as shown below. Gene Reverse Primer Amplicon size SEQ ID NO: 5-aminolevulinate synthase CACTGGGTTGTGCACATTGG 1995 bp 54 Delta-ami nolevulinate dehydratase ACAATATTCTTCTCTGCCGC 1268 bp 55 Phorphobilinogen deaminase TTGATCTCGTCAAGAATGCG 1358 bp 56 Uroporphyrinogen III synthase TAGGTGCCACAACTTTTGGTTT C 1102 bp 57 Uropo rphy ri nogen d ecarb oxy las e GATCCAATGCGATGACATTCTT GT 1430 bp 58 Coproporphyrinogen III oxidase ACCTGCAATAACTCCTCTTCTCT G 1301 bp 59 Protoporphyrinogen oxidase CCACTGAGGGTAGCCGAATC 2027 bp 60 Ferrochelatase GGGCTCTGAAAAACTCTTTTGG 1486 bp 61 MxRl GCATGTCTCAATAACAGATCTC GACGG 629 bp 62 LegH AAGCCTCTTGTTTTTCTGTAAAT GCAC 382 bp 63 Bovine Mb TGATGGCGTCCGAGATGAACTC 688 bp 64 Results of these reactions are shown below. Recombinant Gene (under pAOXl) Stl St2 St3 St4 St5 St6 St7 5-aminolevulinate synthase X X X - X X X Delta-aminolevulinate dehydratase X X X X X X X Phorphobilinogen deaminase X X X - - - X Uroporphyrinogen III synthase X X X - - - X Uropo rphy ri nogen d ecarb oxy 1 as e X X X - - - X Coproporphyrinogen III oxidase X X X - - - X Protoporphyrinogen oxidase X X X - - - X Ferrochelatase X X X - - - X MxRl X X X - - - X 2026205176 30 Jun 2026 LegH X X X X X X - Mb (Bovine Myoglobin) - - - - - - X Example 9 5 Shake flask cultivation of strains St4, St5 and St6 The strains were inoculated into growth media (1% yeast extract, 2% peptone, supplemented with 1% glycerol) overnight at 30°C with shaking at 200 rpm. The next day the overnight cultures were diluted to an OD600 of 0.5-0.7 with YP media supplemented with 10 1% methanol and 1% dextrose. The cultures were grown for 48 hours and harvested by centrifugation at -4000g for 15 mins at 4°C. The low LegH titer strain. St4. didn't have a pre-existing copy of recombinant ALAS, unlike Stl. Integrating a copy of mutALAS (St6) led to a -30% improvement in LegH titer compared to St5 (wlALAS). The titer calculation is based on LegH content as measured by a 15 liquid chromatography method as described in Example 13. The relative LegH titer is shown in Table 2. Table 2 St5 St6 Relative LegH titer 1.00 1.32 20 Example 10 2L cultivation of strains Stl, St2 and St3 Strains Stl. St2 and St3 were grown in 2L fermentation tanks in media containing dextrose as the principal carbon source at 30°C. No methanol was used. In the background of 25 a high LegH titer strain (St 1) that contained pre-existing recombinant ALAS, St3 overexpressing mutALAS improved LegH titer by >30% over the parent Stl. When compared to wtALAS (in St2), mutALAS (in St3) resulted in a 20% improvement in LegH 2026205176 30 Jun 2026 titer. The titer calculation is based on LegH content as measured by a liquid chromatography method as described in Example 13 The relative LegH titer is shown in Table 3. Table 3 Stl St2 St3 Relative LegH titer 1.00 1.10 1.37 Hence, mutating both the ALAS HRMs and overexpressing the mutated ALAS (mutALAS) in Pichia strains with different LegH titer led to further improvement in LegH titer. Furthermore, this suggested that mutALAS improved LegH titer independent of the strain genetic makeup (MxRl and heme enzymes other than ALAS), and presence of 10 methanol. Example 11 mutALAS improved heme levels A quantitative assay for total heme based on reversed-phase high-performance liquid chromatography indicated that strains with mutALAS accumulated more heme levels than wtALAS containing strains. Shown in Table 4 is heme quantification in strain St3 (mutALAS) vs strain St2 (wtALAS). Additionally, mutALAS increased heme loading in multiple strains. Table 4 St2 St3 Relative heme titer 1.00 2.7 20 25 Example 12 ALAS protein levels with mutALAS It is generally believed that heme regulates ALAS levels in a feedback fashion to regulate its own levels. At the protein level, the ALAS level was higher 3-fold in St3 (mutALAS) compared to St2 (wtALAS) (Table 5) as quantitated by shotgun mass spectrometry, when the strains were grown in 2L fermenter tanks with dextrose. Table 5 St2 St3 2026205176 30 Jun 2026 Relative ALAS titer 1.00 3.3 Example 13 Quantification of Leghemoglobin Cell broth samples were pelleted down (at 4000 x g. 4°C, 30 min) and decanted. The 5 pellet samples were then diluted four times with lysis buffer (150 mM NaCl, 50mM Potassium Phosphate. pH 7.4). 