A peptide consisting of any sequence of amino acids, a polynucleotide that encodes the peptide, and an expression vector.

A novel peptide with specific amino acid sequences effectively regenerates hard tissues and treats dental pulp and periodontal diseases by enhancing differentiation marker gene expression, overcoming the inefficiencies of current treatments.

BR122026014007A2Pending Publication Date: 2026-07-07HYSENSBIO CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
BR · BR
Patent Type
Applications
Current Assignee / Owner
HYSENSBIO CO LTD
Filing Date
2018-12-17
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Current treatments for dental pulp diseases and periodontal diseases, such as pulpitis and periapical diseases, face challenges with materials like MTA causing aesthetic issues and gutta-percha leading to pulp viability loss, while periodontal disease treatments struggle with tooth loss due to alveolar bone and cementum regeneration inefficiencies.

Method used

A novel peptide with specific amino acid sequences, such as KY-R1-R2-R3-R4-R5, promotes the regeneration of hard tissues like dentin, bone, and cementum, and dental pulp by increasing expression levels of differentiation marker genes, and is used in pharmaceutical and functional health food compositions.

Benefits of technology

The peptide effectively regenerates hard tissues and treats dental pulp and periodontal diseases, forming dentin/pulp-like and bone-like tissues, enhancing collagen production and odontoblast differentiation, thus addressing the limitations of existing treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

1 / 63 “A peptide consisting of any one amino acid sequence, a polynucleotide encoding the peptide, and an expression vector” Split order from BR 11 2020 012054 5. BACKGROUND OF THE TECHNIQUE FIELD OF THE TECHNIQUE

[001] The present invention relates to a novel peptide and, more particularly, to a peptide for promoting the regeneration of hard tissue and / or dental pulp tissues and treating dentin-pulp diseases and / or periodontal diseases, to a polynucleotide encoding the peptide, to an expression vector comprising the polynucleotide, and to a pharmaceutical composition for preventing or treating dentin-pulp diseases and / or periodontal diseases comprising the peptide, a quasi-medicinal composition for preventing or alleviating dentin-pulp diseases and / or periodontal diseases comprising the peptide, and to a functional health food composition for preventing or alleviating dentin-pulp diseases and / or periodontal diseases including the peptide. DESCRIPTION OF RELATED TECHNOLOGY

[002] Dental pulp is a soft, richly innervated and vascularized connective tissue that occupies the pulp chamber within a tooth and extends to the outer surface of the dentin. Dysfunctions that occur in the dental pulp are called dental pulp diseases.

[003] There are many causes of dental pulp disease, but in most cases, dental pulp disease is caused by bacterial infection due to tooth decay, or infections in the dental pulp through perforation, fracture, fissures, or periodontal pockets. External wounds, abrasion, fissures in the tooth, or friction or heat from dental equipment can also cause dental pulp disease. Pulpitis caused by bacterial infection can lead to root apex and periodontal disease. Dental pulp disease progresses successively to Petition 870260055118, dated 08 / 06 / 2026, pp. 294 / 367 2 / 63 Pulp hyperemia, pulpitis, and pulp necrosis. Pulp necrosis can lead to periapical diseases or dysfunctions throughout the tooth because the death of the dental pulp prevents blood supply to the dental pulp, thus resulting in the loss of the entire pulp tissue.

[004] For the treatment of pulpal or periapical diseases, pulp closure materials and pulp canal filling materials are used, and calcium hydroxides, MTA (Mineral Trioxide Aggregate), gutta-percha, etc., have been used in general. MTA shows therapeutic effects due to its leak-sealing capacity and biocompatibility. However, the use of MTA is hampered by its relatively high cost as a dental repair material and discoloration, leading to an aesthetic problem. Gutta-percha has a relatively low cost and excellent flow characteristics. However, this is not a physiologically acceptable method that causes a loss of pulp viability. To date, conservative treatments for dentin and pulp diseases have had the problems of weak or brittle teeth or reinfection.

[005] Periodontal tissue (periodontium) is a complex organ composed of epithelial tissue, soft connective tissue, and calcified connective tissue. The structure of the periodontium is composed of the gingiva, periodontal ligament (PDL), cementum, and alveolar bone. Gingival fibroblasts and periodontal ligament fibroblasts are the main cellular components of the gingival soft connective tissue, and they form and maintain an extracellular matrix. Additionally, gingival fibroblasts are primarily involved in the maintenance of gingival connective tissue, while periodontal ligament fibroblasts have the exclusive function of forming the periodontal ligament and are involved in the restoration and regeneration of adjacent alveolar bone and cementum in vivo. When periodontal disease occurs, clinically, gingival bleeding and swelling, periodontal pocket formation, and alveolar bone destruction can result in tooth loss.

[006] Since the ultimate goal of periodontal disease treatment is to restore damaged connective tissue, cementum, and alveolar bone, for this purpose, no Petition 870260055118, dated 08 / 06 / 2026, pp. 295 / 367 3 / 63 not only is the regeneration of the periodontal ligament that supports the alveolar bone necessary, but also the regeneration of the alveolar bone and cementum that may be attached by the periodontal ligament.

[007] Therefore, many studies have been actively conducted to develop therapeutic agents capable of effectively treating dentin-pulp diseases or periodontal diseases. For example, Korean Patent Publication 2012-0089547 discloses a composition for forming hard tissue or regenerating dentin or pulp tissues, including ameloblasts, apical bud cells, or cultures thereof, as an active ingredient, and Korean Patent Publication 2009-0033643 discloses novel dental stem cells derived from dental follicles and a method for culturing them. Furthermore, Korean Patent Publication 2016-0105627 discloses a pharmaceutical composition for the treatment of periodontal disease comprising pre-ameloblast conditioned media.

[008] The present inventors have made many efforts to develop an agent capable of more effectively treating dentin-pulp diseases and / or periodontal diseases, which cause damage to the alveolar bone and cementum. As a result, they have developed a peptide that shows cell-treatment effects to promote the regeneration of hard tissue, including dentin, bone and cementum and / or dental pulp tissue, and to treat dentin-pulp diseases and / or periodontal diseases, thereby completing the present invention. SUMMARY OF THE INVENTION

[009] The embodiments of the present inventive concepts can provide a peptide to promote the regeneration of hard tissue and / or dental pulp tissues and treat dentin-pulp diseases and / or periodontal diseases.

[010] The embodiments of the present inventive concepts can also provide a polynucleotide that codes for the peptide.

[011] The embodiments of the present inventive concepts can also provide an expression vector, which includes the polynucleotide. Petition 870260055118, dated 08 / 06 / 2026, pp. 296 / 367 4 / 63

[012] The embodiments of the present inventive concepts may also provide a pharmaceutical composition to prevent or treat dental dentin-pulp diseases and / or periodontal diseases, which includes the peptide.

[013] The embodiments of the present inventive concepts may also provide a quasi-medicinal composition to prevent or alleviate dentin-pulp diseases and / or periodontal diseases, which includes the peptide.

