Modified multisegmented antisense oligonucleotides for use

Modified multisegmented antisense oligonucleotides with specific nucleoside modifications and segment positioning address the limitations of current antisense oligonucleotides, enhancing target degradation and safety, thus improving therapeutic efficacy.

BR112025014191A2Pending Publication Date: 2026-07-07AUSPERBIO THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
BR · BR
Patent Type
Applications
Current Assignee / Owner
AUSPERBIO THERAPEUTICS INC
Filing Date
2024-01-10
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Current antisense oligonucleotides have minimal efficacy in reducing target levels and pose safety concerns, necessitating the development of improved target antisense oligonucleotides.

Method used

Modified multisegmented antisense oligonucleotides with strategically positioned gap and separator segments, including nucleoside modifications such as 2'-O-methoxyethyl and 2'-O-methyl, enhance target mRNA degradation and reduce off-target binding, thereby increasing efficacy and safety.

Benefits of technology

The modified multisegmented antisense oligonucleotides demonstrate enhanced activity, increased in vivo potency, reduced toxicity, and a wider safety margin, effectively modulating target mRNA and protein expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided are modified multi-segmented antisense oligonucleotides and methods for decreasing target mRNA, DNA and protein expression. Such methods, oligonucleotides, and compositions are useful to treat, prevent, or ameliorate diseases or disorders.
Need to check novelty before this filing date? Find Prior Art

Description

Modified multisegmented antisense oligonucleotides for use RELATED DEPOSIT REQUESTS

[001] This application claims priority and benefit of PCT application No. PCT / CN2023 / 000034, filed on January 10, 2023, and PCT application No. PCT / CN2023 / 106924, filed on July 12, 2023, the content of each of which is incorporated herein in its entirety. BACKGROUND

[002] Antisense technology is emerging as an effective means of reducing the expression of specific gene products and may therefore prove exceptionally useful in a range of therapies. Antisense therapy differs from nucleoside therapy in that it can directly target transcripts for targets and antigens of interest and therapeutic value. Antisense technology is emerging as an effective means of reducing the expression of certain gene products and may therefore prove exceptionally useful in a range of therapeutic, diagnostic and research applications for the modulation of diseases of interest.

[003] Many of the antisense oligonucleotides (ASOs) in current clinical use and testing have minimal efficacy in reducing target levels and / or have caused safety concerns. Thus, there is a need in the art for improved target antisense oligonucleotides. In the present invention, methods and compositions are provided that address these needs. SUMMARY

[004] The present disclosure provides modified multisegmented antisense oligonucleotide structures that are complementary to a nucleotide sequence in a gene transcript. The modified multisegmented antisense oligonucleotides of the reve Petition 870250074928, dated 08 / 25 / 2025, page 6 / 475 2 / 292 The splicing comprises, from the order 5' to 3', at least one 5' wing segment; a first gap segment (G1); a first separator segment (S1); a second gap segment (G2); and a 3' wing segment (W2), each segment being joined by an internucleoside linkage; and at least one nucleoside of each of W1, W2, and S1 being modified. In some embodiments, the modified multisegmented antisense oligonucleotide may have additional separator segments, flanked by additional gap segments.

[005] This modified multisegmented antisense oligonucleotide contains gap-separated regions in combination with strategically positioned binding enhancers. The target of these modified multisegmented antisense oligonucleotides can be any target, for example, a mammalian target or a viral target.In some respects, modified multisegmented antisense oligonucleotides target HBV, DM1 protein kinase (DMPK), alpha-1 antitrypsin (AAT), transthyretin proprotein convertase subtilisin / kexin type 9 (PCSK9), apolipoprotein B (ApoB), apolipoprotein C-III (ApoCIII), TNF-alpha, SERPINA8 (AGT), complement factor B (CFB), diacylglycerol O-acyltransferase 2 (DGAT2), patatin-like phospholipase domain containing 3 (PNPLA3), 5'-aminolevulinate synthase 1 (ALAS1), or hydroxy acid. oxidase 1.In some embodiments, the modified multisegmented antisense oligonucleotides target Mat1α, (pro)renin receptor / (P)RR, COVID-19 5'UTR, Acc1, Acc2, ACE2, androgen receptor, ApoB, ASGR1, ASO, ATXN2, B1AR, B2AR, C9ORF72, Caspase 2, CD19, CD4, Chikungunya virus, CLPro, complement component 5, COVID-19, COX2, CTGF, DGAT2, DMD, DMPK, DNM2, DUX4, E2 gene. Petition 870250074928, dated 08 / 25 / 2025, page 7 / 475 3 / 292 EGFR, Envelope, EphA2, epithelial sodium channel α subunit, exon 100 dystrophin, exon 103 dystrophin, exon 106 dystrophin, exon 109 dystrophin, exon 112 dystrophin, exon 115 dystrophin, exon 118 dystrophin, exon 121 dystrophin, exon 124 dystrophin, exon 127 dystrophin, exon 130 dystrophin, exon 133 dystrophin, exon 136 dystrophin, exon 139 dystrophin, exon 142 dystrophin, exon 145 dystrophin, exon 148 dystrophin, exon 151 dystrophin, exon 101 dystrophin, exon 104 dystrophin dystrophin of exon 107, dystrophin of exon 110, dystrophin of exon 113, dystrophin of exon 116, dystrophin of exon 119, dystrophin of exon 122, dystrophin of exon 125, dystrophin of exon 128, dystrophin of exon 131, dystrophin of exon 134, dystrophin of exon 137, dystrophin of exon 140, dystrophin of exon 143, dystrophin of exon 146, dystrophin of exon 149, dystrophin of exon 152, dystrophin of exon 102, dystrophin of exon 105, dystrophin of exon 108,dystrophin of exon 111, dystrophin of exon 114, dystrophin of exon 117, dystrophin of exon 120, dystrophin of exon 123, dystrophin of exon 126, dystrophin of exon 129, dystrophin of exon 132, dystrophin of exon 135, dystrophin of exon 138, dystrophin of exon 141, dystrophin of exon 144, dystrophin of exon 147, dystrophin of exon 150, dystrophin of exon 44, dystrophin of exon 53, dystrophin of exon 54, dystrophin of exon 55, dystrophin of exon 56, dystrophin of exon 57, dystrophin of exon 58, dystrophin of exon 59, dystrophin of exon 60, dystrophin of exon 61, dystrophin of exon 62, dystrophin of exon 63, dystrophin of exon 64, dystrophin of exon 65, dystrophin of exon 68, dystrophin of exon 71, dystrophin of exon 74, dystrophin of exon 77, dystrophin of exon 80, dystrophin of exon 83, dystrophin of exon 66, dystrophin of exon 69, dystrophin of exon 72, dystrophin of exon 75, dystrophin of exon 78, dystrophin of exon 81, dystrophin of exon 84, dystrophin of exon 67,dystrophin of exon 70, dystrophin of exon 73, dystrophin of exon 76, dystrophin of exon 79, dystrophin of exon 82, dystrophin of exon 85, dystrophin of, Petition 870250074928, dated 08 / 25 / 2025, page 8 / 475 4 / 292 exon exon exon exon exon 86, exon dystrophin 87, exon 88 dystrophin, dystrophin 89, exon 90 dystrophin, exon 91 dystrophin, exon 91 dystrophin 92, exon 93 dystrophin, exon 94 dystrophin, exon 94 dystrophin 95, exon 96 dystrophin, exon 97 dystrophin, dystrophin 98, exon 99 dystrophin, Fabp3, Factor VII, Factor XI, FAK, FGFR4, FOXP3, FUS, FXII, GFAP, GFP, glycogen synthase, H1N1, HBV, heat shock protein 47, heat shock protein 48, heat shock protein 49, heat shock protein 50, heat shock protein 51, heat shock protein 52, heat shock protein 53, heat shock protein 54, heat shock protein 55, heat shock protein 56, heat shock protein 57, heat shock protein 58, heat shock protein 59, Helicase, HIV, HOXB13, HPRT, HPV, Hsd11β1, HTT, hydroxyacid oxidase 1, hydroxysteroid 17β-dehydrogenase 13, hypoxia-inducible factor 2α, spindle protein kinesin and vascular endothelial growth factor, KRAS, leader, leucine-rich repeat kinase 2 (LRRK2), MERS-CoV, MGMT, miR-16, miR-21, MMP-2, MMP-9, MTLCEBPA, MuRF1, Mycobacterium tuberculosis, COVID-19 N, rabies N 123, rabies N 749, rabies N 903, rabies N1082, rabies N53, rabies N8, Chikungunya virus ns1 gene, Chikungunya virus ns2 gene, Chikungunya virus ns3 gene, Chikungunya virus ns4 gene, ORF1 b, ORF1a,HIV P24, rabies P330, P53, rabies P721, rabies P91, PCSK9, PDGF, PDL1, COVID-19 PLP, PNPLA3, polo-like kinase 1, protein kinase N3, RAF1, RAF-1, RDRP, RSV, SMN2, SNCA, COVID-19 spike protein, STAT3, TAU, TGFB1, TGFB1 and Cox2, TMPRSS2, TMPRSS6, TNFα, transthyretin, VEGF, VEGFR2, VER2, xanthine dehydrogenase, or YAP1. They are useful for the treatment of acute and chronic disease conditions, including, but not limited to, the oligonucleotide target being an oncogenic target, an inflammatory target, a metabolic disease target, a cardiovascular target, a target of Petition 870250074928, dated 08 / 25 / 2025, page 9 / 475 5 / 292 liver disease, an infectious disease target, a neurological disease target, a neuromuscular disease target, an eye disease target, a kidney disease target, a respiratory disease target, a blood disease target, a wound healing target, a transplant target, an autoimmune disease target, a neuropsychiatric target, or similar.

[006] The present disclosure is based, at least in part, on the finding that a discontinuous gap segment flanked between a 5' wing segment and a 3' wing segment, in a modified multisegmented antisense oligonucleotide of the disclosure, provides enhanced activity compared to conventional gapmers (antisense oligonucleotides composed of a central DNA segment flanked by wing segments). One or more gap segments placed directly between two gap segments, thus making the gap segment discontinuous, surprisingly provides enhanced activity of the modified multisegmented antisense oligonucleotide. The inventors unexpectedly found that placing gap segments at specific positions of the multisegmented antisense oligonucleotides of the disclosure provides enhanced activity.Without being limited by theory or mechanisms, one or more separator segments flanked between gap segments provide an advantageous secondary structure for enhanced physicochemical properties (e.g., solubility) and alternative interactions with nucleases (e.g., endonucleases, such as RNase H) when duplexed with a target nucleic acid, thus increasing the ability of the revelation-modified multisegmented antisense oligonucleotides to target and / or degrade the target mRNA.

[007] In addition, specific types of nucleoside modifications in the separator segments provide unspe enhancements Petition 870250074928, dated 08 / 25 / 2025, page 10 / 475 6 / 292 rados in activity. Without being limited by theory or mechanism, the inventors observed that certain nucleoside modifications in the separator segments, including 2'-O-methoxyethyl and 2'-O-methyl modifications, increase the ability of the modified multisegmented antisense oligonucleotides to target and / or degrade the target mRNA.

[008] Without being limited by theory or mechanism, certain combinations of nucleoside modifications and positioning of the separator segment(s) within the modified multisegmented antisense oligonucleotide enhance interactions with the RNase H endonuclease without compromising hybridization with the target sequence.

[009] A substitution of a nucleoside with a sugar-modified nucleoside (e.g., 2'-O-MOE) in conventional gapmers (i.e., those that are not multisegmented) results in increased binding affinity with a target sequence. This type of enhancement has been exploited in conventional gapmer designs to form more stable duplexes with a target sequence, thus enhancing gapmer activity. The stability of the duplexes can be determined by quantifying the melting temperature (Tm). A higher melting temperature is conventionally indicative of enhanced binding with a target sequence and is expected to result in increased nuclease recruitment and functional activity (e.g., silencing of target expression).

[0010] Distinct from current teachings in the art and distinct from conventional gappers that are not multi-segmented, the inventors unexpectedly found that the introduction of certain nucleosides (e.g., 2'-O-MOE) as a separator at certain locations in a continuous sequence of deoxynucleosides unexpectedly reduced Tm, rather than increasing it. More surprisingly, the Petition 870250074928, dated 08 / 25 / 2025, p. 11 / 475 7 / 292 multisegmented antisense oligonucleotides modified with such a reduction in Tm correlated with enhanced biological activities and potency compared to corresponding conventional gapmer designs. Without being limited by theory or mechanism, a certain combination of nucleoside modifications and positioning of the gapper segment(s) within the full-length multisegmented antisense oligonucleotide can result in a change in secondary structure, which, in turn, is advantageous for enhanced interaction with nucleases (e.g., endonucleases such as RNase H) and enhanced functional activity.

[0011] The present disclosure is based, at least in part, on the finding that certain nucleoside modifications at certain positions in the 5' wing segment and / or 3' wing segment decrease in vivo toxicity. The inventors unexpectedly found that certain nucleosides modified at certain positions in the 3' wing segment (e.g., LNA) decreased in vivo toxicity. Without being limited by theory or mechanism, certain combinations of nucleoside modifications and positioning within the 5' wing segment and / or 3' wing segment contribute to the complementarity of the modified multisegmented antisense oligonucleotide, reducing interactions with off-target sequences. The modified multisegmented antisense oligonucleotides described herein have one or more of the following: increased in vivo activity, reduced off-target binding, reduced toxicity, and a wider safety margin, which are advantageous for therapeutic use.

[0012] Methods, modified multisegmented antisense oligonucleotides and compositions for modulating target mRNA and protein expression are provided here.

[0013] Methods, modified multisegmented antisense oligonucleotides and compositions useful for pre are also provided. Petition 870250074928, dated 08 / 25 / 2025, page 12 / 475 8 / 292 to treat and improve diseases, disorders, and afflictions. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figures 1A to 1E show a series of graphs representing the inhibition of PCSK9 mRNA levels in Hepa1-6 cells after treatment with modified multisegmented antisense oligonucleotides of revelation.

[0015] Figures 2A to 2F show a series of graphs representing the inhibition of PCSK9 mRNA levels in Hepa1-6 cells after treatment with modified multisegmented antisense oligonucleotides of revelation.

[0016] Figures 3A to 3E show a series of graphs representing the inhibition of DMPK mRNA levels in Sol8 cells after treatment with modified multisegmented antisense oligonucleotides of revelation.

[0017] Figures 4A to 4F show a series of graphs representing the inhibition of DMPK mRNA levels in Sol8 cells after treatment with modified multisegmented antisense oligonucleotides of revelation.

[0018] Figures 5A to 5D show a series of graphs representing the inhibition of TTR mRNA levels in AML12 cells after treatment with modified multisegmented antisense oligonucleotides of revelation.

[0019] Figures 6A to 6D show a series of graphs representing the inhibition of TTR mRNA levels in AML12 cells after treatment with modified multisegmented antisense oligonucleotides of revelation.

[0020] Figures 7A to 7D show a series of graphs representing the inhibition of AAT mRNA levels in AML12 cells after treatment with modified multisegmented antisense oligonucleotides of revelation. Petition 870250074928, dated 08 / 25 / 2025, page 13 / 475 9 / 292

[0021] Figure 8 shows a graph representing the effect of development-modified multisegmented antisense oligonucleotides on plasma levels of PCSK9 protein.

[0022] Figure 9 shows a graph representing the percentage inhibition of plasma PCSK9 protein levels after treatment with development-modified multisegmented antisense oligonucleotides.

[0023] Figure 10 shows a graph representing the effect of development-modified multisegmented antisense oligonucleotides on plasma TTR protein levels.

[0024] Figure 11 shows a graph representing the percentage inhibition of plasma TTR protein levels after treatment with development-modified multisegmented antisense oligonucleotides.

[0025] Figures 12A to 12B show graphs representing the effect of modified multisegmented antisense oligonucleotides on hepatitis B virus (HBsAg) surface antigen levels in HBV genotype C transgenic mice.

[0026] Figure 13 shows a graph representing the effect of modified multisegmented antisense oligonucleotides on HBsAg levels in pcDNA3.1-preS2-GTD HDI-HBV mice.

[0027] Figure 14 shows a graph representing the effect of modified multisegmented antisense oligonucleotides on HBsAg levels in pcDNA3.1-preS2-GTD HDI-HBV mice.

[0028] Figure 15 shows a graph representing the effect of modified multisegmented antisense oligonucleotides on HBsAg levels in pcDNA3.1-preS2-GTD mice. Petition 870250074928, dated 08 / 25 / 2025, page 14 / 475 10 / 292 HDI-HBV.

[0029] Figures 16A to 16B show a graph representing the effect of modified multisegmented antisense oligonucleotides on HBsAg levels in pcDNA3.1preS2-GTD HDI-HBV mice.

[0030] Figure 17 shows a graph representing the effect of modified multisegmented antisense oligonucleotides on HBsAg levels in pcDNA3.1-preS2-GTD HDI-HBV mice.

[0031] Figure 18 shows a graph representing the effect of modified multisegmented antisense oligonucleotides on HBsAg levels in pAAV-1.2HBV-GTA HDIHBV mice.

[0032] Figure 19 shows a graph representing the effect of modified multisegmented antisense oligonucleotides on HBsAg levels in pcDNA3.1-preS2-GTD HDI-HBV mice.

[0033] Figure 20 shows a pre-molded 20% UREA-TBE gel of RNase H cleavage products. Lane 1: AUS1233, Lane 2: AUS1493, Lane 3: AUS1493, Lane 4: AUS1013, Lane 5: AUS1014, Lane 6: AUS1015, Lane 7: AUS1212, Lane 8: AUS1654, Lane 9: AUS1655, Lane 10: Molecular weight markers

[0034] Figure 21 shows a table of exemplary modified multisegmented antisense oligonucleotides of the revelation and are incorporated into the detailed description in its entirety. The modifications at each position of the modified multisegmented antisense oligonucleotide sequences are read using the legend in Table 2.2. AUS1010 to AUS1714 (SEQ ID NO: 11 to SEQ ID NO: 666) contain examples of the modified multisegmented antisense oligonucleotides of the revelation. Petition 870250074928, dated 08 / 25 / 2025, page 15 / 475 11 / 292

[0035] Figure 22 shows a table of exemplary multisegmented antisense oligonucleotides. In Figure 22, lowercase represents a 2'-deoxynucleoside, and uppercase represents a nucleoside with any of the modifications shown in the section entitled Exemplary Modifications, such as a 2'-O-methoxyethyl nucleoside, 2'-O-methoxyethyl cytidine, 2'O-methyl nucleoside, 2'-O-methyl nucleoside, 2'-OH nucleoside, GNA, LNA, cytosine-based LNA, 2'-fluoro 2'-deoxynucleoside, 2'-fluoro 2'-deoxycytidine, 2'-F-arabinonucleic acid (2'-F-ANA) or 2'-F-arabinonucleic acid (2'-F-ANA) or a combination thereof. In Figure 22, lowercase c represents a 2'-deoxycytidine or 2'-deoxy 5-methylcytidine, and uppercase C represents a cytidine or 5-methylcytidine with or without the sugar modifications described above. (SEQ ID NOs: 5000 to 30983 are exemplary modified multisegmented antisense oligonucleotides.) DETAILED DESCRIPTION

[0036] It should be understood that both the preceding general description and the detailed description below are merely illustrative and explanatory and are not restrictive of the invention as claimed. Herein, the use of the singular includes the plural, unless specifically indicated otherwise. As used herein, the use of or means and / or, unless otherwise indicated. Furthermore, the use of the term including, as well as other forms such as includes and included, is not limiting. In addition, terms such as element or component encompass both elements and components that make up a unit and elements and components that make up more than one subunit, unless specifically indicated otherwise.

[0037] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or parts of documents, cite Petition 870250074928, dated 08 / 25 / 2025, p. 16 / 475 12 / 292 of the documents in this application, including, but not limited to, patents, patent applications, articles, books and treatises, are expressly incorporated herein by way of reference for the parts of the document discussed herein, as well as in their entirety. Definitions

[0038] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK accession numbers and associated sequence information obtained through databases such as the National Center for Biotechnology Information (NCBI) and other data mentioned throughout the disclosure herein are incorporated by reference to the portions of the document discussed herein, as well as in its entirety.

[0039] Unless otherwise indicated, the following terms have the following meanings:

[0040] 2'-O-methoxyethyl (also 2'-MOE and 2'-O(CH2)2-OCH3) refers to an O-methoxyethyl modification at the 2' position of a furanose ring. A sugar modified with 2'-O-methoxyethyl is a modified sugar.

[0041] 2'-MOE nucleoside (also 2'-O-methoxyethyl nucleoside) means a nucleoside comprising a 2'-MOE modified sugar moiety.

[0042] '2'-substituted nucleoside' means a nucleoside comprising a substituent at the 2' position of the furanosyl ring other than H or OH. In certain embodiments, 2'-substituted nucleosides Petition 870250074928, dated 08 / 25 / 2025, p. 17 / 475 13 / 292 include nucleosides with bicyclic sugar modifications.

[0043] 3' target site refers to the region of a target nucleic acid that is complementary to the 3' end of a specific antisense oligonucleotide.

[0044] 5' target site refers to the region of a target nucleic acid that is complementary to the 5' end of a specific antisense oligonucleotide.

[0045] 5-methylcytosine means a cytosine modified with a methyl group attached at position 5. 5-methylcytosine is a modified nucleobase.

[0046] Approximately means within ±7% of a value. For example, if it is stated that oligonucleotides affected at least about 70% of the target inhibition, it is implied that target levels are inhibited within a range of 63% and 77%.

[0047] An acceptable safety profile means a pattern of side effects that is within clinically acceptable limits.

[0048] Active pharmaceutical ingredient means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual.

[0049] Active target region means a target region to which one or more active antisense oligonucleotides are targeted. Active antisense oligonucleotides means antisense oligonucleotides that reduce target nucleic acid levels or protein levels.

[0050] Concomitantly administered refers to the co-administration of two agents in any manner in which the pharmacological effects of both manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest at the same time. Petition 870250074928, dated 08 / 25 / 2025, page 18 / 475 14 / 292 effects only need to overlap over a period of time and do not need to be coextensive.

[0051] Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, primates and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0052] Antibody refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. The antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, the Fab region, and the Fc region.

[0053] Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense oligonucleotide to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by that target nucleic acid.

[0054] Antisense oligonucleotide or ASO means an oligomeric oligonucleotide that is capable of undergoing hybridization with a target nucleic acid through hydrogen bonding. Examples of antisense oligonucleotides include single-stranded oligonucleotides with a nucleobase sequence that allows hybridization with a corresponding region or segment of a target nucleic acid.

[0055] Antisense inhibition means a reduction in the levels of a target nucleic acid in the presence of an antisense oligonucleotide complementary to a target nucleic acid compared with the levels of the target nucleic acid in the absence of the antisense oligonucleotide.

[0056] Antisense mechanisms are all those mechanisms that involve the hybridization of an oligonucleotide with a target nucleic acid, where the result or effect of the hybridization is degradation. Petition 870250074928, dated 08 / 25 / 2025, page 19 / 475 15 / 292 of the target or occupation of the target with concomitant paralysis of cellular machinery involving, for example, transcription or splicing.

[0057] The area under the curve or AUC is the integral of the concentration of a drug in blood plasma as a function of time. The AUC can be determined for the entire time for which data are available, for example, until the drug is no longer detectable (AUCo-t), the area under the curve from time 0 extrapolated to infinity (AUCo-¥), or for a particular truncated time window, for example, 24 hours after administration (AUC0-24).

[0058] Base complementarity refers to the ability for precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization) and is mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between corresponding nucleobases.

[0059] Bicyclic sugar means a furanose ring modified by the bridging of two non-geminal carbon atoms. A bicyclic sugar is a modified sugar.

[0060] Body weight refers to the total body weight of an animal, including all tissues, including adipose tissue.

[0061] Cap structure or terminal cap portion means chemical modifications that have been incorporated into any terminal of an antisense compound.

[0062] cEt or restricted ethyl means a bicyclic sugar moiety comprising a bridge connecting carbon 4' and carbon 2', the bridge having the formula: 4'-CH(CH3)-O-2'.

[0063] Restricted ethyl nucleoside (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-O-2' bridge.

[0064] Chemically distinct region refers to a region of Petition 870250074928, dated 08 / 25 / 2025, page 20 / 475 16 / 292 an antisense compound that is somehow chemically different from another region of the same antisense compound. For example, a region with 2'-O-methoxyethyl nucleotides is chemically distinct from a region with unmodified 2'-O-methoxyethyl nucleotides.

[0065] Co-administration means the administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered via the same or different routes of administration. Co-administration encompasses administration in parallel or sequentially.

[0066] Complementarity means the ability of nucleobases of a first nucleic acid to pair with a second nucleic acid.

[0067] Diluent means an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, for example, saline solution.

[0068] Dosage unit means a form in which a pharmaceutical agent is supplied, for example, pill, tablet or other dosage unit known in the art.

[0069] Dose means a specified amount of a pharmaceutical agent delivered in a single administration, or over a specified period of time. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain mo Petition 870250074928, dated 08 / 25 / 2025, page 21 / 475 17 / 292 Dosages: A dose may be administered in two or more injections to minimize injection site reaction in an individual. In other modalities, the pharmaceutical agent is administered by infusion over a prolonged period of time or continuously. Doses may be indicated as the amount of pharmaceutical agent per hour, day, week, or month.

[0070] Dosage regimen is a combination of doses designed to achieve one or more desired effects.

[0071] Duration means the period of time during which an activity or event continues. In certain modalities, the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.

[0072] Effective amount in the context of modulating an activity or treating or preventing a condition means administering that amount of active ingredient to an individual in need of such modulation, treatment or prophylaxis, whether in a single dose or as part of a series, which is effective for modulating that effect, or for treating or prophylaxis or improving that condition. The effective amount will vary depending on the health and physical condition of the individual to be treated, the taxonomic group of subjects to be treated, the formulation of the composition, the assessment of the medical situation and other relevant factors.

[0073] Effectiveness means the ability to produce a desired effect.

[0074] Expression includes all the functions by which the encoded information of a gene is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

[0075] The term fragment, as applied to a polynucleotide, will be understood to mean a sequence of nucleotides. Petition 870250074928, dated 08 / 25 / 2025, page 22 / 475 18 / 292 of reduced length relative to a reference nucleic acid or nucleotide sequence and comprising, essentially consisting of and / or comprising a sequence of contiguous nucleotides identical or nearly identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98% or 99% identical) to the reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment according to the invention may, where appropriate, be included in a larger polynucleotide of which it is a constituent. In some embodiments, such fragments may comprise, consist essentially of, and / or consist of oligonucleotides with a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more consecutive nucleotides of a nucleic acid or oligonucleotide structures according to the invention.

[0076] Fully complementary or 100% complementary means that each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense oligonucleotide and a target nucleic acid is a second nucleic acid.

[0077] A totally modified motif refers to an antisense oligonucleotide comprising a contiguous sequence of nucleosides wherein essentially each nucleoside is a uniformly modified sugar-modified nucleoside.

[0078] Gapmer means an antisense oligonucleotide in which an internal region with a continuous sequence of linked deoxynucleosides supporting nuclease recruitment (e.g., an RNase, e.g., RNase H) is positioned between external regions with one or more nucleosides, wherein the nucleosides comprising the internal region may be chemically distinct from the nucleoside or nucleosides comprising the external regions. The region Petition 870250074928, dated 08 / 25 / 2025, page 23 / 475 The inner 19 / 292 can be called the gap, and each of the outer 5' and 3' regions can be called a wing.

[0079] A gap is an internal segment of a modified multisegmented antisense oligonucleotide or a gapmer comprising one or more linked deoxynucleosides and positioned directly or indirectly between a 5' (W1) wing and a 3' (W2) wing. A gap may be interchangeably referred to as a gap, a gap region, or a gap segment.

[0080] Hybridization means the annealing of complementary nucleic acid molecules. In certain embodiments, the complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target. In certain embodiments, the complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.

[0081] Immediately adjacent means that there are no intervening elements between the immediately adjacent elements.

[0082] Individual means a human or non-human animal selected for treatment or therapy.

[0083] Individual compliance means adherence to a therapy recommended or prescribed by an individual.

[0084] To induce, inhibit, potentiate, raise, increase, decrease, or similar terms generally denote quantitative differences between two states. Such terms may refer to a statistically significant difference between the two states. Such terms are applied to, for example, levels of expression and levels of activity. The term to inhibit or reduce, or grammatical variations thereof, as used herein, refers to a decrease or reduction in the specified level or activity of at least about 5%, about 10%, about 15%, about 25%, about 35%, about 40%, about 50%, approximately 50%. Petition 870250074928, dated 08 / 25 / 2025, p. 24 / 475 20 / 292 approximately 60%, approximately 75%, approximately 80%, approximately 90%, approximately 95% or more. In some modalities, the inhibition or reduction results in little or essentially no detectable activity (at most, an insignificant amount, for example, less than approximately 10% or even 5%).

[0085] Inhibiting expression or activity refers to a reduction, blocking of expression or activity and does not necessarily indicate a total elimination of expression or activity.

[0086] Injection site reaction means abnormal inflammation or redness of the skin at an injection site in an individual.

[0087] Intraperitoneal administration means administration by infusion or injection into the peritoneum.

[0088] Intravenous administration means administration into a vein.

[0089] Elongated antisense oligonucleotides are those that have one or more Formula 1 additional nucleosides relative to an antisense oligonucleotide disclosed herein.

[0090] Blocked nucleic acid or LNA or nucleosides. LNA means nucleic acid monomers with a bridge connecting two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thus forming a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to, A) α-L-Methyleneoxy(4'-CH2-O-2') LNA; (B) β-D-Methyleneoxy(4'-CH2-O-2')-LNA; (C) Ethylenexy(4'-(CH2)2-O-2') LNA; (D) Aminooxy(4'-CH2-O-NI-2') LNA; and (E) Oxamino(4'-CH2-NI-O-2') LNA; as described below. Petition 870250074928, dated 08 / 25 / 2025, page 25 / 475 21 / 292

[0091] As used herein, LNA oligonucleotides include, but are not limited to, oligonucleotides with at least one bridge between the 4' and 2' positions of the sugar, each bridge independently comprising 1 or 2 to 4 independently linked groups selected from -[C(R1)(R2)]n-, -C(R1)=C(R2)-, C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O)x- and N(R1)-; wherein: x is 0, 1 or 2; n is 1, 2, 3 or 4; each R1e R2é, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, a heterocyclic radical, a substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJIJ2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1);and each J1e J2é, independently, H, C1-C12 alkyl, substituted C1C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocyclic radical, a substituted heterocyclic radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.;

[0092] Examples of 4'-2' bridge groups encompassed in the LNA definition include, but are not limited to, one of the following formulas: --[C(R1)(R2)]n-, -[C(R1)(R2)]nO-, -C(R1)(R2)-N(R1)-O- or -C(R1)(R2)-ON(R1)-. Furthermore, other bridging groups encompassed by the LNA definition are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2O-N(R1)-2' and 4'-CH2-N(R1)-O-2'- bridging groups, where each R1 and R2 is independently H, a protecting group or C1-C12 alkyl.

[0093] Also included in the definition of LNA according to the invention are LNAs wherein the 2'-hydroxyl group of the ribosyl sugar ring is attached to the carbon atom 4' of the sugar ring, for Petition 870250074928, dated 08 / 25 / 2025, page 26 / 475 22 / 292 thus forming a methylene oxy (4-CH2-O-2') bridge to form the bicyclic sugar moiety. The bridge may also be a methylene group (CH2-) connecting the oxygen atom 2' and the carbon atom 4', for which the term methylene-oxy (4'-CH2-O-2') LNA is used. Furthermore, in the case of the bicyclic sugar moiety with an ethylene linking group in this position, the term ethylene oxy (4-CH2CH2-O-2') LNA is used. Α-L-methylene-oxy (4'-CH2-O-2'), an isomer of methylene-oxy (4-CH2-O2') LNA, is also encompassed within the definition of LNA, as used herein.

[0094] A maximum plasma concentration in the blood or Cmax refers to the highest concentration of a drug in the blood plasma after the drug dose is administered to an individual. Methods of measuring drug concentration will be known to those skilled in the art and include, among others, liquid chromatography and tandem mass spectrometry.

[0095] Incompatibility or non-complementary nucleobase refers to the case where a nucleobase of a first nucleic acid is unable to pair with the corresponding nucleobase of a second nucleic acid or target nucleic acid.

[0096] Modified internucleoside bond refers to a substitution or any alteration of a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond).

[0097] Modified nucleobase means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An unmodified nucleobase means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0098] Modified nucleoside means a nucleoside having independently a modified sugar moiety and / or a modified nucleobase. Petition 870250074928, dated 08 / 25 / 2025, page 27 / 475 23 / 292

[0099] Modified nucleotide means a nucleotide with, independently, a modified sugar moiety, a modified internucleoside bond, or a modified nucleobase.

[00100] Modified oligonucleotide means an oligonucleotide comprising at least one modified internucleosidic bond, a modified sugar and / or a modified nucleobase.

[00101] Modified sugar means the replacement and / or any alteration of a portion of natural sugar.

[00102] Monomer refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether natural or modified.

[00103] Motif means the pattern of unmodified and modified nucleosides in an antisense oligonucleotide. Natural sugar moiety means a sugar moiety found in DNA (2'H) or RNA (2'-OH). Natural internucleoside linkage means a 3' to 5' phosphodiester bond.

[00104] A modified multisegmented antisense oligonucleotide means an antisense oligonucleotide with at least five structural segments, comprising a 5' wing (W1), a 3' wing (W2), at least two gaps (at least G1 and G2), and at least one separator (at least one S1). The separator is flanked by two gap regions. The wings are at the terminal ends of the modified multisegmented antisense oligonucleotide. From 5' to 3', an exemplary modified multisegmented antisense oligonucleotide has the formula of Formula I or Formula II. A developing modified multisegmented antisense oligonucleotide further comprises at least one modified nucleoside in the 5' wing, at least one nucleoside modification in the separator, and at least one modified nucleoside in the 3' wing. A modified multisegmented antisense oligonucleotide may be alternatively referred to as a Petition 870250074928, dated 08 / 25 / 2025, page 28 / 475 24 / 292 modified multisegmented antisense oligonucleotide or multisegmented oligonucleotide.

[00105] Non-complementary nucleobase refers to a pair of nucleobases that do not form hydrogen bonds with each other or that do not support hybridization.

[00106] Nucleic acid refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).

[00107] Nucleobase means a portion of a nitrogenous heterocyclic base capable of pairing with a base of another nucleic acid.

[00108] Nucleobase complementarity refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense oligonucleotide that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a given position of an antisense oligonucleotide is capable of hydrogen bonding with a nucleobase at a given position of a target nucleic acid, then the position of the hydrogen bond between the oligonucleotide and the target nucleic acid is considered complementary at that nucleobase pair.

[00109] Nucleobase sequence means the order of contiguous nucleobases, independent of any sugar, bonding and / or nucleobase modification.

[00110] Nucleoside mimetic includes those structures used to replace sugar or sugar and base and not necessarily the Petition 870250074928, dated 08 / 25 / 2025, p. 29 / 475 25 / 292 linkage at one or more positions of an oligomeric compound, such as, for example, nucleoside mimetics having morpholino, cyclohexenyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, for example, non-furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and linkage at one or more positions of an oligomeric compound, such as, for example, peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=O)-O- or other non-phosphodiester linkage). The term sugar substitute overlaps with the somewhat broader term nucleoside mimetic, but is intended to indicate only the substitution of the sugar unit (furanose ring). The tetrahydropyranyl rings provided here are illustrative of an example of a sugar substitute wherein the furanose sugar group has been replaced by a tetrahydropyranyl ring system.Mimetic refers to groups that replace a sugar, a nucleobase, and / or an internucleoside bond. Generally, a mimetic is used in place of the sugar or sugar-internucleoside bond combination, and the nucleobase is retained for hybridization with a selected target.

[00111] Off-target effect refers to an undesirable or deleterious biological effect associated with the modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[00112] Oligomeric compound means a polymer of linked monomeric subunits that is capable of hybridizing with at least one region of a nucleic acid molecule.

[00113] Oligonucleotide means a polymer of nucleosides linked together by internucleosidic bonds, each of the linked nucleosides may be modified or unmodified, independently of each other.

[00114] Parenteral administration means administration by means of injection (e.g., bolus injection) or infusion. The administration Petition 870250074928, dated 08 / 25 / 2025, page 30 / 475 26 / 292 Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration or intracranial administration, for example, intrathecal or intracerebroventricular administration.

[00115] Peptide means a molecule formed by the linkage of at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins.

[00116] Pharmaceutically acceptable carrier means a medium or diluent that does not interfere with the oligonucleotide structure. Certain such carriers allow pharmaceutical compositions to be formulated as, for example, tablets, pills, coated tablets, capsules, liquids, gels, syrups, suspensions and lozenges for oral ingestion by an individual.

[00117] Pharmaceutically acceptable derivative includes pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the oligonucleotides described herein.

[00118] Pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of antisense oligonucleotides, that is, salts that retain the desired biological activity of the original oligonucleotide and do not impart undesirable toxicological effects to it.

[00119] Pharmaceutical agent means a substance that provides a therapeutic benefit when administered to an individual.

[00120] Pharmaceutical composition means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in the free uptake assay in certain cell lines.

[00121] Phosphorothioate linkage means a linkage between nucleosides Petition 870250074928, dated 08 / 25 / 2025, page 31 / 475 27 / 292 where the phosphodiester bond is modified by replacing one of the non-bonding oxygen atoms with a sulfur atom. A phosphorothioate bond is a modified internucleoside bond.

[00122] Prevention or to prevent refers to delaying or stopping the onset or development of a condition or disease for a period of time ranging from hours to days, preferably weeks to months.

[00123] Prodrug means a therapeutic agent that is prepared in an inactive form that is converted into an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions.

[00124] Prophylactically effective quantity refers to an amount of a pharmaceutical agent that provides a prophylactic or preventive benefit to an animal.

[00125] Recommended therapy means a therapeutic regimen recommended by a medical professional for the treatment, improvement or prevention of a disease.

[00126] Ribonucleotide means a nucleotide that has a hydroxyl group at the 2' position of the sugar portion of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents.

[00127] Salts means physiologically and pharmaceutically acceptable salts of antisense oligonucleotides, that is, salts that retain the desired biological activity of the original oligonucleotide and do not impart undesirable toxicological effects to it.

[00128] Segments can be interchangeably referred to as regions or portions.