300 uL of each resuspension was dispensed into a 96 well deep plate with 120 uL of beads (Zirconium / silica beads (0.5 mm)) per well for cell lysis. The lysis was done with a mini bead beater for 3 minutes, then the plate was cooled down on ice for 5 minutes, and follow ed w ith another 2 minutes of bead beating. The plate was then 10 spun down (at 4000 x g, 4°C, 30 min). The supernatant w as filtered through a 0.2 um filter plate (at 4000 x g, 4°C, 60 min). The filtered lysate was loaded onto a UHPLC with a size-exclusion column (Acquits' BEH SEC column. 200 A, 1.7 um. 4.6 x 150 mm). Method parameters: I) Mobile phase: 15 5mM NaCl. 50mM Potassium Phosphate. (pH 7.4); 2) Flow rate: 0.3 mL / min; 3) Injection volume: 10 uL; 4) Run time: 15 min; 5) Sample tray temperature: 4C. A calibration curve was built w ith a purified LegH standard using absorbance at 280 nm and 415 nm. The quantification w as done using peak area with valley-to-valley peak integration method. The absorbance at 280 nm is proportional to the amount of the polypeptide present and the 20 absorbance at 415 nm is proportional to the amount of heme present. Where a peak is seen at the same elution time at both wavelengths, a heme containing protein is detected. Example 14 mutALAS improved levels of bovine myoglobin 25 In addition to LegH. the production of bovine myoglobin was evaluated. Strain. St7, was generated by integrating myoglobin cDNA of Bos taurus (NM_173881.2) in a strain containing recombinant copies of heme enzymes and MxRl (St7 characterization is described in Example 8) integrated under pAOXl. Three expression plasmids for expression of GFP (control), wtALAS and mutALAS 30 were constructed as described in Example 3. Three strains. St8. St9 and St 10 w’ere generated using a method as described in Example 5 by transforming these three plasmids 2026205176 30 Jun 2026 overexpressing GFP. wtALAS and mutALAS respectively in strain S7, as shown in Table 6. Episomal expression of wtALAS or mutALAS was obtained by growing transformants using a method described in Example 9, except that the growth media was supplemented with 300 ug'ml G418. Table 6 Plasmid expressing Host strain Host strain expressing Resulting Strain 1 GFP St7 Mb St8 2 wtALAS St9 3 mutALAS (C12S, C39S) Stic The cells were pelleted, and shotgun proteomics by LC-MS was performed to quantitate Mb. When normalized to the myoglobin level in Strain St8 (GFP). the average myoglobin levels in St9 and St 10 were as shown in Table 7. Table 7 Strains Normalized Myoglobin levels St8 (GFP) 1 St9 (wt ALAS) 1.60 StlO (mutALAS) 2.58 Example 15 Mutations to other amino acids In addition to cysteine to serine mutations, additional mutations were evaluated. Expression plasmids of mutALAS variants were constructed by gene synthesis and cloning in an autonomous replicating vector (panARS) under a modified pAOXl follow ed by the FDH1 transcription terminator sequence. Furthermore, these plasmids were transformed in strain Stl, using a method as described in Example 5 and the resulting transformants produced 59 2026205176 30 Jun 2026 LegH when cultured, using a method described in Example 9, except that the growth media was supplemented with 300 ug / ml G418. The titer of LegH produced by these strains was normalized to the titer of LegH produced by wtALAS, as determined by the method described in Example 13. The results are shown in Table 8. 