[014] The embodiments of the present inventive concepts may also provide a functional health food composition to prevent or alleviate dental dentin-pulp diseases and / or periodontal diseases, which includes the peptide.

[015] The embodiments of the present inventive concepts may also provide a method of preventing or treating dental dentin-pulp diseases and / or periodontal diseases, the method including administering the composition that includes the peptide to a subject, excluding humans.

[016] The embodiments of the present inventive concepts may also provide a method of promoting the regeneration of hard tissue, including dentin, bone and cementum, and / or dental pulp tissue, the method including administering the composition that includes the peptide to a subject. The embodiments of the present inventive concepts may also provide the use of a peptide to promote the regeneration of hard tissue and / or pulp tissue.

[017] The embodiments of the present inventive concepts may also provide the use of a peptide in the prevention or treatment of dental dentin-pulp diseases and / or periodontal diseases.

[018] The embodiments of the present inventive concepts may also provide a peptide comprising an amino acid sequence of the following Formula 1: KY-R1-R2-R3-R4-R5 (Formula 1) wherein R1 and R2 are arginine(R), lysine(K), glutamine(Q) or asparagine(N), respectively; R3, R4, and R5 are arginine (R) or lysine (K), respectively.

[019] The embodiments of the present inventive concepts may also provide Petition 870260055118, dated 08 / 06 / 2026, pp. 297 / 367 5 / 63 a peptide in which R1 is glutamine (Q), R2 is arginine (R).

[020] The embodiments of the present inventive concepts may also provide a peptide in which R1 is arginine (R) or lysine (K), R2 is glutamine (Q).

[021] The embodiments of the present inventive concepts can also provide a peptide in which R1 and R2 are glutamine (Q), respectively.

[022] The embodiments of the present inventive concepts may also provide a peptide in which R1 is arginine (R) or lysine (K), and R2 is arginine (R).

[023] The embodiments of the present inventive concepts may also provide a peptide in which R1 is glutamine (Q), arginine (R) or lysine (K), and R2 is lysine (K).

[024] The embodiments of the present inventive concepts may also provide a peptide in which R1 is arginine (R), lysine (K), glutamine (Q) or asparagine (N), R2 is arginine (R), lysine (K), glutamine (Q) or asparagine (N), at least one of R1 or R2 is asparagine (N).

[025] The embodiments of the present inventive concepts may also provide a peptide in which the peptide is subjected to N- or C-terminal acetylation, amidation, or methylation; introduction of D-amino acid; modification of the peptide bond including CH2-NH, CH2-S, CH2-S=O, CH2-CH2; main chain modification; or side chain modification. EFFECT OF THE INVENTION

[026] A peptide of the present invention exhibits excellent effects in promoting the regeneration of hard tissue and / or pulp tissues. Therefore, it can be widely applied in the development of a variety of agents to prevent or treat dentin-pulp diseases or to prevent or treat periodontal diseases that cause damage to bone and / or cementum. BRIEF DESCRIPTION OF THE DRAWINGS

[027] Figure 1A is a graph showing the results of comparing the expression levels of dentin sialophosphoprotein (Dspp), a marker gene for odontoblast differentiation, in human dental pulp cells (hDPCs) treated with the novel peptide of the present invention. Petition 870260055118, dated 08 / 06 / 2026, pp. 298 / 367 6 / 63

[028] Figure 1B is another graph showing the result of comparing the expression levels of Dspp, an odontoblast differentiation marker gene, in human dental pulp cells (hDPCs) treated with the novel peptide of the present invention.

[029] Figure 1C is a graph showing the results of comparing the expression levels of Nestin, odontoblast differentiation marker genes, in human dental pulp cells (hDPCs) treated with the peptide of the present invention.

[030] Figure 2A is a graph showing the results of comparing the expression levels of BSP, a bone and cementum differentiation marker gene, in human bone marrow-derived mesenchymal stem cells (hBMSCs) treated with the novel peptide of the present invention.

[031] Figure 2B is another graph showing the results of comparing the expression levels of BSP, a bone and cementum differentiation marker gene, in human bone marrow-derived mesenchymal stem cells (hBMSCs) treated with the novel peptide of the present invention.

[032] Figure 3 shows the results of measuring the amount of newly formed hard tissue using human dental pulp cells (hDPCs) for 6 weeks in vivo.

[033] Figure 4 shows microscopic images showing the histomorphological analysis of hard tissue formed using human dental pulp cells (hDPCs) for 6 weeks in vivo, wherein A to D show the results of transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 6 weeks in a mouse with a compromised immune system, and wherein E to H show the results of transplantation of the implant prepared by mixing hDPCs and 100 mg of HA / TCP, 10 μg of peptide (group 3) in a 0.5% fibrin gel for 6 weeks in a mouse with a compromised immune system, respectively (scale bar: A, E 500 ^, B, F 200 sqm, C, G 100 sqm, D, H 50 ^i). Petition 870260055118, dated 08 / 06 / 2026, pp. 299 / 367 7 / 63

[034] Figure 5 shows microscopic images showing the level of collagen formation in hard tissue formed using human dental pulp cells (hDPCs) for 6 weeks in vivo, wherein A to D show the results of transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 6 weeks in a mouse with a compromised immune system, and wherein E to H show the results of transplantation of the implant prepared by mixing hDPCs, 100 mg of HA / TCP, and 10 μg of peptide (group 3) in a 0.5% fibrin gel for 6 weeks in a mouse with a compromised immune system, respectively (scale bar: A, E 500 ^, B, F 200 sqm, C, G 100 sqm, D, H 50 ^i).

[035] Figure 6 shows immunostaining images that show the analysis of the expression level of DSP, an odontoblast differentiation marker gene, using the immunostaining method, in hard tissue formed using human dental pulp cells (hDPCs) for 6 weeks in vivo, where A shows the results of transplantation of the implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel in a mouse with a compromised immune system for 6 weeks, where B shows the results of transplantation of the implant prepared by mixing hDPCs, 100 mg of HA / TCP, and 10 μg of peptide (group 3) in a 0.5% fibrin gel in a mouse with a compromised immune system for 6 weeks. A and B are immunostained hard tissue formed using the anti-DSP antibody. C is a negative control of the immunohistochemical analysis treated only with secondary antibodies. The arrows in A and B indicate the expression of DSP in newly formed calcified tissue.The scale bar is 50 μm.

[036] Figure 7 shows the result of measuring the amount of newly formed hard tissue using human dental pulp cells (hDPCs) for 12 weeks in vivo.

[037] Figure 8 shows microscopic images that show the histomorphological analysis of hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo, where A to D show the results of Petition 870260055118, dated 08 / 06 / 2026, pages 300 / 367 8 / 63 transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 12 weeks in a mouse with a compromised immune system, and where E to H show the results of transplantation of the implant prepared by mixing hDPCs and 100 mg of HA / TCP, 10 μg of peptide (group 3) in a 0.5% fibrin gel for 12 weeks in a mouse with a compromised immune system, respectively (scale bar: A, E 500 ^, B, F 200 ^, C, G 100 ^, D, H 50 ^).