[00129] A separator in the modified multisegmented antisense oligonucleotides of the development is positioned directly in the middle and separates two gap regions and is positioned between two gap regions in a multisegmented antisense oligonucleotide. Petition 870250074928, dated 08 / 25 / 2025, page 32 / 475 28 / 292 modified. The separator may have one or more nucleosides, the nucleosides being chemically distinct from the nucleosides comprising the gap. A separator segment comprises nucleosides modified to confer properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, reduced in vivo toxicity, or resistance to degradation by nucleases in vivo. A modified multisegmented antisense oligonucleotide may comprise one or more separator segments. Exemplary modified multisegmented antisense oligonucleotides may comprise one, two, three, four, five, or six separator segments. In some embodiments, the modified multisegmented antisense oligonucleotides comprise one separator segment. In some embodiments, the modified multisegmented antisense oligonucleotides comprise two separator segments.

[00130] Shortened or truncated versions of antisense oligonucleotides taught here have one, two, or more nucleosides deleted.

[00131] Side effects means physiological responses attributable to a treatment other than the desired effects. In certain modalities, side effects include, but are not limited to, injection site reactions, abnormal liver function tests, abnormal kidney function, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies. For example, increased serum aminotransferase levels may indicate liver toxicity or abnormal liver function. For example, increased bilirubin may indicate liver toxicity or abnormal liver function.

[00132] Significant, as used herein, means measurable or observable, for example, a significant result, such as a me Petition 870250074928, dated 08 / 25 / 2025, page 33 / 475 29 / 292 Significant improvement or significant reduction generally refers to a measurable or observable result, such as a measurable or observable improvement or reduction.

[00133] Sites, as used here, are defined as unique nucleobase positions within a target nucleic acid.

[00134] Specifically hybridizable refers to an antisense oligonucleotide with a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effect on non-target nucleic acids under conditions where specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments. Strict hybridization conditions or strict conditions refer to conditions under which an oligomeric oligonucleotide will hybridize with its target sequence, but with a minimum number of other sequences.

[00135] Target nucleic acid, target RNA, target RNA transcript and target nucleic acid mean a nucleic acid capable of being targeted by antisense oligonucleotides.

[00136] Target region means a portion of a target nucleic acid to which one or more antisense oligonucleotides are directed.

[00137] Target segment means the nucleotide sequence of a target nucleic acid to which an antisense oligonucleotide is directed.

[00138] Therapeutically effective quantity means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

[00139] Treatment refers to the administration of a composition to effect a change or improvement of the disease or condition.

[00140] Unmodified nucleobases mean the bases of pu Petition 870250074928, dated 08 / 25 / 2025, page 34 / 475 30 / 292 adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

[00141] Unmodified nucleotide means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleosidic linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e., (3-D-ribonucleosides)) or a DNA nucleotide (i.e., (3-D-deoxyribonucleoside).

[00142] A validated target segment is defined as at least an 8-nucleobase portion (i.e., 8 consecutive nucleobases) of a target region to which an active oligomeric oligonucleotide is directed.

[00143] A wing is a terminal segment of a gapmer or a modified multisegmented antisense oligonucleotide, modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, enhanced biological activity, increased binding affinity for a target nucleic acid, reduced in vivo toxicity, or resistance to degradation by nucleases in vivo. A wing may be referred to as a wing, a wing region, or a wing segment. As used herein, a wing comprises at least two linked nucleosides; a subset of which may comprise one or more deoxynucleosides, but the entire wing cannot be composed solely of deoxynucleosides. In some forms, the wing comprises 2 to 8 linked nucleosides.In some forms, the wing comprises 2 to 6 linked nucleosides.

[00144] The modified multisegmented antisense oligonucleotides of the revelation comprise a 5' wing segment (W1) located at the 5' terminus of the modified multisegmented antisense oligonucleotide and the residue at the 3' end of W1 is not a deoxynucleoside. The modified multisegmented antisense oligonucleotides of the revelation also comprise a wing segment Petition 870250074928, dated 08 / 25 / 2025, page 35 / 475 31 / 292 3'(W2) located at the 3' end of the modified multisegmented antisense oligonucleotide and the 5' end residue of W2 is not a deoxynucleoside.

[00145] A 5' wing (W1) starts at the 5' end of the modified multisegmented antisense oligonucleotide, extends in the 5' to 3' direction and is directly linked to a first-gap deoxynucleoside, thus indicating the 3' end of W1 and the 5' end of a first-gap (G1).

[00146] A 3' wing (W2) starts at the 3' end of the modified multisegmented antisense oligonucleotide, extends in the 3' to 5' direction and is directly linked to a gap-gap deoxynucleoside, thus indicating the 3' end of the last gap and the 5' end of W2. Examples of modified multisegmented antisense oligonucleotides

[00147] The disclosure provides at least the following exemplary modified multisegmented antisense oligonucleotides. Modified multisegmental antisense oligonucleotides are envisioned as complementary to a gene transcript, wherein, in some embodiments, the gene may be one or more of the following: HBV, DM1 protein kinase (DMPK), alpha-1 antitrypsin (AAT), transthyretin (TTR) proprotein convertase subtilisin / kexin type 9 (PCSK9), apolipoprotein B (ApoB), apolipoprotein C-III (ApoCIII), TNF-alpha, SERPINA8 (AGT), complement factor B (CFB), diacylglycerol O-acyltransferase 2 (DGAT2), patatin-like phospholipase domain containing 3 (PNPLA3), 5'-aminolevulinate synthase 1 (ALAS1), or hydroxyacid oxidase 1.

[00148] In some embodiments, the modified multisegmented antisense oligonucleotides of the revelation may be complementary to the transcript of a gene, wherein the gene is one or more of Petition 870250074928, dated 08 / 25 / 2025, p. 36 / 475 32 / 292 Matla, (pro)renin receptor / (P)RR, COVID-19 5'UTR, Acc1, Acc2, ACE2, androgen receptor, ApoB, ASGR1, ASO, ATXN2, B1AR, B2AR, C9ORF72, Caspase 2, CD19, CD4, Chikungunya virus, CLPro, complement component 5, COVID-19, COX2, CTGF, DGAT2, DMD, DMPK, DNM2, DUX4, E2 gene, EGFR, Envelope, EphA2, epithelial sodium channel α subunit, exon 100 dystrophin, exon 101 dystrophin, exon 102 dystrophin, exon 103 dystrophin, exon 104 dystrophin, exon 105 dystrophin, exon 106 dystrophin 107, exon 108 dystrophin, exon 109 dystrophin, exon 110 dystrophin, exon 111 dystrophin, exon 112 dystrophin, exon 113 dystrophin, exon 114 dystrophin, exon 115 dystrophin, exon 116 dystrophin, exon 117 dystrophin, exon 118 dystrophin, exon 119 dystrophin, exon 120 dystrophin, exon 121 dystrophin, exon 122 dystrophin, exon 123 dystrophin, exon 124 dystrophin, exon 125 dystrophin, exon 126 dystrophindystrophin of exon 127, dystrophin of exon 128, dystrophin of exon 129, dystrophin of exon 130, dystrophin of exon 131, dystrophin of exon 132, dystrophin of exon 133, dystrophin of exon 134, dystrophin of exon 135, dystrophin of exon 136, dystrophin of exon 137, dystrophin of exon 138, dystrophin of exon 139, dystrophin of exon 140, dystrophin of exon 141, dystrophin of exon 142, dystrophin of exon 143, dystrophin of exon 144, dystrophin of exon 145, dystrophin of exon 146, dystrophin of exon 147, dystrophin of exon 148, dystrophin of exon 149, exon 150 dystrophin, exon 151 dystrophin, exon 152 dystrophin, exon 44 dystrophin, exon 53 dystrophin, exon 54 dystrophin, exon 57 dystrophin, exon 60 dystrophin, exon 63 dystrophin, exon 66 dystrophin, exon 69 dystrophin, exon 55 dystrophin, exon 58 dystrophin, exon 61 dystrophin, exon 64 dystrophin, exon 67 dystrophin, exon 70 dystrophin, exon 56 dystrophin, exon 59 dystrophindystrophin of exon 62, dystrophin of exon 65, dystrophin of exon 68, dystrophin of exon 71, dystrophin of, Petition 870250074928, dated 08 / 25 / 2025, page 37 / 475 33 / 292 exon 72, exon 75, exon 78, exon 81, exon 84, exon 87, exon 90, exon 93, exon 96, exon 73 dystrophin, exon 74 dystrophin, dystrophined exon 76 dystrophin, exon 77 dystrophin, dystrophined exon 79 dystrophin, exon 80 dystrophin, dystrophined exon 82 dystrophin, exon 83 dystrophin, dystrophined exon 85 dystrophin, exon 86 dystrophin, dystrophined exon 88 dystrophin, exon 89 dystrophin, dystrophined exon 91 dystrophin, exon 92 dystrophin, dystrophined exon 94 dystrophin 95, exon 97 dystrophin, exon 98 dystrophin, exon 99 dystrophin, Fabp3, Factor VII, Factor XI, FAK, FGFR4, FOXP3, FUS, FXII, GFAP, GFP, glycogen synthase, H1N1, HBV, heat shock protein 47, heat shock protein 48, heat shock protein 49, heat shock protein 50, heat shock protein 51, heat shock protein 52, heat shock protein 53, heat shock protein 54,Heat shock protein 55, heat shock protein 56, heat shock protein 57, heat shock protein 58, heat shock protein 59, Helicase, HIV, HOXB13, HPRT, HPV, Hsd11β1, HTT, hydroxyacid oxidase 1, hydroxysteroid 17β-dehydrogenase 13, hypoxia-inducible factor 2α, spindle protein kinesin and vascular endothelial growth factor, KRAS, leader, leucine-rich repeat kinase 2 (LRRK2), MERS-CoV, MGMT, miR-16, miR-21, MMP-2, MMP-9, MTL-CEBPA, MuRF1, Mycobacterium tuberculosis, COVID-19 N, rabies N 123, rabies N 749, rabies N 903, rabies N1082, rabies N53, rabies N8, gene Chikungunya virus ns1 gene, Chikungunya virus ns2 gene, Chikungunya virus ns3 gene, Chikungunya virus ns4 gene, ORF1b, ORF1a, HIV P24, rabies P330, P53, rabies P721, rabies P91, PCSK9, PDGF, PDL1, COVID-19 PLP, PNPLA3, polo-like kinase 1, protein kinase N3, RAF1, RAF-1, RDRP, RSV, SMN2, SNCA, COVID-19 spike protein, STAT3, TAU, TGFB1, TGFB1 and Cox2, TMPRSS2, TMPRSS6, TNFα,transthyretin, Petition 870250074928, dated 08 / 25 / 2025, page 38 / 475 34 / 292 VEGF, VEGFR2, VER2, xanthine dehydrogenase, and YAP1.

[00149] In some embodiments, therefore, the modified multisegmented antisense oligonucleotides provided here have one or more of the ability to inhibit the expression of target genes, have greater biological activity, have low off-target binding and low toxicity, and a wider safety margin, which may be advantageous for therapeutic use. Furthermore, in some embodiments, the modified multisegmented antisense oligonucleotides of the development have greater inhibition of target genes compared to a conventional gapmer (which is not multisegmented) with the same template sequence.

[00150] Consequently, in one aspect, the revelation provides a modified multisegmented antisense oligonucleotide comprising 5' to 3': 5' W1 - G1 - S1 - G2 - W2 3' (Formula 1) where: W1 is a 5' wing segment; W2 is a 3' wing segment; G1 is a first gap segment; S1 is a first separator segment; G2 is a second gap segment; - is an internucleoside bond; and at least one nucleoside from each of W1, W2, and S1 is modified.

[00151] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 2-8 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1-2 nucleosides, G2 comprises 2-7 linked deoxynucleosides and W2 comprises 2-8 linked nucleosides.

[00152] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 2-8 Petition 870250074928, dated 08 / 25 / 2025, page 39 / 475 35 / 292 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 nucleoside, G2 comprises 2-7 linked deoxynucleosides, and W2 comprises 2-8 linked nucleosides.

[00153] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 2-8 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 2 nucleosides, G2 comprises 2-7 linked deoxynucleosides and W2 comprises 2-8 linked nucleosides.

[00154] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 2-6 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 nucleoside, G2 comprises 2-7 linked deoxynucleosides and W2 comprises 2-6 linked nucleosides.

[00155] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 2-8 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 nucleoside, G2 comprises 2-7 linked deoxynucleosides and W2 comprises 2-8 linked nucleosides.

[00156] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 4-6 linked nucleosides, G1 comprises 1-6 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 1-6 linked deoxynucleosides and W2 comprises 4-6 linked nucleosides.

[00157] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 4-6 linked nucleosides, G1 comprises 5 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 5 linked deoxynucleosides and W2 comprises 4-6 linked nucleosides.

[00158] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 4 nu Petition 870250074928, dated 08 / 25 / 2025, page 40 / 475 36 / 292 linked cleosides, G1 comprises 5 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 5 linked deoxynucleosides and W2 comprises 5 linked nucleosides.

[00159] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and W1 comprises 5 linked nucleosides, G1 comprises 4 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 5 linked deoxynucleosides and W2 comprises 5 linked nucleosides.

[00160] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I, and the W1-G1-S1G2-W2 motif is 2-4-1-5-2, 3-4-1-4-2, 3-4-1-5-3, 3-4-1-5-4, 3-4-1-5-8, 3-5-1-42, 3-5-1-5-2, 3-5-1-5-3, 3-6-1-5-5, 3-6-1-6-4, 4-4-1-5-3, 4-4-1-5-4, 4-51-4-13, 4-5-1-4-6, 4-5-1-5-1, 4-5-1-5-10, 4-5-1-5-11, 4-5-1-5-13, 4-5-15-3, 4-5-1-5-4, 4-5-1-5-5, 4-5-1-5-6, 4-5-1-5-7, 4-5-1-5-8, 4-5-1-5-9, 4-5-1-6-4, 4-6-1-4-5, 5-1-1-8-5, 5-2-1-7-5, 5-3-1-6-5, 5-4-1-4-6, 5-4-1-5-25, 5-4-1-5-4, 5-4-1-5-5, 5-4-1-6-4, 5-4-1-7-3, 5-4-1-8-2, 5-4-2-4-5, 5-5-2-5-5 5-5-2-6-5, 5-6-2-6-5, 5-5-1-4-25, 5-5-1-4-5, 5-6-1-3-5, 5-7-1-2-5, 5-8-1-1-5, 6-3-1-3-7, 6-3-1-4-6, 6-4-1-4-5 or 6-7-1-1-5, with each number representing the number of nucleosides. That is, for example, a modified multisegmented antisense oligonucleotide of Formula I (W1-G1-S1-G2-W2) which is 2-4-1-5-2 has 2 nucleosides in W1; 4 nucleosides in G1; 1 nucleoside in S1; 5 nucleosides in G2; and 2 nucleosides in W2.

[00161] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and the W1-G1-S1-G2-W2 motif is 4-5-1-5-5. In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and the W1G1-S1-G2-W2 motif is 5-4-1-5-5. In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and the W1-G1-S1-G2-W2 motif is 5-5-1-5-5. In some embodiments, the oligo Petition 870250074928, dated 08 / 25 / 2025, page 41 / 475 37 / 292 modified multisegmented antisense nucleotide is of Formula I and the W1-G1-S1-G2-W2 motif is 5-5-1-4-5. In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I and the W1-G1-S1-G2-W2 motif is 6-5-1-5-5.

[00162] In some embodiments, the modified multisegmented antisense oligonucleotide comprises 5' to 3': 5' W1 - G1 - S1 - G2 - S2 - G3 - W2 3' (Formula II) where: S2 is a second separator segment; G3 is a first gap segment; - is an internucleoside bond; and at least one nucleoside of each of W1, S1, S2, and W2 is a modified nucleoside.

[00163] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II and W1 comprises 2-8 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 1-2 linked deoxynucleosides, S2 comprises 1 linked nucleoside, G3 comprises 2-7 linked deoxynucleosides and W2 comprises 2-8 linked nucleosides.

[00164] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II and W1 comprises 2-8 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 1 linked deoxynucleoside, S2 comprises 1 linked nucleoside, G3 comprises 2-7 linked deoxynucleosides and W2 comprises 2-8 linked nucleosides.

[00165] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II and W1 comprises 2-8 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides Petition 870250074928, dated 08 / 25 / 2025, page 42 / 475 38 / 292 of the molecules, S1 comprises 1 linked nucleoside, G2 comprises 2 linked deoxynucleosides, S2 comprises 1 linked nucleoside, G3 comprises 2-7 linked deoxynucleosides, and W2 comprises 2-8 linked nucleosides.

[00166] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II and W1 comprises 2-6 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 1-2 linked deoxynucleosides, S2 comprises 1 linked nucleoside, G3 comprises 2-7 linked deoxynucleosides and W2 comprises 2-6 linked nucleosides.

[00167] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II and W1 comprises 2-6 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 1 linked deoxynucleoside, S2 comprises 1 linked nucleoside, G3 comprises 2-7 linked deoxynucleosides and W2 comprises 2-6 linked nucleosides.

[00168] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II and W1 comprises 2-6 linked nucleosides, G1 comprises 2-7 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 2 linked deoxynucleosides, S2 comprises 1 linked nucleoside, G3 comprises 2-7 linked deoxynucleosides and W2 comprises 2-6 linked nucleosides.

[00169] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I, and the W1-G1-S1G2-S2-G3-W2 motif is 5-1-1-3-1-3-6, 5-1-1-3-1-4-5, 5-1-1-6-1-1-5, 5-2-1-2-1-2-7, 5-2-1-2-1-4-5, 5-2-1-4-1-2-5, 5-3-1-1-1-4-5, 5-3-1-2-1-3-5, 5-3-1-4-1-1-5, 5-4-1-1-1-3-5, 5-4-1-2-1-1-6, 5-4-1-2-1-2-5, 5-4-1-3-1-1-5, 6-3-1 Petition 870250074928, dated 08 / 25 / 2025, page 43 / 475 39 / 292 1-1-1-7, 6-3-1-3-1-1-5, 6-4-1-1-1-2-5 or 7-2-1-2-1-2-5. That is, for example, a modified multisegmented antisense oligonucleotide of Formula II (W1-G1-S1-G2-S2-G3-W2) which is 5-1-1-3-1-3-6 has 5 nucleosides in W1; 1 nucleoside in G1; 1 nucleoside in S1; 3 nucleosides in G2; 1 nucleoside in S1; 3 nucleosides in G2; 1 nucleoside in S2; 3 nucleosides in G3; and 2 nucleosides in W2.

[00170] In some embodiments, the modified multisegmented antisense oligonucleotide comprises 5' to 3': 5' W1 - G1 - S1 - G2 - S2 - G3 - S3 - G4 - W2 3' (Formula III) where: S3 is a third separator segment; G4 is a fourth gap segment; and - is an internucleoside bond; and at least one nucleoside of each of W1, S1, S2, S3, and W2 is a modified nucleoside.

[00171] In some embodiments, the modified multisegmented antisense oligonucleotide comprises 5' to 3': 5' W1 - G1 - S1 - G2 - S2 - G3 - S3 - G4 - S4 - G5 - W2 3' (Formula IV) where: S4 is a fourth separator segment; G5 is a fifth gap segment; and - is an internucleoside linkage; and at least one nucleoside from each of W1, S1, S2, S3, S4, and W2 is a modified nucleoside. In some embodiments, the modified multisegmented antisense oligonucleotide comprises 5' to 3': 5' W1 - G1 - S1 - G2 - S2 - G3 - S3 - G4 - S4 - G5 - S5 - G6 - W2 3' (Formula V) where: S5 is a fifth separator segment; G6 is a sixth gap segment; and Petition 870250074928, dated 08 / 25 / 2025, page 44 / 475 40 / 292 - It is an internucleoside bond; and at least one nucleoside from each of W1, S1, S2, S3, S4, S5, and W2 is a modified nucleoside.

[00172] In some embodiments, the modified multisegmented antisense oligonucleotide comprises 5' to 3': 5' W1 - G1 - S1 - G2 - S2 - G3 - S3 - G4 - S4 - G5 - S5 - G6 - S6 - G7 W2 3' (Formula VI) where: S6 is a sixth separator segment; G7 is a seventh gap segment; and - It is an internucleoside bond; and at least one nucleoside from each of W1, S1, S2, S3, S4, S5, S6, and W2 is a modified nucleoside.

[00173] In some embodiments, W1 comprises 2 to 25 linked nucleosides. In some embodiments, W1 comprises one or more linked deoxynucleosides.

[00174] In some embodiments, W2 comprises 2 to 35 linked nucleosides. In some embodiments, W2 comprises one or more linked deoxynucleosides.

[00175] In some embodiments, any one or more of G1, G2, G3, G4, G5, G6 and / or G7 comprise 1 to 10 linked deoxynucleosides.

[00176] In some embodiments, any one or more of S1, S2, S3, S4, S5, and / or S6 comprise 1, 2, 3, 4, or 5 linked nucleosides.

[00177] In some embodiments, the modified multisegmented antisense oligonucleotide is 12–50 nucleobases long, 13–50 nucleobases long, or 18–50 nucleobases long. In some embodiments, the modified multisegmented antisense oligonucleotide is approximately 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleobases long. Petition 870250074928, dated 08 / 25 / 2025, page 45 / 475 41 / 292 In some embodiments, the modified multisegmented antisense oligonucleotide is at least 16 nucleobases long. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 17 nucleobases long. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 18 nucleobases long. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 19 nucleobases long. In some embodiments, the modified multisegmented antisense oligonucleotide is 20 nucleobases long.

[00178] In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I, and the G1S1-G2 length is between 6 and 14 nucleobases. In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula I, and the G1S1-G2 length is between 8 and 12 nucleobases. In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II, and the G1S1-G2-S2-G3 length is between 8 and 13 nucleobases. In some embodiments, the modified multisegmented antisense oligonucleotide is of Formula II, and the G1S1-G2-S2-G3 length is between 8 and 12 nucleobases.

[00179] The following embodiments refer to any of Formulas I - VI: In some embodiments, G1, G2, G3, G4, G5, G6 and G7 may comprise a nucleoside comprising a modification to a 2'-deoxynucleoside. In some embodiments, any one or more of G1, G2, G3, G4, G5, G6 and G7 comprise a nucleoside comprising a 2'-deoxy 5-methylcytidine sugar modification. In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprise a nucleoside comprising a 2'-O-methoxyethyl sugar modification. In some embodiments, S1, S2, S3, S4, S5 Petition 870250074928, dated 08 / 25 / 2025, p. 46 / 475 42 / 292 and / or S6 comprises a nucleoside comprising a 5-methylcytidine. In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprises a nucleoside comprising a 2'-O-methyl sugar modification. In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprises a nucleoside comprising a 2'-OH sugar modification. In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprises a nucleoside comprising a 2'-fluoro sugar modification. In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprises a nucleoside comprising a 2'-fluoroarabinonucleic acid (2'-fluoro-ANA) sugar modification. In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprise a glycol nucleic acid (GNA). In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprise a bridging nucleic acid (e.g., LNA, cET, cMOE). In some embodiments, S1, S2, S3, S4, S5 and / or S6 comprise an LNA.In some embodiments, W1 comprises a nucleoside comprising a 2'-deoxy sugar modification. In some embodiments, W1 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification. In some embodiments, W1 comprises a 5-methylcytidine 2'-O-methoxyethyl at position 2 of a 20-mer sequence (a sequence with 20 nucleobases). In some embodiments, W1 comprises a nucleoside comprising a 2'-O-methyl sugar modification. In some embodiments, W1 comprises a 2'-O-methyl-5-methylcytidine at position 2 of a 20-mer. In some embodiments, W1 comprises a nucleoside comprising a 2'-fluoro sugar modification. In some embodiments, W1 comprises a nucleoside comprising a 2'-fluoroarabinonucleic acid (2'-fluoro-ANA) modification. In some embodiments, W1 comprises a glycol nucleic acid (GNA). In some embodiments, W1 comprises a modified nucleoside, and... Petition 870250074928, dated 08 / 25 / 2025, p. 47 / 475 43 / 292 A modified nucleoside is a bridge nucleic acid (e.g., LNA, cET, cMOE). In some embodiments, W1 comprises a modified nucleoside, wherein the modified nucleoside is a locked nucleic acid (LNA). In some embodiments, W2 comprises a nucleoside comprising a 2'-deoxy sugar modification. In some embodiments, W2 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification (e.g., wherein the 2'-O-methoxyethyl sugar modification is at positions 15, 16, 17, 18, 19, and / or 20 of a 20-mer). In some embodiments, W2 comprises a 5-methylcytidine 2'-O-methoxyethyl. In some embodiments, W2 comprises a nucleoside comprising a 2'-O-methyl sugar modification (for example, the 2'-O-methyl sugar modification being at positions 15, 16, 17, 18, 19 and / or 20 of a 20-mer). In some embodiments, W2 comprises a nucleoside comprising a 2'-fluoro sugar modification.In some embodiments, W2 comprises a nucleoside comprising a modification of 2'-fluoroarabinonucleic acid (2'-fluoro-ANA). In some embodiments, W2 comprises a modified nucleoside wherein the modified nucleoside is a glycol nucleic acid (GNA). In some embodiments, W2 comprises a modified nucleoside wherein the modified nucleoside is a bridging nucleic acid (e.g., LNA, cET, cMOE). In some embodiments, W2 comprises a modified nucleoside wherein the modified nucleoside is a blocking nucleic acid (LNA) (e.g., wherein the LNA is at positions 16, 17, 18, 19 and / or 20 of a 20-mer). Illustrative modifications

[00180] Modified multisegmented antisense oligonucleotides may comprise linked nucleosides, for example, linked deoxynucleosides, linked ribonucleosides and Petition 870250074928, dated 08 / 25 / 2025, page 48 / 475 44 / 292 linked deoxyribonucleosides. Therefore, the modified multisegmented antisense oligonucleotides of the development may comprise deoxyribonucleotides, ribonucleotides, or a mixture of both. In some embodiments, the modified multisegmented antisense oligonucleotide is a modified multisegmented antisense oligonucleotide, for example, the modified multisegmented antisense oligonucleotide comprises one or more sugar modifications, one or more modified internucleosidic linkages, and / or one or more base modifications. The characteristics of the modified multisegmented antisense oligonucleotides of the development are discussed in more detail below.

[00181] In some embodiments, the modified multisegmented antisense oligonucleotide is conjugated to a moiety or conjugate, called conjugated modified multisegmented antisense oligonucleotides. The developmental attributes of conjugated modified multisegmented antisense oligonucleotides are discussed in more detail below. Conjugated modified multisegmented antisense oligonucleotides may be modified or unmodified.

[00182] In some embodiments, a modified multisegmented antisense oligonucleotide of the development comprises the sequence of any of the SEQ ID NOS: 11-1453 or 5000-30983, or a modified multisegmented antisense oligonucleotide comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 sequence modifications thereto. The term sequence modification, as used herein, refers to sequence identity (e.g., a modification of an A to a T).

[00183] In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises the sequence of any of the following SEQ IDs: 11-1453 or 5000-30983, or a Petition 870250074928, dated 08 / 25 / 2025, page 49 / 475 45 / 292 modified multisegmented antisense oligonucleotide comprising at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity therewith.

[00184] In some embodiments, the vaccine comprises only one single modified multisegment antisense oligonucleotide; for clarity, the vaccine may comprise copies of the same single modified multisegment antisense oligonucleotide. In some embodiments, the vaccine comprises a plurality of different modified multisegment antisense oligonucleotides, for example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 or more different modified multisegment antisense oligonucleotides as disclosed. Attributes of modified multisegmented antisense oligonucleotides

[00185] As discussed herein, modified multisegmented antisense oligonucleotides involve substitutions or alterations in internucleosidic bonds, sugar moieties, and nucleobases. Modified multisegmented antisense oligonucleotides confer desirable properties such as enhanced cellular uptake, enhanced affinity for a nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity. Chemically modified nucleosides can also be used to increase the binding affinity for their target nucleic acid.

[00186] In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more modified internucleosidic bonds. In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more modified internucleosidic bonds, Petition 870250074928, dated 08 / 25 / 2025, page 50 / 475 46 / 292 wherein the modified internucleosidic linkage is a phosphorodiamidate linkage between morpholino nucleoside mimetics. In some embodiments, a modified multisegmented antisense oligonucleotide of the development comprises one or more modified internucleosidic linkages, wherein the modified internucleosidic linkage is a phosphorothioate internucleosidic linkage. In some embodiments, the phosphorothioate modification comprises a mixture of sp and rp stereoisomers. In some embodiments, the phosphorothioate modification comprises an sp stereoisomer. In some embodiments, the phosphorothioate modification comprises an rp stereoisomer.

[00187] In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more sugar modifications. In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more linked nucleosides comprising a 2' sugar modification (sugar modifications at the C2' position).In exemplary embodiments, a modified multisegmented antisense oligonucleotide of revelation comprises one or more modifications to a 2'-deoxynucleoside, for example, comprising one or more nucleosides comprising a 2'-O-methyl modification, 2'-O-ethyl modification, 2'-O-(2-methoxyethyl) modification, 2'-fluoro modification, 2'-amino modification, 2'-O-propyl modification, 2'-O-butyl modification, 2'-O-cyclopropylmethyl modification, 2'-O-(2-hydroxyethyl) modification, 2'-O-[2-(methylamino)-2-oxyethyl] modification, 2'-O-2-[2(N,N-dimethylamino)ethoxy]ethyl modification, 2'-O-(2-dimethylaminoethyl) modification, 2'-O-(3-aminopropyl) modification, 2'-O-(2-aminopropyl) modification. 2'-O-(2-hydroxy-isopropyl) modification, 2'-O-(2-methoxyisopropyl) modification, 2'-O-(2-dimethylaminoisopropyl) modification, 2'-O-(2-aminobutyl) modification, 2'-O-(2-hydroxybutyl) modification, 2'Petition 870250074928, dated 08 / 25 / 2025, page 51 / 475. 47 / 292 O-(2-methoxybutyl), 2'-O-(2-dimethylaminobutyl) modification, 2'-O-(2-aminocyclopropylmethyl) modification, 2'-O-(2-hydroxycyclopropylmethyl) modification, 2'-O-(2-methoxycyclopropylmethyl) modification, 2'-O-(2-dimethylaminocyclopropylmethyl) modification, 2'-O(2-guanidinium)ethyl) modification, and / or a 2'-fluoroarabino(2'-fluoroANA) modification.

[00188] In some embodiments, a modified multisegmented antisense oligonucleotide comprises one or more nucleosides modified with a bicyclic sugar. In some embodiments, a modified multisegmented antisense oligonucleotide of revelation comprises one or more bridged nucleic acids wherein the 2' oxygen is linked via bridged carbons to the 4' carbon of ribose to form a bridged nucleic acid (BNA), for example, linked via a 2',4'-methylene bridge to form a blocked nucleic acid (LNA), or, for example, in 2',4'-constricted 2'-O-ethyl modifications ((R)-cET or (S)-cET), or, for example, in 2',4'-constricted 2'-O-methoxyethyl modifications ((R)-cMOE or (S)-cMOE).

[00189] In some embodiments, a modified multisegmented antisense oligonucleotide comprises one or more carbocyclic LNAs (cLNAs) wherein the 2'-oxygen atom in the LNA is replaced by a carbon atom. In some exemplary embodiments, a modified multisegmented antisense oligonucleotide of revelation comprises one or more bicyclo[3.1.0]hexane methanecarba sugars in the North C2'-exo (N-MC) or South C3'-exo (SMC) forms, or 2'-F-NMC. In some embodiments, a modified multisegmented antisense oligonucleotide comprises (R)-Me-cLNA, or (S)-Me-cLNA, or F-LNA, or methylene-cLNA as shown below. Petition 870250074928, dated 08 / 25 / 2025, page 52 / 475 48 / 292

[00190] In some embodiments, a modified multisegmented antisense oligonucleotide comprises one or more α-LLNA, bcDNA, or tcDNA as shown below. bcDNA tcDNA

[00191] In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more morpholino modifications wherein a morpholino group is in place of the ribose sugar. In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises a phosphorodiamidate morpholino modification wherein the sugar-phosphate backbone is replaced by a phosphorodiamidate morpholino moiety. In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more peptide nucleic acid (PNA) modifications wherein the sugar-phosphate backbone or sugar-phosphorothioate backbone is replaced by a peptide backbone. In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more modifications Petition 870250074928, dated 08 / 25 / 2025, page 53 / 475 49 / 292 Glycol nucleic acid (GNA) compounds, which are sometimes also called glycerol nucleic acid, wherein a propylene glycol group is in place of the ribose sugar. In some embodiments, a modified multisegmented antisense oligonucleotide comprises one or more E-vinylphosphonate (E-VP) phosphate analogs and an amide backbone linkage, as shown below. Formula 5

[00192] In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more base modifications. In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more nucleosides that are a 5-methylcytidine. In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more nucleosides that are an N1-methyl-pseudouridine.

[00193] In some embodiments, a modified multisegmented antisense oligonucleotide of the revelation comprises one or more modifications at the 3' and / or 5' ends of the oligonucleotides, for example, modifications with 3' and / or 5'-amino.

[00194] In some embodiments, a modified multisegmented antisense oligonucleotide of revelation comprises segmented oligonucleotides, creating one or more internal regions (gaps) with a plurality of nucleotides that support RNaseH cleavage, which are positioned between external regions (segments) Petition 870250074928, dated 08 / 25 / 2025, page 54 / 475 50 / 292 of 5' and 3' wings) with a plurality of nucleotides that are chemically distinct from the nucleosides of the internal regions. In the case of an oligonucleotide exhibiting complementarity with a target having a segmented motif, the gap segment can hybridize with a target RNA sequence for endonuclease cleavage, while the wing segments comprise modified nucleosides. In some embodiments, the gap regions are differentiated by the types of sugar moieties comprising each distinct region.The types of sugar moieties used to differentiate the regions of a gap may, in some embodiments, include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include 2'-MOE and 2-O-CH3, among others, as described in the preceding paragraphs), and bicyclic sugar-modified nucleosides (such bicyclic sugar-modified nucleosides may include those with a restricted ethyl group). In some embodiments, the nucleosides in the wings may include modified sugar moieties, including, for example, 2'-MOE, and bicyclic sugar moieties such as ethyl or restricted LNA. In some embodiments, the wings may include various modified and unmodified sugar moieties, as described in the preceding paragraphs.In some embodiments, the wings may include various combinations of 2'-MOE nucleosides, bicyclic sugar moieties such as restricted ethyl nucleosides or LNA nucleosides, and 2'-deoxynucleosides. There may be a single internal region (gap) or it may be further segmented with separator segments, thus resulting in discontinuous gap segments that, in some embodiments, provide enhanced activity compared to conventional oligonucleotides that have a continuous gap (e.g., reduction of HBsAg levels, HBeAg levels, and / or HBcAg levels in serum or other body fluid or tissue). One or more separator segments are placed. Petition 870250074928, dated 08 / 25 / 2025, page 55 / 475 51 / 292 directly between the slack segments can be beneficial.

[00195] Modified multisegmented antisense oligonucleotides exemplifying the breakthrough include, but are not limited to, those exemplified in Table 2.1, Table 1A, Table 1B, Table 1C, Figure 21, and Figure 22.