5 Table 8 Variant Normalized LegH titer fold C12, C39 (wtALAS) 1 C12S, C39S (mutALAS) 1 14 C12A, C39A 1.22 C12D, C39D 0.91 C12F, C39F 1.17 C12H, C39H 1.12 Example 16 Single cysteine to serine mutants in Pichiapastoris 10 In addition to evaluating the double mutant (C12S. C39S) of ALAS in P. pastoris, single cysteine to serine mutants were also evaluated. Single mutations were created in wtALAS by site directed mutagenesis as described in Example 2. Expression plasmids for expression of w tALAS. mutALAS and single ALAS mutants (C12S and C39S) were constructed as described in Example 3 and were transformed in strain StL using a method as 15 described in Example 5. The resulting transformants produced LegH when cultured, using a method described in Example 9, except that the growth media w as supplemented with 300 ug'ml G41X. The titer of LegH produced by these strains was normalized to the titer of LegH 2026205176 30 Jun 2026 produced by wtALAS. as determined by the method described in Example 13. The results are shown in Table 9. Table 9 Valiant Normalized LegH titer fold C12, C39 (wtALAS) 1 C12S.C39S 1.27 C12S 1 03 C39S 1.01 OTHER EMBODIMENTS 10 It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A cell comprising:a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first5 promoter element, wherein the ALAS comprises at least a first heme responsive motif (HRM), and wherein the ALAS comprises a mutation in the first HRMi anda second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein,wherein the second exogenous nucleic acid construct comprising a nucleotide10 sequence encoding the heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element.
2. The cell of claim 1, wherein the cell is a fungal cell, or is a yeast cell.15 3. The cell of claim 2, wherein yeast cell is a Pichia pastoris cell.
4. The cell of any one of claims 1 -3, wherein the mutation in the first HRM is a mutation from a cysteine to a different amino acid.20 5. The cell of any one of claims 1 -4, wherein the ALAS protein comprises asecond HRM. and wherein the ALAS protein comprises a mutation in the second HRM.
6. The cell of claim 5, wherein the mutation in the second HRM is a mutation25 from a cysteine to a different amino acid.
7. The cell of claim 5, wherein the different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM.30 8. The cell of claim 5. wherein the different amino acid is not the same for themutation in the first HRM and the mutation in the second HRM.2026205176 30 Jun 20269. The cell of any one of claims 4-8, wherein the different amino acid is selectedfrom the group consisting of arginine, histidine, lysine, senne. threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, glutamic acid, aspartic acid, phenylalanine, tryptophan, tyrosine, and valine.
510. The cell of any one of claims 4-8, wherein the different amino acid is selectedfrom a nonpolar aliphatic amino acid, an aromatic amino acid, a polar uncharged amino acid, or a positively charged amino acid.10 11. The cell of any one of claims 4-9, wherein the different amino acid is serine.
12. The cell of any one of claims 4-9, wherein the different amino acid is alanine.
13. The cell of any one of claims 4-9, wherein the different amino acid is15 phenylalanine.
14. The cell of any one of claims 4-9, wherein the different amino acid ishistidine.20 15. The cell of any one of claims 1-14, wherein the first exogenous nucleic acidconstruct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence in SEQ ID NO: 2816. The cell of any one of claims 1-15, wherein the ALAS protein comprises an25 amino acid sequence having al least 90% sequence identity to the amino acid sequence in SEQ ID NO: 29.