[038] Figure 9 shows microscopic images showing the level of collagen formation in hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo, wherein A to D show the results of transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 12 weeks in a mouse with a compromised immune system, and wherein E to H show the results of transplantation of the implant prepared by mixing hDPCs, 100 mg of HA / TCP, and 10 μg of peptide (group 3) in a 0.5% fibrin gel for 12 weeks in a mouse with a compromised immune system, respectively (scale bar: A, E 500 sqm, B, F 200 sqm, C, G 100 sqm, D, H 50 ^i).

[039] Figure 10 shows immunostaining images that show the analysis of the expression level of DSP, an odontoblast differentiation marker gene, using the immunostaining method, in hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo, where A shows the results of transplantation of the implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel in a mouse with a compromised immune system for 12 weeks, where B shows the results of transplantation of the implant prepared by mixing hDPCs, 100 mg of HA / TCP, and 10 μg of peptide (group 3) in a 0.5% fibrin gel in a mouse with a compromised immune system for 12 weeks. A and B are immunostained hard tissue formed using the anti-DSP antibody. C is a negative control of the immunohistochemical analysis treated only with secondary antibodies. The arrows at A and B indicate the expression. Petition 870260055118, dated 08 / 06 / 2026, pages 301 / 367 9 / 63 of DSP in newly formed calcified tissue. The scale bar is 50 μm.

[040] Figure 11 shows scanning electron microscopy (SEM) images showing the analysis of hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo, where A shows the results of transplantation of the implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel in a mouse with a compromised immune system for 12 weeks, where B and C show the results of transplantation of the implant prepared by mixing hDPCs, 100 mg of HA / TCP, and 10 μg of peptide (group 3) in a 0.5% fibrin gel in a mouse with a compromised immune system for 12 weeks.

[041] Figure 12 shows SEM images where the dentinal tubules of damaged dentin are regenerated and closed with physiological dentin. Individually, B, C, and D of Figure 12 are magnified images of A of Figure 12, respectively. E, F, G, and H of Figure 12 are magnified images of E of Figure 12, respectively. (Scale bar A: 1 mm, B: 50 ^, C: 20 ^, D: 10 ^, E: 1 mm, F: 50 ^, G: 20 ^, H: 10 ^).

[042] Figure 13 shows SEM images where dentinal tubules exposed to the damaged dentin surface are closed by physiological remineralization. Individually, B, C, and D of Figure 13 are magnified images of A of Figure 13, respectively. E, F, G, and H of Figure 13 are magnified images of E of Figure 13, respectively. (Scale bar A: 1 mm, B: 50 µm, C: 20 µm, D: 10 µm, E: 1 mm, F: 50 µm, G: 20 µm, H: 10 µm). DETAILED DESCRIPTION OF PREFERRED MODALITIES

[043] The present inventors conducted many studies to develop an agent capable of more effectively treating dentin-pulp diseases and / or periodontal diseases. As a result, they developed a novel peptide comprising or consisting of 7 amino acids.

[044] The innovatively developed peptide was prepared by replacing a portion of an amino acid sequence in a peptide, which may exhibit a Petition 870260055118, dated 08 / 06 / 2026, pp. 302 / 367 10 / 63 Therapeutic effect in diseases of the dentin or dental pulp. It has been confirmed that the innovatively developed peptide can increase the expression levels of Dspp (Dentin Sialophosphoprotein) and Nestin, which are odontoblast differentiation marker genes, thus showing a dentin regeneration-promoting effect, and, furthermore, it is possible to increase the expression level of BSP (Bone Sialoprotein), which is a marker gene for osteoblast and cementoblast differentiation, thus exhibiting a bone and cementum regeneration-promoting effect.

[045] Additionally, an implant that includes the peptide along with human dental pulp cells was prepared, and the prepared implant was transplanted into the subcutaneous tissue of an immunocompromised mouse, and after 6 to 12 weeks, the transplanted tissue was analyzed. As a result, it was discovered that a dentin / pulp-like tissue with the most similar morphology to dentin / pulp tissue in vivo was formed, and a bone-like tissue with the most similar morphology to bone tissue in vivo was formed. A level of collagen production was increased, and the expression level of DSP, which is a specific odontoblast differentiation marker, was increased.

[046] Furthermore, the morphology of the transplanted tissue was examined using a scanning electron microscope. As a result, odontoblast-like cells were observed throughout the hard tissue formed, and it was confirmed that dendritic cell processes also extend towards the hard tissue formed. In addition, a typical feature was confirmed in which osteoblasts and / or cementoblasts with a cuboidal cell attached to the surface of the hard tissue formed.

[047] Therefore, it can be seen that the peptide of the present invention can exhibit effects of promoting the regeneration of hard tissue and / or dental pulp and treat dentin-pulp diseases and / or periodontal diseases. The peptide of the present invention with these effects has never been reported until now, and the present inventors have developed it for the first time. Petition 870260055118, dated 08 / 06 / 2026, pages 303 / 367 11 / 63

[048] In one aspect, the present invention provides a peptide to promote the regeneration of hard tissue and / or dental pulp and to treat dentin-pulp diseases and / or periodontal diseases, the peptide including an amino acid sequence of the following Formula 1: KY-R1-R2-R3-R4-R5 (Formula 1) where R1 and R2 are arginine (R), lysine (K), glutamine (Q) or asparagine (N); R3, R4, and R5 are arginine (R) or lysine (K), respectively.

[049] The term “hard tissue”, as used herein, refers to a relatively hard skeletal tissue that includes bone, hyaline cartilage, and fibrous cartilage. In one aspect, according to the present invention, the hard tissue may include dentin, bone, and cementum.

[050] The term “dentin,” as used here, is also called dentin, and refers to a hard, yellowish-white tissue that constitutes the majority of a tooth. Dentin is not exposed on the tooth surface because it is covered by enamel in the dental crown and cementum in the root. However, dentin exposure can occur at the apical end or on the occlusal surface of the dental crown as the enamel wears away with aging. Dentin is a type of bone-like tissue, but it is distinguished from general bone tissue in that the dentin cell bodies are located in the dental pulp, while its processes extend into the dentinal tubules.

[051] The term cementum in the present invention refers to a thin film of a form in which the bones covering the roots of the tooth (root roots) and other parts of a mammal are slightly deformed. Cementum is composed of 50% inorganic material and 50% moist organic material, is yellow in color, and exhibits lower hardness than dentin or enamel. Cementum includes periodontal ligament fibers that fix the teeth to the alveolar bone, and when bacteria infect the gums, degeneration of the cementum surrounding the teeth occurs, and the periodontal ligament fibers of the deformed cementum connecting the teeth and alveolar bone are damaged. Petition 870260055118, dated 08 / 06 / 2026, pp. 304 / 367 12 / 63 do not adhere to the teeth and the teeth will become unstable. In order to treat such cementum degeneration, a method is used to remove the degenerated cementum and promote the formation of new cementum.