[00196] Table 2.2 shows a legend for the modifications in each of the residues shown in Table 2.1, Table 1A, and Table 1B. In some embodiments, the modified multisegmented antisense oligonucleotide comprises the sequence of any of the following SEQ ID NOS: 668-677, 679-682, 684-688, 690-692, 698-1107, 1109-1120, 1122-1125, 1127-1138, 1140, 1145-1156, 1158-1161, 1163-1174, 1176-1179, 1181-1192, 1194-1197, 1199-1210, 1212-1215, 1217-1228, 1230-1233, 1235-1246, 1248-1251, 1253-1264, 1266-1269, 1271-1282, 1284-1287, 1289-1300, 1302-1305, 1307-1318, 1320-1323, 1325-1336, 1338-1341, 1343-1354, 1356-1359 1361-1372, 1374-1377, 1379-1390, 1392-1395, 1397-1408, 1410 1413, 1415-1426 and 1428-1431. Table 2.1. Modified multisegmented antisense oligonucleotides exemplifying the revelation. SEQ ID NO AUS# Sequence Target Gene 667 AUS-P1000 GGGCTcatagcacatTATCC PCSK9 668 AUS-P1001 GGGCtcataGcacatTATCC PCSK9 669 AUS-P1002 GGGCTcataGcacatTATCC PCSK9 670 AUS-P1003 GGGCtcataGcacatT+A+TCC PCSK9 671 AUS-P1004 GGGCTcataGcacatT+A+TCC PCSK9 672 AUS-P1005 GGGCTcatagCacatTATCC PCSK9 673 AUS-P1006 GGGCtcataGcacatT+AT+CC PCSK9 674 AUS-P1007 GGGCtcataGcacatT+ATC+C PCSK9 675 AUS-P1008 GGGCTcatagCacatT+A+TCC PCSK9 676 AUS-P1009 ACAGacaatAaatacCGAGG DMPK Petition 870250074928, dated 08 / 25 / 2025, page 56 / 475 52 / 292 SEQ ID NO AUS# Sequence Gene Alvo 680 AUS-D1002 ACAGAcaatAaatacCGAGG DMPK 681 AUS-D1003 ACAGacaatAaatacC+G+AGG DMPK 682 AUS-D1004-D1004 ACAGAcaatAAG180DCMPK+G ACAGacaataacCGAGG DMPK 684 AUS-D1006 ACAGacaataAatacCGAGG DMPK 685 AUS-D1007 ACAGAcaataAatacCGAGG DMPK 686 AUS-D1008 ACAGacaataaatacC+GA+D18G DMPK 68K ACAGacaatAaatacC+GAG+G DMPK 688 AUS-D1010 ACAGAcaataAatacC+G+AGG DMPK 689 AUS-T1000 TAC AAatgggatgctACT GC TTR 690 AUS-T1001 TAC AAatgg1CT GCAT21 TATRGAT AaatggGatgctACTGC TTR 692 AUS-T1003 TAC AaatggGatgctA+C+T GC TTR 693 AUS-T1004 ACACAgtttgaatgaAATAG TTR 694 AUS-T1005 AC AGT ttgaatgaaaT 610 AUS95 A TTR AGTTTgaatgaataGCAGG TTR 696 AUS-T1007 TTT G Aatgaaatagc AGGT G TTR 697 AUS-A1000 ACCCAattcagaaggAAGGA AAT 698 AUS-A1001 ACCCAattcAgaaggAAGGA A2AAT-6190 ACCaattcAgaaggAAGGA AAT 700 AUS-A1003 ACCCaattcAgaaggA+A+GGA AAT 1108 AUS-PAI 000 CCTT GgccacgccggC ATCC PCSK9 1109 AUS-PAI 001 PCSPA1g CCUS1CATggcca 002CCTTggccaCgccggC+A+TCC PCSK9 1111 AUS-PAI 003 CCTTggccaCgccggC+AT+CC PCSK9 1112 AUS-PAI 004 CCTTggccaCgccggC+ATC+C PCSK9 1113 AUS-PAI 005 CCTTGgccaCgccggCATCC PCSK9 1114 AUS-FATHER 006 CCTTGgccaCgccggC+A+TCC PCSK9 1115 AUS-FATHER 007 CCTTGgccaCgccggC+AT+CC PCSK9 1116 AUS-FATHER 008 CCTTGgccaCgccggC+ATC+C PCSK9 1117 AUS-FATHER 009 CCTTGgccacGccggCATCC PCSK9 1118 AUS-PAI 0010 CCTTGgccacGccggC+A+TCC PCSK9 1119 AUS-PAI 0011 CCTTGgccacGccggC+AT+CC PCSK9 1120 AUS-PAI 0012 CCTTGgccacGccggC+ATC+C PCSK9 1121 AUS-PAI 0013 CCTTggccaCgccggCATCC PCSK9 1122 AUS-PAI 0014 CCTTggccacGccggCATCC PCSK9 1123 AUS-PAI 0015 CCTTggccacGccggC+A+TCC PCSK9 1124 AUS-PAI 0016 CCTTggccacGccggC+AT+CC PCSK9 1125 AUS-PAI 0017 CCTTggccacGccggC+ATC+C PCSK9 1126 AUS-DAI 000 ACAGAcaataaatacCGAGG DMPK Petition 870250074928, dated 08 / 25 / 2025, p. 57 / 475 53 / 292 SEQ ID NO AUS# Gene Sequence Alvo 1127 AUS-DAI 001 ACAGacaatAaatacCGAGG DMPK 1128 AUS-DAI 002 ACAGacaatAaatacC+G+AGG DMPK 1129 AUS-DAI 003 ACAGata3CMP+A+1 AUS-DAI 004 ACAGacaatAaatacC+GAG+G DMPK 1131 AUS-DAI 005 ACAGAcaatAaatacCGAGG DMPK 1132 AUS-DAI 006 ACAGAcaatAaatacC+G+AGG DMPK 11GATAc+a AUS-DA DMPK 1134 AUS-DAI 008 ACAGAcaatAaatacC+GAG+G DMPK 1135 AUS-DAI 009 ACAGAcaataAatacCGAGG DMPK 1136 AUS-DAI 0010 ACAGAcaataAatacC+G+DAIG 7 AUS01-AGI3 AUS01 1 ACAGAcaataAatacC+GA+GG DMPK 1138 AUS-DAI 0012 ACAGAcaataAatacC+GAG+G DMPK 1139 AUS-DAI 0013 ACAGacaatacCGAGG DMPK 1140 AUS-DAI 00GA4 D1AtacKAGAGata 0015 AC AG Ac aaaatacC+G+AGG DMPK 1142 AUS-DAI 0016 ACAGAcaataaatacC+GA+GG DMPK 1143 AUS-DAI 0017 ACAGAcaataatacC+GAG+G DMPK 1144GCGtgtCGGAK1000 1145 AUS-DB1001 CGGAgcggtT gtgaaCT GGC DMPK 1146 AUS-DB1002 CGGAgcggtT gtgaaC+T+GGC DMPK 1147 AUS-DB1003 CGGAgcggtT gtgaaC4K+T G1+1GCCGGAgcggtT gtgaaC+T GG+C DMPK 1149 AUS-DB1005 CGGAGcggtT gtgaaCT GGC DMPK 1150 AUS-DB1006 CGG AGcggtT gtgaaC+T+GGC DMPK 1151 AUS-DB1007 CGGAGcggtTgtgaaC+TG+GC DMPK 1152 AUS-DB1008 CGGAGcggtTgtgaaC+TGG+C DMPK 1153 AUS-DB1009 CGGAGcggttGtgaaCTGGC DMPK 1154 AUS-DB10010 CGGAGcggttGtgaaC+T+GGC DMPK 1155 AUS-DB10011 CGGAGcggttGtgaaC+T G+GC DMPK 1156 AUS-DB10012 CGGAGcggttGtgaaC+T GG+C DMPK 1157 AUS-DB10013 CGGAgcggttgtgaaCTGGC DMPK 1158 AUS-DB10014 CGGAgcggttGtgaaCTGGC DMPK 1159 AUS-DB10015 CGGAgcggttGtgaaC+T+GGC DMPK 1160 AUS-DB10016 CGGAgcggttGtgaaC+T G+GC DMPK 1161 AUS-DB10017 CGGAgcggttGtgaaC+TGG+C DMPK 1162 AUS-DC1000 GCGUAgaagggcgucUGCCC DMPK 1163 AUS-DC1001 GCGUagaagGgcgucUGCCC DMPK 1164 AUS-DC1002 GCGUagaagGgcgucU+G+CCC DMPK 1165 AUS-DC1003 GCGUagaagGgcgucU+GC+CC DMPK 1166 AUS-DC1004 GCGUagaagGgcgucU+GCC+C DMPK 1167 AUS-DC1005 GCGUAgaagGgcgucUGCCC DMPK 1168 AUS-DC1006 GCGUAgaagGgcgucU+G+CCC DMPK Petição 870250074928, de 25 / 08 / 2025, pág. 58 / 475 54 / 292SEQ ID NO AUS# Sequence Gene Target 1169 AUS-DC1007 GCGUAgaagGgcgucU+GC+CC DMPK 1170 AUS-DC1008 GCGUAgaagGgcgucU+GCC+C DMPK 1171 AUS-DC1009 GCGUAGGcGCCGU1 AUS-DC10010 GCGUAgaaggGcgucU+G+CCC DMPK 1173 AUS-DC10011 GCGUAgaaggGcgucU+GC+CC DMPK 1174 AUS-DC10012 GCGUAgaaggGcgucU+GCC+C DMPK 1175 AUS-DC1013 GCGUagaagggcgucUGCCC DMPK 1176 AUS-DC10014 GCGUagaaggGcgucUGCCC DMPK 1177 AUS-DC10015 GCGUagaaggGcgucU+G+CCC DMPK 1178 AUS-DC10016 GCGUagaaggGCCGUcGUcGU179 AUS-DC10017 GCGUagaaggGcgucU+GCC+C DMPK 1180 AUS-TAI 000 UCUUGgttacatgaaAUCCC TTR 1181 AUS-TAI 001 UCUUggttaCatgaaAUCCC TTR 1182 AUS-TAI 002ATTA+GCCATCA+GCCACUCA 1183 AUS-TAI 003 UCUUggttaCatgaaA+UC+CC TTR 1184 AUS-TAI 004 UCUUggttaCatgaaA+UCC+C TTR 1185 AUS-TAI 005 UCUUGgttaCatgaaAUCCC TTR 1186 AUS-TAI UCUUGgttaCatgaaA+U+CCC TTR 1187 AUS-TAI 007 UCUUGgttaCatgaaA+UC+CC TTR 1188 AUS-TAI 008 UCUUGgttaCatgaaA+UCC+C TTR AUS-TAI 0010 UCUUGgttacAtgaaA+U+CCC TTR1191 AUS-TAI 0011 UCUUGgttacAtgaaA+UC+CC TTR 1192 AUS-TA10012 UCUUGgttacAtgaaA+UCC+C TTR 1193 AUS-TAI 0013 UCUUggttaCatgaaA+1190 TTR 1190 AUCCC 1 UCUUggttacAtgaaAUCCC TTR 1195 AUS-TAI 0015 UCUUggttacAtgaaA+U+CCC TTR 1196 AUS-TAI 0016 UCUUggttacAtgaaA+UC+CC TTR 1197 AUS-TAI+CC1Ct9a8Atta+17 UCU17 AUS-AA1000 T GTTAaaacatgcctaaACGCT AAT 1199 AUS-AA1001 T GTT aaacaT gcctaaACGCT AAT 1200 AUS-AA1002 T GTT aaacaT gcctaaA+C+GCT AAT 1201 AUS-AA2AAcctaa1 GcctaaC+ g AUS-AA1004 T GTT aaacaT gcctaaA+C GC+T AAT 1203 AUS-AA1005 TGTTAaacaTgcctaaACGCT AAT 1204 AUS-AA1006 TGTTAaacaTgcctaaA+C+GCT AAT 1205 AcaATa7TgcctaaA+C+GCT AAT 1205 AcaGTa7T+gcctaa1 1206 AUS-AA1008 T GTTAaaacaTgcctaaA+C GC+T AAT 1207 AUS-AA1009 T GTTAaaacatGcctaaACGCT AAT 1208 AUS-AA10010 T GTTAaaacatGcctaaA+C+GCT AUS1-1209 AAT 1209 GTTAaaacatGcctaaA+CG+CT AAT 1210 AUS-AA10012 T GTTAaaacatGcctaaA+CGC+T AAT Petition 870250074928, dated 08 / 25 / 2025, p. 59 / 475 55 / 292 SEQ ID NO AUS# Sequência Gene Alvo 1211 AUS-AA10013 T GTT aaacatgcctaaACGCT AAT 1212 AUS-AA10014 T GTT aaacatGcctaaACGCT AAT 1213 AUS-AA10015 T GTT aaacatGcctaa A+C+GCT AAT 1214 AUS-AA10016 T GTT aaacatGcctaaA+CG+CT AAT 1215 AUS-AA10017 T GTT aaacatGcctaaA+CGC+T AAT 1216 AUS-AB1000 GCCTCagtctgcttcGCACC ApoB 1217 AUS-AB1001 GCCTcagtcTgcttcGCACC ApoB 1218 AUS-AB1002 GCCTcagtcTgcttcG+C+ACC ApoB 1219 AUS-AB1003 GCCTcagtcTgcttcG+CA+CC ApoB 1220 AUS-AB1004 GCCTcagtcTgcttcG+CAC+C ApoB 1221 AUS-AB1005 GCCTCagtcTgcttcGCACC ApoB 1222 AUS-AB1006 GCCTCagtcTgcttcG+C+ACC ApoB 1223 AUS-AB1007 GCCTCagtcTgcttcG+CA+CC ApoB 1224 AUS-AB1008 GCCTCagtcTgcttcG+CAC+C ApoB 1225 AUS-AB1009 GCCTCagtctGcttcGCACC ApoB 1226 AUS-AB10010 GCCTCagtctGcttcG+C+ACC ApoB 1227 AUS-AB10011 GCCTCagtctGcttcG+CA+CC ApoB 1228 AUS-AB10012 GCCTCagtctGcttcG+CAC+C ApoB 1229 AUS-AB10013 GCCTcagtctgcttcGCACC ApoB 1230 AUS-AB10014 GCCTcagtctGcttcGCACC ApoB 1231 AUS-AB10015 GCCTcagtctGcttcG+C+ACC ApoB 1232 AUS-AB10016GCCTcagtctGcttcG+CA+CC ApoB 1233 AUS-AB10017 GCCTcagtctGcttcG+CAC+C ApoB 1234 AUS-AC1000 AGCTTcttgtccagcTTTAT ApoCIII 1235 AUS-AC1001 AGCTtcttgTTA2GcTTTAT13636 AUS-AC1002 AGCT tcttgT ccagcT+T+T AT ApoCIII 1237 AUS-AC1003 AGCT tcttgT ccagcT+TT+AT ApoCIII 1238 AUS-AC1004 AGCT tcttgT ccagcT+TT A+T ApoCIII AUS 1-2105 AGCTTcttgTccagcTTTAT ApoCIII 1240 AUS-AC1006 AGCTTcttgTccagcT+T+TAT ApoCIII 1241 AUS-AC1007 AGCTTcttgTccagcT+TT+AT ApoCIII 1242 AUS-AC1008 AGCTTcttcTgTcagT3CTA+TAT3 AUS-AC1009 AGCTTcttgtCcagcTTTAT ApoCIII 1244 AUS-AC10010 AGCTTcttgtCcagcT+T+TAT ApoCIII 1245 AUS-AC10011 AGCTTcttgtCcagcT+TT+AT ApoCIII 1246 AUS-AC10012 AGCTTcttgtCcagcT+TTA+T ApoCIII 1247 AUS-AC10013 AGCT tcttgtccagcTTT AT ApoCIII 1248 AUS-AC10014 AGCTtcttgtCcagcTTTAT ApoCIII 1249 AUS-AC10015 AGcacttCCTTGA+TTA+GCTTA 1250 AUS-AC10016 AGCTtcttgtCcagcT+TT+AT ApoCIII 1251 AUS-AC10017 AGCT tcttgtCcagcT+TT A+T ApoCIII Petition 870250074928, of 25 / 08 / 2025, p. 60 / 475 56 / 292 SEQ ID NO AUS# Sequência Gene Alvo 1252 AUS-TB1000 GCTGAttagagagagGTCCC TNF-alfa 1253 AUS-TB1001 GCTGattagAgagagGTCCC TNF-alfa 1254 AUS-TB1002 GCTGattagAgagagG+T+CCC TNF-alfa 1255 AUS-TB1003 GCTGattagAgagagG+TC+CC TNF-alfa 1256 AUS-TB1004 GCTGattagAgagagG+TCC+C TNF-alfa 1257 AUS-TB1005 GCTGAttagAgagagGTCCC TNF-alfa 1258 AUS-TB1006 GCTGAttagAgagagG+T+CCC TNF-alfa 1259 AUS-TB1007 GCTGAttagAgagagG+TC+CC TNF-alfa 1260 AUS-TB1008 GCTGAttagAgagagG+TCC+C TNF-alfa 1261 AUS-TB1009 GCTGAttagaGagagGTCCC TNF-alfa 1262 AUS-TB10010 GCTGAttagaGagagG+T+CCC TNF-alfa 1263 AUS-TB10011 GCTGAttagaGagagG+TC+CC TNF-alfa 1264 AUS-TB10012 GCTGAttagaGagagG+TCC+C TNF-alfa 1265 AUS-TB10013 GCTGattagagagagGTCCC TNF-alfa 1266 AUS-TB10014 GCTGattagaGagagGTCCC TNF-alfa 1267 AUS-TB10015 GCTGattagaGagagG+T+CCC TNF-alfa 1268 AUS-TB10016 GCTGattagaGagagG+TC+CC TNF-alfa 1269 AUS-TB10017 GCTGattagaGagagG+TCC+C TNF-alfa 1270 AUS-TC1000 AAGAGgacctgggagTAGAT TNF-alfa 1271 AUS-TC1001 A AG AggaccT gggagT AG AT TNF-alfa 1272AUS-TC1002 A AG AggaccT gggagT+A+G AT TNF-alfa 1273 AUS-TC1003 A AG AggaccT gggagT+AG+AT TNF-alfa 1274 AUS-TC1004 A AG AggaccT gggagT+AG A+T TNF-alfa 1275 AUS-TC1005 AAGAGgaccTgggagTAGAT TNF-alfa 1276 AUS-TC1006 AAGAGgaccTgggagT+A+GAT TNF-alfa 1277 AUS-TC1007 AAGAGgaccTgggagT+AG+AT TNF-alfa 1278 AUS-TC1008 AAGAGgaccTgggagT+AGA+T TNF-alfa 1279 AUS-TC1009 AAGAGgacctGggagTAGAT TNF-alfa 1280 AUS-TC10010 AAGAGgacctGggagT+A+GAT TNF-alfa 1281 AUS-TC10011 AAGAGgacctGggagT+AG+AT TNF-alfa 1282 AUS-TC10012 AAGAGgacctGggagT+AGA+T TNF-alfa 1283 AUS-TC10013 A AG AggacctgggagT AG AT TNF-alfa 1284 AUS-TC10014 AAGAggacctGggagTAGAT TNF-alfa 1285 AUS-TC10015 A AG AggacctGggagT+A+G AT TNF-alfa 1286 AUS-TC10016 A AG AggacctGggagT+AG+AT TNF-alfa 1287 AUS-TC10017 AAGAggacctGggagT+AGA+T TNF-alfa 1288 AUS-AG1000 CACAAAacaagctggtCGGUU AGT 1289 AUS-AG1001 CACAaacaaGctggtCGGUU AGT 1290 AUS-AG1002 CACAaacaaGctggtC+G+GUU AGT 1291 AUS-AG1003 CACAaacaaGctggtC+GG+UU AGT 1292 AUS-AG1004 CACAaacaaGctggtC+GGU+U AGT Petition 870250074928, dated 08 / 25 / 2025, p. 61 / 475 57 / 292 SEQ ID NO AUS# Sequence Alvo Gene 1293 AUS-AG1005 CACAAaacaaGctggtCGGUU AGT 1294 AUS-AG1006 CACAAacaaGctggtC+G+GUU AGT 1295 AUS-AG1007 CACAAacaaGT8US-1Gct+196UC+G CACAAacaaGctggtC+GGU+U AGT 1297 AUS-AG1009 CACAAacaagCtggtCGGUU AGT 1298 AUS-AG10010 CACAAacaagCtggtC+G+GUU AGT 1299 AUS-AG10011 AGCt1CAggAUC0acaag AUS-AG10012 CACAAaacaagCtggtC+GGU+U AGT 1301 AUS-AG10013 CACAaacaagctggtCGGUU AGT 1302 AUS-AG10014 CACAaaacaagCtggtCGGUU AGT 1303 GT+caGt+AGGUtA1001 1304 AUS-AG10016 CACAaaacaagCtggtC+GG+UU AGT 1305 AUS-AG10017 CACAaacaagCtggtC+GGU+U AGT 1306 AUS-CF1000 ATCCCacgcccctgtCCCF10 CFB-131 ATCCcacgcCcctgtCCAGC CFB 1308 AUS-CF1002 ATCCcacgcCcctgtC+AGC CFB 1309 AUS-CF1003 ATCCcacgcCcctgtC+CA+GC CFB 1310 AUSCCG+ccgc00 CFB 1311 AUS-CF1005 ATCCCacgcCcctgtCCAGC CFB 1312 AUS-CF1006 ATCCCacgcCcctgtC+C+AGC CFB 1313 AUS-CF1007 ATCCCacgcCcctgtC8B+CA+1GC ATCCCacgcCcctgtC+CAG+C CFB 1315 AUS-CF1009ATCCCacgccCctgtCCAGC CFB 1316 AUS-CF10010 ATCCCacgccCctgtC+C+AGC CFB 1317 AUS-CF10011 ATCCCacgccCctgtC+CA+GC CFB 1318 AUS-CF10012 ATCCCacgccCctgtC+CAG+C CFB 1319 AUS-CF10013 ATCCcacgcccctgtCCAGC CFB 1320 AUS-CF10014 ATCCcacgccCctgtCCAGC CFB 1321 AUS-CF10015 ATCCcacgccCctgtC+C+AGC CFB 1322 AUS-CF10016 ATCCcacgccCctgtC+CA+GC CFB 1323 AUS-CF10017 ATCCcacgccCctgtC+CAG+C CFB 1324 AUS-DG1000 TGCCAtttaatgagcTTCAC DGAT2 1325 AUS-DG1001 TGCCatttaAtgagcTTCAC DGAT2 1326 AUS-DG1002 TGCCatttaAtgagcT+T+CAC DGAT2 1327 AUS-DG1003 TGCCatttaAtgagcT+TC+AC DGAT2 1328 AUS-DG1004 TGCCatttaAtgagcT+TCA+C DGAT2 1329 AUS-DG1005 TGCCAtttaAtgagcTTCAC DGAT2 1330 AUS-DG1006 TGCCAtttaAtgagcT+T+CAC DGAT2 1331 AUS-DG1007 TGCCAtttaAtgagcT+TC+AC DGAT2 1332 AUS-DG1008 TGCCAtttaAtgagcT+TCA+C DGAT2 1333 AUS-DG1009 TGCCAtttaaTgagcTTCAC DGAT2 1334 AUS-DG10010 TGCCAtttaaTgagcT+T+CAC DGAT2 Petição 870250074928, de 25 / 08 / 2025, pág. 62 / 475 58 / 292 SEQ ID NO AUS# Target Gene Sequence 1335 AUS-DG10011 TGCCAtttaaTgagcT+TC+AC DGAT2 1336 AUS-DG10012 TGCCAtttaaTgagcT+TCA+C DGAT2 1337 AUS-DG10013 TGCCatttaatgagcTTCAC DGAT2 1338 AUS-DG10014 TGCCatttaaTgagcTTCAC DGAT2 1339 AUS-DG10015 TGCCatttaaTgagcT+T+CAC DGAT2 1340 AUS-DG10016 TGCCatttaaTgagcT+TC+AC DGAT2 1341 AUS-DG10017 TGCCatttaaTgagcT+TCA+C DGAT2 1342 AUS-PN1000 TACTTtattcaatgtGGCTT PNPLA3 1343 AUS-PN1001 TACTttattCaatgtGGCTT PNPLA3 1344 AUS-PN1002 TACTttattCaatgtG+G+CTT PNPLA3 1345 AUS-PN1003 TACTttattCaatgtG+GC+TT PNPLA3 1346 AUS-PN1004 TACTttattCaatgtG+GCT+T PNPLA3 1347 AUS-PN1005 TACTTtattCaatgtGGCTT PNPLA3 1348 AUS-PN1006 TACTTtattCaatgtG+G+CTT PNPLA3 1349 AUS-PN1007 TACTTtattCaatgtG+GC+TT PNPLA3 1350 AUS-PN1008 TACTTtattCaatgtG+GCT+T PNPLA3 1351 AUS-PN1009 TACTTtattcAatgtGGCTT PNPLA3 1352 AUS-PN10010 TACTTTattcAatgtG+G+CTT PNPLA3 1353 AUS-PN10011 TACTTTattcAatgtG+GC+TT PNPLA3 1354 AUS-PN10012 TACTTTattcAatgtG+GCT+T PNPLA3 1355 AUS-PN10013 TACTttattCaatgtGGCTT PNPLA3 1356AUS-PN10014 TACTttattcAatgtGGCTT PNPLA3 1357 AUS-PN10015 TACTttattcAatgtG+G+CTT PNPLA3 1358 AUS-PN10016 TACTttattcAatgtG+GC+TT PNPLA3 1359 AUS-PN10017 TACTttattcAatgtG+GCT+T PNPLA3 1360 AUS-PB1000 ACAAAagcaaaacagGUCUA PCSK9 1361 AUS-PB1001 ACAAaagcaAaacagGUCUA PCSK9 1362 AUS-PB1002 ACAAaagcaAaacagG+U+CUA PCSK9 1363 AUS-PB1003 ACAAaagcaAaacagG+UC+UA PCSK9 1364 AUS-PB1004 ACAAaagcaAaacagG+UCU+A PCSK9 1365 AUS-PB1005 ACAAAagcaAaacagGUCUA PCSK9 1366 AUS-PB1006 ACAAAagcaAaacagG+U+CUA PCSK9 1367 AUS-PB1007 ACAAAagcaAaacagG+UC+UA PCSK9 1368 AUS-PB1008 ACAAAagcaAaacagG+UCU+A PCSK9 1369 AUS-PB1009 ACAAAagcaaAacagGUCUA PCSK9 1370 AUS-PB10010 ACAAAagcaaAacagG+U+CUA PCSK9 1371 AUS-PB10011 ACAAAagcaaAacagG+UC+UA PCSK9 1372 AUS-PB10012 ACAAAagcaaAacagG+UCU+A PCSK9 1373 AUS-PB10013 ACAAaagcaaaacagGUCUA PCSK9 1374 AUS-PB10014 ACAAaagcaaAacagGUCUA PCSK9 1375 AUS-PB10015 ACAAaagcaaAacagG+U+CUA PCSK9 1376 AUS-PB10016 ACAAaagcaaAacagG+UC+UA PCSK9 Petition 870250074928, dated 08 / 25 / 2025, p. 63 / 475 59 / 292 SEQ ID NO AUS# Alvo Gene Sequence 1377 AUS-PB10017 ACAAaagcaaAacagG+UCU+A PCSK9 1378 AUS-AL1000 UAAGAugacacucUUUCU ALAS1 1379 AUS-AL1001 cuAL80GaUUUUgAca AUS-AL1002 UAAGaugagAcacucU+U+UCU ALAS1 1381 AUS-AL1003 UAAGaugagAcacucU+UU+CU ALAS1 1382 AUS-AL1004 UAAGaugagAcacucU+UUC+U ALAS1 ca UAcAL183 UCU ALAS1 1384 AUS-AL1006 UAAGAugagAcacucU+U+UCU ALAS1 1385 AUS-AL1007 UAAGAugagAcacucU+UU+CU ALAS1 1386 AUS-AL1008 UAAGAugaugAcacucU AL3091+ASUUC+U UAAGAugagaCacucUUCU ALAS1 1388 AUS-AL10010 UAAGAugagaCacucU+U+UCU ALAS1 1389 AUS-AL10011 UAAGAugagaCacucU+UU+CU ALAS1 1390 AUS-AL10uga1AS9ga+Ca1cu1c1cu+ UAAU+ AUS-AL10013 UAAGaugagacacucUUCU ALAS1 1392 AUS-AL10014 UAAGaugagaCacucUUCU ALAS1 1393 AUS-AL10015 UAAGaugagaCacucU+U+UCU ALAS1 139ga+CaU6-UCU1 ALAS1 1395 AUS-AL10017 UAAGaugagaCacucU+UUC+U ALAS1 1396 AUS-TD1000 AUGGAauacucuuggUUACT TTR 1397 AUS-TD1001 AU GGaauacU cugguU ACTGa08 ATR T2 AUcU TD319CuggU+U+ACT TTR 1399 AUS-TD1003 AU GGaauacU cuggU+U A+CT TTR 1400 AUS-TD1004 AUGGaauacUcuuggU+UAC+T TTR 1401 AUS-TD-1005 AUGGAauac020 ATRUS46TDUCT AUGGAauacUcuuggU+U+ACT TTR 1403 AUS-TD1007 AUGGAauacUcuuggU+UA+CT TTR 1404 AUS-TD1008 AUGGAauacUcuuggU+UAC+T TTR 1405 AUS-TD10UAu4Acu TTR AUG AUS-TD10010 AU GG AauacuCuuggU+U+ACT TTR 1407 AUS-TD10011 AU GG AauacuCuuggU+U A+CT TTR 1408 AUS-TD10012 AU GG AauacuCuugg01 -1 -1 ACTR10T TTR AUGGaauacucuuggUUACT TTR 1410 AUS-TD10014 AUGGaauacuCuuggUUACT TTR 1411 AUS-TD10015 AU GGaauacuCuuggU+U+ACT TTR 1412 AUS-TD10GauG0ggau1TTR16 AUCU AUS-TD10017 AUGGaauacuCuuggU+UAC+T TTR 1414 AUS-H1000 UAUAUuuccaggaugAAGU hydroxyacid oxidase 1 1415 AUS-H1001 UAUAuuuccAggaugAAGU101US101 hydroxyacid-1hydroxide oxide UAUAuuuccAggaugA+A+AGU hydroxyacid oxidase 1 1417 AUS-H1003 UAUAuuuccAggaugA+AA+GU hydroxyacid oxidase 1 Petition 870250074928, dated 08 / 25 / 2025, p. 64 / 475 60 / 292 SEQ ID NO AUS# Sequence Target Gene 1418 AUS-H1004 UAUAUuuuccAggaugA+AAG+U hydroxyacid oxidase 1 1419 AUS-H1005 UAUAUuuccAggaugAAAGU hydroxyacid oxidase 1 1420 AUS-H1006 UAUAUuuccAggaugA+A+AGU hydroxyacid oxidase 1 1421 AUS-H1007 UAUAUuuccAggaugA+AA+GU hydroxyacid oxidase 1 1422 AUS-H1008 UAUAUuuccAggaugA+AAG+U hydroxyacid oxidase 1 1423 AUS-H1009 UAUAUuuccaGgaugAAAGU hydroxyacid oxidase 1 1424 AUS-H10010 UAUAUuuccaGgaugA+A+AGU hydroxyacid oxidase 1 1425 AUS-H10011 UAUAUuuccaGgaugA+AA+GU hydroxyacid oxidase 1 1426 AUS-H10012 UAUAUuuccaGgaugA+AAG+U hydroxyacid oxidase 1 1427 AUS-H10013 UAUAuuuccaggaugAAAGU hydroxyacid oxidase 1 1428 AUS-H10014 UAUAuuuccaGgaugAAAGU hydroxyacid oxidase 1 1429 AUS-H10015 UAUAuuuccaGgaugA+A+AGU hydroxyacid oxidase 1 1430 AUS-H10016 UAUAuuuccaGgaugA+AA+GU hydroxyacid oxidase 1 1431 AUS-H10017 UAUAuuuccaGgaugA+AAG+U hydroxyacid oxidase 1 Table 2.2 Legend of modifications Symbol Description Representation Examples lowercase 2'-deoxy nucleoside c means 2'-deoxy 5-methylcytidine, a means 2'-deoxy adenosine, g means 2'-deoxy guanosine, et means 2'-deoxy thymidine. C-CUT -methoxyethyl nucleoside C means 2'-(9-methoxyethyl-5-methylcytidine), A means 2'-O-methoxyethyl adenosine, G means 2'-O-methoxyethyl guanosine, T means 2'-O-methoxyethyl thymidine, and U means 2'-O-methoxyethyl uridine (CUT, Underlined) T-O-methoxyethyl cytidine C means 2'-G-merox / eZ / 7-cytidine (namely, ordinary unmethylated cytidine with a 2'-O-methoxyethyl modification). ç lowercase, underlined 2'-deoxycytidine c means 2'-(7-deoxycytidine (i.e., regular unmethylated 2'-deoxycytidine). .V CUT IN ITALICS 2;-(9-methyl nucleoside C means 2'-G-methyl-5-mctylcitidine, A stands for 2'-O-methyl adenosine, G stands for 2'-O-methyl guanosine, T stands for 2'-G-methyl thymidine,U stands for 2'-O-methyl uridine. Lowercase in bold and italics: 2'-Ol nucleoside; c stands for 2'-Ol 5-methylcytidine (or 5-methylcytidine); a stands for 2'-QH adenosine (or adenosine); g stands for 2'-Ol guanosine (or guanosine); i stands for 2'-OH uridine (or uridine). Uppercase in bold: Glycol nucleic acid (GNA). A stands for an adenine-based GNA, C stands for a 5-methylcytidine-based GNA. -X UPPERCASE with a + sign in front Blocked nucleic acid (LNA) +A means an adenine-based LNA, +C means a 5-methylcytosine-based LNA, +G means a guanine-based LNA, +T means a thymine-based LNA, +U means a uracil-based LNA -c UPPERCASE underlined with a + sign in front Blocked nucleic acid (LNA) with a cytosine base +C means a regular (non-methylated) cytosine-based LNA X'1 UPPERCASE followed by a ' sign 2'-Fluoro 2'-deoxy nucleoside A' means 2'-fluoro 2'-deoxy adenosine,C' means 2'-fluoro 2'-deoxy 5-methylcytidine, G' means 2'-fluoro 2'-deoxy guanosine, U' means 2'-fluoro 2'-deoxy uridine. C' means 2'-Fluoro 2'-deoxycytidine (unmethylated). N means 2'-F-Arabinonucleic Acid (2'-F-ANA). A means adenine-based 2'-F-ANA, T means thymine-based 2'-F-ANA, G means guanine-based 2'-F-ANA. C means cytosine-based 2'-F-ANA, C means cytosine-based 2'-F-ANA. Conjugated oligonucleotides

[00197] The development oligonucleotides may be further covalently linked to one or more conjugate groups / modules. In some embodiments, such groups enhance the activity, cellular distribution and / or cellular uptake of the resulting vaccines. Exemplary conjugate groups include, but are not limited to, carbohydrate modules (e.g., carbohydrate chains containing N-acetylgalactosamine or carbohydrate chains containing galactose) and Petition 870250074928, dated 08 / 25 / 2025, p. 65 / 475 61 / 292 lipid moieties (e.g., cholesterol and phospholipids). Other conjugated groups include, but are not limited to, phospholipids, biotin or other affinity markers (e.g., streptavidin), polymers (e.g., polyethylene glycol (PEG), polylysine), cell-penetrating peptides (e.g., Tat, Penetratin), enzymes (e.g., horseradish peroxidase, alkaline phosphatase), antibodies or antibody fragments (e.g., anti-HER2, anti-EGFR), proteins or peptides (e.g., growth factors, cytokines), metal nanoparticles (e.g., gold nanoparticles), small molecule drugs (e.g., doxorubicin, paclitaxel), phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

[00198] The development oligonucleotides can also be modified to have one or more stabilizing groups that are generally attached to one or both oligonucleotide termini to enhance properties such as, for example, nuclease stability. Included in the stabilizing groups are cap structures. These terminal modifications can protect the nucleic acid-terminal oligonucleotide from exonuclease degradation and can aid in distribution and / or localization within a cell. The cap can be present at the 5' terminus (5'-cap), or at the 3' terminus (3'-cap), or it can be present at both termini. Cap structures are well known in the art and include, for example, inverted deoxybasic caps. The conjugated oligonucleotides of the development can be modified as described in the previous section. A. Wing segment 5', General (W1)

[00199] In certain embodiments, at least one of the nucleosides in the 5' wing segment comprises a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, each of the nucleosides in the 5' wing segment Petition 870250074928, dated 08 / 25 / 2025, page 66 / 475 62 / 292 comprises a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 5' wing segment comprises a nucleoside with a 2'-deoxy sugar and the other nucleosides in the 5' wing segment comprise a 2'-O(CH2)2-OCH3 sugar.

[00200] In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a sugar modification described herein. In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a bicyclic sugar. In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a restricted ethyl sugar.

[00201] In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a blocked nucleic acid. In certain embodiments, one, two, three, or four of the nucleosides in the 5' wing segment comprise a 4-CH2-O2' sugar. In certain embodiments, two of the nucleosides in the 5' wing segment comprise a blocked nucleic acid. In certain embodiments, two of the nucleosides in the 5' wing segment comprise a 4'-CH2-O-2' sugar. B1. 5' wing segment with 4 nucleosides attached (W1)

[00202] In certain embodiments, the 5' wing segment consists of 4 linked nucleosides. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, each of the 4 linked nucleosides comprising a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, 3 of the 4 linked nucleosides comprising a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, 2 of the 4 linked nucleosides comprising a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments Petition 870250074928, dated 08 / 25 / 2025, page 67 / 475 63 / 292 des, the 5' wing segment consists of 4 linked nucleosides, where 1 of the 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. B2. 5' wing segment with 4 linked nucleosides, 2'-deoxy combinations (W1)

[00203] In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein one of the linked nucleosides comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein two of the linked nucleosides comprise a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, one of the 4 linked nucleosides comprises a blocked nucleic acid, and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 4 linked nucleosides comprise a blocked nucleic acid, and the other linked nucleoside comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. B3. 5' wing segment with 4 linked nucleosides, 2'-LNA combinations (W1)

[00204] In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, one of which comprises a blocked nucleic acid. In certain embodiments, the Petition 870250074928, dated 08 / 25 / 2025, page 68 / 475 64 / 292 The 5' wing segment consists of 4 linked nucleosides, wherein two of the 4 linked nucleosides comprise a blocked nucleic acid. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a 4-CH2-O-2' sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein two of the 4 linked nucleosides comprise a 4-CH2-O-2' sugar.

[00205] In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a blocked nucleic acid and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein two of the 4 linked nucleosides comprise a blocked nucleic acid and each of the other 2 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a 4'-CH2-O-2' sugar and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2OCH3 sugar.In certain embodiments, the 5' wing segment consists of 4 linked nucleosides, wherein two of the 4 linked nucleosides comprise a 4'-CH2-O-2' sugar and each of the other 2 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. C1. 5' wing segment with 5 nucleosides attached (W1)

[00206] In certain embodiments, the 5' wing segment consists of 5 linked nucleosides. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, each of the 5 linked nucleosides comprising a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists Petition 870250074928, dated 08 / 25 / 2025, page 69 / 475 65 / 292 in 5 linked nucleosides, wherein 4 of the 5 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein 3 of the 5 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein 2 of the 5 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein 1 of the 5 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. C2. 5' wing segment with 5 linked nucleosides, 2'-deoxy combinations (W1)

[00207] In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein one of the linked nucleosides comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein two of the linked nucleosides comprise a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, one of the 5 linked nucleosides comprises a blocked nucleic acid, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, one of which comprises a... Petition 870250074928, dated 08 / 25 / 2025, page 70 / 475 66 / 292 nucleoside with a 2'-deoxy sugar, two of the 5 linked nucleosides comprise a blocked nucleic acid and the other 2 linked nucleosides comprise a nucleoside with a 2'O(CH2)2-OCH3 sugar. C3. 5' wing segment with 5 linked nucleosides, 2'-LNA combinations (W1)

[00208] In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a blocked nucleic acid. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein two of the 5 linked nucleosides comprise a blocked nucleic acid. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a 4-CH2-O-2' sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein two of the 5 linked nucleosides comprise a 4-CH2-O-2' sugar.

[00209] In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a blocked nucleic acid and each of the other 4 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein two of the 5 linked nucleosides comprise a blocked nucleic acid and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a 4'-CH2-O-2' sugar and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2OCH3 sugar. In certain embodiments, the 5' wing segment consists of 5 linked nucleosides, wherein two of the 5 linked nucleosides Petition 870250074928, dated 08 / 25 / 2025, page 71 / 475 67 / 292 comprise a 4-CH2-O-2' sugar and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. D. Wing segment 3', General (W2)

[00210] In certain embodiments, at least one of the nucleosides in the 3' wing segment comprises a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, each of the nucleosides in the 3' wing segment comprises a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3' wing segment comprises a nucleoside with a 2'-deoxy sugar and the other nucleosides in the 3' wing segment comprise a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment further comprises two nucleosides, each with a 2'-deoxy sugar.

[00211] In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a sugar modification described herein. In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a bicyclic sugar. In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a restricted ethyl sugar.