17. The cell of any one of claims 1-16, wherein the heme-binding protein isselected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, 30 a ligninase, a catalase, and a peroxidase.2026205176 30 Jun 202618. The cell of any one of claims 1-16, wherein the heme-binding protein is a leghemoglobin.
19. The cell of any one of claims 1-16, wherein the heme-binding protein5 comprises an amino acid sequence having at least 90% sequence identity- to an amino acid sequence in any one of SEQ ID NOs: 1-27.
20. A method of producing a heme-binding protein in a cell comprising: expressing a first exogenous nucleic acid construct comprising a nucleotide10 sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme responsive motif (HRM), and wherein the ALAS comprises a mutation in the first HRM; and expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein,15 wherein the second exogenous nucleic acid construct comprising a nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element.
21. The method of claim 20, wherein the method produces the heme-binding20 protein in a titer that is at least 5% greater than a corresponding method lacking the first exogenous nucleic acid construct.
22. The method of claim 20 or claim 21, wherein the method produces the hemebinding protein in a titer that is at least 10% greater than a corresponding method25 lacking the first exogenous nucleic acid construct.
23. The method of claim 20, wherein the method produces the heme-binding protein in a titer that is at least 5% greater than a corresponding method lacking the mutation in the first HRM.302026205176 30 Jun 202624. The method of claim 20, wherein the method produces the heme-binding protein in a titer that is at least 10% greater than a corresponding method lacking the mutation in the first HRM.5 25. The method of any one of claims 20-24. wherein the method is carried out inthe absence of added methanol.
26. The method of any one of claims 20-25. wherein the mutation in the first HRM is a mutation from a cysteine to a different amino acid.1027. The method of any one of claims 20-26, wherein the ALAS protein comprises a second HRM. and wherein the ALAS protein comprises a mutation in the second HRM.15 28. The method of claim 26, wherein the method produces the heme-bindingprotein in a titer that is at least 5% greater than a corresponding method lacking the mutations in the first HRM and second HRM.
29. The method of claim 26, wherein the method produces the heme-binding 20 protein in a titer that is at least 10% greater than a corresponding method lacking the mutations in the first HRM and second HRM.
30. The method of any one of claims 27-29. wherein the mutation in the second HRM is a mutation from a cysteine to a different ammo acid.2531 The method of claim 30, wherein the different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM.
32. The method of claim 30. wherein the different amino acid is not the same for 30 the mutation in the first HRM and the mutation in the second HRM.2026205176 30 Jun 202633. The method any one of claims 26-32. wherein the different amino acid is selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, aspartic acid, glutamic acid, phenylalanine, tryptophan, tyrosine, and 5 valine.
34. The method of any one of claims 26-33, wherein the different amino acid is serine.10 35. The method of any one of claims 26-33, wherein the different amino acid isalanine.
36. The method of any one of claims 26-33, wherein the different amino acid is phenylalanine.1537. The method of any one of claims 26-33. wherein the different amino acid is histidine.
38. The method of any one of claims 20-37, wherein the first exogenous nucleic 20 acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence in SEQ ID NO: 28.
39. The method of any one of claims 20-38. wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid25 sequence in SEQ ID NO: 29.
40. The method of any one of claims 20-39, wherein the heme-binding protein is selected from the group consisting of a globin, a cytochrome, a cytochrome c oxidase, a ligninase, a catalase, and a peroxidase.3041. The method of any one of claims 20-39, wherein the heme-binding protein is a leghemoglobin.2026205176 30 Jun 202642. The method of any one of claims 20-39, w herein the heterologous hemebinding protein composes an amino acid sequence having at least 90% sequence identity to an amino acid sequence in any one of SEQ ID NOs: 1-27.