[052] The peptide of the present invention is characterized in that it can increase the expression levels of the Dspp and Nestin genes, which are odontoblast differentiation marker genes, the expression level of the BSP (Bone Sialoprotein) genes, which are osteoblast and cementoblast differentiation marker genes, and, when the peptide is transplanted together with human dental pulp cells, the human dental pulp cells form a dentin / dental pulp-like tissue and a bone-like tissue.

[053] The peptide of the present invention includes peptide variants thereof with a sequence that includes one or more amino acid residues different from those of the amino acid sequence of the peptide of the present invention, provided that they can promote the regeneration of hard tissue such as dentin, bone and cementum and / or dental pulp and exhibit a therapeutic effect in dentin-pulp diseases and / or periodontal diseases.

[054] Amino acid substitutions in proteins and polypeptides, which generally do not alter molecular activity, are known in technology. The most common substitutions are amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly, in both directions. The peptide may include peptides that have better structural stability against heat, pH, etc., or better ability to promote the regeneration of hard tissue such as dentin, bone, and cementum and / or dental pulp due to alteration or modification of the amino acid sequence.

[055] Variations in amino acids are made based on the relative similarity of amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, and congeners. Since all seven amino acids comprising the peptide of the present invention correspond to hydrophilic amino acids, the relative similarity of amino acid side chain substituents is Petition 870260055118, dated 08 / 06 / 2026, pp. 305 / 367 13 / 63 high. In this way, even if the amino acids comprising the peptide of SEQ ID NO: 1 are replaced with various amino acids with hydrophilic properties, the effect of the peptide provided by the present invention can be exhibited, since it is due to its structural similarity.For example, although glutamine, which is an acidic amino acid, at position 3 of the peptide of SEQ ID NO: 1 of the present invention is replaced with an acidic amino acid, asparagine, or a basic amino acid, lysine or arginine, the effects of the peptide of the present invention can be obtained as is; although arginine, which is a basic amino acid, at position 4 of the peptide of SEQ ID NO: 1, is replaced with a basic amino acid, lysine, or an acidic amino acid, glutamine or asparagine, the effects of the peptide of the present invention can be obtained as is; although arginine, which is a basic amino acid, at position 5 of the peptide of SEQ ID NO: 1, is replaced with a basic amino acid, lysine, the effects of the peptide of the present invention can be obtained as is; although lysine, which is a basic amino acid, at position 6 or 7 of the peptide of SEQ ID NO: 1, is replaced with a basic amino acid, arginine, the effects of the peptide of the present invention can be obtained as is.

[056] As such, although the acidic amino acids or basic amino acids comprising the peptide of the present invention are replaced with amino acids having the same properties, or replaced with different acidic amino acids or basic amino acids, respectively, the effects of the peptide of the present invention can be obtained as is. Therefore, it is apparent that a variant of the peptide with a sequence that includes one or more amino acid residues different from those of the amino acid sequence constituting the peptide of the present invention is also included within the scope of the peptide of the present invention.

[057] Additionally, although arbitrary amino acids are added to the N-terminal or C-terminal of the prevention peptide, the effects of the peptide of the present invention can be obtained as is. Therefore, a peptide prepared by adding arbitrary amino acids to the N-terminal or C-terminal of the peptide of the present invention is also included within the scope of the peptide of the present invention. Petition 870260055118, dated 08 / 06 / 2026, pages 306 / 367 14 / 63 For example, a peptide prepared by adding 1 to 300 amino acids to the N-terminal or C-terminal of the peptide of the present invention may be exemplified; as another example, a peptide prepared by adding 1 to 100 amino acids to the N-terminal or C-terminal of the peptide of the present invention may be exemplified; and as yet another example, a peptide prepared by adding 1 to 24 amino acids to the N-terminal or C-terminal of the peptide of the present invention may be exemplified.

[058] The peptide of the present invention can be chemically modified or protected with an organic group at the N-terminus and / or the C-terminus, or it can be modified by adding amino acids to the peptide terminal in order to protect the peptide from protease in vivo and to increase its stability. In particular, since chemically synthesized peptides have charged N-terminus and C-terminus, N-terminal acetylation, N-terminal methylation and / or C-terminal amidation can be performed, or the introduction of D-amino acid, peptide bond modification, such as CH2-NH, CH2-S, CH2-S=O, CH2-CH2, main chain modification, or side chain modification can be included in order to remove the charge, but without limitations. The methods for preparing peptidomimetic compounds are well known in technology, for example, in relation to a description in Quantitative Drug Design, CA Ramsden Gd., Choplin Pergamon Press (1992).

[059] The term “main chain modification”, as used herein, refers to the direct modification of the amino acids that constitute a peptide main chain with analogous amino acids, wherein the main chain (main chain) refers to a main chain or ring-shaped structure of the amino acids that constitute a peptide. Analogous amino acid refers to an amino acid modified by the substitution of hydrogen atoms on the nitrogen or α-carbon of the amino acid main chain.

[060] The term “side chain modification”, as used here, refers to the modification of amino acid side chains by the use of a chemical material, in Petition 870260055118, dated 08 / 06 / 2026, pp. 307 / 367 15 / 63 that amino acid side chains refer to the branched atomic groups from a main chain or ring-shaped structure of the amino acids that constitute a peptide. Examples of peptide side chain modification may include amine group modification, such as reductive alkylation; amidation with methyl acetimidate; alkylation with acetic anhydride; carbamylation of amine groups with cyanate; trinitrobenzylation of amino acids with 2,4,6-trinitrobenzenesulfonic acid (TNBS); alkylation of amine groups with succinic anhydride; and pyridoxylation with pyridoxal-5-phosphate followed by reduction with NaBH4.

[061] Additionally, the peptide of the present invention can be used individually or in combination with various approved carriers as a medicine, such as an organic solvent. In order to improve stability and efficacy, the peptide of the present invention can also be used by including carbohydrates, such as glucose, sucrose, or dextran, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, other stabilizers, etc.

[062] According to one embodiment of the present invention, 128 types of peptides corresponding to Formula 1 of the present invention were synthesized, and the effects of the synthesized peptides on the expression level of the Dspp gene, which is an odontoblast differentiation marker gene, were examined. As a result, it was confirmed that all mRNA levels of the odontoblast differentiation marker gene Dspp in human dental pulp cells that were treated with the 128 types of peptides were 8 times higher, 6 times higher, 3 times higher, or at least 1.5 times higher than the mRNA level of the Dspp gene that was measured in human dental pulp cells (control group) that were treated with none of the peptides of the present invention (Figure 1A, Figure 1B and Tables 18 to 33).