[00212] In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a blocked nucleic acid. In certain embodiments, one, two, three, or four of the nucleosides in the 3' wing segment comprise a 4'-CH2-O2' sugar. In certain embodiments, two of the nucleosides in the 3' wing segment comprise a blocked nucleic acid. In certain embodiments, two of the nucleosides in the 3' wing segment comprise a 4'-CH2-O-2' sugar. In certain embodiments, three of the nucleosides in the 3' wing segment comprise a blocked nucleic acid.In certain embodiments, three of the nucleosides are in the 3' wing segment. Petition 870250074928, dated 08 / 25 / 2025, page 72 / 475 68 / 292 comprise a 4-CH2-O-2' sugar. E1. Wing segment 3' with 4 nucleosides attached (W2)

[00213] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, each of the 4 linked nucleosides comprising a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, 3 of the 4 linked nucleosides comprising a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, 2 of the 4 linked nucleosides comprising a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, where 1 of the 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2>OCH3) sugar. E2. 3' wing segment with 4 linked nucleosides, 2'-deoxy combinations (W2)

[00214] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein one of the linked nucleosides comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein two of the linked nucleosides comprise a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, and one of the 4 linked nucleosides comprises an acid. Petition 870250074928, dated 08 / 25 / 2025, page 73 / 475 69 / 292 blocked nucleic acid and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 4 linked nucleosides comprise a blocked nucleic acid and the other linked nucleoside comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. E3. 3' wing segment with 4 linked nucleosides, 2'-LNA combinations (W2)

[00215] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, one of which comprises a blocked nucleic acid. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, two of which comprise a blocked nucleic acid. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, one of which comprises a 4-CH2-O-2' sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, two of which comprise a 4'-CH2-O-2' sugar.

[00216] In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a blocked nucleic acid and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein two of the 4 linked nucleosides comprise a blocked nucleic acid and each of the other 2 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein three of the 4 linked nucleosides comprise a blocked nucleic acid and the other nucleoside Petition 870250074928, dated 08 / 25 / 2025, page 74 / 475 70 / 292 gado comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein one of the 4 linked nucleosides comprises a 4-CH2-O-2' sugar and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein two of the 4 linked nucleosides comprise a 4-CH2-O-2' sugar and each of the other 2 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 4 linked nucleosides, wherein three of the 4 linked nucleosides comprise a 4'-CH2-O-2' sugar and the other linked nucleoside comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. F1. 3' wing segment with 5 nucleosides attached (W2)

[00217] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, each of the 5 linked nucleosides comprising a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, 4 of the 5 linked nucleosides comprising a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, 3 of the 5 linked nucleosides comprising a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein 2 of the 5 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein 1 of the 5 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. Petition 870250074928, dated 08 / 25 / 2025, page 75 / 475 71 / 292 F2. 3' wing segment with 5 linked nucleosides, 2'-deoxy combinations (W2)

[00218] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein one of the linked nucleosides comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein two of the linked nucleosides comprise a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, one of the 5 linked nucleosides comprises a blocked nucleic acid, and each of the other 3 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar.In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 5 linked nucleosides comprise a blocked nucleic acid, and the other 2 linked nucleosides comprise a nucleoside with a 2'O(CH2)2-OCH3 sugar. F3. 3' wing segment with 5 linked nucleosides, 2'-LNA combinations (W2)

[00219] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, one of which comprises a blocked nucleic acid. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, two of which comprise a blocked nucleic acid. Petition 870250074928, dated 08 / 25 / 2025, page 76 / 475 72 / 292 queado. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, one of which comprises a 4-CH2-O-2' sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, two of which comprise a 4-CH2-O-2' sugar.

[00220] In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a blocked nucleic acid and each of the other 4 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein two of the 5 linked nucleosides comprise a blocked nucleic acid and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein three of the 5 linked nucleosides comprise a blocked nucleic acid and each of the other 2 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar.In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein one of the 5 linked nucleosides comprises a 4'-CH2-O-2' sugar and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2OCH3 sugar. In certain embodiments, the 3' wing segment consists of 5 linked nucleosides, wherein two of the 5 linked nucleosides comprise a 4'-CH2-O-2' sugar and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. G1. Wing segment 3' with 6 nucleosides attached (W2)

[00221] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, each of the 6 nucleosides... Petition 870250074928, dated 08 / 25 / 2025, page 77 / 475 73 / 292 linked nucleosides comprise a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein 5 of the 6 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein 4 of the 6 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein 3 of the 6 linked nucleosides comprise a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein 2 of the 6 linked nucleosides comprise a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein 1 of the 6 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. G2. 3' wing segment with 6 linked nucleosides, 2'-deoxy combinations (W2)

[00222] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein one of the linked nucleosides comprises a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein two of the linked nucleosides comprise a nucleoside with a 2'-deoxy sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein one of the 6 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar and each of the other 5 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein one of the 6 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, and one of the 6 linked nucleosides comprises an acid. Petition 870250074928, dated 08 / 25 / 2025, page 78 / 475 74 / 292 blocked nucleic acid and each of the other 4 linked nucleosides comprises a nucleoside with a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein one of the 5 linked nucleosides comprises a nucleoside with a 2'-deoxy sugar, two of the 6 linked nucleosides comprise a blocked nucleic acid and the other 3 linked nucleosides comprise a nucleoside with a 2'O(CH2)2-OCH3 sugar. G3. 3' wing segment with 6 linked nucleosides, 2'-LNA (W2) combinations

[00223] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, one of which comprises a blocked nucleic acid. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, two of which comprise a blocked nucleic acid. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, one of which comprises a 4-CH2-O-2' sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, two of which comprise a 4'-CH2-O-2' sugar.

[00224] In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein one of the 6 linked nucleosides comprises a blocked nucleic acid and each of the other 5 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein two of the 6 linked nucleosides comprise a blocked nucleic acid and each of the other 4 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein three of the 6 linked nucleosides Petition 870250074928, dated 08 / 25 / 2025, page 79 / 475 75 / 292 comprise a blocked nucleic acid and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein one of the 6 linked nucleosides comprises a 4-CH2-O-2' sugar and each of the other 5 linked nucleosides comprises a nucleoside with a 2'O(CH2)2OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein two of the 6 linked nucleosides comprise a 4-CH2-O-2' sugar and each of the other 4 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. In certain embodiments, the 3' wing segment consists of 6 linked nucleosides, wherein three of the 6 linked nucleosides comprise a 4-CH2-O-2' sugar and each of the other 3 linked nucleosides comprises a nucleoside with a 2'O(CH2)2-OCH3 sugar. H-0 Gap segments

[00225] In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of at least one gap segment. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of at least two gap segments. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of at least three gap segments. In some embodiments, a modified multisegmented antisense oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, or 9 or 10 gap segments. The gap segments are consecutively referred to as a first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth gap segment, respectively, with the first gap segment being closest to the 5' end of the multisegmented antisense oligonucleotide. Petition 870250074928, dated 08 / 25 / 2025, page 80 / 475 76 / 292 modified segmented and the last gap segment being closest to the 3' end of the modified multisegmented antisense oligonucleotide. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of 2 gap segments. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of 3 gap segments. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of 4 gap segments. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of 5 gap segments. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of 6 gap segments. In some embodiments, a modified multisegmented antisense oligonucleotide comprises or consists of 7 gap segments.

[00226] In some embodiments, a gap segment comprises or consists of 1 to 20 linked nucleosides. In some embodiments, a gap segment comprises or consists of 2 to 7 linked nucleosides. In some embodiments, the gap segment consists of 1 nucleoside. In some embodiments, the gap segment consists of 2 linked nucleosides. In some embodiments, the gap segment consists of 3 linked nucleosides. In some embodiments, the gap segment consists of 4 linked nucleosides. In some embodiments, the gap segment consists of 5 linked nucleosides. In some embodiments, the gap segment consists of 6 linked nucleosides. In some embodiments, the gap segment consists of 7 linked nucleosides. In some embodiments, the gap segment consists of 8 linked nucleosides. In some embodiments, the gap segment consists of 9 linked nucleosides. In some embodiments, the Petition 870250074928, dated 08 / 25 / 2025, page 81 / 475 The 77 / 292 lacuna segment consists of 10 linked nucleosides. H-1. First gap segment (G1)

[00227] In certain embodiments, the first gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 2 to 7 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 4 or 5 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 4 linked nucleosides. In certain embodiments, the first gap segment comprises or consists of 5 linked nucleosides.

[00228] In certain embodiments, the first gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the first gap segment comprises or consists of 2 to 7 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the first gap segment comprises or consists of 4 or 5 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the first gap segment comprises or consists of 4 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the first gap segment comprises or consists of 5 linked nucleosides, each with 2'-deoxy sugars. H-2. Second gap segment (G2)

[00229] In certain embodiments, the second gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides. In certain embodiments, the second gap segment comprises or consists of 2 to 7 linked nucleosides. In certain embodiments, the second gap segment comprises or consists of 1 or 2 linked nucleosides. In certain embodiments, the second gap segment comprises or consists of 4 or 5 linked nucleosides. Petition 870250074928, dated 08 / 25 / 2025, page 82 / 475 78 / 292 In certain embodiments, the second gap segment comprises 1 nucleoside. In certain embodiments, the second gap segment comprises or consists of 2 linked nucleosides. In certain embodiments, the second gap segment comprises or consists of 4 linked nucleosides. In certain embodiments, the second gap segment comprises or consists of 5 linked nucleosides.

[00230] In certain embodiments, the second gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the second gap segment comprises or consists of 2 to 7 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the second gap segment comprises or consists of 1 or 2 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the second gap segment comprises 1 nucleoside, with one 2'-deoxy sugar. In certain embodiments, the second gap segment comprises or consists of 2 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the second gap segment comprises or consists of 4 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the second gap segment comprises or consists of 5 linked nucleosides, each with 2'-deoxy sugars.In certain embodiments, the second gap segment comprises or consists of 6 linked nucleosides, each with 2'-deoxy sugars. H-3. Third gap segment (G3)

[00231] In certain embodiments, the third gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides. In certain embodiments, the third gap segment comprises or consists of 2 to 7 linked nucleosides. In certain embodiments, the third gap segment comprises or consists of 4 or 5 linked nucleosides. In certain embodiments, the third gap segment Petition 870250074928, dated 08 / 25 / 2025, p. 83 / 475 79 / 292 lacuna comprises or consists of 4 linked nucleosides. In certain embodiments, the third lacuna segment comprises or consists of 5 linked nucleosides.

[00232] In certain embodiments, the third gap segment comprises or consists of 1, 2, 3, 4, 5, 6, 7, or 8 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the third gap segment comprises or consists of 2 to 7 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the third gap segment comprises or consists of 4 or 5 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the third gap segment comprises or consists of 4 linked nucleosides, each with 2'-deoxy sugars. In certain embodiments, the third gap segment comprises or consists of 5 linked nucleosides, each with 2'-deoxy sugars. J. Separator segment

[00233] In some embodiments, the separator segment comprises 1, 2, 3, 4, or 5 linked nucleosides. In some embodiments, the separator segment comprises 1 nucleoside. In some embodiments, the separator segment comprises 2 nucleosides.

[00234] In some embodiments, the nucleoside comprises a modification. Exemplary modifications include any of the modifications shown in the section entitled Exemplary Modifications, including, but not limited to, a 2'-O-methoxyethyl nucleoside, 2'-O-methoxyethyl cytidine, 2'-O-methyl nucleoside, 2'-O-methyl nucleoside, 2'OH nucleoside, GNA, LNA, cytosine-based LNA, 2'-fluoro 2'-deoxynucleoside, 2'-fluoro 2'-deoxycytidine, 2'-F-arabinonucleic acid (2'-F-ANA) or 2'-F-arabinonucleic acid (2'-F-ANA) or a combination thereof.

[00235] In certain embodiments, the separating segment consists of a nucleoside comprising a 2-OCH3 sugar. In certain mo Petition 870250074928, dated 08 / 25 / 2025, p. 84 / 475 80 / 292 dalidades, the separating segment consists of a nucleoside comprising a 2'-O(CH2)2-OCH3 sugar.

[00236] In certain embodiments, the separator segment is at position 7, 8, 9, 10, 11, 12, 13, or 14 of a modified multisegmented antisense oligonucleotide that is 16 residues long. In certain embodiments, the separator segment is at position 7, 8, 9, 10, 11, 12, 13, or 14 of a modified multisegmented antisense oligonucleotide that is 17 residues long. In certain embodiments, the separator segment is at position 7, 8, 9, 10, 11, 12, 13, or 14 of a modified multisegmented antisense oligonucleotide that is 18 residues long. In certain embodiments, the separator segment is at position 7, 8, 9, 10, 11, 12, 13, or 14 of a modified multisegmented antisense oligonucleotide that is 19 residues long. In certain embodiments, the separator segment is at position 7, 8, 9, 10, 11, 12, 13, or 14 of a modified multisegmented antisense oligonucleotide that is 20 residues long.In certain embodiments, the separator segment is at position 7, 8, 9, 10, 11, 12, 13, or 14 of a modified multisegmented antisense oligonucleotide that is 21 residues long. In certain embodiments, the separator segment is at position 7, 8, 9, 10, 11, 12, 13, or 14 of a modified multisegmented antisense oligonucleotide that is 22 residues long.

[00237] In certain embodiments, the separator segment is at position 9, 10, 11, or 12 of a modified multisegmented antisense oligonucleotide that is 20 residues long.

[00238] In certain embodiments, the separator segment is at position 10 of a modified multisegmented antisense oligonucleotide that is 20 residues long.

[00239] In certain forms, the separator segment is in the po Petition 870250074928, dated 08 / 25 / 2025, page 85 / 475 81 / 292 position 10 of a modified multisegmented antisense oligonucleotide that is 20 residues long and consists of a nucleoside comprising a 2'-O(CH2)2-OCH3 sugar. In certain embodiments, the separator segment consists of a nucleoside comprising a 2'-OCH3 sugar. In certain embodiments, the separator segment is at position 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 of a modified multisegmented antisense oligonucleotide that is 20 residues long. In certain embodiments, the separator segment is at position 9 or 10 or 11 of a modified multisegmented antisense oligonucleotide that is 20 residues long. In certain embodiments, the separator segment is at position 10 of a modified multisegmented antisense oligonucleotide that is 20 residues long.

[00240] In certain embodiments, the separator segment consists of a nucleoside comprising a 2'-O(CH2) 2-OCH3 sugar. In certain embodiments, the separator segment consists of a nucleoside comprising a 2'-OCH3 sugar. In certain embodiments, the separator segment is at position 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 of a modified multisegmented antisense oligonucleotide that is 20 residues long. In certain embodiments, the separator segment is at position 9 or 10 or 11 of a modified multisegmented antisense oligonucleotide that is 20 residues long. In certain embodiments, the separator segment is at position 10 of a modified multisegmented antisense oligonucleotide that is 20 residues long. K. Main structure of the oligonucleotide

[00241] In certain embodiments, the modified multisegmented antisense oligonucleotide is a single strand. In certain embodiments, at least one internucleosidic bond is a modified internucleosidic bond. In certain embodiments, each internucleosidic bond Petition 870250074928, dated 08 / 25 / 2025, page 86 / 475 82 / 292 tip is a phosphorothioate internucleosidic linkage. In some embodiments, a modified multisegmented antisense oligonucleotide of the development comprises one or more modified internucleosidic linkages, wherein the modified internucleosidic linkage is a phosphorodiamidate linkage between morpholino nucleoside mimetics. L. Modified nucleobases

[00242] In certain embodiments, the modified multisegmented antisense oligonucleotide comprises at least one modified nucleobase. In certain embodiments, the modified multisegmented antisense oligonucleotide comprises one, two, or three modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[00243] In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2'-substituted nucleoside. In certain embodiments, the 2'-substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2'-MOE nucleoside. In certain embodiments, the modified nucleoside is a restricted ethyl (cEt) nucleoside. In certain embodiments, each modified nucleoside in each wing segment is independently a 2'-MOE nucleoside or a nucleoside with a bicyclic sugar modification, such as a restricted ethyl (cEt) nucleoside or LNA nucleoside. 4-5-1-5-5 modified multisegmented antisense oligonucleotides

[00244] In certain embodiments, the modified multisegmented antisense oligonucleotide comprises: a 5' wing segment consisting of 4 linked nucleosides; a first gap segment Petition 870250074928, dated 08 / 25 / 2025, page 87 / 475 83 / 292 consisting of 5 nucleosides linked with 2'-deoxy sugars; a separator segment at position 10 of a modified multisegmented antisense oligonucleotide having 20 residues in length; a second gap segment consisting of 5 nucleosides linked with 2'-deoxy sugars; and a 3' wing segment consisting of 5 linked nucleosides. In an exemplary embodiment, the modified multisegmented antisense oligonucleotide of this paragraph further comprises that the cytosines at positions 2, 13, and 20 of a modified multisegmented antisense oligonucleotide having 20 residues in length are each 5-methylcytosine. In an exemplary embodiment of the modified multisegmented antisense oligonucleotide of this paragraph, each cytosine of the modified multisegmented antisense oligonucleotide is a 5-methylcytosine.In an exemplary embodiment, the modified multisegmented antisense oligonucleotide of this paragraph further comprises internucleosidic linkages, each of which is a phosphorothioate internucleosidic linkage. In an exemplary embodiment, the modified multisegmented antisense oligonucleotide of this paragraph further comprises that a cytosine at positions 2, 13, and 20 of a modified multisegmented antisense oligonucleotide that is 20 residues long is each 5-methylcytosine and further comprises internucleosidic linkages, each of which is a phosphorothioate internucleosidic linkage.

[00245] In certain embodiments, the modified multisegmented antisense oligonucleotide comprises: a 5' wing segment described in Section B1, B2 or B3; a first gap segment consisting of 5 nucleosides linked with 2'-deoxy sugars; a separator segment at position 10 of a modified multisegmented antisense oligonucleotide that is 20 residues long; a second gap segment consisting of 5 nucleosides Petition 870250074928, dated 08 / 25 / 2025, page 88 / 475 84 / 292 sugars with 2'-deoxy sugars; and a 3' wing segment described in Section F1, F2, or F3. In an exemplary embodiment, the modified multisegmented antisense oligonucleotide of this paragraph further comprises that the cytosines at positions 2, 13, and 20 of a modified multisegmented antisense oligonucleotide having 20 residues in length are each 5-methylcytosine. In an exemplary embodiment, the modified multisegmented antisense oligonucleotide of this paragraph further comprises internucleosidic linkages in which each is a phosphorothioate internucleosidic linkage.In an exemplary embodiment, the modified multisegmented antisense oligonucleotide of this paragraph further comprises a cytosine at positions 2, 13, and 20 of a modified multisegmented antisense oligonucleotide that is 20 residues long, each of which is 5-methylcytosine, and further comprises internucleosidic linkages, each of which is a phosphorothioate internucleosidic linkage.

[00246] Exemplary notes of the positions and segments of AUS 1493 or SEQ ID NO: 456 are shown below. Wing segment 5' First gap segment Separator segment Second gap segment Wing segment 3' Position 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 SEQ ID NO AUS n° 456 AUS 14 93 GCAG aggtg A agcga A +GT +G +C

[00247] In certain embodiments, the oligonucleotides or compositions comprise a modified multisegmented antisense oligonucleotide salt.

[00248] In certain embodiments, the oligonucleotides or compositions additionally comprise a pharmaceutically acceptable carrier or diluent.

[00249] In certain embodiments, the modified multisegmented antisense compound or oligonucleotide is single-stranded.

[00250] In certain embodiments, at least one nucleoside of Petition 870250074928, dated 08 / 25 / 2025, page 89 / 475 85 / 292 Modified multisegmented antisense oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-O-methoxyethyl group (2'-O(CH2)2OCH3). In certain embodiments, the modified sugar comprises a 2-O-CH3 group. In certain embodiments, the modified nucleobase is a 2'-O-methoxyethyl-5-methylcytidine.

[00251] In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar, the bicyclic sugar comprises a 4'-(CH2)-O-2' bridge, wherein n is 1 or 2. In certain embodiments, the bicyclic sugar comprises a 4'-CH2-O-2' bridge. In certain embodiments, the bicyclic sugar comprises a 4'-CH(CH3)-O-2' bridge. Methods

[00252] The revelation provides methods of treating an individual with an illness or disorder that implicates the target.

[00253] In some modalities, the disease or disorder is a disease or disorder associated with DMPK. In some modalities, the disease or disorder is a disease or disorder associated with AAT. In some modalities, the disease or disorder is a disease or disorder associated with TTR. In some modalities, the disease or disorder is a disease or disorder associated with PCSK9. In some modalities, the disease or disorder is a disease or disorder associated with ApoB. In some modalities, the disease or disorder is a disease or disorder associated with TNF-alpha. In some modalities, the disease or disorder is a disease or disorder associated with ApoCIII-alpha. In some modalities, the disease or disorder is a disease or disorder associated with DMPK. In some modalities, the disease or disorder is a disease or disorder associated with AGT. In some modalities, the disease or disorder is a disease or disorder associated with CFB. In some modalities, the disease or disorder is a disease Petition 870250074928, dated 08 / 25 / 2025, p. 90 / 475 86 / 292 disease or disorder associated with DGAT2. In some modalities, the disease or disorder is a disease or disorder associated with PNPLA3. In some modalities, the disease or disorder is a disease or disorder associated with ALAS1. In some modalities, the disease or disorder is a disease or disorder associated with hydroxyacid oxidase 1.

[00254] In some modalities, the disease or disorder is non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), COVID-19, skin aging conditions, prostate cancer, atherosclerosis, chronic kidney disease, chikungunya virus, amyotrophic lateral sclerosis, advanced malignant solid neoplasm, non-arteritic anterior ischemic optic neuropathy, HIV, immunoglobulin A nephropathy, inflammation and injury, human Tenon's capsule fibroblasts, antifibrotic, cystic fibrosis, Duchenne muscular dystrophy (DMD), myotonic dystrophy 1, centronuclear myopathy, facioscapulohumeral muscular dystrophy (FSHD), pancreatic cancer, solid tumor, cystic fibrosis, antithrombosis, blood clotting disorder, thrombotic disorder, Alexander disease, disease Pompe disease, H1N1 influenza, HBV, liver fibrosis, HPV,Huntington's disease, clear cell renal cell carcinoma, pancreatic cancer, Parkinson's disease, MERS-CoV, inflammatory bowel disease, Alport syndrome, advanced liver cancer, muscular atrophy and mitotic dystrophy, Mycobacterium tuberculosis, rabies, hypercholesterolemia, pulmonary fibrosis, primary or secondary liver cancer, breast cancer, RSV, spinal muscular atrophy, multiple system atrophy, cancer, Alzheimer's disease and frontotemporal degeneration, thalassemia / low-risk myelodysplastic syndrome, autoimmune, hATTR, hereditary transthyretin amyloidosis (attrv), or gout.

[00255] In some modalities, the disease or disorder is a Petition 870250074928, dated 08 / 25 / 2025, page 91 / 475 87 / 292 Matla, (pro)renin / (P) RR receptor, COVID-19 5'UTR, Acc1, Acc2, ACE2, androgen receptor, ApoB, ASGR1, ASO, ATXN2, B1AR, B2AR, C9ORF72, Caspase 2, CD19, CD4, Chikungunya virus, CLPro, complement component 5, COVID-19, COX2, CTGF, DGAT2, DMD, DMPK, DNM2, DUX4, E2 gene, EGFR, Envelope, EphA2, epithelial sodium channel α subunit, exon 100 dystrophin, exon 101 dystrophin, exon 102 dystrophin, exon 103 dystrophin, exon 104 dystrophin, exon 105 dystrophin, exon 106 dystrophin 107, exon 108 dystrophin, exon 109 dystrophin, exon 110 dystrophin, exon 111 dystrophin, exon 112 dystrophin, exon 113 dystrophin, exon 114 dystrophin, exon 115 dystrophin, exon 116 dystrophin, exon 117 dystrophin, exon 118 dystrophin, exon 119 dystrophin, exon 120 dystrophin, exon 121 dystrophin, exon 122 dystrophin, exon 123 dystrophin, exon 124 dystrophin, exon 125 dystrophin, exon 126 dystrophindystrophin of exon 127, dystrophin of exon 128, dystrophin of exon 129, dystrophin of exon 130, dystrophin of exon 131, dystrophin of exon 132, dystrophin of exon 133, dystrophin of exon 134, dystrophin of exon 135, dystrophin of exon 136, dystrophin of exon 137, dystrophin of exon 138, dystrophin of exon 139, dystrophin of exon 140, dystrophin of exon 141, dystrophin of exon 142, dystrophin of exon 143, dystrophin of exon 144, dystrophin of exon 145, dystrophin of exon 146, dystrophin of exon 147, dystrophin of exon 148, dystrophin of exon 149, exon 150 dystrophin, exon 151 dystrophin, exon 152 dystrophin, exon 44 dystrophin, exon 53 dystrophin, exon 54 dystrophin, exon 57 dystrophin, exon 60 dystrophin, exon 63 dystrophin, exon 66 dystrophin, exon 69 dystrophin, exon 55 dystrophin, exon 58 dystrophin, exon 61 dystrophin, exon 64 dystrophin, exon 67 dystrophin, exon 70 dystrophin, exon 56 dystrophin, exon 59 dystrophindystrophin of exon 62, dystrophin of exon 65, dystrophin of exon 68, dystrophin of exon 71, dystrophin of, Petition 870250074928, dated 08 / 25 / 2025, page 92 / 475 88 / 292 exon 72, exon 75, exon 78, exon 81, exon 84, exon 87, exon 90, exon 93, exon 96, exon 73 dystrophin, exon 74 dystrophin, dystrophined exon 76 dystrophin, exon 77 dystrophin, dystrophined exon 79 dystrophin, exon 80 dystrophin, dystrophined exon 82 dystrophin, exon 83 dystrophin, dystrophined exon 85 dystrophin, exon 86 dystrophin, dystrophined exon 88 dystrophin, exon 89 dystrophin, dystrophined exon 91 dystrophin, exon 92 dystrophin, dystrophined exon 94 dystrophin, exon 98 dystrophin 95, exon 97 dystrophin, exon 98 dystrophin, exon 99 dystrophin, Fabp3, Factor VII, Factor XI, FAK, FGFR4, FOXP3, FUS, FXII, GFAP, GFP, glycogen synthase, H1N1, HBV, heat shock protein 47, heat shock protein 48, heat shock protein 49, heat shock protein 50, heat shock protein 51, heat shock protein 52, heat shock protein 53, heat shock protein 54,Heat shock protein 55, heat shock protein 56, heat shock protein 57, heat shock protein 58, heat shock protein 59, Helicase, HIV, HOXB13, HPRT, HPV, Hsd11β1, HTT, hydroxyacid oxidase 1, hydroxysteroid 17β-dehydrogenase 13, hypoxia-inducible factor 2α, spindle protein kinesin and vascular endothelial growth factor, KRAS, leader, leucine-rich repeat kinase 2 (LRRK2), MERS-CoV, MGMT, miR-16, miR-21, MMP-2, MMP-9, MTL-CEBPA, MuRF1, Mycobacterium tuberculosis, COVID-19 N, rabies N 123, rabies N 749, rabies N 903, rabies N1082, rabies N53, rabies N8, gene Chikungunya virus ns1 gene, Chikungunya virus ns2 gene, Chikungunya virus ns3 gene, Chikungunya virus ns4 gene, ORF1b, ORF1a, HIV P24, rabies P330, P53, rabies P721, rabies P91, PCSK9, PDGF, PDL1, COVID-19 PLP, PNPLA3, polo-like kinase 1, protein kinase N3, RAF1, RAF-1, RDRP, RSV, SMN2, SNCA, COVID-19 spike protein, STAT3, TAU, TGFB1, TGFB1 and Cox2, TMPRSS2, TMPRSS6, TNFα,transthyretin, Petition 870250074928, dated 08 / 25 / 2025, page 93 / 475 89 / 292 VEGF, VEGFR2, VER2, xanthine dehydrogenase, and YAP1.

[00256] In certain modalities, the individual is a human being.

[00257] In certain modalities, the individual is a non-human primate, for example, a monkey, for example, a cynomolgus monkey.

[00258] In certain forms, the individual is a rodent, such as a mouse or rat.

[00259] In some embodiments, modified multisegmented antisense oligonucleotides enhance activity in vivo (compared to a sequence that has the same nucleobase sequence but is not modified).

[00260] In some embodiments, the development-modified multisegmented antisense oligonucleotides reduce the result in reduced off-target binding (compared to a sequence that has the same nucleobase sequence but is not modified).

[00261] In some embodiments, the use of the development-modified multisegmented antisense oligonucleotides results in reduced toxicity (compared to a sequence that has the same nucleobase sequence but is not modified).

[00262] In certain embodiments, modified multisegmented antisense oligonucleotides or pharmaceutical compositions are designated as a first agent. In certain embodiments, the methods comprise the administration of a first agent and one or more second agents. In certain embodiments, the first agent and one or more second agents are co-administered. In certain embodiments, the first agent and one or more second agents are co-administered sequentially or concomitantly. In certain embodiments, the first agent and one or more second agents are not co-administered.

[00263] Modified multisegmented antisense oligonucleotides Petition 870250074928, dated 08 / 25 / 2025, page 94 / 475 90 / 292 The pharmaceutical products of the disclosure and the pharmaceutical compositions comprising them may be administered to the individual by any suitable route of administration. Examples of routes of administration include parenteral administration, for example, intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), intraocular, intramuscular, intraperitoneal (into the body cavity) and transmucosal.

[00264] In certain modalities, administration includes parenteral administration. In certain modalities, administration includes subcutaneous administration. In certain modalities, administration includes intravenous injection or infusion.

[00265] In some embodiments, EC50 in cells treated with a modified multisegmented antisense oligonucleotide was measured as a proxy for the efficacy of the modified multisegmented antisense oligonucleotide. In some embodiments, the EC50 is from about 0.1 nM to about 250 nM.In some modalities, the EC50 is less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 49 nM, less than 47 nM, less than 46 nM, less than 45 nM, less than 44 nM, less than 43 nM, less than 42 nM, less than 41 nM, less than 40 nM, less than 39 nM, less than 38 nM, less than 37 nM, less than 36 nM, less than 35 nM, less than 34 nM, less than 33 nM, less than 32 nM, less than 31 nM. less than 30 nM, less than 29 nM, less than 28 nM, less than 27 nM, less than 26 nM, less than 25 nM, less than 24 nM, less than 23 nM, less than 22 nM, less than 21 nM, less than 20 nM, less than 19 nM, less than 18 nM, less than 17 nM, less than 16 nM, less than 15 nM, less than 14 nM, less than 13 nM, less than 12 nM, less than 11 nM, less than 10 nM, less than 9 nM. Petition 870250074928, dated 08 / 25 / 2025, page 95 / 475 91 / 292 less than 8 nM, less than 7 nM, less than 6 nM, less than 5 nM, less than 4 nM, less than 3 nM, less than 2 nM, less than 1 nM, less than 0.9 nM, less than 0.8 nM, less than 0.7 nM, less than 0.6 nM, less than 0.5 nM, less than 0.4 nM, less than 0.3 nM, less than 0.2 nM or less than 0.1 nM.

[00266] In some embodiments, the EC50 ratio in cells treated with a modified multisegmented antisense oligonucleotide / EC50 ratio in cells treated with a reference oligonucleotide (e.g., modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment) is calculated as a measure of effectiveness in reducing target protein expression levels. In some embodiments, the ratio is about 0.05 to about 250. In some embodiments, the ratio is about 0.05 to about 100.In some modalities, the EC50 ratio is less than 250, less than 150, less than 100, less than 90, less than 80, less than 70, less than 65, less than 60, less than 55, less than 50, less than 49, less than 47, less than 46, less than 45, less than 44, less than 43, less than 42, less than 41, less than 40, less than 39, less than 38, less than 37, less than 36, less than 35, less than 34, less than 33, less than 32, less than 31, less than 30, less than 29, less than 28, less than 27, less than 26, less than 25, less than 24, less than 23, less than 22, less than 21, less than 20, less than 19, less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, less than 1, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, or less than 0.1.

[00267] In some modes, the value of MTT CC25 (nM) is Petition 870250074928, dated 08 / 25 / 2025, p. 96 / 475 92 / 292 is used as a measure of cellular toxicity. In some embodiments, the MTT CC25 of cells treated with the modified multisegmented antisense oligonucleotide described herein is from about 10 nM to about 250 nM. In some modalities, the MTT CC25 is greater than 10 nM, greater than 15 nM, greater than 20 nM, greater than 25 nM, greater than 30 nM, greater than 35 nM, greater than 40 nM, greater than 45 nM, greater than 50 nM, greater than 55 nM, greater than 60 nM, greater than 65 nM, greater than 70 nM, greater than 75 nM, greater than 80 nM, greater than 85 nM, greater than 90 nM, greater than 95 nM, greater than 100 nM, greater than 110 nM, greater than 120 nM, greater than 130 nM, greater than 140 nM, greater than 150 nM, greater than 160 nM, greater than 170 nM, greater than 180 nM, greater than 190 nM. greater than 200 nM, greater than 210 nM, greater than 220 nM, greater than 230 nM, greater than 240 nM, or greater than 250 nM.

[00268] In some embodiments, CCK8 CC30 (nM) is used as a measure of cellular toxicity. In some embodiments, the CCK8 CC30 of cells treated with the modified multisegmented antisense oligonucleotide described herein is from about 10 nM to about 250 nM. In some modalities, CCK8 CC30 is greater than 10 nM, greater than 15 nM, greater than 20 nM, greater than 25 nM, greater than 30 nM, greater than 35 nM, greater than 40 nM, greater than 45 nM, greater than 50 nM, greater than 55 nM, greater than 60 nM, greater than 65 nM, greater than 70 nM, greater than 75 nM, greater than 80 nM, greater than 85 nM, greater than 90 nM, greater than 95 nM, greater than 100 nM, greater than 110 nM, greater than 120 nM, greater than 130 nM, greater than 140 nM, greater than 150 nM, greater than 160 nM, greater than 170 nM, greater than 180 nM, greater than 190 nM, greater than 200 nM, greater than 210 nM, greater than 220 nM, greater than 230 nM, greater than 240 nM, or greater than 250 nM.

[00269] In some modes, the MTT ratio is CC25 or CCK8 Petition 870250074928, dated 08 / 25 / 2025, p. 97 / 475 93 / 292 CC30 of cells treated with a modified multisegmented antisense oligonucleotide / MTT CC25 or CCK8. CC30 of cells treated with a reference oligonucleotide (e.g., modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment) is calculated as a measure of cellular toxicity (relative cellular toxicity). In some embodiments, the ratio of MTT CC25 or CCK8 CC30 of cells treated with a modified multisegmented antisense oligonucleotide / MTT CC25 or CCK8 CC30 of cells treated with a reference oligonucleotide (e.g., modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment) is less than 250, less than 150, less than 100, less than 90, less than 80, less than 70, less than 65, less than 60, less than 55, less than 50, less than 49, less than 47, less than 46, less than 45, less than 44, less than 43, less than 42,less than 41, less than 40, less than 39, less than 38, less than 37, less than 36, less than 35, less than 34, less than 33, less than 32, less than 31, less than 30, less than 29, less than 28, less than 27, less than 26, less than 25, less than 24, less than 23, less than 22, less than 21, less than 20, less than 19, less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, less than 1, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, or less than 0.1.

[00270] In some modalities, the C / E ratio is used as a measure of effectiveness in reducing target protein expression levels relative to cellular toxicity. In some modalities, the Petition 870250074928, dated 08 / 25 / 2025, page 98 / 475 The 94 / 292 C / E ratio is calculated by taking the MTT CC25 (nM) ratio of a modified multisegmented antisense oligonucleotide to the MTT CC25 (nM) ratio of a reference oligonucleotide (e.g., a modified antisense oligonucleotide with the same template nucleobase sequence that does not include a separator segment) and dividing it by the EC50 ratio of a modified multisegmented antisense oligonucleotide to the EC50 ratio of a reference oligonucleotide (e.g., a modified antisense oligonucleotide with the same template nucleobase sequence that does not include a separator segment).In some embodiments, the C / E ratio is calculated by taking the CCK8 CC25 (nM) ratio of a modified multisegmented antisense oligonucleotide / CCK8 CC25 (nM) of a reference oligonucleotide (e.g., a modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment) and dividing it by the EC50 ratio of a modified multisegmented antisense oligonucleotide / EC50 of a reference oligonucleotide (e.g., a modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment). In some embodiments, the C / E ratio is from about 0.01 to about 50.In some modalities, the C / E ratio is greater than 1, greater than 1.1, greater than 1.2, greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.6, greater than 1.7, greater than 1.8, greater than 1.9, greater than 2.0, greater than 2.1, greater than 2.2, greater than 2.3, greater than 2.4, greater than 2.5, greater than 2.6, greater than 2.7, greater than 2.8, greater than 2.9, greater than 3.0, greater than 10, greater than 11, greater than 12, greater than 13, greater than 14, greater than 15, greater than 16, greater than 17, greater than 18, greater than 19, greater than 20, greater than 21, greater than 22, greater than 23, greater than 24. greater than 25, greater than 30, greater than 35, greater than 40, greater than 45, greater than 50, greater than 55, greater than 65, greater than 70, greater than. Petition 870250074928, dated 08 / 25 / 2025, page 99 / 475 95 / 292 80, greater than 90, or greater than 100.

[00271] In some embodiments, the melting temperature of the modified multisegmented antisense oligonucleotide is used as a measure of stability. In some embodiments, the melting temperature of the modified multisegmented antisense oligonucleotide described herein is at least 0.01 times lower than that of a reference oligonucleotide (e.g., a modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment). In some embodiments, the melting temperature is about 0.01 times, about 0.02 times, about 0.03 times, about 0.04 times, about 0.05 times, about 0.06 times, about 0.07 times, about 0.08 times, about 0.09 times, about 0.1 times, about 0.15 times, about 0.2 times, about 0.25 times, about 0.3 times, about 0.35 times, about 0.4 times, about 0.45 times, about 0.5 times, about 0.55 times, about 0.6 times, about 0.65 times, about 0.7 times, about 0.75 times, about 0.8 times, about 0,85 times, approximately 0.9 times, approximately 0.95 times, approximately 1 time, approximately 1.1 times, approximately 1.15 times, approximately 1.2 times, approximately 1.25 times, approximately 1.3 times, approximately 1.35 times, approximately 1.4 times, approximately 1.45 times, approximately 1.5 times, approximately 1.55 times, approximately 1.6 times, approximately 1.65 times, approximately 1.7 times, approximately 1.75 times, approximately 1.8 times, approximately 1.85 times, approximately 1.9 times, approximately 1.95 times, approximately 2 times, approximately 2.1 times, approximately 2.15 times, approximately 2.2 times, approximately 2.25 times, approximately 2.3 times, approximately 2.35 times, approximately 2.4 times, approximately 2.45 times, approximately 2.5 times, approximately 2.55 times, approximately 2.6 times, approximately 2.65 times, approximately 2.7 times, approximately 2.75 times, approximately 2.8 times, approximately 2.85 times, approximately 2.9 times, approximately 2.95 times, approximately 3 times, approximately 3.1 times, approximately 3.15 times, approximately 3.2 times, approximately 3.25 times, approximately 3.3 times, approximately 3.35 times, approximately 3.4 times, approximately 3.45 times, approximately, Petition 870250074928, dated 08 / 25 / 2025, page 100 / 475 96 / 292 3.5 times, approximately 3.55 times, approximately 3.6 times, approximately 3.65 times, approximately 3.7 times, approximately 3.75 times, approximately 3.8 times, approximately 3.85 times, approximately 3.9 times, approximately 3.95 times, approximately 4 times, approximately 4.1 times, approximately 4.15 times, approximately 4.2 times, approximately 4.25 times, approximately 4.3 times, approximately 4.35 times, approximately 4.4 times, approximately 4.45 times, approximately 4.5 times, approximately 4.55 times, approximately 4.6 times, approximately 4.65 times, approximately 4.7 times, approximately 4.75 times, approximately 4.8 times, approximately 4.85 times, approximately 4.9 times, approximately 4.95 times or approximately 5 times less than a reference oligonucleotide (e.g., a modified antisense oligonucleotide with the same template nucleobase sequence that does not include a separator segment).

[00272] In some embodiments, the ability of a modified multisegmented antisense oligonucleotide to recruit an endonuclease (e.g., RNaseH) and degrade a template sequence is used as a measure of biological function. In some embodiments, the degradation of a template sequence by a modified multisegmented oligonucleotide is at least 0.01 times greater than a reference oligonucleotide (e.g., a modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment).In some embodiments, the degradation of a template sequence by a modified multisegmented oligonucleotide is approximately 0.01-fold, approximately 0.02-fold, approximately 0.03-fold, approximately 0.04-fold, approximately 0.05-fold, approximately 0.06-fold, approximately 0.07-fold, approximately 0.08-fold, approximately 0.09-fold, approximately 0.1-fold, approximately 0.15-fold, approximately 0.2-fold, approximately 0.25-fold, approximately 0.3-fold, approximately 0.35-fold, approximately 0.4-fold, approximately 0.45-fold, approximately 0.5-fold, approximately 0.55-fold, approximately 0.6-fold, approximately 0.65-fold, approximately 0.7-fold, approximately 0.75-fold, approximately 0.8-fold, approximately 0.85-fold, approximately 0.9 times, about 0.95 times, about. Petition 870250074928, dated 08 / 25 / 2025, page 101 / 475 97 / 292 of 1 time, approximately 1.1 times, approximately 1.15 times, approximately 1.2 times, approximately 1.25 times, approximately 1.3 times, approximately 1.35 times, approximately 1.4 times, approximately 1.45 times, approximately 1.5 times, approximately 1.55 times, approximately 1.6 times, approximately 1.65 times, approximately 1.7 times, approximately 1.75 times, approximately 1.8 times, approximately 1.85 times, approximately 1.9 times, approximately 1.95 times, approximately 2 times, approximately 2.1 times, approximately 2.15 times, approximately 2.2 times, approximately 2.25 times, approximately 2.3 times, approximately 2.35 times, approximately 2.4 times, approximately 2.45 times, approximately 2.5 times, approximately 2.55 times, approximately 2.6 times, approximately 2.65 times, approximately 2.7 times, approximately 2.75 times, approximately 2.8 times, approximately 2.85 times, approximately 2.9 times, approximately 2.95 times, approximately 3 times, approximately 3.1 times, approximately 3.15 times, approximately 3.2 times, approximately 3.25 times, approximately 3.3 times, approximately 3.35 times, approximately 3.4 times, approximately 3.45 times, approximately 3.5 times, approximately 3.55 times, approximately 3.6 times, approximately 3.65 times,approximately 3.7 times, approximately 3.75 times, approximately 3.8 times, approximately 3.85 times, approximately 3.9 times, approximately 3.95 times, approximately 4 times, approximately 4.1 times, approximately 4.15 times, approximately 4.2 times, approximately 4.25 times, approximately 4.3 times, approximately 4.35 times, approximately 4.4 times, approximately 4.45 times, approximately 4.5 times, approximately 4.55 times, approximately 4.6 times, approximately 4.65 times, approximately 4.7 times, approximately 4.75 times, approximately 4.8 times, approximately 4.85 times, approximately 4.9 times, approximately 4.95 times, or approximately 5 times greater than a reference oligonucleotide (e.g., modified antisense oligonucleotide with the same model nucleobase). a sequence that does not include a separator segment. Kits and supplies for manufacturing

[00273] The disclosure provides kits comprising the modified multisegmented antisense oligonucleotides described herein and pharmaceutical compositions comprising the same. In some Petition 870250074928, dated 08 / 25 / 2025, page 102 / 475 98 / 292 embodiments, the modified multisegmented antisense oligonucleotide comprises a structure of any of the oligonucleotide sequences described herein. Target nucleic acids, target regions, and nucleotide sequences

[00274] Modified multisegmented antisense oligonucleotides can be targeted to any target of interest.

[00275] Targets can be any target for which a reduction in activity is desired. In some embodiments, the target is a mammalian target, for example, a human or other animal target; targeting an oncogenic target, an inflammatory target, a metabolic target, a cardiovascular target, a neurological target, a neuropsychiatric target, or similar. In some embodiments, the target is a gene transcript (e.g., an mRNA) or an RNA that regulates gene expression. Exemplary genes include, but are not limited to, DMPK, AAT, TTR, PCSK9, ApoB, ApoCIII, TNF-alpha, AGT, CFB, DGAT2, PNPLA3, ALAS1, or hydroxyacid oxidase 1. In some embodiments, the gene is DMPK, AAT, TTR, or PCSK9.

[00276] In some embodiments, the gene is Mat1α, (pro)renin / (P) RR receptor, COVID-19 5'UTR, Acc1, Acc2, ACE2, androgen receptor, ApoB, ASGR1, ASO, ATXN2, B1AR, B2AR, C9ORF72, Caspase 2, CD19, CD4, Chikungunya virus, CLPro, complement component 5, COVID19, COX2, CTGF, DGAT2, DMD, DMPK, DNM2, DUX4, E2 gene, EGFR, Envelope, EphA2, epithelial sodium channel subunit α, exon 100 dystrophin, exon 101 dystrophin, exon 102 dystrophin, exon 103 dystrophin, exon 104 dystrophin, exon 105 dystrophin, dystrophin of exon 106, dystrophin of exon 107, dystrophin of exon 108, dystrophin of exon 109, dystrophin of exon 110, dystrophin of exon 111, dystrophin of exon 112, dystrophin of exon 113, dystrophin of exon 114, dystrophin of exon 115, dystrophin of exon 116, dystrophin of exon 117, dystrophin of exon 118, dystrophin of exon 119, dystrophin Petition 870250074928, dated 08 / 25 / 2025, page 103 / 475 99 / 292 of exon 120, dystrophin of exon 121, dystrophin of exon 122, dystrophin of exon 123, dystrophin of exon 124, dystrophin of exon 125, dystrophin of exon 126, dystrophin of exon 127, dystrophin of exon 128, dystrophin of exon 129, dystrophin of exon 130, dystrophin of exon 131, dystrophin of exon 132, dystrophin of exon 133, dystrophin of exon 134, dystrophin of exon 135, dystrophin of exon 136, dystrophin of exon 137, dystrophin of exon 138, dystrophin of exon 139, dystrophin of exon 140, dystrophin of exon 141, dystrophin of exon 142, dystrophin of exon 143, dystrophin of exon 144, dystrophin of exon 145, dystrophin of exon 146, dystrophin of exon 147, dystrophin of exon 148, dystrophin of exon 149, dystrophin of exon 150, dystrophin of exon 151, dystrophin of exon 152, dystrophin of exon 44, dystrophin of exon 53, dystrophin of exon 54, dystrophin of exon 55, dystrophin of exon 58, dystrophin of exon 61, dystrophin of exon 64, dystrophin of exon 67, dystrophin of exon 70,dystrophin of exon 73, dystrophin of exon 76, dystrophin of exon 79, dystrophin of exon 82, dystrophin of exon 85, dystrophin of exon 88, dystrophin of exon 91, dystrophin of exon 94, dystrophin of exon 56, dystrophin of exon 59, dystrophin of exon 62, dystrophin of exon 65, dystrophin of exon 68, dystrophin of exon 71, dystrophin of exon 74, dystrophin of exon 77, dystrophin of exon 80, dystrophin of exon 83, dystrophin of exon 86, dystrophin of exon 89, dystrophin of exon 92, dystrophin of exon 95, dystrophin of exon 57, dystrophin of exon 60, dystrophin of exon 63, exon 66 dystrophin, exon 69 dystrophin, exon 72 dystrophin, exon 75 dystrophin, exon 78 dystrophin, exon 81 dystrophin, exon 84 dystrophin, exon 87 dystrophin, exon 90 dystrophin, exon 93 dystrophin, exon 96 dystrophin, exon 97 dystrophin, exon 98 dystrophin, exon 99 dystrophin, Fabp3, Factor VII, Factor XI, FAK, FGFR4, FOXP3, FUS, FXII, GFAP, GFP, glycogen synthase, H1N1, HBV,heat shock protein 47, heat shock protein 48, heat shock protein 49, heat shock protein, Petition 870250074928, dated 08 / 25 / 2025, page 104 / 475 100 / 292 50, heat shock protein 51, heat shock protein 52, heat shock protein 53, heat shock protein 54, heat shock protein 55, heat shock protein 56, heat shock protein 57, heat shock protein 58, heat shock protein 59, Helicase, HIV, HOXB13, HPRT, HPV, Hsd11β1, HTT, hydroxyacid oxidase 1, hydroxysteroid 17β-dehydrogenase 13, hypoxia-inducible factor 2α, spindle protein kinesin and vascular endothelial growth factor, KRAS, leader, leucine-rich repeat kinase 2 (LRRK2), MERS-CoV, MGMT, miR-16, miR-21, MMP-2, MMP-9, MTL-CEBPA, MuRF1, Mycobacterium tuberculosis, COVID-19 N, rabies N 123, rabies N 749, rabies N 903, rabies N1082, rabies N53, rabies N8, Chikungunya virus ns1 gene, Chikungunya virus ns2 gene, Chikungunya virus ns3 gene, Chikungunya virus ns4 gene, ORF1 b, ORF1a, HIV P24, rabies P330, P53, rabies P721, rabies P91, PCSK9, PDGF, PDL1, COVID-19 PLP, PNPLA3, pole-like kinase 1,protein kinase N3, RAF1, RAF-1, RDRP, RSV, SMN2, SNCA, Covid-19 spike, STAT3, TAU, TGFB1, TGFB1 and Cox2, TMPRSS2, TMPRSS6, TNFα, transthyretin, VEGF, VEGFR2, VER2, xanthine dehydrogenase or YAP1.

[00277] Exemplary nucleic acid target sequences include, but are not limited to, those shown in Tables 8.1, 8.2, and 8.3. In some embodiments, the nucleic acid target comprises a sequence from any of the sequences described in Tables 8.1, 8.2, and 8.3. Each of the residues in Tables 8.1, 8.2, and 8.3 reflects only sequence information, without any modified nucleoside. Petition 870250074928, dated 08 / 25 / 2025, p. 105 / 475 101 / 292 Table 8.1. Nucleobase sequences of exemplary modified multisegmented antisense oligonucleotide and gene target sequences. Gene AUS# Modified multisegmented antisense oligonucleotide nucleobase sequence SEQ ID NO: Gene target sequence SEQ ID NO: PCSK9 AUS-P GGGCTCATAGCACATTA TCC 1432 CCCGAGTATCGTGT AATAGG 1454 DMPK AUSCAGAGAGD AUSCAGAGA34GATA ACAGACAATAAATA CCGAGG 1455 TTR AUS-T TACAAATGGGATGCTAC TGC 1434 ATGTTTACCCTACGA TGACG 1456 AAT AUS-A ACCCAATTCAGAAGGAA GGA 1435 TGGGTTAAGTCTTCC TTCCT 1457 AUS-T GCCGGGGGGGGGGGG 1436 GGAACCGGTGCGGC CGTAGG 1458 DMPK AUS- DA ACAGACAATAAATACCG AGG 1437 TGTCTGTTATTTATG GCTCC 1459 DMPK AUS- DB CGGAGCGGTTGTGAACT GGC 1438 GCCTCGCCAACACCAGCTGGAACT GGC GCGUAGAAGGGCGUCU GCCC 1439 CGCATCTTCCCGCA GACGGG 1461 TTR AUSTA UCUUGGTTACATGAAAU CCC 1440 AGAACCAATGTACT TTAGGG 1462 AAT AUSAA TGTTAAACATGCCTAAA CGCT 14ATTT4 TGGATTG 163141 GCCTAA AUSAB GCCTCAGTCTGCTTCGCA CC 1442 CGGAGTCAGACGAA GCGTGG 1464 ApoCIII AUSAC AGCTTCTTGTCCAGCTTT AT 1443 TCGAAGAACAGGTC GAAATA 1465 TNFalfa AUS- TB GCTGATTAGAGAGAGGT CCC CCC4GTC4GTC4GTC 1466TNFalfa AUSTC AAGAGGACCTGGGAGTA GAT 1445 TTCTCCTGGACCCTC ATCTA 1467 AGT AUSAG CACAAACAAGCTGGTCG GUU 1446 GTGTTTGTTCGACCA GCCAA 1468 CFB AUSCF ATCCCACGCCCCTGTGGGGGGGGGGG4 1469 DGAT2 AUSDG TGCCATTTAATGAGCTTC AC 1448 ACGGTAAATTACTC GAAGTG 1470 PNPLA3 AUSPN TACTTTATTCAATGTGGC TT 1449 ATGAAATAAGTTAC ACCGAA 1471 PCSK9 AUS- PCB ACAAGAACAAC ACAGAAC1450 TGTTTTCGTTGTC CAGAT 1472 ALAS1 AUSAL UAAGAUGAGACACUCU UUCU 1451 ATTCTACTCTGTGAG AAAGA 1473 TTR AUS- TD AUGGAAUACUCUUGGU UACT 1452 TACCTTATGAGAAC CAGAT 1474 hydroxide Aci-H UAUAUUUCCAGGAUGA AAGU 1453 ATATAAAGGTCCTA CTTTCA 1475 Petition 870250074928, of 25 / 08 / 2025, p. 106 / 475 102 / 292 Table 8.2. Exemplary HBV target sequences Sequência alvo de HBV SEQ ID NO: CTTGG TCATG GGCCA TCAG 1 GCACT TCGCT TCACC TCTGC 4 TTTGTTTACGTCCCGTCGGC 1484 TTTACGTCCCGTCGGCGCTGAATCCTGCGG 1485 TTTACGTCCCGTCGGCGCTG 1486 TTTACGCGGACTCCCCGTCT 1487 TTGTTTACGTCCCGTCGGCG 1488 TTGTTGACAAGAATCCTCAC 1489 TTGAGAGAAGTCCACCACG 1490 TTCTCCTGGCTCAGTTTACTAGTGCCATTT 1491 TTCTCCTGGCTCAGTTTACT 1492 TTACGTCCCGTCGGCGCTGA 1493 TGTTTACGTCCCGTCGGCGC 1494 TGTGCCTTCTCATCTGCCGG 1495 TGTGCACTTCGCTTCACCTC 1496 TGGTGGACTTCTCTCAATTT 1497 TGGCTCAGTTTACTAGTGCC 1498 TGGACTTCTCTCAATTTTCTAGGGG 1499 TGGACTTCTCTCAATTTTCT 1500 TGCCTTCTCATCTGCCGGAC 1501 TGCCGGACCGTGTGCACTTC 1502 TGCCGATCCATACTGCGGAA 1503 TGCACTTCGCTTCACCTCTG 1504 TGACAAGAATCCTCACAATA 1505 TCTTTACGCGGACTCCCCGT 1506 TCTTGTTGACAAGAATCCTC 1507 Petição 870250074928, de 25 / 08 / 2025, pág. 107 / 475 103 / 292 Sequência alvo de HBV SEQ ID NO: TCTGTGCCTTCTCATCTGCC 1508 TCTGCCGATCCATACTGCGG 1509 TCTCTTTACGCGGACTCCCC 1510 TCTCATCTGCCGGACCGTGT 1511 TCGGCGCTGAATCCTGCGGA 1512 TCCTGGCTCAGTTTACTAGT 1513 TCCTCACAATACCGCAGAGT 1514 TCCCGTCGGCGCTGAATCCT 1515 TCCATACTGCGGAACTCCTA 1516 TCATCTGCCGGACCGTGTGC 1517 TCATCTCGAACGTTCACAGTCA 1518 TCAGTTTACTAGTGCCATTT 1519 TATTGTGAGGATTCTTGTCA 1520 TAGGAGGCTGTAGGCATAAATTGGTCTGCG 1521 TACGTCCCGTCGGCGCTGAA 1522 TACGCGGACTCCCCGTCTGT 1523 GTTTACGTCCCGTCGGCGCT 1524 GTTGGTGCACTTCGCTTCAC 1525 GTTGACAAGAATCCTCACAA 1526 GTTCCCAGTATGGATCGGC 1527 GTGTGCACTTCGCTTCACCT 1528 GTGGTGGACTTCTCTCAATT 1529 GTGGACTTCTCTCAATTTTCT 1530 GTGGACTTCTCTCAATTTTC 1531 GTGCCTTCTCATCTGCCGGA 1532 GTGCACTTCGCTTCACCTCT 1533 GTGAAGCGAAGTGCACACGG 1534 GTCTGTGCCTTCTCATCTGC 1535 GTCGGCGCTGAATCCTGCGG 1536 GTCCCGTCGGCGCTGAATCC 1537 GTATTGTGAGGATTCTTGTC 1538 GGTGGACTTCTCTCAATTTT 1539 GGGCGCACCTCTCTTTACGC 1540 GGCTGTAGGCATAAATTGGT 1541 GGCGCTGAATCCTGCGGACG 1542 GGAGGAACCTTCAGGGAAGG 1543GGACTCCCCGTCTGTGCCTT 1544 GGACCGTGTGCACTTCGCTT 1545 GCTGTAGGCATAAATTGGT 1546 GCTGAATCCTGCGGACGACC 1547 Petition 870250074928, dated 08 / 25 / 2025, page 108 / 475 104 / 292 Sequência alvo de HBV SEQ ID NO: GCTCAGTTTACTAGTGCCAT 1548 GCGGACTCCCCGTCTGTGCC 1549 GCGCTGAATCCTGCGGACGA 1550 GCGCACCTCTCTTTACGCGG 1551 GCCTTCTCATCTGCCGGACC 1552 GCCGGACCGTGTGCACTTCG 1553 GCCGATCCATACTGCGGAAC 1554 GCCGATCCATACTGCGGAA 1555 GCACTTCGCTTCACCTCTGC 1556 GCACTAGTAAACTGAGCCAG 1557 GCACCTCTCTTTACGCGGAC 1558 GATCCATACTGCGGAACTCC 1559 GACTCCCCGTCTGTGCCTTC 1560 GACCGTGTGCACTTCGCTTC 1561 GACAAGAATCCTCACAATAC 1562 GAATCCTCACAATACCGCAG 1563 GAAAATTGAGAGAAGTCCAC 1564 CTTTGTTTACGTCCCGTCGG 1565 CTTGTTGACAAGAATCCTCACAATACCGCA 1566 CTTCTCATCTGCCGGACCGT 1567 CTGTGCCTTCTCATCTGCCG 1568 CTGGCTCAGTTTACTAGTGC 1569 CTGGCTCAGTTTACTAGTG 1570 CTGCCGGACCGTGTGCACTT 1571 CTGCCGATCCATACTGCGGA 1572 CTCTGCCGATCCATACTGCG 1573 CTCCTGGCTCAGTTTACTAG 1574 CTCCCCGTCTGTGCCTTCTC 1575 CTCACAATACCGCAGAGTCT 1576 CTATCAAGGTATGTTGCCCGTTTGTCCTCT 1577 CGTGTGCACTTCGCTTCACC 1578 CGTGGTGGACTTCTCTCAATTTTCTAGGGG 1579 CGTGGTGGACTTCTCTCAATTTTCT 1580 CGTGGTGGACTTCTCTCAAT 1581 CGTGGTGGACTTCTCTCAAT 1582 CGTCGGCGCTGAATCCTGCG1583 CGTCCCGTCGGCGCTGAATC 1584 CGGGGCGCACCTCTCTTTAC 1585 CGGCGCTGAATCCTGCGGAC 1586 CGGACTCCCCGTCTGTGCCT 1587 Petition 870250074928, dated 08 / 25 / 2025, page 109 / 475 105 / 292 Sequência alvo de HBV SEQ ID NO: CGGACCGTGTGCACTTCGCT 1588 CGCTGAATCCTGCGGACGAC 1589 CGCGGACTCCCCGTCTGTGC 1590 CGCACCTCTCTTTACGCGGA 1591 CCTTTGTTTACGTCCCGTCG 1592 CCTTCTCATCTGCCGGACCG 1593 CCTTAGGCACTCCTGCCTCT 1594 CCTGGCTCAGTTTACTAGTG 1595 CCTCTGCCGATCCATACTGCGGAACTCCTA 1596 CCTCTGCCGATCCATACTGC 1597 CCTCTCTTTACGCGGACTCC 1598 CCTCACAATACCGCAGAGTC 1599 CCGTGTGCACTTCGCTTCAC 1600 CCGTGTGCACTTCGCTGTTG 1601 CCGTGTGCACTTCGCT 1602 CCGTCTGTGCCTTCTCATCT 1603 CCGTCGGCGCTGAATCCTGC 1604 CCGGTCCGTGTGCACTTCGC 1605 CCGGACCGTGTGCACTTCGC 1606 CCGATCCATACTGCGGAACT 1607 CCCGTCGGCGCTGAATCCTG 1608 CCCCGTCTGTGCCTTCTCAT 1609 CAGGTCCCCTAGAAGAAGAA 1610 CACGGGGCGCACCTCTCTTT 1611 CACCTCTCTTTACGCGGACT 1612 CAAGAATCCTCACAATACCG 1613 ATCTGCCGGACCGTGTGCAC 1614 ATCCTCACAATACCGCAGAG 1615 AGACTCGTGGTGGACTTCTCTCAATTTTCT 1616 AGAATCCTCACAATACCGCA 1617 ACGTCCCGTCGGCGCTGAAT 1618 ACGCGGACTCCCCGTCTGTG 1619 ACCTCTCTTTACGCGGACTC 1620 ACCGTGTGCACTTCGCTTCA 1621 ACCAATTTATGCCTACAGCG 1622 ACAAGAATCCTCACAATACC 1623AATCCTCACAATACCGCAGA 1624 AAGGTATGTTGCCCGTTTGT 1625 AAGAATCCTCACAATACCGC 1626 CTAGACTCGTGGTGGACTTC 1627 Petition 870250074928, dated 08 / 25 / 2025, page 110 / 475 106 / 292 HBV target sequence SEQ ID NO: CCTGCTGCTATGCCTCATCT 1628 CTGCTGCTATGCCTCATCTT 1629 TGCTGCTATGCCTCATCTTC 1630 GCTGCTATGCCTCATCTTCT 1631 CTGCTATGCCTCATCTTCTT 1632 CCTATGGGAGTGGGCCTCAG 1633 GCCATTTGTTCAGTGGTTCG 1634 GGAGGCTGTAGGCATAAATT 1635 GAGGCTGTAGGCATAAATTG 1636 AGGCTGTAGGCATAAATTGG 1637 GGCTGTAGGCATAAATTGGT 1638 TTCAAGCCTCCAAGCTGTGC 1639 TCAAGCCTCCAAGCTGTGCC 1640 CAAGCCTCCAAGCTGTGCCT 1641 AAGCCTCCAAGCTGTGCCTT 1642 AGCCTCCAAGCTGTGCCTTG 1643 GCCTCCAAGCTGTGCCTTGG 1644 GAACTCCCTCGCCTCGCAGA 1645 CACCATATTCTTGGGAACA 1646 HBV

[00278] Certain embodiments provide methods, modified multisegmented antisense oligonucleotides and compositions to inhibit HBV mRNA expression.