[063] As reported so far, it is known that as the level of DSPP mRNA increases, odontoblast differentiation and dentin regeneration are promoted, and therefore it can be seen that 128 types of peptides that Petition 870260055118, dated 08 / 06 / 2026, pp. 308 / 367 Studies 16 / 63 show that increasing mRNA levels of the Dspp gene may exhibit the effect of promoting odontoblast differentiation and dentin regeneration (Taduru Sreenath et al., THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol. 278, No. 27, Issue of July 4, pp. 24874-24880, 2003; William T. Butler et al., Connective Tissue Research, 44(Suppl. 1): 171-178, 2003).

[064] Additionally, in one embodiment of the present invention, the effects of the synthesized peptides on the expression level of the BSP gene, which is a marker gene for osteoblast / cementoblast differentiation, were examined. As a result, it was confirmed that all mRNA levels of the BSP gene, a marker gene for osteoblast / cementoblast differentiation, in human dental pulp cells that were treated with the 128 types of peptides were 13 times higher, 12 times higher, 9 times higher, or at least 3 times higher than the mRNA level of the BSP gene that was measured in human dental pulp cells (control group) that were treated with none of the peptides of the present invention (Figure 2A, Figure 2B).

[065] It is known that as the level of BSP mRNA increases, osteoblast / cementoblast differentiation and bone and cementum differentiation are promoted, and therefore it can be seen that the 128 types of peptides that show the effect of increasing the level of BSP gene mRNA can exhibit the effect of promoting osteoblast / cementoblast and odontoblast differentiation and dentin regeneration. In another aspect, the present invention provides a polynucleotide that encodes the peptide.

[066] The polynucleotide can be modified by the substitution, deletion, or insertion of one or more bases, or a combination thereof. When the nucleotide sequence is prepared by chemical synthesis, a synthetic method widely known in the technology, for example, a method described in the literature (Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988) can be used, and the nucleotide sequence can be synthesized by triester, phosphite, phosphoramidite and H-phosphate methods, PCR and other autoinitiator methods, synthesis of Petition 870260055118, dated 08 / 06 / 2026, pp. 309 / 367 17 / 63 oligonucleotide on solid support, etc. For example, the polynucleotide encoding the peptide of the present invention may include a nucleotide sequence with SEQ ID NO: 4.

[067] In yet another aspect, the present invention provides an expression vector that includes the polynucleotide, a transformant that includes the expression vector, and a method for preparing the peptide using the transformant.

[068] The term “expression vector,” as used herein, refers to a recombinant vector capable of expressing a target peptide in a host cell, and refers to a genetic construct that includes essential regulatory elements that are operatively linked to express a genetic insert. The expression vector includes regulatory expression sequences, such as an initiation codon, a stop codon, a promoter, an operator, etc. The initiation and stop codons are generally considered to be part of a nucleotide sequence that codes for a polypeptide and are necessary to be functional in an individual to whom a genetic construct has been administered, and must be in sync with the coding sequence. The vector promoter may be constitutive or inducible.

[069] The term “operatively linked,” as used herein, refers to a functional linkage between a nucleic acid expression control sequence and a nucleotide sequence encoding a target protein or RNA in such a way as to allow general functions. For example, a promoter may be operatively linked to a nucleotide sequence encoding a protein or RNA to influence the expression of the coding sequence. Operable linkage to the expression vector may be prepared by the use of a recombinant genetic technique well known in the technology, and site-specific DNA cleavage and ligation may be performed by the use of enzymes generally known in the technology.

[070] Additionally, the expression vector may include signal sequences for peptide discharge in order to promote peptide isolation from a cell culture. Specific initiation signals may also be required for the Petition 870260055118, dated 08 / 06 / 2026, pp. 310 / 367 18 / 63 efficient translation of inserted nucleotide sequences. These signals include the ATG initiation codon and adjacent sequences. In some cases, exogenous translation control signals, including the ATG initiation codon, must be provided. These exogenous translation control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression can be enhanced by the introduction of appropriate transcription or translation enhancers.

[071] Furthermore, the expression vector may additionally include a protein label that may optionally be removed by endopeptidase in order to facilitate peptide detection.

[072] The term “label,” as used herein, refers to a molecule that exhibits a quantifiable activity or characteristic. The label may include fluorescent molecules, including chemical fluorescent molecules such as fluorescein and fluorescent polypeptide molecules such as green fluorescent protein (GFP) or related proteins; and epitope labels such as a Myc label, a Flag label, a His label, a leucine label, an IgG label, a streptavidin label, etc. In particular, if an epitope label is used, a peptide label consisting preferably of 6 or more amino acid residues, and more preferably about 8 to 50 amino acid residues, may be used.

[073] In the present invention, the expression vector may include a nucleotide sequence encoding the above-described peptide to promote the regeneration of hard tissue, including dentin, bone, and cementum and / or dental pulp, and to treat the dentin-pulp diseases and / or periodontal diseases of the present invention. The vector used herein is not expressly limited, provided that it can produce the peptide. Preferably, the vector may be plasmid DNA, phage DNA, etc. More preferably, the vector may be a commercially developed plasmid (pUC18, pBAD, pIDTSAMRT-AMP, etc.), an E. coli-derived plasmid (pYG601BR322, pBR325, pUC118, pUC119, etc.), a Bacillus subtilis-derived plasmid (pUB110, pTP5, etc.), a yeast-derived plasmid (YEp13, YEp24, etc.). Petition 870260055118, dated 08 / 06 / 2026, pp. 311 / 367 19 / 63 YCp5G, etc.), a phage DNA (Charon4A, Charon21A, EMBL3, EMBL4, AgtIG, Agt11, λZAP, etc.), an animal virus vector (retrovirus, adenovirus, vaccinia virus, etc.), an insect virus (baculovirus, etc.), or congeners. For the expression vector, a host cell most suitable for the intended use is preferably selected and used, since the level of expression and protein modification varies depending on the type of host cell.

[074] The transformant of the present invention can be prepared by transforming a host with the expression vector of the present invention, and the transformant can express the polynucleotide in the expression vector, thereby producing the peptide. Several methods can accomplish the transformation. The transformation method is not particularly limited, provided it can produce the peptide. CaCl2 precipitation, a Hanahan method which is a CaCl2 precipitation method improved by using DMSO (dimethyl sulfoxide) as a reducing agent, electroporation, calcium phosphate precipitation, protoplast fusion, agitation using silicon carbide fiber, Agrobacterium-mediated transformation, PEG-mediated transformation, dextran sulfate-mediated transformation, lipofectamine or desiccation / inhibition, etc. can be used.The host used in the preparation of the transformant is not particularly limited, provided that it can produce the peptide of the present invention. The host may comprise bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium, etc.; yeast cells, such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, etc.; fungal cells, such as Pichia pastoris, etc.; insect cells, such as Drosophila cells, Spodoptera Sf9 cells, etc.; animal cells, such as CHO, COS, NSO, 293, Bowes' melanoma cells, etc.; and plant cells.