[00279] Certain embodiments provide modified multisegmented antisense oligonucleotides targeting an HBV nucleic acid sequence. Exemplified HBV nucleic acid sequences include, but are not limited to, those shown in Table 8.3. Table 8.3 Exemplary HBV Sequences Genótipo de HBV N° de acesso SEQ ID NO: Sequência GTD (células HepG 2.2.15) U95551.1 3 AATTCCACAACCTTTCACCAAACTCTGCAAGATCCCAGAGTGAGAGGCCT GTATTTCCCTGCTGGTGGCTCCAGTTCAGGAGCAGTAAACCCTGTTCCGA CTACTGCCTCTCCCTTATCGTCAATCTTCTCGAGGATTGGGGACCCTGCG CTGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTTCTCGTGTT ACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTC TAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAACTACCGTGTGT CTTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTG TCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCA TCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTG GACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCCTCAAC CACCAGCACGGGACCATGCCGAACCTGCATGACTACTGCTCAAGGAACCT CTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACC Petição 870250074928, de 25 / 08 / 2025, pág. 111 / 475 107 / 292 Genótipo de HBV N° de acesso SEQ ID NO: Sequência TGTATTCCCATCCCATCATCCTGGGCTTTCGGAAAATTCCTATGGGAGTG GGCCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGT GGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATG TGGTATTGGGGGCCAAGTCTGTACAGCATCTTGAGTCCCTTTTTACCGCT GTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTAACAAAAC AAAGAGATGGGGTTACTCTCTGAATTTTATGGGTTATGTCATTGGAAGTT ATGGGTCCTTGCCACAAGAACACATCATACAAAAAATCAAAGAATGTTTT AGAAAACTTCCTATTAACAGGCCTATTGATTGGAAAGTATGTCAACGAAT TGTGGGTCTTTTGGGTTTTGCTGCCCCATTTACACAATGTGGTTATCCTG CGTTAATGCCCTTGTATGCATGTATTCAATCTAAGCAGGCTTTCACTTTC TCGCCAACTTACAAGGCCTTTCTGTGTAAACAATACCTGAACCTTTACCC CGTTGCCCGGCAACGGCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCC CCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCGTGCGTGGAACCTTT TCGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGC TCGCAGCAGGTCTGGAGCAAACATTATCGGGACTGATAACTCTGTTGTCC TCTCCCGCAAATATACATCGTATCCATGGCTGCTAGGCTGTGCTGCCAAC TGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCC TGCGGACGACCCTTCTCGGGGTCGCTTGGGACTCTCTCGTCCCCTTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCTTTACGCGGACTCC CCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCT GCACGTCGCATGGAGACCACCGTGAACGCCCACCGAATGTTGCCCAAGGT CTTACATAAGAGGACTCTTGGACTCTCTGCAATGTCAACGACCGACCTTG AGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTTGGGGGAG GAGATTAGATTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGT CTGCGCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCTTG TTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGG GCATGGACATCGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTC TCGTTTTTGCCTTCTGACTTCTTTCCTTCAGTACGAGATCTTCTAGATAC CGCCTCAGCTCTGTATCGGGAAGCCTTAGAGTCTCCTGAGCATTGTTCAC CTCACCATACTGCACTCAGGCAAGCAATTCTTTGCTGGGGGGAACTAATG ACTCTAGCTACCTGGGTGGGTGTTAATTTGGAAGATCCAGCATCTAGAGA CCTAGTAGTCAGTTATGTCAACACTAATATGGGCCTAAAGTTCAGGCAAC TCTTGTGGTTTCACATTTCTTGTCTCACTTTTGGAAGAGAAACCGTTATA GAGTATTTGGTGTCTTTCGGAGTGTGGATTCGCACTCCTCCAGCTTATAG ACCACCAAATGCCCCTATCCTATCAACACTTCCGGAAACTACTGTTGTTA GACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGA AGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAACCTCAATGTTAGTATTCCTTGGACTCATAAGGTGGGGAACTTTACTGGTCTTTATTCT TCTACTGTACCTGTCTTTAATCCTCATTGGAAAACACCATCTTTTCCTAA TATACATTTACACCAAGACATTATCAAAAAATGTGAACAGTTTGTAGGCC CACTTACAGTTAATGAGAAAAGAAGATTGCAATTGATTATGCCTGCTAGG TTTTATCCAAAGGTTACCAAATATTTACCATTGGATAAGGGTATTAAACC TTATTATCCAGAACATCTAGTTAATCATTACTTCCAAACTAGACACTATT TACACACTCTATGGAAGGCGGGTATATTATATAAGAGAGAAACAACACAT AGCGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAGATCTACAGCA TGGGGCAGAATCTTTCCACCAGCAATCCTCTGGGATTCTTTCCCGACCAC CAGTTGGATCCAGCCTTCAGAGCAAACACAGCAAATCCAGATTGGGACTT CAATCCCAACAAGGACACCTGGCCAGACGCCAACAAGGTAGGAGCTGGAG CATTCGGGCTGGGTTTCACCCCACCGCACGGAGGCCTTTTGGGGTGGAGC CCTCAGGCTCAGGGCATACTACAAACTTTGCCAGCAAATCCGCCTCCTGC CTCCACCAATCGCCAGACAGGAAGGCAGCCTACCCCGCTGTCTCCACCTT T GAGAAACAC TCATCCTCAGGCCATGCAGTGG GTA AJ309369 .1 1476 TTCCACTGCCTTCCACCAAGCACTGCAGGATCCCAGAGTCAGGGGTCCGT ATTTTCCTGCTGGTGGCTCCAGTTCAGGAACAGTAAACCCTGCTCCGAAT ATTGCCTCTCACATCTCGTCAATCTCCGCGAGGACTGGGGACCCTGTGAC Petição 870250074928, de 25 / 08 / 2025, pág. 112 / 475 108 / 292 Genótipo de HBV N° de acesso SEQ ID NO: Sequência GAACATGGAGAACATCACATCAGGACTCCTAGGACCCCTGCTCGTGTTAC AGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTA GGCTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGATCACCCGTGTGTCT TGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTC CTCCAATTTGTCCTGGTTATCGTTGGATGTGTCTGCGGCGTTTTATCATA TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTATTGGTTCTTCTGGA TTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCAACAACAA CCGGTACGGGACCATGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCT ATGTTTCCCTCATGTTGCTGTACAAAACCTACGGACGGAAATTGCACCTG TATTCCCATCCCATCGTCCTGGGCTTTCGCAAAATACCTATGGGAGTGGG CCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGG TTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGCTATATGGATGATGTG GTATTGGGGGCCAAGACTGTACAGCATCGTGAGTCCCTTTATACCGCTGT TACCAATTTTCTTTTGTCTCTGGGTATACATTTAAACCCTAACAAAACAA AAAGATGGGGTTATTCCCTAAACTTCATGGGTTACATAATTGGAAGTTGG GGAACTTTGCCACAGGATCATATTGTACAAAAGATCAAACACTGTTTTAG AAAACTTCCTGTTAACAGGCCTATTGATTGGAAAGTATGTCAAAGAATTG TGGGTCTTTTGGGCTTTGCTGCTCCATTTACACAATGTGGATATCCTGCCTTAATGCCTTTGTATGCATGTATACAAGCTAAACAGGCTTTCACTTTCTC GCCAACTTACAAGGCCTTTCTAAGTAAACAGTACATGAACCTTTACCCCG TTGCTCGGCAACGGCCTGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCC ACTGGCTGGGGCTTGGCCATAGGCCATCAGCGCATGCGTGGAACCTTTGT GGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTC GCAGCCGGTCTGGAGCAAAGCTCATCGGAACTGACAATTCTGTCGTCCTC TCGCGGAAATATACATCGTTTCCATGGCTGCTAGGCTGTACTGCCAACTG GATCCTTCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCG CGGACGACCCCTCTCGGGGCCGCTTGGGACTCTATCGTCCCCTTCTCCGT CTGCCGTTCCAGCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCC GTCTGTGCCTTCTCATCTGCCGGTCCGTGTGCACTTCGCTTCACCTCTGC ACGTTGCATGGAGACCACCGTGAACGCCCATCAGATCCTGCCCAAGGTCT TACATAAGAGGACTCTTGGACTCCCAGCAATGTCAACGACCGACCTTGAG GCCTACTTCAAAGACTGTGTGTTTAAGGACTGGGAGGAGCTGGGGGAGGA GAGTAGGTTAATGATCTTTGTATTAGGAGGCTGTAGGCATAAATTGGTCT GCGCACCAGCACCATGCAACTTTTTCACCTCTGCCAAATCATCTCTTGTA CATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGC ATGGACATTGACCCTTATAAAGAATTTGGAGCTACTGTTGAGTTACTCTC GTTTTTGCCTTCTGACTTCTTTCCTTCCGTCAGAGATCTTCTAGACACCGCCTCAGCTCTGTATCGAGAAGCCTTAGAGTCTCCTGAGCACTGCTCACCT CACCATACTGCACTCAGGCAAGCCATTCTCTGCTGGGGGGAATTGATGAC TCTAGCTACCTGGGTGGGTAATAATTTGGATGATCCAGCATCCAGGGATC TAGTAGTCAATTAT TTGTGGTTTCATATATCTTGCCTTACTTTTGGAAGAGAGACTGTACTTGA ATATTTGGTCTCTTTCGGAGTGTGGATTCGCACTCCTCCACCCTATAGAC CACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTATTAGA CGACGGGACCGAGGCAGGTCCTACTGACCTAGACCTAGCCGACCTCGA ACGCAGATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTC AATGTTAGTATTCCTTGGACTCATAAGGTGGGAAACTTTACGGGGCTTTA TTCCTCTACTACCTATCTTTAATCCTGAATGGCAAACTCCTTCCTTTC CTAAGATTCATTTACAAGGACAAGTAGTTCAGTCAGTCA GGCCCTCTCACTGTAAATGAAAAGAGAAGATTGAAATTAATTATGCCTGC TAGAT TC TAT CC TAC C CACAC TAAATAT T TGC CC T TAGACAAAGGAAT TA AACCTTATTATCCAGTCAGGTAGTTAATCATTCCAAACCAGACAT ACGTAGCGCATCATTTTGCGGGTCACCATATTCTTGGGAACAAGAGCTAC AGCATGGGAGGTTGGTCATCAAAACCTCGCAAAGGCATGGGGACGAATCT Petition 870250074928, of 25 / 08 / 2025, p. 113 / 475 109 / 292 Genótipo de HBV N° de acesso SEQ ID NO: Sequência TTCTGTTCCCAACCCTCTGGGATTCTTTCCCGATCATCAGTTGGACCCTG CATTCGGAGCCAACTCAAACAATCCAGATTGGGACTTCAACCCCATCAAG GACCACTGGCCAGCAGCCAACCAGGTGGGAGTGGGGGCATTCGGGCCAGG GCTCACCCCTCCACACGGCGGTATCTTGGGGTGGAGCCCTCAGGCTCAGG GCATATTGACCACAGTGTCAACAATTCCTCCTCCTGCCTCCACCAATCGG CAGTCAGGAAGGCAGCCTACTCCCATCTCTCCACCTCTCCGAGACAGTCA TCCTCAGGCCACGCAGTGGAA GTB D00330.1 1477 CTCCACCACTTTCCACCAAACTCTTCAAGATCCCGGAGTCAGGGCCCTGT ACTTTCCTGCTGGTGGCTCCAGTTCAGGAACAGTGAGCCCTGCTCAGAAT ACTGTCTCTGCCATATCGTCAATCTTATCGAAGACTGGGGACCCTGTACC GAACATGGAGAACATCGCATCAGGACTCCTAGGACCCCTGCTCGTGTTAC AGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTA GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAACACCCGTGTGTCT TGGCCAAAATTCGCAGTCCCAAATCTCCAGTCACTCACCAACCTGTTGTC CTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATC TTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGA CTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACAA CCAGCACCGGACCATGCAAAACCTGCACAACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGATGGAAACTGCACCTG TATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGG CCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGG TTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATATG GTTTTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATGCCGCTGT TACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTCACAAAACAA AAAGATGGGGATATTCCCTTAACTTCATGGGATATGTAATTGGGAGCTGG GGCACATTGCCACAGGAACATATTGTACAAAAAATCAAAATGTGGTTTAG GAAACTTCCTGTAAACAGGCCTATTGATTGGAAAGTATGTCAACGAATTG TGGGTCTTTTGGGGTTTGCCGCCCCTTTCACGCAATGTGGATATCCTGCT TTAATGCCTTTATATGCATGTATACAAGCAAAACAGGCTTTTACTTTCTC GCCAACTTACAAGGCCTTTCTAACTAAACAGTATCTGAACCTTTACCCCG TTGCTCGGCAACGGCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCC ACTGGTTGGGGCTTGGCCATAGGCCATCAGCGCATGCGTGGAACCTTTGT GTCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTC GCAGCCGGTCTGGGGCAAAACTCATCGGGACTGACAATTCTGTCGTGCTC TCCCGCAAGTATACATCATTTCCATGGCTGCTAGGCTGTGCTGCCAACTG GATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCG CGGACGACCCTTCCCGGGGCCGCTTGGGGCTCTACCGCCCGCTTCTCCGCCTGTTGTACCGACCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCC GTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGC ACGTCGCATGGAGACCACCGTGAACGCCCACGGGAACCTGCCCAAGGTCT TGCATAAGAGGACCTCTTGGACTTTCAGCAGGACCGGACCTTGGACCTTGC GCATACTTCCAAAGACTGTGTGTTTAATGAGTGGGAGGAGTTGGGGGAGGA GGTTAGGTTAAAGGTCTTTGTACTAGGAGCTGTAGGCATAAATTGGTGT GTTCACCAGCACCATGCAACTTTCACCTCTGCCTAATCATCTCATGTT CATGTCCTACTGTTCAAGCCAGCTGTCGTTGTTGTTGTTGTTGTTCACTCTGCTGTTGTTGTT ATGGACATTGACCTCGTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC TTTTTTGCCTTCTGACTTCTTTCCGTCGGTGCGAGATCTCCTCGACCCCG CCTCTGCTTTGTATCGGGAGGCCTTAGA TCTAGCCACCTGGGTGGGAAGTAATTTGGAAGATCCGGCATCCAGGGAAT TAGTAGTCAGCTATGTCAACGTTAATATGGGCCTAAATCAGACAACTA TTGTGGTTTCACATTTCCTGTCTTACTTTGGGAGAGAAACTGTTCTTGA ATATTTGGTGTCTTTTGGAGTCGTTGAGTTGACTGCCTT CACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGA CGAAGAGGCAGGTCCCCTAGAAAGAACTCCCTCGCCTCGCAGACGAAG Petition 870250074928, of 25 / 08 / 2025, p. 114 / 475 110 / 292Genótipo de HBV N° de acesso SEQ ID NO: Sequência GTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCTCAATGTT AGTATTCCTTGGACACATAAGGTGGGAAACTTTACGGGGCTTTATTCTTC TACGGTACCTTGCTTTAATCCTAAATGGCAAACTCCTTCTTTTCCTGACA TTCATTTGCAGGAGGACATTGTTGATAGATGTAAGCAATTTGTGGGGCCC CTTACAGTAAATGAAAACAGGAGACTAAAATTAATTATGCCCGCTAGGTT TTATCCCAATGTTACTAAATATTTGCCCTTAGATAAAGGGATCAAACCGT ATTATCCAGAGTATGTAGTTAATCATTACTTCCAGACGCGACATTATTTA CACACTCTTTGGAAGGCGGGGATCTTATATAAAAGAGAGTCCACACGTAG CGCCTCATTTTGCGGGTCACCATATTCTTGGGAACAAGATCTACAGCATG GGAGGTTGGTCTTCCAAACCTCGAAAAGGCATGGGGACAAATCTTTCTGT CCCCAATCCTCTGGGATTCTTCCCCGATCATCAGTTGGACCCTGCATTCA AAGCCAACTCAGAAAATCCAGATTGGGACCTCAACCCGAACAAGGACAAC TGGCCGGACGCCAACAAGGTGGGAGTGGGAGCATTCGGGCCAGGGTTCAC CCCTCCCCATGGGGGACTGTTGGGGTGGAGCCCTCAGGCTCAGGGCCTAC TCACAACTGTGCCAGCAGCTCCTCCTCCTGCCTCCACCAATCGGCAGTCA GGAAGGCAGCCTACTCCCTTATCCCCACCTCTAAGGGACACTCATCCTCA GGCCATGCAGTGGAA GTC AB03355 0.1 1478 CTCCACCACATTCCACCAAGCTCTGCTAGATCCCAGAGTGAGGGGCCTATATTTTCCTGCTGGTGGCTCCAGTTCCGGAACAGTAAACCCTGTTCCGACT ACTGCCTCACCCATATCGTCAATCTTCTCGAGGACTGGGGACCCTGCACA GAACATGGAGAACACAACATCAGGATTCCTAGGACCCCTGCTCGTGTTAC AGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTA GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCC TGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTC CTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATA TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGA CTACCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAGGAACAACAACTA CCAGCACGGGACCATGCAAGACCTGCACGATTCCTGCTCAAGGAACCTCT ATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAACTGCACTTG TATTCCCATCCCATCATCCTGGGCTTTCGCAAGATTCCTATGGGAGTGGG CCTCAGTCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGG TTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTG GTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTTTACCTCTAT TACCAATTTTCTTTTGTCTTTGGGTATACATTTGAATCCTAATAAAACCA AACGTTGGGGCTACTCCCTTAACTTCATGGGATATGTAATTGGAAGTTGG GGTACTTTACCACAGGAACATATTGTACGGAAACTCAAGCAATGTTTTCG AAAACTGCCTGTAAATAGACCTATTGATTGGAAAGTATGTCAAAGAATTGTGGGTCTTTTGGGCTTTGCTGCCCCTTTTACACAATGTGGCTATCCTGCC TTGATGCCTTTATATGCATGTATACACTCTAAGCAGGCTTTCACTTTCTC GCCAACTTACAAGGCCTTTCTGTGTAAACAATATCTGCACCTTTACCCCG TTGCCCGGCAACGGTCAGGTCTCTGCCAAGTGTTTGCTGACGCAACCCCC ACTGGATGGGGCTTGGCCATAGGCCATCGGCGCATGCGCGGAACCTTTGT GGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCAGCTTGTTTTGCTC GCAGCCGGTCTGGAGCAAAACTTATCGGGACTGACAACTCTGTTGTCCTC TCTCGGAAATACACCTCCTTCCCATGGCTGCTCGGGTGTGCTGCCAACTG GATCCTTCGCGGGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCCG CGGACGACCCGTCTCGGGGCCGTTTGGGGCTCTATCGTCCCCTTCTTCAT CTGCCGTTCCGGCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCC GTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGC ACGTCGCATGGAGACCACCGTGAACGCCCACCAGGTCTTGCCCAAGGTCT TACATAAGAGGAC T C T T G GAC T C T CAT CAAT G T CAAC GAC C GAC C T T GAG GCATACTTCAAAGACTGTTTGTTTAAGGACTGGGAGGAGTTGGGGGAGGA GATTAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCT GTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCATGTT CATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGC Petição 870250074928, de 25 / 08 / 2025, pág. 115 / 475 111 / 292 HBV Genotype Accession No. SEQ ID NO: Sequence ATGGACATTGACCCCGTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC TTTTTTGCCTTCTGACTTCTTTCCTTCTATTCGAGATCCTCGACACCG CCTCTGCTCTGTATCGGGAGGCCTTAGAGTTCCGACCTTGGACCTT CACCATACAGCACTCAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAA TCTGGCCACCTGGGTGGGAAGTAATTTGGAAGACCCAGCATCCAGGGAAT TAGTAGTCAGCTATGTCAATGTTAATATGGGCCTAAATCAGACAACTA TTGTGGTTCCATTTCTTGATTGACTGACTGATTGATTGATT GTATTTGGTATCTTTTGGAGTGTGGATTCGCACTCCTCCAGCTTACAGAC CACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGA CGACGAGGCAGGTCCCCTAGAAAGAACTCCCTCGCCTCGCAGACGAAG GTCTCAATCGCCGCGTCGCAGAAGATCTCAATCCATGTTGTTGTTCGGAAACTACTGTTGTTAGA AGTATCCCTTGGACTCATAAGGTGGGAAACTTTACTGGGCTTTATTCTTC TACTGTACCTGTCTTTAATCCTGAGTGGCAAACTCCCTCCTTTCCTAACA TTCATTTACAGGAGGACATTTAATAGATGTGAACATATGTGGGCCCT CTTACAACTAATGAAAAAAGGATTAATTAACTGATTGATTGATTGATTATTAGAT TTATCCTAACCTTACCAAATACTTGCCCTTGGATAAAGGCATTAAACCTT ATTATCCTGAACATGCAGTTAATCATTACTTCAAAACTAGGCATTATTTA CATACTCTGTGGAAGGCCGGCATTCTATATAAGAGAAACTACACGCAGCGCTTCATTTTGTGGGTCACCATATTCTTGGGAACAAGAGCTACAGCATG GGAGGTTGGTCTTCCAAACCTCGACAAGGCATGGGGACGAATCTTTCTGT TCCCAATCCTCTGGGATTTTTTCCCGATCACCAGTTGGACCCTGCGTTCG GAGCCAACTCAAACAATCCAGATTGGGACTTCAACCCCAACAAGGATCAC TGGCCAGAGGCAAATCAGGTAGGAGCGGGAGCATTCGGGCCAGGGTTCAC CCCACCACACGGCGGTCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATAT TGACCACAGTGCCAGCAGCGCCTCCTCCTGCCTCCACCAATCGGCAGTCA GGAAGACAGCCTACTCCCATCTCTCCACCTCTAAGAGACAGTCATCCTCA GGCCATGCAGTGGAA GTD KX47073 3.1 1479 AAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAAT TGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCA ATAGCAT CACAAAT T T CACAAATAAAGCAT T TTTTTCACT GCAT T C TAGT TGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTGGGC CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCTTTGC CCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACT CCATCACTAGGGGTTCCTCTGCTCGATGTATTCAATCTAAGCAGGCTTTC ACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATACCTGAACCT TTACCCCGTTGCCCGGCAACGGCCAGGTCTGTGCCAAGTGTTTGCTGACG CAACCCCCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCGTGCGTGGAACCTTTTCGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTG TTTTGCTCGCAGCAGGTCTGGAGCAAACATTATCGGGACTGATAACTCTG TTGTCCTCTCCCGCAAATATACATCGTATCCATGGCTGCTAGGCTGTGCT GCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCT GAATCCTGCGGACGACCCTTCTCGGGGTCGCTTGGGACTCTCTCGTCCCC TTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCTTTACGCG GACTCCCCGTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTC ACCTCTGCACGTCGCATGGAGACCACCGTGAACGCCCACCGAATGTTGCC CAAGGTCTTACATAAGAGGACTCTTGGACTCTCTGCAATGTCAACGACCG ACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTTG GGGGAGGAGATTAGATTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAA ATTGGTCTGCGCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCAT CTCTTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGC TTTGGGGCATGGACATCGACCCTTATAAAGAATTTGGAGCTACTGTGGAG TTACTCTCGTTTTTGCCTTCTGACTTCTTTCCTTCAGTACGAGATCTTCT AGATACCGCCTCAGCTCTGTATCGGGAAGCCTTAGAGTCTCCTGAGCATT GTTCACCTCACCATACTGCACTCAGGCAAGCAATTCTTTGCTGGGGGGAA CTAATGACTCTAGCTACCTGGGTGGGTGTTAATTTGGAAGATCCAGCATC Petição 870250074928, de 25 / 08 / 2025, pág. 116 / 475 112 / 292HBV Genotype Accession No. SEQ ID NO: Sequence TAGAGACCTAGTAGTCAGTTATGTCAACACTAATATGGGCCTAAAGTTCA GGCAACTCTTGTGGTTTCACATTTCTTGTCTCACTTTGGAAGAGAAACC GTTATAGAGTATTTGGTGTCTTTCGGACTGGGATTCCCATCCATTCA TTATAGACCACCAAATGCCCCTATCCTATCAACACTTCCGGAAACTACTG TTGTTAGACGACGAGGCAGGTCCCCTAGAAAGAACTCCCTCGCCTCGC AGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGGAACC TCAATGTTAGTATTCCTTGGACTCAATGGAGTTGTTGTTGTTG TATTCTTCTACTGTACCTGTCTTTAATCCTCATTGGAAAACACCATCTTT TCC TAATATACAT T TACAC CAAGACAT TAT CAAAAAAT GT GAACAGT TTG TAGGCCCACTTACAGTTAATGAAAAGAAGATTGCAATTGATTATGCCT GCTAGGTTTTATCCAAGTTTACCATTAGTAGTAGTTAT TAAACCTTTATCCAGAACATCTAGTTAATCATTACTTCCAAACTAGAC ACTATTTACACACTCTATGGAAGGCGGGTATATTATAAGAGAAACA ACACATAGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAGATCT ACAGCATGGGGCAGAATCTTTCCACCCATCCTTTCTTCCTT GACCACCAGTTGGATCCAGCCTTCAGAGCAAAACACAGCAAATCCAGATTG GGACTTCAATCCCAACAAGGACACCTGGCCAGACGCCAACAAGGTAGGAG CTGGAGCATTCGGGCTGGGTTTCACCCCACCGCACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATACTACAAACTTTGCCAGCAAATCCGCC TCCTGCCTCCACCAATCGCCAGACAGGAAGGCAGCCTACCCCGCTGTCTC CACCTTTGAGAAACACTCATCCTCAGGCCATGCAGTGGAATTCCACAACC TTTCACCAAACTCTGCAAGATCCCAGAGTGAGAGGCCTGTATTTCCCTGC TGGTGGCTCCAGTTCAGGAGCAGTAAACCCTGTTCCGACTACTGCCTCTC CCTTATCGTCAATCTTCTCGAGGATTGGGGACCCTGCGCTGAACATGGAG AACATCACATCAGGATTCCTAGGACCCCTTCTCGTGTTACAGGCGGGGTT TTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGT GGACTTCTCTCAATTTTCTAGGGGGAACTACCGTGTGTCTTGGCCAAAAT TCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTG TCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCA TCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGT ATGTTGCCCGTTTGTCCTCTAATTCCAGGATCCTCAACCACCAGCACGGG ACCATGCCGAACCTGCATGACTACTGCTCAAGGAACCTCTATGTATCCCT CCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATC CCATCATCCTGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCG TTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGC TTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGG CCAAGTCTGTACAGCATCTTGAGTCCCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTAACAAAACAAAGAGATGGGG TTACTCTCTGAATTTTATGGGTTATGTCATTGGAAGTTATGGGTCCTTGC CACAAGAACACATCATACAAAAAATCAAAGAATGTTTTAGAAAACTTCCT ATTAACAGGCCTATTGATTGGAAAGTATGTCAACGAATTGTGGGTCTTTT GGGTTTTGCTGCCCCATTTACACAATGTGGTTATCCTGCGTTAATGCCCT TGTATGCATGTATTCAATCTAAGCAGGCTTTCACTTTCTCGCCAACTTAC AAGGCCTTTCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCCCGGCA ACGGCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGG GCTTGGTCATGGGCCATCAGCGCGTGCGTGGAACCTTTTCGGCTCCTCTG CCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGCAGCAGGTC TGGAGCAAACATTATCGGGACTGATAACTCTGTTGTCCTCTCCCGCAAAT ATACATCGTATCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGC GGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCTGCGGACGACCC TTCTCGGGGTCGCTTGGGACTCTCTCGTCCCCTTCTCCGTCTGCCGTTCC GACCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCCT TCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATG GAGACCACCGTGAACGCCCACCGAATGTTGCCCAAGGTCTTACATAAGAG GACTCTTGGACTCTCTGCAATGTCAACGACCGACCTTGAGGCATACTTCA Petição 870250074928, de 25 / 08 / 2025, pág. 117 / 475 113 / 292Genótipo de HBV N° de acesso SEQ ID NO: Sequência AAGACTGTTTGTTTAAAGACTGGGAGGAGTTGGGGGAGGAGATTAGATTA AAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGCGCACCAGC ACCATGCAACTTTTTCACCTCTGCCTAATCATCTCTTGTTCATGTCCTAC TGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATCG ACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCGTTTTTGCCT TCTGACTTCTTTCCTTCAGTACGAGATCCCCTAACTACAAGGAACCCCTA GTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGC CGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAG TGAGCGAGCGAGCGCGCAGAGAGGGACAGATCCCCAGGAAGCTCCTCTGT GTCCTCATAAACCCTAACCTCCTCTACTTGAGAGGACATTCCAATCATAG GCTGCCCATCCACCCTCTGTGTCCTCCTGTTAATTAGGTCACTTAACAAA AAGGAAATTGGGTAGGGGTTTTTCACAGACCGCTTTCTAAGGGTAATTTT AAAATATCTGGGAAGTCCCTTCCACTGCTGTGTTCCAGAAGTGTTGGTAA ACAGCCCACAAATGTCAACAGCAGAAACATACAAGCTGTCAGCTTTGCAC AAGGGCCCAACACCCTGCTCATCAAGAAGCACTGTGGTTGCTGTGTTAGT AATGTGCAAAACAGGAGGCACATTTTCCCCACCTGTGTAGGTTCCAAAAT ATCTAGTGTTTTCATTTTTACTTGGATCAGGAACCCAGCACTCCACTGGA TAAGCATTATCCTTATCCAAAACAGCCTTGTGGTCAGTGTTCATCTGCTGACTGTCAACTGTAGCATTTTTTGGGGTTACAGTTTGAGCAGGATATTTGG TCCTGTAGTTTGCTAACACACCCTGCAGCTCCAAAGGTTCCCCACCAACA GCAAAAAAATGAAAATTTGACCCTTGAATGGGTTTTCCAGCACCATTTTC ATGAGTTTTTTGTGTCCCTGAATGCAAGTTTAACATAGCAGTTACCCCAA TAACCTCAGTTTTAACAGTAACAGCTTCCCACATCAAAATATTTCCACAG GTTAAGTCCTCATTTAAATTAGGCAAAGGAATTAATTCTTGAAGACGAAA GGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGG TTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCT ATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACA ATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTA TTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTT CCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGA TCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTA AGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACT TTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCA AGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGT ACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAA TTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACT TCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAA GCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAAC AACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGC AACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTG CGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGG TGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGC CCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGAT GAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC TTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTC ATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCC CGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAA TCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAG AGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACC ACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTG TTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGA CTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGG Petição 870250074928, de 25 / 08 / 2025, pág. 118 / 475 114 / 292Genótipo de HBV N° de acesso SEQ ID NO: Sequência GTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGA TACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAA GGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGA GGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTT CGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCG GAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCT TTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCT GTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAG CCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCC TGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATA TGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTA TACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCC GCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCG CTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTT TCACCGTCATCACCGAAACGCGCGAGGCAGCTGTGGAATGTGTGTCAGTT AGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCA TGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCA GCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCC ATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAG GCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGG AGGCCTAGGCTTTTGCAAAAAGCTTCACGCTGCCGCAAGCACTCAGGGCG CAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAAC GGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAA AACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCG ATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAG CTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATG GCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGATCTG ATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTG CACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTG GGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAG CGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTG AATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGG CGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACT GGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTT GCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCA TACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGAT CTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCT CAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATG CCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATC GACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGC TACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCC TCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTAT CGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACC GACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGC CTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGA TGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCGGG CTCGATCCCCTCGCGAGTTGGTTCAGCTGCTGCCTGAGGCTGGACGACCT CGCGGAGTTCTACCGGCAGTGCAAATCCGTCGGCATCCAGGAAACCAGCA GCGGCTATCCGCGCATCCATGCCCCCGAACTGCAGGAGTGGGGAGGCACG ATGGCCGCTTTGGTCCGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGT GACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATA TAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGT GTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA Petição 870250074928, de 25 / 08 / 2025, pág. 119 / 475 115 / 292Genótipo de HBV N° de acesso SEQ ID NO: Sequência TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTG ATGATGAGGCTACTGCTGACTCTCAACATTCTACTCCT C CAAAAAAGAAG AGAAAGGTAGAAGACCCCAAGGACTTTCCTTCAGAATTGCTAAGTTTTTT GAGTCATGCTGTGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACA CCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTATGGAAAAATAT TCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTC AAAAATTGTGTACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAA TATTTGATGTATAGTGCCTTGACTAGAGATCATAATCAGCCATACCACAT TTGTAGAGGTTTTACTTGCTTTA GTE KX18658 4 1480 TTCCACAACATTCCACCAAGCTCTGCAGGATCCCAGAGTAAGAGGCCTGT ATTTTCCTGCTGGTGGCTCCAGTTCCGGAACAGTGAACCCTGTTCCGACT ACTGCCTCACTCATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCACC GAACATGGAAAGCATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTAC AGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACCGCAGAGTCTA GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCTCCCGTGTGTCT TGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTC CTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGA CTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACCA CCAGTACGGGACCCTGCCGAACCTGCACGACTCTTGCTCAAGGAACCTCT ATGTTTCCCTCATGTTGCTGTTCAAAACCTTCGGACGGAAATTGCACTTG TATTCCCATCCCATCATCATGGGCTTTCGGAAAATTCCTATGGGAGTGGG CCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGG TTCGCCGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTG GTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATACCTCTGT TACCAATTTTCTTTTGTCTTTGGGTATACATTTAAATCCCAACAAAACAA AAAGATGGGGATATTCCCTAAATTTCATGGGTTATGTAATTGGAAGTTGG GGGTCATTACCACAGGAACACATCAGAATGAAAATCAAAGACTGTTTTAG AAAACTCCCTGTTAACCGGCCTATTGATTGGAAAGTATGTCAAAGAATTG TGGGTCTTTTGGGCTTTGCTGCCCCTTTTACACAATGTGGATATCCTGCT TTAATGCCTCTGTATGCGTGTATTCAATCTAAGCAGGCTTTCACTTTCTC GCCAACTTACAAGGCCTTTCTGTGTAAACAATACCTGAACCTTTACCCCG TTGCCCGGCAACGGCCAGGTCTGTGCCAAGTGTTTGCTGATGCAACCCCC ACTGGCTGGGGCTTGGCCATAGGCCATCAGCGCATGCGTGGAACCTTTGT GGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTC GCAGCAGGTCTGGAGCGAAACTTATCGGGACAGATAATTCTGTCGTTCTCTCCCGGAAATATACATCATTTCCATGGCTGCTAGGCTGTGCTGCCAACTG GATCCTGCGAGGGACGTCCTTTGTCTACGTCCCGTCAGCGCTGAATCCTG CGGACGACCCGTCTCGGGGTCGCTTGGGGATCTATCGTCCCCTTCTCCGT CTGCCGTTCCAGCCGACCACCCGCCTTGGCCTTGCCTTGGTCGCGT GTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGC ACGTCGCATGGAGACCACCGTGAACGCCCACCAAATCTTGCCCAAGGTCT TACATAAGAGGACTCTTGGACTCTCTGCAATGTCAACGACCGACCTTGAG GCATACTTCAAAGACTGTTTGTTTAAAGACTGGAGGGGAGGGAGGGGGAGGACTCTGCCTTGCCCAAGGTCT GATTAGATTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCT GCGCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCTTGTT CATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGGC ATGGACATTGACCCTTAAAGAGAGTAGTAGCTGCTGCCTT GTTTTTGCCTTCTGACTTCTTTCCTTCAGTAAGAGATCTTCTAGATACCG CCTCAGCTCTGTATCGGGATGCCTTAGAATCCCTGAGCATTGTTCACCT CACCACACTGCACTCAGGCAAGCCATTCTTTGCTGGGGGGAACTAATGAC TCTAGCTACCTGGGTGGGTGAGGAGGATTGATTGACCTTGGGTGGGGAGGATTGATTGACCTT TAGTAGTCAGTTATGTCAATACTAATATGGGCCTAAAGTTCAGGCAATTA TTGTGGTTTCACATTTCTTGTCTCACTTTGGAAGAGAAACCGTCATAGA Petition 870250074928, of 25 / 08 / 2025, p. 120 / 475 116 / 292HBV Genotype Accession No. SEQ ID NO: Sequence GTATTTGGTGTCTTTTGGAGTGGATTCGCACTCCTCCAGCTTATAGAC CACCAAATGCCCCTATCTTATCAACACTTCCGGAATACTGTTGTTAGA C GAAGAG G CAG GTCCCC TAGAAGAAGAAC TCCCAGTCGACTCG ATCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTT AGTATTCCTTGGACTCACAAGGTGGGAAAATTTTACGGGGCTTTACTCTTC TACTATACCTGTCTTTAATCCTAACTGGAAACTCCATCTTTTCCTGATA TTCATTTGCACCAGGACATTATTAACAAGAGGACTCATTTAGTTTAGTT GAAAAAC GAAGAT TAAAC TTAGTCATGCC T GC TAGAT T TTTTCCCATCTCTACGAAATATTTGCCCCTAGAGAAAGGTATAAAACCTT ATTATCCAGATAATGTAGTTAATCATTACTTCCAAACCAGACACTATTTA CATACCCTATGGAAGGCGGGCATCTTATAAAGAGAGACTAACTAACT CGCCTCATTTTGTGGGTCACCTTATTCTTGGGAACAAGAGCTACATCATG GGGCTTTCTTGGACGGTCCCTCTTCGAATGGGGAAGAATCATTCCACCAC CAATCCCTCTGGGATTTTCCCGACCACCAGTTGGATCCAGCATTCAGAG CAAACAC CAGAAAT CAGAT TCACCAACACCATCAGAGGGACCATGGAG ACAGAAGCCAACAAGGTAGGAGTGGGAGCATTCGGGCCGGGGTTCACTCC CCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAAGGCATGCTAAAAACATTGCCAGCAGATCCGCCTCCTGCCTCCACCAATCGGCAGTCAGGA AGGCAGCCTACCCCAATCACTCCACCTTTGAGAGACACTCATCCTCAGGC CATGCAGTGGAA GTF KP718112 1481 CTCAACTCAGTTCCACCAGGCTCTGTTGGATCCGAGGGTAAGGGCTCTGT ATTTTCCTGCTGGTGGCTCCAGTTCAGGGACACAGAACCCTGCTCCGACT ATTGCCTCTCTCACATCATCAATCTTCTCGAAGACTGGGGGCCCTGCCAT GAACATGGAGAACATCACATCAGGACTCCTAGGACCCCTGCTCGTGTTAC AGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTA GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGACTACCCGGGTGTCC TGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTTACCAACCTCCTGTC CTCCAACTTGTCCTGGCTATCGTTGGATGTGTCTGCGGCGTTTTATCATC TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGA CTACCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAGGATCCACGACCA CCAGCACGGGACCATGCAAAACCTGCACAACTCTTGCTCAAGGAACCTCT ATGTTTCCCTCCTGTTGCTGTTCCAAACCCTCGGACGGAAACTGCACCTG TATTCCCATCCCATCATCTTGGGCTTTAGGAAAATACCTATGGGAGTGGG CCTCAGCCCGTTTCTCCTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGG TGCGTAGGGCTTTCCCCCACTGTCTGGCTTTTAGTTATATGGATGATCTG GTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATACCGCTGT TACCAATTTTCTGTTATCTGTGGGTATCCATTTAAATACTGCTAAAACAAAAAGATGGGGTTACTCCCTACATTTCATGGGTTATGTTATTGGTAGTTGG GGAACGTTACCCCAAGATCATATTGTACAAAATCAAAGATTGTTTTCG GAAACTTCCTGTAAATCGTCCAATTTGGAAAGTTTGTCAACGCATTG TGGGTCTTTTGGGCTTCTTCAGCCTTGGCCTTGGCCTT CTCATGCCTTTGTATACCTGTATTACTGCTAAACAGGCGTTTGTCTTTTC GCCAACTTACAAGGCCTTTCTCTGTAAACAATACATGAACCTTTACCCCG TTGCTCGGCAACGGCCAGGCCTGTGCCAAGTGTTTGCTGACGCAACCCCC ACTGGTTGGGGCTTGGCATTTGGCCATGCCTTGGCCTTGGCTT GGCTCCTCTGCCGATCCATACTGCGGAACTCCTTGCAGCCTGTTTCGCTC GCAGCCGGTCTGGAGCGAACATTATCGGCACAGACAACTGTTGTCCTC TCTAGGAAGTACACCTCCTTTCCATGGCTGCTCGGTTGTGCTGCCAACTG GATCCTGCGCGGGACGTCTTGTCCCTTGTCCGTTGCGTCCG CGGACGACCCCTCCCGGGGTCGCTTGGGGCTGTACCGCCCCCTTCTTCGT CTGCCGTTCCAGCCGACAACGGGTCGTACCTCTCTTTACGCGGACTCCCC GTCTGTTCCTTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGC ACGTCGCATGGAGACCACCGTGACCCCTTGGACCATCCGCTCCATGCGGGACCGGACCGTGTGCACTTCGCTCCCTCCGTACCGGGTCGTACCTCTTTACGCGGACTCCCC TACATAAGAGGACTCTTGGACTTTCAGGACGGTCAATGACCTGGATCGAA GACTACATCAAAGACTGTGTATTTAAGGACTGGGAGGAGCTGGGGGAGGA Petition 870250074928, of 25 / 08 / 2025, p. 121 / 475 117 / 292HBV Genotype Accession No. SEQ ID NO: Sequence GATCACGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCT GTGCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTTTTGTT CATGTCCCACTGTCCAAGCCTCCAAGCTGCTGGTTGGGGGGCT ATGGACATTGACCCTTAAAGAATTTGGAGCTTCTGTGGAATTGCTCTC TTTTTTGCCTTCTGATTTCTTCCCGTCTGTTCGGGACCTACTCGACACCG CTTCAGCCCTGTACCGGATGCTCTAGAGTCACCGGAACATTGCACCCCC AATCATACCGCTCTCAGGCAACTGTTGAGTTGAGTTGATTGGGGTC TTTGGCTTCCTGGGTGGGTAATAATTTGGAAGACCCTGCAGCTAGGGATT TAGTAGTTAATTATTGTCAACACTAATGGGCCTAAATTAGACAACTG TTGTGGTTTCACATTTCCTGTCTTACTTTGGAAGAGAAACAGTTCTTGA GTATTTGGTGTCCTTTGGAGAGAGAAACAGTTCTTGA GTATTTGGTGTCCTTTGCCTTGCCTTGCCTTGACCTTGA CACCAAATGCCCCTATCCTATCCACACTTCCGGAAACTACTGTTGTTAGA CGACGAGGCAGGTCCCCTAGAAAGAACTCCCTCGCCTCGCCGAAG GTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTT AGTATTCCTTGGACTCATAAGGTGGGAATTTGTCCTGTTCGTTCGTT TACTGTACCTGCTTTCAATCCTAACTGGTTAACTCCTTCTTTTCCTGATA TTCATTTACATCAGGATCTGATATCTAAATGTGAACAATTTGTAGGCCCG CTCACTAAATGAATTGAGAAGATTAAATTGGTCATGCCAGCTAGATTTTATCCTAAGGTTACCAAATACTTTCCTATGGAGAAAGGGATTAAACCCT AT TAT C C T GAGCAT G CAG T TAAT CAT TAT T T TAAAACAAGACAT TAT T T G CATACTTTATGGAAGGCGGGAATCTTATATAAGAGAGAATCCACACGTAG CGCCTCATTTTGTGGGTCACCATATTCCTGGGAACAAGAGCTACAGCATG GGAGCACCTCTCTCAACGACAAGAAGGGGCATGGGACTGAATCTTTCTGT GCCCAATCCTCTGGGCTTCTTGCCAGACCATCAGCTGGATCCGCTATTCA GAGCAAATTCCAGCAGTCCCGACTGGGACTTCAACACAAACAAGGACAGT TGGCCAATGGCAAACAAGGTAGGAGTGGGAGGCTACGGTCCAGGGTTCAC ACCCCCACACGGTGGCCTGCTGGGGTGGAGCCCTCAGGCACAGGGTGTTT TAACAACCTTGCCAGCAGATCCGCCTCCTGCTTCCACCAATCGGCGGTCC GGGAGAAAGCCAACCCCAGTCTCTCCACCTCTAAGAGACACACATCCACA GGCCATGCAGTGGAA GTG KX26450 0 1482 CTCTACAGCATTCCACCAAGCTCTACAAAATCCCAAAGTCAGGGGCCTGT ATTTTCCTGCTGGTGGCTCCAGTTCAGGGATAGTGAACCCTGTTCCGACT ATTGCCTCTCACATCTCGTCAATCTTCTCCAGGATTGGGGACCCTGCACC GAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTAC AGGCGGGGTTTTTCTTGTTGACAAGAATCCTCACAATACCGCAGAGTCTA GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGTGCCCGTGTGTCC TGGCCTAAATTCGCAGTCCCCAACCTCCAATCACTCACCAATCTCCTGTCCTCCAACTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATA TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGA CTATCAAGGTATGTTGCCCGTTTGTCCTCTGATTCCAGGATCCTCGACCA CCAGTACGGGACCCTGCAAAACCTGCACGACTCCTGCTCAAGGCAACTCT ATGTATCCCTCATGTTGCTGTACAAAACCTTCGGACGGAAATTGCACCTG TATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGG CCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGG TTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGCTATATGGATGATGTG GTATTGGGGGCCAAATCTGTACAACATCTTGAGTCCCTTTATACCGCTGT TACCAATTTTCTTTTGTCTTTGGGTATACATCTAAACCCTAACAAAACAA AAAGATGGGGTTATTCCTTAAATTTTATGGGATATGTAATTGGAAGTTGG GGTAC T T T GC CACAAGAACACATCACACAGAAAAT TAAGCAATGT T T T CG GAAACTCCCTGTTAACAGGCCAATTGATTGGAAAGTCTGTCAACGAATAA CTGGTCTGTTGGGTTTCGCTGCTCCTTTTACCCAATGTGGTTACCCTGCC TTAATGCCTTTATATGCATGTATACAAGCTAAGCAGGCTTTTACTTTCTC GCCAACTTATAAGGCCTTTCTCTGTAAACAATACATGAACCTTTACCCCG TTGCTAGGCAACGGCCCGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCC ACTGGTTGGGGCTTGGCCATCGGCCATCAGCGCATGCGTGGAACCTTTGT Petição 870250074928, de 25 / 08 / 2025, pág. 122 / 475 118 / 292 Genótipo de HBV N° de acesso SEQ ID NO: Sequência GGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCTGCTTGTTTTGCTC GCAGCCGGTCTGGAGCAAAACTCATTGGGACTGACAATTCTGTCGTCCTT TCTCGGAAATATACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTG GATCCTTCGCGGGACGTCCTTTGTTTACGTCCCGTCAGCGCTGAATCCAG CGGACGACCCCTCCCGGGGCCGTTTGGGGCTCTGTCGCCCCCTTCTCCGT CTGCCGTTCCTGCCGACCACGGGGCGCACCTCTCTTTACGCGGTCTCCCC GTCTGTTCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGC ACGTTACATGGAAACCGCCATGAACACCTCTCATCATCTGCCAAGGCAGT TATATAAGAGGACTCTTGGACTGTTTGTTATGTCAACAACCGGGGTGGAG AAATACTTCAAGGACTGTGTTTTTGCTGAGTGGGAAGAATTAGGCAATGA GTCCAGGTTAATGACCTTTGTATTAGGAGGCTGTAGGCATAAATTGGTCT GCGCACCAGCACCATGTAACTTTTTCACCTCTGCCTAATCATCTCTTGTT CATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTAGGGC ATGGATAGAACAACTTTGCCATATGGCCTTTTTGGCTTAGACATTGACCC TTATAAAGAATTTGGAGCTACTGTGGAGTTGCTCTCGTTTTTGCCTTCTG ACTTTTTCCCGTCTGTTCGTGATCTTCTCGACACCGCTTCAGCTTTGTAC CGGGAATCCTTAGAGTCCTCTGATCATTGTTCGCCTCACCATACAGCACT CAGGCAAGCAATCCTGTGCTGGGGTGAGTTGATGACTCTAGCTACCTGGGTGGGTAATAATTTGGAAGATCCAGCATCCAGAGATTTGGTGGTCAATTAT GTTAATACTAATATGGGTTTAAAAATCAGGCAACTATTGTGGTTTCACAT TTCCTGTCTTACTTTTGGGAGAGAAACCGTTCTTGAGTATTTGGTGTCTT TTGGAGTGTGGATTCGCACTCCTCCTGCTTATAGACCACCAAATGCCCCT ATCCTATCAACACTTCCGGAGACTACTGTTGTTAGACGAAGAGGCAGGTC CCCTCGAAGAAGAACTCCCTCGCCTCGCAGACGAAGATCTCAATCGCCGC GTCGCAGAAGATCTGCATCTCCAGCTTCCCAATGTTAGTATTCCTTGGAC TCACAAGGTGGGAAACTTTACGGGGCTGTATTCTTCTACTATACCTGTCT TTAATCCTGATTGGCAAACTCCTTCTTTTCCAAATATCCATTTGCATCAA GACATTATAACTAAATGTGAACAATTTGTGGGCCCTCTCACAGTAAATGA GAAACGAAGATTAAAACTAGTTATGCCTGCCAGATTTTTCCCAAACTCTA CTAAATATTTACCATTAGACAAAGGTATCAAACCGTATTATCCAGAAAAT GTAGTTAATCATTACTTCCAGACCAGACATTATTTACATACCCTTTGGAA GGCGGGTATTCTATATAAGAGAGAAACATCCCGTAGCGCTTCATTTTGTG GGTCACCATATACTTGGGAACAAGATCTACAGCATGGGGCTTTCTTGGAC GGTCCCTCTCGAGTGGGGAAAGAACCTTTCCACCAGCAATCCTCTAGGAT TCCTTCCCGATCACCAGTTGGACCCAGCATTCAGAGCAAATACCAACAAT CCAGATTGGGACTTCAATCCCAAAAAGGACCCTTGGCCAGAGGCCAACAA GGTAGGAGTTGGAGCCTATGGACCCGGGTTCACCCCTCCACACGGAGGCCTTTTGGGGTGGAGCCCTCAGTCTCAGGGCACACTAACAACTTTGCCAGCA GATCCGCCTCCTGCCTCCACCAATCGTCAGTCAGGGAGGCAGCCTACTCC CATCTCTCCACCACTAAGAGACAGTCATCCTCAGGCCATGCAGTGGAA GTH KX26450 1 1483 CTCAACACAGTTCCACCAAGCACTGTTGGATCCGAGAGTAAGGGGTCTGT ATTTTCCTGCTGGTGGCTCCAGTTCAGAAACACAGAACCCTGCTCCGACT ATTGCCTCTCTCACATCATCAATCTTCTCGAAGACTGGGGACCCTGCTAT GAACATGGAGAACATCACATCAGGACTCCTAGGACCCCTTCTCGTGTTAC AGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTA GACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGTACCACCCGGGTGTCC TGGCCAAAATTCGCAGTCCCCAATCTCCAATCACTTACCAACCTCCTGTC CTCCAACTTGTCCTGGCTATCGTTGGATGTGTCTGCGGCGTTTTATCATC TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGA CTATCAAGGTATGTTGCCCGTGTGTCCTCTACTTCCAGGATCTACAACCA CCAGCACGGGACCCTGCAAAACCTGCACCACTCTTGCTCAAGGAACCTCT ATGTTTCCCTCCTGCTGCTGTACCAAACCTTCGGACGGAAATTGCACCTG TATTCCCATCCCATCATCTTGGGCTTTCGGAAAATACCTATGGGAGTGGG CCTCAGCCCGTTTCTCTTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGG TGCGTAGGGCTTTCCCCCACTGTCTGGCTTTTAGTTATATGGATGATTTG Petição 870250074928, de 25 / 08 / 2025, pág. 123 / 475 119 / 292 Genótipo de HBV N° de acesso SEQ ID NO: Sequência GTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATACCGCTGT TACCAATTTTTTGTTATCTGTGGGCATCCATTTGAACACAGCTAAAACAA AATGGTGGGGTTATTCCTTACACTTTATGGGTTATATAATTGGGAGTTGG GGGACCTTGCCTCAGGAACATATTGTGCATAAAATCAAAGATTGCTTTCG CAAACTTCCCGTGAATAGACCCATTGATTGGAAGGTTTGTCAACGCATTG TGGGTCTTTTGGGCTTTGCAGCCCCTTTTACTCAATGTGGTTATCCTGCT CTCATGCCCTTGTATGCCTGTATTACCGCTAAGCAGGCTTTTGTTTTCTC GCCAACTTACAAGGCCTTTCTCTGTAAACAATACATGAACCTTTACCCCG TTGCTCGGCAACGGCCAGGCCTTTGCCAAGTGTTTGCTGACGCAACCCCC ACTGGCTGGGGCTTGGCGATTGGCCATCAGCGCATGCGCGGAACCTTTGT GGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCAGCTTGTTTCGCTC GCAGCAGGTCTGGAGCGGACATTATCGGCACTGACAACTCCGTTGTCCTT TCTCGGAAGTACACCTCCTTCCCATGGCTGCTAGGCTGTGCTGCCAACTG GATCCTGCGCGGGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCTG CGGACGACCCCTCTCGTGGTCGCTTGGGGCTCTGCCGCCCTCTTCTCCGC CTGCCGTTCCGGCCGACGACGGGTCGCACCTCTCTTTACGCGGACTCCCC GCCTGTGCCTTCTCATCTGCCGGCCCGTGTGCACTTCGCTTCACCTCTGC ACGTCGCATGGAGACCACCGTGAACGCCCCTTGGAACTTGCCAACAACCTTACATAAGAGGACTCTTGGACTTTCGCCCCGGTCAACGACCTGGATTGAG GAATACATCAAAGACTGTGTATTTAAGGACTGGGAGGAGTCGGGGGAGGA GTTGAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCATAAATTGGTCT GTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTTTTGTT CATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGC ATGGACATTGACCCTTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC ATTTTTGCCTTCTGACTTCTTCCCGTCTGTCCGGGACCTACTCGACACCG CTTCAGCCCTCTACCGAGATGCCTTAGAATCACCCGAACATTGCACCCCC AACCACACTGCTCTCAGGCAAGCTATTTTGTGCTGGGGTGAGTTGATGAC CTTGGCTTCCTGGGTGGGCAATAATTTAGAGGATCCTGCAGCAAGAGATC TAGTAGTTAATTATGTCAATACTAACATGGGCCTAAAAATTAGACAATTA TTATGGTTTCACATTTCCTGCCTTACATTTGGAAGAGAAACTGTGCTTGA GTATTTGGTGTCTTTTGGAGTGTGGATTCGCACTCCACCTGCTTATAGAC CACCAAATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTGTTAGA CAACGAGGCAGGGCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAG ATCTCAATCACCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTT AGTATTCCTTGGACTCATAAGGTGGGAAACTTTACCGGTCTTTACTCCTC TACTATACCTGTTTTCAATCCTGACTGGTTAACTCCTTCTTTTCCTGACA TTCACTTGCATCAAGATCTGATACAAAAATGTGAACAATTTGTAGGCCCACTCACTACAAATGAAAGGAGACGATTGAAACTAATTATGCCAGCTAGGTT TTATCCCAAAGTTACTAAATACTTCCCTTTGGATAAAGGTATTAAGCCTT ACTAT C CAGAGAAT GT GGT TAATCAT TAC TT TAAAAC TAGACAT TAT T TA CATACTTTGGAAGGAGATCACTGACCATGACCATGACCTT CGCCTCATTTTGTGGGTCACCATTCCTGGGAACAAGAGCTACAGCATG GGAGCACCTCTCTCAACGGCGAGAAGGGGCATGGGACAGAATCTTTCTGT GCCAATCCTCTGGGATTCTTTCCAGACCACCAGTTGGATCCACTATTCA TGGCCAATGGCAAACAAGGTAGGAGTGGGAGGCTTCGGTCCAGGGTTCAC ACCCCCACACGGTGGCCTTCTGGGGTGGAGCCCTCAGGCACAGGGCATTC TGACAACCTCGCCACCAGATCCACCTCCTGCTTCCACCAATCGGGAGGTCA GGCCATGCAGTGGAA

[00280] In certain embodiments, the HBV nucleic acid is the sequence established in GENBANK accession number U95551.1 (incorporated herein as SEQ ID NO: 3). In some embodiments, the modified multisegmented antisense oligonucleotides target a sequence cited in SEQ ID NO: 3 or a portion thereof. In some embodiments, the modified multisegmented antisense oligonucleotides target a sequence at positions Petition 870250074928, dated 08 / 25 / 2025, p. 124 / 475 120 / 292 1583-1602 of SEQ ID NO: 3. PCSK9

[00281] Subtilisin / Kexin Type 9 proprotein convertase (PCSK9) may also be called Subtilisin / Kexin-Like Protease PC9. Human PCSK9 has a cytogenetic location of 1p32.3 and genomic coordinates are on chromosome 1 on the right strand at positions 55,039,548-55,064,852. Human PCSK9 has a gene NCBI ID of 255738, Ref Seq Accession No. of NM_174936.4, Ref Seq Accession No. of NP_777596.2 and Ensembl Gene ID of ENSG00000169174.

[00282] PCSK9 activity is primarily in the liver, and PCSK9 is associated with dyslipidemias, PCSK9-related familial hypercholesterolemia, hypercholesterolemia (familial), gastric papillary adenocarcinoma, homozygous familial hypercholesterolemia, and nasopharyngitis. PCSK9-related familial hypercholesterolemia is a hereditary (autosomal dominant) disease in which the body develops dangerously high blood cholesterol levels due to the lack of a receptor for low-density lipoprotein cholesterol. PCSK9-related familial hypercholesterolemia affects between 1 in 500 heterozygous individuals and 1 in 1,000,000 homozygous individuals worldwide and is more common in Afrikaner, French-Canadian, Lebanese Christian, and Finnish populations. Common symptoms of familial hypercholesterolemia related to PCSK9 include elevated circulating cholesterol contained in low-density lipoproteins alone or also in very low-density lipoproteins.Current treatments for PCSK9-related familial hypercholesterolemia include the administration of statins to inhibit hydroxymethylglutaryl CoA reductase (HMG-CoA reductase) in the liver. Another treatment option for PCSK9-related familial hypercholesterolemia is ezetimibe to inhibit cholesterol absorption in the intestine. Petition 870250074928, dated 08 / 25 / 2025, page 125 / 475 121 / 292

[00283] In some embodiments, the PCSK9 nucleic acid is the sequence established in the NCBI ID gene of NM_174936.4 or a portion thereof.

[00284] In some embodiments, the PCSK9 target comprises the sequence cited in SEQ IDs NOS: 1454, 1458, or 1472, or a portion thereof, or a variant thereof. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to SEQ IDs NO: 1454, 1458, or 1472.

[00285] In some embodiments, the modified multisegmented antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1432, 1436, or 1450. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 1432, 1436, or 1450. DMPK

[00286] The DM1 protein kinase (DMPK) may also be called DM, DM1, DMK, MDPK, DM1PK, MT-PK. Human DMPK has a cytogenetic location of 19q13.32 and the genomic coordinates are on Chromosome 19 on the reverse strand at positions 45, 769, 70945, 782, 490. Human DMPK has a gene NCBI ID of 1760, Ref Seq Accession No. of NM_004409.5, Ref Seq Accession No. of NP_004400.4 and Ensembl Gene ID of ENSG00000104936.

[00287] DMPK activity is primarily in muscle and Petition 870250074928, dated 08 / 25 / 2025, page 126 / 475 122 / 292 DMPK is associated with myotonic dystrophy type 1 and adult-onset Steinert's myotonic dystrophy. The genetic defect in DM1 results from an amplified trinucleotide repeat in the untranslated region of the 3-prime of a protein kinase gene. The severity of the disease varies with the number of repeats: normal individuals have 5 to 37 repeats, mildly affected individuals have 50 to 150 repeats, patients with classic DM have 100 to 1000 repeats, and those with birth-onset may have more than 2000 repeats. The disorder shows genetic anticipation, with the expansion of the repeat number dependent on the sex of the transmitting parent. Alleles with 40 to 80 repeats are generally expanded when transmitted by males, while only alleles with more than 80 repeats tend to expand in maternal transmissions. Repeat contraction events occur 4.2 to 6.4% of the time.The prevalence rate of type 1 diabetes (T1D) is greater than 1 / 1000 in specific populations and 1-9 / 100,000 people worldwide, especially in Europe, Italy, Japan, Ireland, Norway, and the United States. T1D is mainly characterized by myotonia, muscular dystrophy, cataracts, hypogonadism, frontal baldness, and ECG changes. Currently approved drugs for T1D include methylphenidate, dopamine, lamotrigine, mexiletine, and metformin.

[00288] In some embodiments, the DMPK nucleic acid is the sequence established in the NCBI ID gene of NM_004409.5 or a portion thereof.

[00289] In some embodiments, the DMPK target comprises the sequence recited in SEQ ID NO: 1455, 1459, 1460, or 1461, or a portion thereof, or a variant thereof. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, by Petition 870250074928, dated 08 / 25 / 2025, page 127 / 475 123 / 292 less 90%, at least 95%, at least 99%, or 100% complementarity to SEQ ID NO: 1455, 1459, 1460, or 1461.

[00290] In some embodiments, the modified multisegmented antisense oligonucleotide has a nucleobase sequence of SEQ ID NO: 1433, 1437, 1438, or 1439. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 1433, 1437, 1438, or 1439. TTR

[00291] Transthyretin (TTR) may also be called CTS, TTN, ATTR, CTS1, PALB, TBPA, HEL111, HsT2651. Human TTR has a cytogenetic location of 18q12.1 and genomic coordinates are on chromosome 18 on the right strand at position 3159187731598821. Human TTR has a gene NCBI ID of 7276, Ref Seq Accession No. of NM_000371.4, Ref Seq Accession No. of NP_000362.1 and Ensembl Gene ID of ENSG00000118271.

[00292] Transthyretin synthesized in the liver is secreted into the blood, while transthyretin originating in the choroid plexus is destined for the CSF (cerebrospinal fluid). Transthyretin is associated with local and systemic amyloidosis, a disorder characterized by the systemic extracellular deposition of mutated or wild-type transthyretin as amyloid fibrils. Senile systemic amyloidosis is a sporadic disorder resulting from the extracellular deposition of wild-type transthyretin fibrils in cardiac and other tissues. More than 80 mutations in transthyretin are associated with familial amyloidotic polyneuropathy and cardiomyopathy. The Val122Ile, Val30Met, and Gluo.1Lys variants are common amyloidogenic mutations worldwide. Petition 870250074928, dated 08 / 25 / 2025, page 128 / 475 124 / 292 In most of these cases, inheritance is autosomal dominant. The prevalence ratio of Val30Met amyloidosis is 6-9 / 10,000 in Portugal, 1-9 / 1,000,000 in Japan and Cyprus. Patients with transthyretin amyloidosis typically present with polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiomyopathy, and gastrointestinal features, occasionally accompanied by vitreous opacities and renal failure. In later stages of the disease, severe diarrhea with malabsorption, cachexia, disabling neuropathy, severe cardiac disorders, and marked orthostatic hypotension dominate the clinical picture. Death usually occurs 5 to 15 years after the onset of symptoms. The FDA has approved vutrisiran (Amvuttra), patisiran (Onpattro), and inotersen (Tegsedi) for the treatment of polyneuropathy caused by hATTR in adults. Tafamidis (Vyndamax) and tafamidis meglumine (Vyndaqel) are FDA-approved for transthyretin-mediated amyloid cardiomyopathy (ATTR-CM).

[00293] In some embodiments, the TTR nucleic acid is the sequence established in the NCBI ID gene of NM_000371.4 or a portion thereof.

[00294] In some embodiments, the TTR target comprises the sequence recited in SEQ ID NO: 1456, 1462, or 1474, or a portion thereof, or a variant thereof. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementarity to SEQ ID NO: 1456, 1462, or 1474.

[00295] In some embodiments, the modified multisegmented antisense oligonucleotide has a nucleobase sequence with SEQ ID NO: 1434, 1440, or 1452. In some embodiments, the oligo Petition 870250074928, dated 08 / 25 / 2025, p. 129 / 475 The modified multisegmented antisense nucleotide 125 / 292 is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 1434, 1440, or 1452. AAT

[00296] Member 1 of the A family of serpin (SERPINA1) may also be called PI, A1A, AAT, PI1, A1AT, nNIF, PRO2275, alpha1AT. Human SERPINA1 has a cytogenetic location of 14q32.13 and the genomic coordinates are on Chromosome 14 on the reverse strand at positions 94, 376, 747-94, 390, 635. Human SERPINA1 has a gene NCBI ID of 5265, Ref Seq Accession No. of NM_000295.5, Ref Seq Accession No. of NP_000286.3 and Ensembl Gene ID of ENSG00000197249.

[00297] AAT is predominantly produced by hepatocytes and secreted into the blood; however, low levels of AAT expression are also detected in the lung and intestine. Diseases associated with SERPINA1 include Alpha-1-Antitrypsin deficiency and hemorrhagic disease due to the Pittsburgh mutation of Alpha-1-Antitrypsin. Alpha-1 antitrypsin deficiency is a hereditary disorder that can cause lung disease and liver disease. Alpha-1 antitrypsin deficiency occurs worldwide, but its prevalence varies by population. This disorder affects approximately 1 in 1500 to 3500 individuals of European descent. It is uncommon in people of Asian descent. Many individuals with alpha-1 antitrypsin deficiency are likely undiagnosed, particularly people with a lung condition called chronic obstructive pulmonary disease (COPD).COPD can be caused by alpha-1 antitrypsin deficiency; however, alpha-1 antitrypsin deficiency often does not cause chronic conditions. Petition 870250074928, dated 08 / 25 / 2025, page 130 / 475 A deficiency of 126 / 292 is diagnosed. Some people with alpha-1 antitrypsin deficiency are misdiagnosed with asthma. Treatment of lung disease may include bronchodilators, inhaled steroids, and, when infections occur, antibiotics. Intravenous infusions of A1AT protein or lung transplantation in severe cases may also be recommended. In people with severe liver disease, liver transplantation may be an option. It is also recommended to avoid smoking and to get vaccinated against influenza, pneumococcus, and hepatitis.

[00298] In some embodiments, the nucleic acid of AAT is the sequence established in the NCBI ID gene of NM_000295.5 or a portion thereof.

[00299] In some embodiments, the AAT target comprises the sequence recited in SEQ ID NO: 1457 or 1463 or a portion thereof or a variant thereof. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% complementarity to SEQ ID NO: 1457 or 1463.

[00300] In some embodiments, the modified multisegmented antisense oligonucleotide has a nucleobase sequence of SEQ ID NO: 1435 or 1441. In some embodiments, the modified multisegmented antisense oligonucleotide is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 1435 or 1441.

[00301] As a general matter, the target of oligonucleotides Petition 870250074928, dated 08 / 25 / 2025, page 131 / 475 127 / 292 Modified multisegmented tissue samples are gene transcripts. In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon / intron junction, a coding region, a translation initiation region, a translation termination region, or another defined nucleic acid region. Structurally defined regions for a target can be obtained by accession number from sequence databases such as NCBI, and such information is incorporated herein by reference. In certain embodiments, a target region may span the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.

[00302] Targeting involves determining at least one target segment to which an antisense compound hybridizes so that a desired effect occurs. In certain embodiments, the desired effect is a reduction in the levels of the target nucleic acid mRNA. In certain embodiments, the desired effect is a reduction in the levels of the protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[00303] A target region may contain one or more target segments. Multiple target segments within a target region may overlap. Alternatively, they may be non-overlapping. In certain embodiments, the target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, the target segments within a target region are separated by a number of nucleotides that is, is about, is not more than, is not more than about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides in the target nucleic acid, or is a range defined by any two of the preceding values. In certain mo Petition 870250074928, dated 08 / 25 / 2025, page 132 / 475 In embodiments 128 / 292, the target segments within a target region are separated by no more than, or no more than about 5 nucleotides in the target nucleic acid. In certain embodiments, the target segments are contiguous. Target regions defined by a band with a starting nucleic acid that is either one of the 5' target sites or 3' target sites listed here are contemplated.

[00304] Suitable target segments can be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon / intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifically exclude a certain structurally defined region, such as the start codon or the stop codon.

[00305] Determining suitable target segments may involve comparing the sequence of a target nucleic acid with other sequences throughout the genome. For example, the BLAST algorithm can be used to identify regions of similarity between different nucleic acids. This comparison can prevent the selection of antisense oligonucleotide sequences that may hybridize in a non-specific manner with sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences). Hybridization

[00306] In some embodiments, hybridization occurs between an antisense oligonucleotide disclosed herein and a target nucleic acid. The most common hybridization mechanism involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or inverted Hoogsteen hydrogen bonding) between complementary nucleobases of nucleic acid molecules.

[00307] Hybridization can occur under varying conditions. The strict conditions are sequence-dependent and are determined Petition 870250074928, dated 08 / 25 / 2025, page 133 / 475 129 / 292 of the nature and composition of the nucleic acid molecules to be hybridized.

[00308] The methods for determining whether a sequence is specifically hybridizable with a target nucleic acid are well known in the art. In certain embodiments, the antisense oligonucleotides provided here are specifically hybridizable with a target nucleic acid. Complementarity

[00309] An antisense oligonucleotide and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense oligonucleotide can hydrogen-bind with the corresponding nucleobases of the target nucleic acid, so that a desired effect occurs (e.g., antisense inhibition of a target nucleic acid).

[00310] Non-complementary nucleobases between an antisense oligonucleotide and a target nucleic acid may be tolerated provided that the antisense oligonucleotide remains capable of specifically hybridizing with a target nucleic acid. Furthermore, an antisense oligonucleotide may hybridize onto one or more segments of a target nucleic acid, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch, or hairpin structure).

[00311] In certain embodiments, the antisense oligonucleotides provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a target nucleic acid, a target region, target segment or specified portion thereof. The percent complementarity of an antisense oligonucleotide with a target nucleic acid may be Petition 870250074928, dated 08 / 25 / 2025, page 134 / 475 130 / 292 determined using routine methods.

[00312] For example, an antisense oligonucleotide wherein 18 of the 20 nucleobases of the antisense oligonucleotide are complementary to a target region and therefore would specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense oligonucleotide that is 18 nucleobases long with four non-complementary nucleobases that are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8 percent overall complementarity with the target nucleic acid and would therefore fall within the scope of the present invention.The percent complementarity of an antisense oligonucleotide with a region of a target nucleic acid can be routinely determined using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Percent homology, sequence identity, or complementarity can be determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison, Wis.), using default settings, which uses the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482-489).

[00313] In certain embodiments, the antisense oligonucleotides provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, or a specified portion thereof. As used herein, fully complementary means that each nucleobase of an antisense oligonucleotide is capable of precise base pairing with Petition 870250074928, dated 08 / 25 / 2025, page 135 / 475 131 / 292 as the corresponding nucleobases of a target nucleic acid. For example, a 20-nucleobase antisense oligonucleotide is fully complementary to a target sequence that is 400 nucleobases long, provided there is a corresponding 20-nucleobase portion of the target nucleic acid that is fully complementary to the antisense oligonucleotide. Fully complementary can also be used in reference to a specified portion of the first and / or second nucleic acid. For example, a 20-nucleobase portion of a 30-nucleobase antisense oligonucleotide can be fully complementary to a target sequence that is 400 nucleobases long. The 20-nucleobase portion of the 30-nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20-nucleobase portion, with each nucleobase being complementary to the 20-nucleobase portion of the antisense oligonucleotide.At the same time, the entire 30-nucleobase antisense oligonucleotide may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense oligonucleotide are also complementary to the target sequence.

[00314] The location of a non-complementary nucleobase may be at the 5' end or the 3' end of the antisense oligonucleotide. Alternatively, the non-complementary nucleobase or nucleobases may be in an internal position of the antisense oligonucleotide. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapper antisense oligonucleotide. In another embodiment, a non-complementary nucleobase is located in the wing segment of a multisegmented antisense oligonucleotide. Petition 870250074928, dated 08 / 25 / 2025, page 136 / 475 132 / 292

[00315] The antisense oligonucleotides provided also include those that are complementary to a portion of a target nucleic acid. As used herein, portion refers to a defined number of contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A portion may also refer to a defined number of contiguous nucleobases of an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotides are complementary to at least an 8-nucleobase portion of a target segment. In certain embodiments, the antisense oligonucleotides are complementary to at least a 9-nucleobase portion of a target segment. In certain embodiments, the antisense oligonucleotides are complementary to at least a 10-nucleobase portion of a target segment. In certain embodiments, antisense oligonucleotides are complementary to at least one 11-nucleobase portion of a target segment.In certain embodiments, antisense oligonucleotides are complementary to at least one 12-nucleobase portion of a target segment. In certain embodiments, antisense oligonucleotides are complementary to at least one 13-nucleobase portion of a target segment. In certain embodiments, antisense oligonucleotides are complementary to at least one 14-nucleobase portion of a target segment. In certain embodiments, antisense oligonucleotides are complementary to at least one 15-nucleobase portion of a target segment. Antisense oligonucleotides that are complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase portions of a target segment, or a range defined by any two of these values, are also contemplated. Identity

[00316] The antisense oligonucleotides provided here may have Petition 870250074928, dated 08 / 25 / 2025, page 137 / 475 133 / 292 also a defined percentage of identity for a particular nucleotide sequence (i.e., SEQ ID NOs: 11-1453 or 500030983, or oligonucleotide, or portion thereof). As used herein, an antisense oligonucleotide is identical to the sequence disclosed herein if it has the same nucleobase pairing capability. For example, an RNA containing uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence, since uracil and thymidine pair with adenine. Shortened and elongated versions of the antisense oligonucleotides described herein, as well as oligonucleotides with non-identical bases relative to the antisense oligonucleotides provided herein, are also contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense oligonucleotide.The percentage of identity of an antisense oligonucleotide is calculated based on the number of bases that have identical base pairings with respect to the sequence being compared.

[00317] As used herein, complementary polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will pair with pyrimidines to form a combination of guanine paired with cytosine (G:C) and adenine paired with thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. For example, the sequence AGT binds to the complementary sequence TCA. It is understood that two polynucleotides can hybridize with each other even if they are not completely complementary to each other, provided that each has at least one region that is substantially complementary to the other.

[00318] As used herein, the terms substantially complementary or partially complementary mean that two nucleic acid sequences are complementary in at least about Petition 870250074928, dated 08 / 25 / 2025, page 138 / 475 134 / 292%, 60%, 70%, 80% or 90% of its nucleotides.

[00319] In some embodiments, the two nucleic acid sequences may be complementary in at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some modalities, the two nucleic acid sequences can be between 60% and 100% complementary, between 70% and 100% complementary, between 80% and 100% complementary, between 90% and 100% complementary, between 60% and 90% complementary, between 60% and 80% complementary, between 60% and 70% complementary, between 70% and 90% complementary, between 70% and 80% complementary, between 80% and 100% complementary, or between 80% and 90% complementary.

[00320] The terms substantially complementary and partially complementary can also mean that two nucleic acid sequences can hybridize under conditions of high rigor, and such conditions are well known in the art.

[00321] As used herein, the term identity means that the sequences are compared with each other as follows. In order to determine the percentage of identity of two nucleic acid sequences, the sequences may first be aligned with respect to each other in order to subsequently make a comparison of these sequences possible. For this, for example, gaps may be inserted into the sequence of the first nucleic acid sequence and the nucleotides may be compared with the corresponding position in the second nucleic acid sequence. If a position in the first nucleic acid sequence is occupied by the same nucleotide as is the case in a position in the second sequence, the two sequences are identical at this position. The percentage of identity between two sequences is a function of the number of identical positions divided by the number of all positions compared in the sequences investigated. Petition 870250074928, dated 08 / 25 / 2025, page 139 / 475 135 / 292

[00322] A percentage of identity for aligned segments of a test sequence and a reference sequence is the percentage of identical components that are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, that is, the entire reference sequence or a defined smaller part of the reference sequence.

[00323] The percentage identity of two sequences can be determined with the aid of a mathematical algorithm. An example of a mathematical algorithm that can be used for comparing two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90: 5873-5877. Such an algorithm is integrated into the NBLAST program, with which sequences that have a desired identity with the sequences of the present invention can be identified. In order to obtain a gapped alignment, as described herein, the Gapped BLAST program can be used, as described in Altschul et al.(1997), Nucleic Acids Res, 25:3389-3402. If the BLAST and Gapped BLAST programs are used, the predefined parameters of the specific program (e.g., NBLAST) can be used. Sequences can be further aligned using version 9 of the Genetic Computing Group's GAP (global alignment program) using the predefined matrix (BLOSUM62) (values ​​-4 to +11) with a gap opening penalty of -12 (for the first zero of a gap) and a gap extension penalty of -4 (for each additional successive zero in the gap). After alignment, percent identity is calculated by expressing the number of matches as a percent content of nucleic acids in the claimed sequence. The methods described for determining the percent identity of two nucleic acid sequences can also be used correspondingly, if necessary, on encoded amino acid sequences. Petition 870250074928, dated 08 / 25 / 2025, page 140 / 475 136 / 292

[00324] Useful methods for determining sequence identity are also revealed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo, H., and Lipton, D., (Applied Math48: 1073 (1988)). More particularly, preferred computer programs for determining sequence identity include, but are not limited to, Basic Local Alignment Search Tool (BLAST) programs that are publicly available from the National Center for Biotechnology Information (NCBI) at the National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; See BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)); version 2.BLAST programs with version 0 or higher allow the introduction of gaps (deletions and insertions) in alignments; for peptide sequences, BLASTX can be used to determine sequence identity; and, for polynucleotide sequences, BLASTN can be used to determine sequence identity. The percentage of identity can be 70% identity or higher, for example, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity. Modifications

[00325] A nucleoside is a base-sugar combination. The nucleobase (also known as the base) portion of the nucleoside is typically a heterocyclic base. Nucleotides are nucleosides that also include a phosphate group covalently linked to the sugar portion of the nucleoside. For nucleosides that include a pentofuranosyl sugar, the phosphate group may be attached to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides. Petition 870250074928, dated 08 / 25 / 2025, page 141 / 475 137 / 292 to the others, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleosidic bonds of the oligonucleotide.

[00326] Modifications to antisense oligonucleotides include substitutions or alterations in internucleosidic bonds, sugar moieties, or nucleobases. Modified antisense oligonucleotides are often preferred over native forms due to desirable properties such as enhanced cellular uptake, increased affinity for the nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

[00327] Chemically modified nucleosides can also be used to increase the binding affinity of a shortened or truncated antisense oligonucleotide to its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense oligonucleotides that have such chemically modified nucleosides. Modified internucleoside bonds

[00328] The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester bond. Antisense oligonucleotides with one or more modified, i.e., non-naturally occurring, internucleoside linkages are often selected over antisense oligonucleotides with naturally occurring internucleoside linkages due to desirable properties such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[00329] Oligonucleotides with modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom, as well as internucleoside linkages that lack a phosphorus atom. Petition 870250074928, dated 08 / 25 / 2025, page 142 / 475 138 / 292 phosphorus atom. Representative internucleosidic bonds containing phosphorus include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. The methods for preparing both phosphorus-containing and non-phosphorus-containing bonds are well known.

[00330] In certain embodiments, antisense oligonucleotides targeting a specific nucleic acid comprise one or more modified internucleosidic bonds. In certain embodiments, the modified internucleosidic bonds are phosphorothioate bonds. In certain embodiments, each internucleosidic bond of an antisense oligonucleotide is a phosphorothioate internucleosidic bond. In some embodiments, a modified multisegmented antisense oligonucleotide comprises one or more modified internucleosidic bonds, wherein the modified internucleosidic bond is a phosphorodiamidate bond between morpholino nucleoside mimetics. Modified sugar portions

[00331] The antisense oligonucleotides provided herein may optionally contain one or more nucleosides having the sugar group modified. Such sugar-modified nucleosides may confer greater stability to the nuclease, greater binding affinity, or some other beneficial biological property to the antisense oligonucleotides. In certain embodiments, the nucleosides comprise a chemically modified portion of the ribofuranose ring. Examples of chemically modified ribofuranose rings include, without limitation, the addition of substituent groups (including 5' and 2' substituent groups); bridging of non-geninal ring atoms to form bicyclic nucleic acids (BNA); substitution of the oxygen atom of the ribosyl ring by S, N(R), or C(R1)(R2)(R = H, C1-C12 alkyl, or a protecting group); and combinations thereof. Examples of chemically modified sugars Petition 870250074928, dated 08 / 25 / 2025, page 143 / 475 139 / 292 Modified forms include, substituted 2'-F-5'-methyl nucleoside (see International PCT Application No. WO 2008 / 101157, published on 21 / 08 / 08 for other 5',2'-bis-substituted nucleosides disclosed), substitution of the oxygen atom of the ribosyl ring by S with additional substitution at the 2' position (see US Patent Application No. US2005 / 0130923, published on June 16, 2005), or, alternatively, 5' substitution of a BNA (see International PCT Application No. WO 2007 / 134181, published on 22 / 11 / 07, wherein LNA is substituted by, for example, a 5'-methyl or 5'-vinyl group).

[00332] Examples of nucleosides with modified sugar moieties include, without limitation, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3 and 2'O(CH2)2OCH3 substituent groups. The substituent at the 2' position may also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, OCF3, O(CH2)2SCH3, O(CH2)2-ON(Rm)(Rn), and O-CH2-C(=O)-N(Rm)(Rn), wherein each Rm and Rn independently H or C1-C10 alkyl is substituted or unsubstituted.

[00333] As used herein, bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense oligonucleotides provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4' to 2' bicyclic nucleoside. Examples of such 4' to 2' bicyclic nucleosides include, but are not limited to, one of the following formulas: 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2; 4'-(CH2)2-O-2' (Ena); 4'-CH(CH3)-O-2' (cEt) and 4'-CH(CH2OCH3)-O-2', and analogues thereof (see US Patent No. 7,399,845, issued July 15, 2008); 4'-C(CH3)(CH3)-O-2', and analogues thereof (see International PCT Application WO2009 / 006478, published January 8, 2009). Petition 870250074928, dated 08 / 25 / 2025, page 144 / 475 140 / 292 2009); 4-CH2-N(OCH3)-2', and analogues thereof (see International PCT Application published WO2008 / 150729, published December 11, 2008); 4'-CH2-ON(CH3)-2' (see US Patent Application published US2004 / 0171570, published September 2, 2004); 4'-CH2N(R)-O-2', wherein R is H, C1-C12 alkyl, or a protecting group (see US Patent No. 7,427,672, issued September 23, 2008); 4'CH2-C(H)(CH3)-2' (see Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2', and analogues thereof (see, published International PCT Application WO 2008 / 154401, published December 8, 2008). See also, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Academic. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 22192222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc.,129 (26) 8362-8379 (July 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; US Patent Nos. 6,670,461, 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 7,399,845; Published international PCT applications WO 2004 / 106356, WO 94 / 14226, WO 2005 / 021570 and WO 2007 / 134181; US ​​Patent Publications Nos. US2004 / 0171570, US2007 / 0287831 and US2008 / 0039618; and US Patents Nos. 12 / 129,154, 60 / 989,574, 61 / 026,995, 61 / 026,998, 61 / 056,564, 61 / 086,231, 61 / 097,787 and 61 / 099,844; and International PCT Applications Nos. PCT / US2008 / 064591, PCT / US2008 / 066154 and. PCT / US2008 / 068922. Each of the above bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see international PCT application no. PCT / DK98 / 00393, published on March 25, 1999 as WO 99 / 14226). Petition 870250074928, dated 08 / 25 / 2025, p. 145 / 475 141 / 292

[00334] In certain embodiments, the bicyclic sugar moieties of BNA nucleosides include, but are not limited to, oligonucleotides with at least one bridge between the 4' and 2' positions of the pentofuranosyl sugar moiety, such bridges independently comprising 1 or 2 to 4 independently linked groups selected from --[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, C(=S)-, -O-, -Si(Ra)2-, -S(=O)x- and -N(Ra)-; given that: x is 0, 1, or 2; n is 1, 2, 3 or 4; each Ra and Rbé, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, a heterocyclic radical, a substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1e J2é, independently, H, C1-C12 alkyl, substituted C1C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocyclic radical, a substituted heterocyclic radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

[00335] In certain embodiments, the bridge of a bicyclic sugar moiety is -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, -C(Ra)(Rb)-N(R)-O-or, -C(Ra)(Rb)-ON(R)-. In certain embodiments, the bridge is 4'-CH2-2', 4'(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2'-, where each R is independently H, a protecting group or C1-C12 alkyl. Petition 870250074928, dated 08 / 25 / 2025, p. 146 / 475 142 / 292

[00336] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge may be in the α-L configuration or the β-D configuration. Previously, α-L-methylene-oxy (4'-CH2-O-2') BNAs were incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 63 6563 72).

[00337] In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-Methyleneoxy (4'-CH2-O-2') BNA, (B) βD-Methyleneoxy (4'-CH2-O-2') BNA, (C) Ethyleneoxy (4'-(CH2)2-O-2') BNA, (D) Aminooxy (4'-CH2-ON(R)-2') BNA, (E) Oxamino (4'-CH2-N(R)-O-2') BNA, (F) Methyl (methylenexy) (4'-CH(CHs)-O-2') BNA, (G) methylene-thio (4'CH2-S-2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA and (J) propylene carbocyclic (4'(CH2)3-2') BNA as represented below. Formula 6 Petition 870250074928, dated 08 / 25 / 2025, pp. 147 / 475 143 / 292 where Bx is the base portion and R is, independently, H, a protecting group or C1-C12 alkyl.

[00338] In certain embodiments, the bicyclic nucleoside conforms to Formula I: Formula 7 where: Bx is a heterocyclic base moiety; -Qa-Qb-Qc- is -CH2-N(Rc)-CH2-, -C(=O)-N(Rc)-CH2-, -CH2-ON(Rc)-, -CH2-N(Rc)-O- or -N(Rc)-O-CH2; Rcé C1-C12 alkyl or an amino protecting group; and Tae Tbsão, each independently, H, a protecting hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a supporting medium.

[00339] In certain embodiments, the bicyclic nucleoside with Formula II: Ta^°~\O Bx Formula 8 where: Bx is a heterocyclic base moiety; Tae Tbsão, each independently, H, a protecting hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a supporting medium. Petition 870250074928, dated 08 / 25 / 2025, page 148 / 475 144 / 292 te; Za is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.

[00340] In one embodiment, each of the substituted groups is independently mono- or poly-substituted by substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJcJd, SJc, N3, OC(=X)Jc, and NJeC(=X)NJcJd, wherein each Jc, Jd, and Je is independently H, C1-C6 alkyl, or substituted C1-C6 alkyl and X is O or NJc.

[00341] In certain embodiments, the bicyclic nucleoside with Formula III: Formula 9 where: Bx is a heterocyclic base moiety; Tae Tbsão, each independently, H, a protecting hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a supporting medium; Zbé C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(=O)-).

[00342] In certain embodiments, the bicyclic nucleoside with Formula IV: Petition 870250074928, dated 08 / 25 / 2025, p. 149 / 475 145 / 292 given that: Bx is a heterocyclic base moiety; Ta and Tb are, each independently, H, a protecting hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a supporting medium; R is C1-C6 alkyl, C1-C6 substituted alkyl, C2-C6 alkenyl, C2-C6 substituted alkenyl, C2-C6 alkynyl, or C2-C6 substituted alkynyl; each qa, qb, qce, qdé, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl, or substituted C1-C6 aminoalkyl;

[00343] In certain embodiments, the bicyclic nucleoside with Formula V: given that: Bx is a heterocyclic base moiety; Tae Tbsion, each independently, H, a protecting hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a supporting medium. Petition 870250074928, dated 08 / 25 / 2025, p. 150 / 475 146 / 292 te; qa, qb, qee qf are each independently hydrogen, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, OC(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk or N(H)C(=S)NJjJk; or q and qf together are =C(qg) (qh); qge qhsion, each independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

[00344] The synthesis and preparation of the monomers of methyleneoxy(4'-CH2-O-2') adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, together with their oligomerization and nucleic acid recognition properties, have been described (see, for example, Koshkin et al., Tetraedro, 1998, 54, 3607-3630). The BNAs and their preparation are also described in WO 98 / 39352 and WO 99 / 14226.

[00345] Analogs of methylene-oxy(4'-CH2-O-2')BNA, methylene-oxy(4'-CH2-O-2')BNA and 2'-thio-BNAs have also been prepared (see, for example, Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of blocked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (see, for example, Wengel et al., WO 99 / 14226). Furthermore, the synthesis of 2'-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog, has been described in the technique (see, for example, Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino and 2'-methylamino-BNA have been prepared, and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported. Petition 870250074928, dated 08 / 25 / 2025, page 151 / 475 147 / 292

[00346] In certain embodiments, the bicyclic nucleoside with Formula VI: given that: Bx is a heterocyclic base moiety; Ta and Tb are, each independently, H, a protecting hydroxyl group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a supporting medium; each qi, qj, qke ql is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted C1-C12 alkoxyl, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, OC(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk, or N(H)C(=S)NJjJk; and qie qjou ql and qk together are =C(qg) (qh), where qge qh are, each one, independently, H, halogen, C1-C12 alkyl, or substituted C1-C12 alkyl.

[00347] A carbocyclic bicyclic nucleoside with a 4'(CH2)3-2' bridge and the alkenyl analog, 4'-CH=CH-CH2-2' bridge, have been described (see, for example, Freier et al., Nucleic Acids Research, 1997, 25 (22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, for example, Srivastava et al., J. Am. Chem. Soc. 2007, 129 (26), 8362-8379).

[00348] As used herein, bicyclic nucleoside refers to a Petition 870250074928, dated 08 / 25 / 2025, page 152 / 475 148 / 292 nucleoside comprising a bridge linking two carbon atoms of the sugar ring, thus forming a bicyclic sugar moiety. In certain embodiments, the bridge connects carbon 2' and another carbon of the sugar ring.

[00349] As used herein, 4-2' bicyclic nucleoside or 4' to 2' bicyclic nucleoside refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge linking the 2' carbon atom and the 4' carbon atom.