[075] The transformant can be used in a peptide production method to promote the regeneration of hard tissue, including dentin, bone, and cementum and / or dental pulp, and to treat dentin-pulp diseases and / or periodontal diseases of the present invention. Specifically, the peptide production method for Petition 870260055118, dated 08 / 06 / 2026, pp. 312 / 367 20 / 63 promoting the regeneration of dentin or dental pulp and treating diseases of the dentin or dental pulp of the present invention may include (a) cultivating the transformant to obtain a culture; and (b) recovering the peptide of the present invention from the culture.

[076] The term “culture,” as used herein, refers to a method of allowing a microorganism to grow under artificially controlled environmental conditions. In the present invention, the method of cultivating the transformant can be carried out by a method widely known in the art.Specifically, the cultivation is not particularly limited, provided that it can express and produce the peptide to promote the regeneration of hard tissue, including dentin, bone, and cementum and / or dental pulp, and treat the dentin or dentin-pulp diseases and / or periodontal diseases of the present invention, and the cultivation can be carried out by a batch process, a fed-batch process, or a repeated fed-batch process.

[077] A growing medium includes appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc., and must adequately meet the requirements of a specific strain while adjusting temperature, pH, etc., under aerobic conditions. Applicable carbon sources may include, in addition to the mixed sugars of glucose and xylose as a primary carbon source, sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower seed oil, castor oil, coconut oil, etc.; fatty acids such as palmitic acid, stearic acid, or linoleic acid; alcohols such as glycerol or ethanol; and organic acids such as acetic acid. These substances may be used individually or in combination.Applicable nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, or ammonium nitrate; amino acids such as glutamic acid, methionine, or glutamine; and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn starch, casein hydrolysate, fish meal, or... Petition 870260055118, dated 08 / 06 / 2026, pp. 313 / 367 21 / 63 digested products thereof, defatted soybean meal or digested products thereof, etc. These nitrogen sources may be used individually or in combination. The media may include, as phosphorus sources, monobasic potassium phosphate, dibasic potassium phosphate, and corresponding salts containing sodium. Applicable phosphorus sources may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, or corresponding salts containing sodium. Also, inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate. In addition to the materials listed, essential growth materials such as amino acids and vitamins may be used.

[078] Additionally, appropriate precursors may be used in the culture medium. During cultivation, the above-described materials may be appropriately added to the culture in a batch, fed-batch, or continuous manner, but are not limited to the same. The pH of the culture may be adjusted by the appropriate use of a basic compound, such as sodium hydroxide, potassium hydroxide, or ammonia, or an acidic compound, such as phosphoric acid or sulfuric acid.

[079] Furthermore, bubble formation can be inhibited by the use of an antifoaming agent, such as fatty acid polyglycol ester. In order to maintain an aerobic state, oxygen or oxygen-containing gas (e.g., air) can be injected into the culture. The culture temperature is generally 27 °C to 37 °C, preferably 30 °C to 35 °C. The culture is continued until the desired level of peptide production is obtained. This is achieved in 10 to 100 hours.

[080] Furthermore, the recovery of the peptide from the culture can be carried out by a method known in the technology. Specifically, the recovery method is particularly limited, since it can recover the produced peptide. Preferably, a method such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobic, and size exclusion), etc. can Petition 870260055118, dated 08 / 06 / 2026, pp. 314 / 367 22 / 63 to be used.

[081] In yet another aspect, the present invention provides a pharmaceutical composition for preventing or treating dental dentin-pulp diseases and / or periodontal diseases comprising the peptide.

[082] In the manner described above, when the peptide to promote the regeneration of hard tissue, including dentin, bone and cementum and / or dental pulp, and to treat dentin-pulp diseases and / or periodontal diseases of the present invention is transplanted into the body together with human dental pulp cells, the formation of dentin / pulp-like tissue by human dental pulp cells can be promoted and, when the peptide is applied to the site of damaged dentin or dental pulp, the same physiological dentin observed in the dentin of a natural human tooth can be formed. Therefore, the peptide can be used as an active ingredient in the pharmaceutical composition for the treatment of dentin-pulp diseases, which are caused by damage to the dentin or dental pulp.

[083] The peptide included in the pharmaceutical composition may be used in a single peptide form or in a polypeptide form of 2 or more peptide repeats, and the peptide may also be used in a complex form of a drug with a therapeutic effect on diseases of the dentin or dental pulp linked to the N-terminal or C-terminal of the peptide.

[084] The term “dental dentin-pulp diseases”, as used herein, refers to all diseases caused by damaged dental pulp tissue and dentin attached to the dental pulp due to damage to the dentin and dental pulp tissues.

[085] In the present invention, the diseases of the dental dentin-pulp are not particularly limited, provided that the peptide of the present invention exhibits therapeutic effects on the diseases, and the diseases of the dental dentin or pulp may include, for example, dentin hypersensitivity, pulp hyperemia, pulpitis, pulp degeneration, pulp necrosis, gangrenous pulp, etc.

[086] In yet another aspect, the present invention provides a pharmaceutical composition for preventing or treating periodontal diseases comprising Petition 870260055118, dated 08 / 06 / 2026, pages 315 / 367 23 / 63 peptide. As described, when the peptide to promote the regeneration of hard tissue, including dentin, bone and cementum and / or dental pulp, and treat dentin-pulp diseases and / or periodontal diseases of the present invention is transplanted into the body along with human dental pulp cells, the formation of bone-like tissue by human dental pulp cells can be promoted. Therefore, the peptide can be used as an active ingredient in the pharmaceutical composition for the treatment of periodontal diseases, which are caused by damage to bone and / or cementum.

[087] The peptide included in the pharmaceutical composition may be used in a single peptide form or in a polypeptide form of 2 or more peptide repeats, and the peptide may also be used in a complex form of a drug with a therapeutic effect on diseases of the dentin or dental pulp linked to the N-terminal or C-terminal of the peptide.

[088] The term periodontal disease, as used here, also referred to as chronic periodontitis, refers to a disease that infects the periodontal ligament and adjacent tissues through bacterial infection in the space between the gums and teeth. Depending on the severity of the disease, it is divided into gingivitis or periodontitis. During the onset of periodontal disease, inflammation progresses, and more tissues are damaged to form a periodontal pocket. It is known that when periodontitis worsens and the periodontal pocket deepens, the periodontal pocket causes inflammation of the periodontal ligament and ultimately leads to bone loss.

[089] In the present invention, periodontal diseases are not particularly limited, provided that the peptide of the present invention exhibits therapeutic effects in the diseases, and the diseases of the dentin or dental pulp may include, for example, gingivitis, periodontitis, periodontal pocket or periodontal abscess, etc.

[090] The term “prevention”, as used herein, means all actions by which the occurrence of dentin-pulp diseases is restricted or delayed by the administration of the pharmaceutical composition to prevent or treat the diseases of Petition 870260055118, dated 08 / 06 / 2026, pp. 316 / 367 24 / 63 dentin-dental pulp containing the peptide of the present invention.

[091] The term “treatment”, as used herein, means all actions by which dentin-pulp diseases are treated by promoting the regeneration of dentin or pulp by administering the pharmaceutical composition comprising the peptide of the present invention as an active ingredient to a subject in need of treatment of dentin-pulp diseases or all actions that are performed by administering a pharmaceutical composition comprising the peptide of the present invention as an active ingredient to an individual in need of treatment of periodontal disease by promoting the regeneration of bone and / or cementum.

[092] The pharmaceutical composition of the present invention can be prepared in the form of a pharmaceutical composition for the treatment of dentin-pulp diseases and / or periodontal diseases, which additionally includes, besides the peptide, a suitable carrier (natural or non-natural carrier), excipient, or diluent commonly used in the preparation of pharmaceutical compositions. Notably, the pharmaceutical composition can be formulated according to a standard method in the form of a sterile injectable solution that can be administered at the site induced by dentin or dentin-pulp diseases and / or periodontal diseases.In the present invention, the carrier, excipient, and diluent that may be included in the pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oils, collagen, etc. Depending on the formulation, commonly used diluents or excipients, such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc., may be used. In particular, a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized preparation, a suppository, an ointment (e.g., pulp coating, etc.) may be included. For example... Petition 870260055118, dated 08 / 06 / 2026, pp. 317 / 367 25 / 63 Non-aqueous solvents or suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. can be used. As a base for suppositories, witepsol, Macrogol, Tween 61, cocoa butter, lauryl fat, glycerogelatin, etc. can be used.

[093] The peptide content in the pharmaceutical composition of the present invention is not particularly limited, but the peptide may be included in an amount of 0.0001% by weight to 50% by weight, more preferably 0.01% by weight to 20% by weight, based on the total weight of the final composition.

[094] The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount. The term “pharmaceutically effective amount,” as used herein, refers to an amount sufficient to treat or prevent disease, at a reasonable benefit / risk ratio applicable in any medical treatment or prevention. An effective dosage level can be determined depending on factors including disease severity, drug activity, a patient’s age, body weight, health conditions, sex, drug sensitivity, timing of administration, route of administration and excretion rate of the composition of the present invention, duration of treatment, drugs mixed or co-administered with the composition of the present invention, and other factors known in the medical field.The pharmaceutical composition of the present invention can be administered individually or in combination with a known pharmaceutical composition for the treatment of dental dentin-pulp diseases and / or periodontal diseases. It is essential to administer the composition in a minimum quantity that can exhibit a maximum effect without causing side effects, by virtue of all the factors described above.

[095] An administration dose of the pharmaceutical composition of the present invention may be determined by those skilled in the art, by virtue of the purpose of use, the severity of the disease, the age of a patient, body weight, sex and medical history, the type of material used as an active ingredient, etc. Petition 870260055118, dated 08 / 06 / 2026, pp. 318 / 367 26 / 63 For example, the pharmaceutical composition of the present invention can be administered at a dose of about 0.1 ng / kg to about 100 mg / kg. Preferably, about 1 ng / kg to about 10 mg / kg per adult, and the frequency of administration of the composition of the present invention is not particularly limited. Meanwhile, the composition can be administered once daily or several times daily in divided doses. The delivery dose does not limit the scope of the present invention in any respect.

[096] In yet another aspect, the present invention provides a method of treating dental dentin-pulp diseases, the method including administering the pharmaceutically effective amount of the pharmaceutical composition to a human or a subject with dental dentin-pulp diseases, excluding humans.

[097] The term “subject”, as used herein, may include mammals, including humans, rats, livestock, etc., requiring treatment for dental dentin-pulp diseases and / or periodontal diseases, without limitation, but humans may be excluded from subjects with the diseases described.

[098] The pharmaceutical composition for the treatment of dental dentin-pulp diseases and / or periodontal diseases of the present invention can be administered by any general route, provided that the pharmaceutical composition can reach a target tissue. The pharmaceutical composition can be administered, but is not particularly limited to, intraoral administration, intraoral injection, etc., depending on the purpose.

[099] In yet another aspect, the present invention provides a quasi-medicinal composition for preventing or alleviating dental dentin-pulp diseases that includes the peptide.

[0100] The term “alleviate”, as used here, means all actions that at least reduce a parameter related to the conditions that will be treated, for example, the degree of the symptom.

[0101] In the present invention, relief should be interpreted as all actions by which the symptoms of dental dentin-pulp diseases have improved. Petition 870260055118, dated 08 / 06 / 2026, pp. 319 / 367 27 / 63 or were favorably modified by promoting the regeneration of the dental dentin pulp or the symptoms of periodontal diseases improved or were favorably modified by promoting the regeneration of bone and / or cementum by administering the pharmaceutical composition that includes the peptide of the present invention as an active ingredient in a subject in need of treatment for diseases of the dentin or dental pulp.

[0102] The term “quasi-medicine,” as used herein, refers to an article with a milder action than medicines, among articles that are used for the diagnosis, treatment, improvement, relief, management, or prevention of human or animal diseases. For example, according to the Pharmaceutical Affairs Law, quasi-medicines are those, excluding articles used as medicines, including articles made from fiber or rubber that are used to treat or prevent human or animal diseases, articles, other than a tool or machine, or an analogue thereof, that have a mild action or have no direct influence on the human body, and articles that are used for disinfection or pest control for the prevention of infectious diseases.

[0103] In the present invention, one type of formulation of the quasi-medicinal composition that includes the peptide is not particularly limited, but the quasi-medicinal composition may be, for example, oral antiseptic mouthwashes, oral hygiene products, toothpastes, dental floss, oral ointments, etc.

[0104] In yet another aspect, the present invention provides a functional health food composition to prevent or alleviate dental dentin-pulp diseases and / or periodontal diseases that includes the peptide.

[0105] The term “food”, as used herein, includes meats, sausages, breads, chocolates, sweets, snacks, confectionery, pizzas, ramen noodles, other noodles, chewing gum, dairy products, including ice cream, various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, functional health foods, health foods, etc., and food includes all foods in the ordinary acceptance of the term. Petition 870260055118, dated 08 / 06 / 2026, pp. 320 / 367 28 / 63

[0106] The term “functional food,” as used herein, is the same term as food for special health use (FoSHU), and refers to a food with high medical and medicinal effects, which is processed to efficiently exhibit biological modulation function as well as to supply nutrients. Here, the term “functional” indicates a beneficial effect on human health, such as the regulation of nutrients for the structure and function of the human body, physiological action, etc. The food of the present invention can be prepared according to a method commonly employed in the technology, and raw materials and ingredients commonly used in the technology can be added during the preparation of the food. Furthermore, a food formulation is not limited, provided that the formulation is accepted as a food. The food composition of the present invention can be prepared as a variety of formulations.Since food is used as a raw material, unlike general medications, the food composition lacks the side effects that can occur when a medication is taken for a long period, and it can have excellent portability. Therefore, the food of the present invention can be taken as a supplement to enhance the effects of prevention or alleviate dental dentin-pulp diseases and / or periodontal diseases.