[00350] As used herein, monocyclic nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

[00351] As used herein, modified sugar at position 2' means a furanosyl sugar modified at position 2'. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to, substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2' modifications are selected from substituents including, but not limited to: O[(CH2)nO]mCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, OCH2C(=O)N(H)CH3, and O(CH2)nON[(CH2)nCH3]2, wherein there are from 1 to about 10.Other 2' substituent groups may also be selected from: C1-C12 alkyl; substituted alkyl; alkenyl; alkynyl; alkaryl; aralkyl; O-alkaryl or O-aralkyl; SH; SCH3; OCN; Cl; Br; CN; CF3; OCF3; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleavage group; a reporter group; an intercalator; a group to enhance RNA properties. Petition 870250074928, dated 08 / 25 / 2025, p. 153 / 475 149 / 292 pharmacokinetics; and a group to enhance the pharmacodynamic properties of an antisense oligonucleotide and other substituents with similar properties. In certain embodiments, the modified nucleosides comprise a 2'-MOE side chain (see, for example, Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such a 2'-MOE substitution has been described as having enhanced binding affinity compared to unmodified nucleosides and to other modified nucleosides such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides with the 2'-MOE substituent have also been shown to be antisense inhibitors of gene expression with promising characteristics for in vivo use (see, for example, Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[00352] As used herein, a modified tetrahydropyran nucleoside or modified THP nucleoside means a nucleoside with a six-membered tetrahydropyran sugar substituted for the pentofuranosyl residue in normal nucleosides (a sugar substitute). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841854), fluoro HNA (F-HNA), or oligonucleotides with Formula X: wherein, independently, for each of the said, at least one tetrahydropyran nucleoside analogue of Formula X: Petition 870250074928, dated 08 / 25 / 2025, p. 154 / 475 150 / 292 Bx is a heterocyclic base moiety; T3 and T4 are each independently either an internucleoside linking group that links the tetrahydropyran nucleoside analog to the antisense oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links the tetrahydropyran nucleoside analog to the antisense oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a conjugated group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and one of R1 and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJJ2, NJ3C(=X)NJ1J2, and CN, wherein X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[00353] In certain embodiments, the modified THP nucleosides of Formula X are provided wherein qm, qn, qp, qr, qs, qt, and qq are each H. In certain embodiments, at least one of qm, qn, qp, qr, qs, qt, and qq is different from H. In certain embodiments, at least one of qm, qn, qp, qr, qs, qt, and qq is methyl. In certain embodiments, the THP nucleosides of Formula X are provided where one of R1 and R2 is F. In certain embodiments, R1 is fluoro and R2 is H, R1 is methoxy and R2 is H, and R1 is methoxyethoxy and R2 is H.

[00354] As used herein, 2'-modified nucleoside or 2'-substituted nucleoside refers to a nucleoside comprising a sugar comprising a substituent at the 2' position of a furanose ring other than H or OH. 2'-modified nucleosides include, but are not limited to, bicyclic nucleosides where the bridge connecting two carbon atoms of the sugar ring Petition 870250074928, dated 08 / 25 / 2025, pp. 155 / 475 151 / 292 connects the 2' carbon and another carbon of the sugar ring and nucleosides with unbridged 2' substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, -OCF3, O-(CH2>OCH3), 2'-O(CH2)2SCH3, O(CH2)2-ON(Rm)(Rn), or O-CH2-C(=O)-N(Rm)(Rn), wherein each Rm and Rn independently have either H or C1-C10 alkyl, substituted or unsubstituted.

[00355] As used herein, 2'-F refers to a sugar comprising a fluoro group at the 2' position.

[00356] As used herein, 2'-OMe or 2'-OCH3 or 2'-O-methyl each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2' position of the sugar ring.

[00357] As used herein, oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[00358] Many other bicyclic and tricyclic sugar substitute ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense oligonucleotides (see, for example, review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to increase activity.

[00359] The methods for preparing modified sugars are well known to those skilled in the art.

[00360] In nucleotides with modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are retained for hybridization with an acid target. Petition 870250074928, dated 08 / 25 / 2025, page 156 / 475 152 / 292 appropriate nucleic acid.

[00361] In certain embodiments, antisense oligonucleotides comprise one or more nucleotides with modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'MOE. In certain embodiments, the nucleotides modified with 2'MOE are arranged in a gapper motif or a multi-segmented antisense oligonucleotide motif. In certain embodiments, the modified sugar moiety is a cEt. In certain embodiments, the nucleotides modified with cEt are arranged along the wings of a gapper motif or a multi-segmented antisense oligonucleotide motif. Compositions and methods for formulating pharmaceutical compositions

[00362] The oligonucleotides of the development can be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on various criteria, including, but not limited to, route of administration, extent of the disease, or dose to be administered.

[00363] Pharmaceutical compositions comprising antisense oligonucleotides encompass any salts, esters, or pharmaceutically acceptable salts of such esters, or any other oligonucleotide which, after administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Therefore, for example, the disclosure is also designed for pharmaceutically acceptable salts of antisense oligonucleotides, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. Petition 870250074928, dated 08 / 25 / 2025, page 157 / 475 153 / 292

[00364] A prodrug may involve the incorporation of additional nucleosides at one or both ends of an antisense compound that are cleaved by endogenous nucleases within the body to form the active antisense compound.

[00365] The disclosure provides pharmaceutical compositions comprising the modified multisegmented antisense oligonucleotides of the disclosure and a pharmaceutically acceptable vehicle, diluent or excipient. In some embodiments, the modified multisegmented antisense oligonucleotide comprises a sequence structure of any of the oligonucleotide sequences described herein.

[00366] Modified multisegmented antisense oligonucleotides can be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on various criteria, including, but not limited to, route of administration, extent of the disease, or dose to be administered.

[00367] The pharmaceutical compositions of the disclosure may optionally comprise therapeutic agents, pharmaceutical agents, carriers, adjuvants, dispersing agents, diluents and the like.

[00368] Pharmaceutical compositions comprising modified multisegmented antisense oligonucleotides may include any pharmaceutically acceptable salts, esters or salts of such esters, or any other oligonucleotide which, after administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Therefore, for example, the disclosure is also designed for pharmaceutically acceptable salts of antisense oligonucleotides. Petition 870250074928, dated 08 / 25 / 2025, page 158 / 475 154 / 292 so, prodrugs, pharmaceutically acceptable salts of such prodrugs and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[00369] Modified multisegmented antisense oligonucleotides formulated as prodrugs are contemplated as being within the scope of the present disclosure. A prodrug may include the incorporation of additional nucleosides at one or both ends of an antisense oligonucleotide that are cleaved by endogenous nucleases within the body to form the active antisense oligonucleotide.

[00370] Pharmaceutical compositions may contain any of the reagents discussed above and one or more of a pharmaceutically acceptable vehicle, diluent or excipient.

[00371] A pharmaceutical composition is a formulation comprising the modified multisegmented antisense oligonucleotides described herein, in a form suitable for administration to an individual. In certain embodiments, the pharmaceutical composition is in bulk or in unit dose form. The unit dose form is any one of a variety of forms, including, for example, a capsule, an IV bag, a tablet, a single-use injector, a single pump in an aerosol inhaler, or a vial. The amount of active ingredient (e.g., a formulation of the modified multisegmented antisense oligonucleotide) in a unit dose of the composition is an effective amount and is varied according to the particular treatment involved. One skilled in the art will appreciate that it is sometimes necessary to make routine variations in dosage depending on the age and condition of the patient. The dosage will also depend on the route of administration.A variety of routes are contemplated, including oral, pulmonary, rectal, parenteral, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, inhalation, buccal, subcutaneous. Petition 870250074928, dated 08 / 25 / 2025, page 159 / 475 155 / 292 lingual, intrapleural, intrathecal, intranasal and the like. Dosage forms for topical or transdermal administration of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. In certain embodiments, the modified multisegmented antisense oligonucleotide is mixed under sterile conditions with a pharmaceutically acceptable vehicle and with any preservatives, buffers or propellants that may be necessary.

[00372] Pharmaceutically acceptable excipient means an excipient that is useful in the preparation of a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes excipients that are acceptable for veterinary use as well as human pharmaceutical use. A pharmaceutically acceptable excipient, as used in the descriptive report, includes one and more than one of these excipients.

[00373] A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral administration, for example, intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), intraperitoneal (into the body cavity), and transmucosal. Solutions or suspensions used for parenteral, intradermal, intraperitoneal, or subcutaneous application may include the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methylparabens; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates; and tonicity adjusters, such as sodium chloride or dextrose.pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A. Petition 870250074928, dated 08 / 25 / 2025, page 160 / 475 156 / 292 Parenteral or subcutaneous preparations may be enclosed in ampoules, disposable syringes, or multi-dose vials made of glass or plastic. These preparations may contain antioxidants, buffers, bacteriostatics, and solutes that make the formulation isotonic with the blood of the intended recipient. Sterile aqueous and non-aqueous suspensions may include suspending agents and thickening agents. The formulations may be presented in single / dose or multidose containers, for example, ampoules, syringes, and sealed vials, and may be stored in a lyophilized (freeze-dried) condition that requires only the addition of the sterile liquid vehicle, for example, saline solution or water for injection, immediately before use.

[00374] The pharmaceutical composition described herein may be manufactured in a manner generally known, for example, by conventional processes of mixing, dissolving, granulating, producing dragees, levigating, emulsifying, encapsulating, trapping or lyophilizing. Pharmaceutical compositions may be conventionally formulated using one or more pharmaceutically acceptable vehicles, comprising excipients and / or adjuvants that facilitate the processing of the active compounds into preparations that can be used pharmaceutically. Naturally, the appropriate formulation depends on the chosen route of administration.

[00375] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (when soluble in water) or sterile dispersions and powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline solution, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid enough to allow for easy syringeability. It must be stable in Petition 870250074928, dated 08 / 25 / 2025, page 161 / 475 157 / 292 manufacturing and storage conditions and must be protected against the contaminating action of microorganisms such as bacteria and fungi. The vehicle may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol and the like) and suitable mixtures thereof. Adequate fluidity may be maintained, for example, by the use of a coating such as lecithin, by maintaining the necessary particle size in the case of dispersion, and by the use of surfactants. Prevention of microbial action may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol and sorbitol, and sodium chloride in the composition.Prolonged absorption of injectable compositions can be caused by the inclusion in the composition of an agent that delays absorption, for example, aluminum monostearate and gelatin.

[00376] Oral compositions generally include an inert diluent or a pharmaceutically acceptable edible vehicle. They may be placed in gelatin capsules or tablets. For purposes of oral therapeutic administration, the active ingredient may be incorporated with excipients and used in the form of tablets, pills, or capsules. Oral compositions may also be prepared using a fluid carrier for use as a mouthwash, wherein the agents in the fluid carrier are applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents and / or adjuvant materials may be included as part of the composition. Tablets, pills, capsules, pills, and the like may contain any of the following ingredients or agents of a similar nature: a binder, such as microcrystalline cellulose, tragacanth gum, or gelatin; a Petition 870250074928, dated 08 / 25 / 2025, page 162 / 475 158 / 292 excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel or corn starch; a lubricant such as magnesium stearate or Sterotes; a glide such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate or orange flavor.

[00377] For administration by inhalation, the agents are administered in the form of an aerosol spray from a pressurized container or dispenser, which contains a suitable propellant, for example, a gas such as carbon dioxide or a nebulizer.

[00378] Pharmaceutical compositions can be prepared with pharmaceutically acceptable carriers that will protect the modified multisegmented antisense oligonucleotides against rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. The methods for preparing such formulations will be evident to those skilled in the art, and the materials can be obtained commercially. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. They can be prepared according to methods known to those skilled in the art, for example, as described in US Patent No. 4.522,811.

[00379] It is especially advantageous to formulate oral or parenteral compositions in dosage unit form to facilitate administration and dosage uniformity. The dosage unit form, as used herein, refers to physically discrete units suitable Petition 870250074928, dated 08 / 25 / 2025, page 163 / 475 159 / 292 of the unit dosage forms for the individual to be treated; each unit containing a predetermined amount of the modified multisegmented antisense oligonucleotide calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The specification for the unit dosage forms of the disclosure is dictated by and directly dependent on the unique characteristics of the active agent and the specific therapeutic effect to be achieved.

[00380] Pharmaceutical compositions may be included in a container, package or dispenser, together with instructions for administration.

[00381] Examples of pharmaceutically acceptable salts include, but are not limited to, salts of mineral or organic acids from basic residues, such as amine salts, alkaline or organic acidic residues, such as carboxylic acids and the like. Pharmaceutically acceptable salts include conventional non-toxic salts or quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.

[00382] Techniques for formulating and administering the disclosed compositions of the invention can be found in Remington: the Science and Practice of Pharmacy, 19th edition, Mack Publishing Co., Easton, PA (1995).

[00383] All percentages and ratios used herein, unless otherwise indicated, are by weight. Other attributes and advantages of the present invention are evident from the different examples. The examples provided illustrate different components and methodology useful in practicing the present invention. The examples do not limit the claimed invention. Based on the present disclosure, those skilled in the art can identify and employ other components and methodology useful in practicing the present invention. The modified multisegmented antisense oligonucleotides of the disclosure can be used. Petition 870250074928, dated 08 / 25 / 2025, page 164 / 475 160 / 292 conjugates that increase the activity, cellular distribution, or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

[00384] Modified multisegmented antisense oligonucleotides can also be modified to have one or more stabilizing groups that are generally attached to one or both ends of antisense oligonucleotides to improve properties such as, for example, nuclease stability. Included in the stabilizing groups are cap structures. These terminal modifications protect the antisense oligonucleotide with terminal nucleic acid from exonuclease degradation and can aid in delivery and / or localization within a cell. The cap may be present at the 5' end (5'-cap), or at the 3' end (3'-cap), or it may be present at both ends. Cap structures are well known in the art and include, for example, inverted deoxybasic caps.Other 3' and 5' stabilizing groups that can be used to cover one or both ends of an antisense oligonucleotide to confer stability to the nuclease include those disclosed in WO 03 / 004602, published on January 16, 2003.

[00385] Modified multisegmented antisense oligonucleotides of revelation can be encapsulated or incorporated into the surface of particles. In certain embodiments, the particle is a nanoparticle. Exemplary nanoparticles include liposomes, micelles, polymer-based nanoparticles, lipid polymer-based nanoparticles, and polymeric micelles.

[00386] In certain embodiments, the nanoparticle comprises a Petition 870250074928, dated 08 / 25 / 2025, pp. 165 / 475 161 / 292 Liposome. Liposomes are spherical vesicles that possess at least one lipid bilayer and, in some embodiments, an aqueous core. In some embodiments, the lipid bilayer of the liposome may comprise phospholipids. An exemplary, but not limiting, example of a phospholipid is phosphatidylcholine, but the lipid bilayer may comprise additional lipids such as phosphatidylethanolamine. Liposomes may be multilamellar, that is, composed of several lamellar phase lipid bilayers, or unilamellar liposomes with a single lipid bilayer. Liposomes may be produced in a specific size range that makes them viable targets for phagocytosis. Liposomes can vary in size from 20 nm to 100 nm, 100 nm to 400 nm, 1 μM and larger, or 200 nm to 3 μM. Examples of lipidoids and lipid-based formulations are provided in US Published Application 20090023673. In other embodiments, one or more lipids are one or more cationic lipids.Someone skilled in the art will recognize which liposomes are appropriate for encapsulating the modified multisegmented antisense oligonucleotides described herein.

[00387] In certain embodiments, the nanoparticle comprises a micelle. A micelle is an aggregate of surfactant molecules. An exemplary micelle comprises an aggregate of amphiphilic macromolecules, polymers or copolymers in aqueous solution, wherein the hydrophilic head portions come into contact with the surrounding solvent, while the hydrophobic tail regions are sequestered in the center of the micelle.

[00388] In certain embodiments, the nanoparticle comprises a polymer-based nanoparticle. Polymer-based nanoparticles comprise one or more polymers, such as polyester, poly(orthoester), poly(ethylene imine), poly(caprolactone), polyanhydride, poly(acrylic acid), polyglycolide, or poly(urethane). In other embodiments, one or Petition 870250074928, dated 08 / 25 / 2025, page 166 / 475 162 / 292 more polymers comprise poly(lactic acid) (PLA) or poly(lactic-co-glycolic acid) (PLGA). In exemplary embodiments, one or more polymers comprise polyalkylene glycol, such as polyethylene glycol (PEG), or polyalkylene oxide, such as polyethylene oxide (PEO).

[00389] In some embodiments, the nanoparticles or some part thereof are degradable. In other embodiments, the lipids and / or polymers of the nanoparticles are degradable. Conjugated antisense oligonucleotides

[00390] Antisense oligonucleotides can be covalently linked to one or more moieties or conjugates that increase the activity, cellular distribution, or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

[00391] Antisense oligonucleotides can also be modified to have one or more stabilizing groups that are generally...

Claims

1. Modified multisegmented antisense oligonucleotide, characterized by being complementary to a nucleotide sequence in a gene transcript, wherein the modified multisegmented antisense oligonucleotide comprises 5' to 3': 5' W1 -G1 -S1 -G2 -W2 3' (Formula I) wherein: W1 is a 5' wing segment; W2 is a 3' wing segment; G1 is a first gap segment; S1 is a first separator segment; and G2 is a second gap segment, wherein each segment is joined by an internucleoside linkage, and wherein at least one nucleoside of each of W1, W2 and S1 is a modified nucleoside.

2. Modified multisegmented antisense oligonucleotide, according to claim 1, characterized by comprising from 5' to 3': 5' W1 -G1 -S1 -G2 -S2 -G3 -W2 3' (Formula II) wherein: S2 is a second separator segment; and G3 is a third gap segment, in which at least one nucleoside of S2 is a modified nucleoside.

3. Modified multisegmented antisense oligonucleotide, according to claim 1 or 2, characterized in that W1 comprises from 2 to 25 linked nucleosides.

4. Modified multisegmented antisense oligonucleotide, according to claim 3, characterized in that the first 5' nucleoside of W1 is a modified nucleoside and / or the last 3' nucleoside of W1 is a modified nucleoside.

5. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 4, characterized in that W2 comprises from 2 to 35 linked nucleosides.

6. Modified multisegmented antisense oligonucleotide, according to claim 5, characterized in that the first 5' nucleoside of W2 is a modified nucleoside and / or the last 3' nucleoside of W2 is a modified nucleoside.

7. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 6, characterized in that G1 comprises 1 to 10 linked deoxynucleosides.

8. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 7, characterized in that G2 comprises 1 to 10 linked deoxynucleosides.

9. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 8, characterized in that S1 comprises 1 to 3 linked nucleosides.

10. Modified multisegmented antisense oligonucleotide, according to any one of claims 2 to 9, characterized in that G3 comprises 1 to 10 linked deoxynucleosides.

11. Modified multisegmented antisense oligonucleotide, according to any one of claims 2 to 10, characterized in that S2 comprises 1 to 3 linked nucleosides.

12. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 11, characterized by having 11 to 50 nucleobases in length.

13. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 11, characterized by having 11 to 30 nucleobases in length.

14. Modified multisegmented antisense oligonucleotide Petition 870250074928, dated 08 / 25 / 2025, page 299 / 475 3 / 18, according to any one of claims 1 to 11, characterized by having at least 20 nucleobases in length.

15. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 11, characterized by having 20 nucleobases in length.

16. Modified multisegmented antisense oligonucleotide, according to claim 15, characterized in that W1 comprises 2 to 8 linked nucleosides.

17. Modified multisegmented antisense oligonucleotide, according to claim 15, characterized in that W1 comprises 2 to 6 linked nucleosides.

18. Modified multisegmented antisense oligonucleotide, according to claim 15, characterized in that W1 comprises 4, 5 or 6 linked nucleosides.

19. Modified multisegmented antisense oligonucleotide, according to claim 15, characterized in that W1 comprises 5 linked nucleosides.

20. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 19, characterized in that G1 comprises 2 to 7 linked deoxynucleosides.

21. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 19, characterized in that G1 comprises 4 linked deoxynucleosides.

22. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 19, characterized in that G1 comprises 5 linked deoxynucleosides.

23. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 19, characterized in that G1 comprises 6 linked deoxynucleosides.

24. Modified multisegmented antisense oligonucleotide Petition 870250074928, dated 08 / 25 / 2025, page 300 / 475 4 / 18, according to any one of claims 15 to 23, characterized in that G2 comprises 1 to 7 linked deoxynucleosides.

25. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 23, characterized in that G2 comprises 2 to 7 linked deoxynucleosides.

26. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 23, characterized in that G2 comprises 1 to 2 linked deoxynucleosides.

27. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 23, characterized in that G2 comprises 4 linked deoxynucleosides.

28. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 23, characterized in that G2 comprises 5 linked deoxynucleosides.

29. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 23, characterized in that G2 comprises 6 linked deoxynucleosides.

30. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 23, characterized in that G2 comprises 7 linked deoxynucleosides.

31. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 30, characterized in that G3 comprises 2 to 7 linked deoxynucleosides.

32. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 30, characterized in that G3 comprises 4 linked deoxynucleosides.

33. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 30, characterized in that G3 comprises 5 linked deoxynucleosides.

34. Modified multisegmented antisense oligonucleotide Petition 870250074928, dated 08 / 25 / 2025, page 301 / 475 5 / 18, according to any one of claims 15 to 30, characterized in that G3 comprises 6 linked deoxynucleosides.

35. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 30, characterized in that G3 comprises 7 linked deoxynucleosides.

36. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 35, characterized in that S1 comprises at least one linked nucleoside.

37. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 35, characterized in that S1 comprises a linked nucleoside.

38. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 35, characterized in that S1 comprises 2 linked nucleosides.

39. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 38, characterized in that S2 comprises at least one linked nucleoside.

40. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 38, characterized in that S2 comprises a linked nucleoside.

41. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 38, characterized in that S2 comprises 2 linked nucleosides.

42. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 41, characterized in that W2 comprises 2 to 8 linked nucleosides.

43. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 41, characterized in that W2 comprises 2 to 6 linked nucleosides.

44. Modified multisegmented antisense oligonucleotide Petition 870250074928, dated 08 / 25 / 2025, page 302 / 475 6 / 18, according to any one of claims 15 to 41, characterized in that W2 comprises 3 linked nucleosides.

45. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 41, characterized in that W2 comprises 4 linked nucleosides.

46. ​​Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 41, characterized in that W2 comprises 5 linked nucleosides.

47. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 41, characterized in that W2 comprises 6 linked nucleosides.

48. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 47, characterized in that S1 is at position 10 of the modified multisegmented antisense oligonucleotide.

49. Modified multisegmented antisense oligonucleotide, according to any one of claims 15 to 47, characterized in that S1 is at position 11 of the modified multisegmented antisense oligonucleotide.

50. Modified multisegmented antisense oligonucleotide, according to claim 48, characterized in that: W1 comprises 4 linked nucleosides, G1 comprises 5 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 5 linked deoxynucleosides, and W2 comprises 5 linked nucleosides.

51. Modified multisegmented antisense oligonucleotide according to claim 48, characterized by: W1 comprising 5 linked nucleosides, G1 comprising 4 linked deoxynucleosides, S1 comprising 1 linked nucleoside, G2 comprising 5 linked deoxynucleosides, and W2 comprising 5 linked nucleosides.

52. Modified multisegmented antisense oligonucleotide, according to claim 1, characterized by: W1 comprising 2 to 8 linked nucleosides, G1 comprising 2 to 7 linked deoxynucleosides, S1 comprising 1 to 2 linked nucleosides, G2 comprising 2 to 7 linked deoxynucleosides, and W2 comprising 2 to 8 linked nucleosides.

53. Modified multisegmented antisense oligonucleotide, according to claim 52, characterized in that: W1 comprises 2 to 6 linked nucleosides, G1 comprises 2 to 7 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 2 to 7 linked deoxynucleosides, and W2 comprises 2 to 6 linked nucleosides.

54. Modified multisegmented antisense oligonucleotide, according to claim 2, characterized in that: W1 comprises 2 to 8 linked nucleosides, G1 comprises 2 to 7 linked deoxynucleosides, S1 comprises 1 linked nucleoside, G2 comprises 1 to 2 linked deoxynucleosides, S2 comprises 1 linked nucleoside, G3 comprises 2 to 7 linked deoxynucleosides, and W2 comprises 2 to 8 linked nucleosides.

55. Modified multisegmented antisense oligonucleotide according to claim 54, characterized by: W1 comprising 2 to 6 linked nucleosides, G1 comprising 2 to 7 linked deoxynucleosides, S1 comprising 1 linked nucleoside, G2 comprising 1 to 2 linked deoxynucleosides, S2 comprising 1 linked nucleoside, G3 comprising 2 to 7 linked deoxynucleosides, and W2 comprising 2 to 6 linked nucleosides.

56. Modified multisegmented antisense oligonucleotide, according to claim 52 or 53, characterized in that the length of the G1-S1-G2 segment is between 8 and 12 nucleobases in length.

57. Modified multisegmented antisense oligonucleotide, according to any one of claims 52 to 54, characterized in that the G1-S1-G2-S2-G3 group has a length between 8 and 12 nucleobases.

58. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 57, characterized in that G1, G2 and / or G3 comprise a nucleoside comprising a modification in a 2'-deoxynucleoside.

59. Modified multisegmented antisense oligonucleotide, according to claim 58, characterized in that G1, G2 and / or G3 comprise a nucleoside comprising a 2'-deoxy 5-methylcytidine sugar modification.

60. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 59, characterized in that S1 and / or S2 comprise a nucleoside comprising a 2'-O-methoxyethyl sugar modification.

61. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 59, characterized in that S1 and / or S2 comprise a nucleoside comprising a 5-methylcytidine.

62. Modified multisegmented antisense oligonucleotide Petition 870250074928, dated 08 / 25 / 2025, page 305 / 475 9 / 18, according to any one of claims 1 to 59, characterized in that S1 and / or S2 comprise a nucleoside comprising a 2'-O-methyl sugar modification.

63. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 59, characterized in that S1 and / or S2 comprise a nucleoside comprising a 2'-O-ethyl sugar modification.

64. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 63, characterized in that S1 and / or S2 comprise a nucleoside comprising a 2'-OH sugar modification.

65. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 64, characterized in that S1 and / or S2 comprise a nucleoside comprising a 2'-fluoro sugar modification.

66. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 65, characterized in that S1 and / or S2 comprise a nucleoside comprising a 2'-fluoro-arabinonucleic acid (2'fluoro-ANA) sugar modification.

67. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 66, characterized in that S1 and / or S2 comprise a glycol nucleic acid (GNA).

68. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 67, characterized in that S1 and / or S2 comprise a blocked nucleic acid (LNA).

69. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 68, characterized in that W1 comprises a nucleoside comprising a 2'-deoxy sugar modification.

70. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 69, characterized in that W1 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification.

71. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 70, characterized in that W1 comprises a nucleoside comprising a 2'-O-methyl sugar modification.

72. Modified multisegmented antisense oligonucleotide, according to claim 71, characterized in that W1 comprises a 2'-O-methyl-5-methylcytidine.

73. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 71, characterized in that W1 comprises a nucleoside comprising a 2'-fluoro sugar modification.

74. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 73, characterized in that W1 comprises a nucleoside comprising a 2'-fluoro-arabinonucleic acid (2'-fluoro-ANA) modification.

75. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 74, characterized in that W1 comprises a glycol nucleic acid (GNA).

76. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 75, characterized in that W1 comprises a blocked nucleic acid (LNA).

77. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 76, characterized in that W1 comprises a nucleoside comprising a 2'-O-ethyl sugar modification. Petition 870250074928, dated 08 / 25 / 2025, pp. 307 / 475 11 / 18 78. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 77, characterized in that W2 comprises a nucleoside comprising a 2'-deoxy sugar modification.

79. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 78, characterized in that W2 comprises a nucleoside comprising a 2'-O-methoxyethyl sugar modification.

80. Modified multisegmented antisense oligonucleotide, according to claim 79, characterized in that W2 comprises a 2'-O-methoxyethyl-5-methylcytidine.

81. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 78, characterized in that W2 comprises a nucleoside comprising a 2'-fluoro sugar modification.

82. Modified multisegmented antisense oligonucleotide, according to claim 81, characterized in that W2 comprises a nucleoside comprising a 2'-fluoro-arabinonucleic acid (2'-fluoro-ANA) modification.

83. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 82, characterized in that W2 comprises a glycol nucleic acid (GNA).

84. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 83, characterized in that W2 comprises a blocked nucleic acid (LNA).

85. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 84, characterized in that W2 comprises a nucleoside comprising a 2'-O-ethyl sugar modification.

86. Modified multisegmented antisense oligonucleotide Petition 870250074928, dated 08 / 25 / 2025, page 308 / 475 12 / 18, according to any one of claims 1 to 85, characterized in that at least one internucleosidic linkage is a phosphodiester bond.

87. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 86, characterized in that at least one internucleosidic bond is a modified internucleosidic bond.

88. Modified multisegmented antisense oligonucleotide, according to claim 87, characterized in that the modified internucleosidic linkage is a phosphorothioate internucleosidic linkage.

89. Modified multisegmented antisense oligonucleotide, according to claim 87, characterized in that the modified internucleosidic linkage comprises a morpholino phosphorodiamidate modification.

90. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 89, characterized by: a. an EC50 ratio of cells treated with a modified multisegmented antisense oligonucleotide / EC50 ratio of cells treated with a modified antisense oligonucleotide with the same template nucleobase sequence that does not comprise a separator segment being from about 0.05 to about 250; b. an MTT CC25 value of cells treated with a modified multisegmented antisense oligonucleotide being from about 10 nM to about 250 nM; c. a CCK8 CC30 value of cells treated with a modified multisegmented antisense oligonucleotide being from about 10 nM to about 250 nM; d. a Fold CC30 / Fold EC50 ratio of treated cells Petition 870250074928, dated 08 / 25 / 2025, page.309 / 475 13 / 18 with a modified multisegmented antisense oligonucleotide compared to a modified antisense oligonucleotide with the same nucleobase template sequence that does not comprise a separator segment, being from about 0.01 to about 50; and e. exhibiting a decrease of at least 1.1 times in the melting temperature, compared to a modified antisense oligonucleotide with the same nucleobase template sequence that does not comprise a separator segment; and / or f. exhibiting an increase of at least 1.1 times in the recruitment of an endonuclease, compared to the modified antisense oligonucleotide with the same nucleobase template sequence that does not comprise a separator segment.

91. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 90, characterized in that it is complementary to a nucleotide sequence in a viral gene transcript, wherein, optionally, the viral gene is selected from the group consisting of an HPV, HBV, EBV, HSV, HIV and RSV gene.

92. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 90, characterized by being complementary to a human gene transcript.

93. Modified multisegmented antisense oligonucleotide, according to claim 92, characterized by being complementary to a human gene transcript selected from the group consisting of DM1 protein kinase (DMPK), alpha-1 antitrypsin (AAT), transthyretin (TTR) proprotein convertase subtilisin / kexin type 9 (PCSK9), apolipoprotein B (ApoB), apolipoprotein C-III (ApoCIII), TNF-alpha, SERPINA8 (AGT), complement factor B (CFB), diacylglycerol O-acyltransferase 2 (DGAT2), patatin-containing phospholipase domain 3 (PNPLA3), 5'-aminolevulinate synthase 1 Petition 870250074928, dated 08 / 25 / 2025, p. 310 / 475 14 / 18 (ALAS1) and a hydroxyacid oxidase 1 gene transcript.

94. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 90, characterized by being complementary to a selected gene transcript from the group consisting of DM1 protein kinase (DMPK), alpha-1 antitrypsin (AAT), transthyretin (TTR) proprotein convertase subtilisin / kexin type 9 (PCSK9), apolipoprotein B (ApoB), apolipoprotein C-III (ApoCIII), TNF-alpha, SERPINA8 (AGT), complement factor B (CFB), diacylglycerol O-acyltransferase 2 (DGAT2), patatin-like phospholipase domain containing 3 (PNPLA3), 5'-aminolevulinate synthase 1 (ALAS1) or hydroxyacid oxidase 1, Mat1α, (pro)renin receptor / (P)RR, COVID-19 5'UTR, Acc1, Acc2, ACE2, androgen receptor, ApoB, ASGR1, ASO, ATXN2, B1AR, B2AR, C9ORF72, Caspase 2, CD19, CD4, Chikungunya virus, CLPro, complement component 5, COVID-19, COX2, CTGF, DGAT2, DMD, DMPK, DNM2, DUX4, E2 gene, EGFR, Envelope, EphA2, epithelial sodium channel α subunit,dystrophin of exon 100, dystrophin of exon 101, dystrophin of exon 102, dystrophin of exon 103, dystrophin of exon 104, dystrophin of exon 105, dystrophin of exon 106, dystrophin of exon 107, dystrophin of exon 108, dystrophin of exon 109, dystrophin of exon 110, dystrophin of exon 111, dystrophin of exon 112, dystrophin of exon 113, dystrophin of exon 114, dystrophin of exon 115, dystrophin of exon 116, dystrophin of exon 117, dystrophin of exon 118, dystrophin of exon 119, dystrophin of exon 120, dystrophin of exon 121, dystrophin of exon 122, exon 123 dystrophin, exon 124 dystrophin, exon 125 dystrophin, exon 126 dystrophin, exon 127 dystrophin, exon 128 dystrophin, exon 129 dystrophin, exon 130 dystrophin, exon 131 dystrophin, exon 132 dystrophin, exon 133 dystrophin, exon 134 dystrophin, exon 135 dystrophin, exon 136 dystrophin, exon 137 dystrophin, exon 138 dystrophin, exon 139 dystrophin, exon 140 dystrophindystrophin Petition 870250074928, dated 08 / 25 / 2025, page. 311 / 475 15 / 18 of exon 141, dystrophin of exon 142, dystrophin of exon 143, dystrophin of exon 144, dystrophin of exon 145, dystrophin of exon 146, dystrophin of exon 147, dystrophin of exon 148, dystrophin of exon 149, dystrophin of exon 150, dystrophin of exon 151, dystrophin of exon 152, dystrophin of exon 44, dystrophin of exon 53, dystrophin of exon 54, dystrophin of exon 55, dystrophin of exon 58, dystrophin of exon 61, dystrophin of exon 64, dystrophin of exon 67, dystrophin of exon 70, dystrophin of exon 73, dystrophin of exon 76, dystrophin of exon 79, dystrophin of exon 82, dystrophin of exon 85, dystrophin of exon 88, dystrophin of exon 91, dystrophin of exon 94, dystrophin of exon 56, dystrophin of exon 59, dystrophin of exon 62, dystrophin of exon 65, dystrophin of exon 68, dystrophin of exon 71, dystrophin of exon 74, dystrophin of exon 77, dystrophin of exon 80, dystrophin of exon 83, dystrophin of exon 86,dystrophin of exon 89, dystrophin of exon 92, dystrophin of exon 95, dystrophin of exon 57, dystrophin of exon 60, dystrophin of exon 63, dystrophin of exon 66, dystrophin of exon 69, dystrophin of exon 72, dystrophin of exon 75, dystrophin of exon 78, dystrophin of exon 81, dystrophin of exon 84, dystrophin of exon 87, dystrophin of exon 90, dystrophin of exon 93, dystrophin of exon 96, dystrophin of exon 97, dystrophin of exon 98, dystrophin of exon 99, Fabp3, Factor VII, Factor XI, FAK, FGFR4, FOXP3, FUS, FXII, GFAP, GFP, glycogen synthase, H1N1, HBV, heat shock protein 47, heat shock protein 48, heat shock protein 49, heat shock protein 50, heat shock protein 51, heat shock protein 52, heat shock protein 53, heat shock protein 54, heat shock protein 55, heat shock protein 56, heat shock protein 57, heat shock protein 58, heat shock protein 59, Helicase, HIV, HOXB13, HPRT, HPV,Hsd11β1, HTT, hydroxyacid oxidase 1, hydroxysteroid 17β-dehydrogenase 13, hypoxia-inducible factor 2α, spindle kinesin protein and growth factor. Petition 870250074928, dated 08 / 25 / 2025, page 1. 312 / 475 16 / 18 to vascular endothelial cell carcinoma, KRAS, leader, leucine-rich repeat kinase 2 (LRRK2), MERS-CoV, MGMT, miR-16, miR-21, MMP-2, MMP-9, MTL-CEBPA, MuRF1, Mycobacterium tuberculosis, COVID-19 N, rabies N123, rabies N749, rabies N903, rabies N1082, rabies N53, rabies N8, Chikungunya virus ns1 gene, Chikungunya virus ns2 gene, Chikungunya virus ns3 gene, Chikungunya virus ns4 gene, ORF1b, ORF1a, HIV P24, rabies P330, P53, rabies P721, rabies P91, PCSK9, PDGF, PDL1, COVID-19 PLP, PNPLA3, polo-like kinase 1, protein kinase N3, RAF1, RAF-1, RDRP, RSV, SMN2, SNCA, Covid-19 spike, STAT3, TAU, TGFB1, TGFB1 and Cox2, TMPRSS2, TMPRSS6, TNFα, transthyretin, VEGF, VEGFR2, VER2, xanthine dehydrogenase and YAP1., 95. Modified multisegmented antisense oligonucleotide, according to any one of claims 1 to 90, characterized in that it is complementary to a selected gene transcript from the group consisting of an oncogenic gene transcript, an inflammatory gene transcript, a metabolic disease gene transcript, a cardiovascular gene transcript, a liver disease gene transcript, an infectious disease gene transcript, a neurological disease gene transcript, a neuromuscular disease gene transcript, an eye disease gene transcript, a kidney disease gene transcript, a respiratory disease gene transcript, a blood disease gene transcript, a wound healing gene transcript, a transplant gene transcript, an autoimmune disease gene transcript, and a neuropsychiatric gene transcript.

96. Modified multisegmented antisense oligonucleotide, characterized by comprising the modified multisegmented antisense oligonucleotide structure of any of the SEQ ID NOS: 11 to 1453 or 5000 to 30983. Petition 870250074928, dated 08 / 25 / 2025, p. 313 / 475 17 / 18 97. Modified multisegmented antisense oligonucleotide, characterized by comprising the structure of the modified multisegmented antisense oligonucleotide of any of the SEQ ID NOS: 11 to 1453 or 5000 to 30983, or an oligonucleotide with at least 70%, at least 80%, at least 90%, at least 95% or at least 99% sequence identity therewith.

98. Modified multisegmented antisense oligonucleotide, characterized by comprising the modified multisegmented antisense oligonucleotide structure of any of the SEQ ID NOS: 11 to 1453 or 5000 to 30983, or an oligonucleotide comprising at least 1, 2, 3, 4 or 5 additional modifications thereof.

99. Pharmaceutical composition, characterized by comprising the modified multisegmented antisense oligonucleotide, as defined in any one of claims 1 to 98, or a salt thereof, and at least one pharmaceutically acceptable vehicle or diluent.

100. A method for treating a disease, disorder, or condition, characterized by comprising administering to an individual the modified multisegmented antisense oligonucleotide, as defined in any one of claims 1 to 98, or the pharmaceutical composition, as defined in claim 99.

101. Method according to claim 100, characterized in that administration to an individual is parenteral.

102. Method according to claim 100, characterized in that administration to an individual is subcutaneous.

103. Method according to claim 100, characterized in that administration to an individual is transdermal.

104. Method, according to claim 100, characterized by administration to an individual being intraocular. Petition 870250074928, dated 08 / 25 / 2025, p. 314 / 475 18 / 18 105. Method according to claim 100, characterized in that the administration to an individual is intramuscular.

106. Method according to claim 100, characterized in that the administration to an individual is intravenous.

107. Method, according to any one of claims 100 to 106, characterized in that the individual is a human.

108. Method, according to any one of claims 100 to 106, characterized in that the individual is a non-human primate.