[0107] Health food means that the food is actively having effects of maintaining or promoting health conditions, compared to general foods, and health supplement food means a food to supplement health. If necessary, functional health food, health food and health supplement food can be used interchangeably.

[0108] Specifically, a functional health food is a food prepared by adding the peptide of the present invention to food materials, such as beverages, teas, spices, gums, confectionery, etc., or prepared as a capsule, a powder, a suspension, etc. A functional health food means that it has a specific effect on health when consumed, but unlike general medicines, a functional health food has the advantage of not having Petition 870260055118, dated 08 / 06 / 2026, pp. 321 / 367 29 / 63 side effects that can occur when a medication is taken for a long time, due to it using food as a raw material.

[0109] Since the food composition of the present invention is routinely ingested, it is expected that the food composition will show high efficacy in preventing or improving dental dentin-pulp diseases and / or periodontal diseases. Thus, it can be very usefully applied.

[0110] The food composition may additionally include a physiologically acceptable carrier. The type of carrier is not particularly limited. Any carrier may be used, provided that it is commonly used in the technology.

[0111] Additionally, the food composition may include additional ingredients that are commonly used in food compositions to enhance aroma, flavor, appearance, etc. For example, the food composition may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. Additionally, the food composition may also include minerals such as Zn, Fe, Ca, Cr, Mg, Mn, Cu, etc. Additionally, the food composition may also include amino acids such as lysine, tryptophan, cysteine, valine, etc. Additionally, the food composition may also include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), disinfectants (bleaching powder, superior bleaching powder, sodium hypochlorite, etc.), antioxidants (butyl hydroxyanisole (BHA), butylated hydroxytoluene (BHT), etc.), coloring agents (tar color, etc.).), color-developing agents (sodium nitrite, etc.), bleaching agents (sodium sulfite), flavorings (monosodium glutamate (MSG), etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), swelling agents (alum, potassium D-bitartrate, etc.), fortifiers, emulsifiers, thickeners (adhesive pastes), film-forming agents, gum-based agents, antifoaming agents, solvents, correctors, etc. Additives can be selected and used in an appropriate quantity according to the types of food. Petition 870260055118, dated 08 / 06 / 2026, pp. 322 / 367 30 / 63

[0112] The peptide of the present invention can be added as is, or it can be used in conjunction with other foods or food ingredients according to a standard method, or it can be used appropriately according to a standard method. The mixing amounts of the active ingredient can be suitably determined depending on the purpose of use (prophylactic, health or therapeutic treatment). In general, when producing a food or beverage, the food composition of the present invention can be added in an amount of 50 parts by weight or less, specifically 20 parts by weight or less, based on the total weight of the food or beverage. However, when prolonged intake is intended for health and hygiene, the food composition can be included in an amount below the stated range. Furthermore, since there is no safety concern, the active ingredient can be used in an amount above the high range.

[0113] The food composition of the present invention can be used, for example, as a health drink composition. In this case, the health drink composition may additionally include various flavors or natural carbohydrates, as in common beverages. Natural carbohydrates may include monosaccharides, such as glucose and fructose; disaccharides, such as maltose and sucrose; polysaccharides, such as dextrin and cyclodextrin; and sugar alcohols, such as xylitol, sorbitol, and erythritol. Sweeteners may be natural sweeteners, such as thaumatin or a stevia extract; or synthetic sweeteners, such as saccharin or aspartame. The natural carbohydrate may, in general, be used in an amount of about 0.01 g to 0.04 g, and specifically about 0.02 g to 0.03 g, based on 100 mL of the health drink composition of the present invention.

[0114] Furthermore, the composition of a health drink may include various nutrients, vitamins, minerals, flavorings, colorings, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH modifiers, stabilizers, antiseptics, glycerin, alcohols, carbonating agents, etc. Moreover, the composition of a health drink may Petition 870260055118, dated 08 / 06 / 2026, pp. 323 / 367 31 / 63 include fruit pulp used to prepare natural fruit juices, fruit juice drinks, or vegetable drinks. These ingredients may be used individually or in combination. A proportion of the additives is not critical, but is generally selected from 0.01 part by weight to 0.1 part by weight per 100 parts by weight of the health drink composition of the present invention.

[0115] The food composition of the present invention may include the peptide of the present invention in a variety of weight percentages, provided that it can exhibit the effect of preventing or alleviating dental dentin-pulp diseases and / or periodontal diseases. Specifically, the peptide of the present invention may be included in an amount from 0.00001% by weight to 100% by weight or 0.01% by weight to 80% by weight, based on the total weight of the food composition, but is not limited to the same.

[0116] In yet another aspect, the present invention provides a method of preventing or treating dental dentin-pulp diseases and / or periodontal diseases, the method including administering the composition containing the peptide to a subject.

[0117] In yet another aspect, the present invention provides a method of promoting the regeneration of dentin or dental pulp tissues and / or hard tissue including dentin, bone, and cementum, the method including administering the composition including the peptide to a subject.

[0118] In yet another aspect, the present invention provides the use of a peptide comprising an amino acid sequence of the following Formula 1 or a composition comprising the peptide in promoting the regeneration of hard tissue including dentin, bone and cementum and / or dental pulp and in the treatment of dentin-pulp diseases or periodontal diseases: KY-R1-R2-R3-R4-R5 (Formula 1) where R1 and R2 are arginine (R), lysine (K), glutamine (Q) or asparagine (N), respectively; R3, R4, and R5 are arginine (R) or lysine (K), respectively. Petition 870260055118, dated 08 / 06 / 2026, pp. 324 / 367 32 / 63

[0119] In yet another aspect, the present invention provides the use of a peptide that includes any amino acid sequence of SEQ ID NOS: 1 to 128 or a composition that includes the peptide in promoting the regeneration of hard tissue including dentin, bone and cementum and / or dental pulp and in the treatment of dentin-pulp diseases and / or periodontal diseases.

[0120] The present invention will now be described in more detail in relation to the Examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not intended to be limited by these Examples. EXAMPLE 1: METHODS AND MATERIALS Synthesis of peptides to promote the generation of hard tissue including dentin, bone, and cementum and / or dental pulp, and in the treatment of dentin-pulp and / or periodontal diseases.

[0121] The present inventors synthesized a peptide (SEQ ID NO: 1) that shows the effect of promoting the regeneration of hard tissue including dentin, bone and cementum and / or dental pulp tissue by a 9fluorenylmethyloxycarbonyl (Fmoc) method, and their synthesized peptides from Representative groups (Tables 1 to 16) by replacing the amino acids of the synthesized peptide. N-KYQRRKK-C (SEQ ID NO: 1)

[0122] First, the Group 1 peptides were synthesized using the peptide with SEQ ID NO: 1 or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 1). [Table 1] Group 1 Peptides SEQ ID NO: Amino acid sequence(NC) 1 KYQRRKK 2 KYQRRKR 3 KYQRRRK Petition 870260055118, dated 08 / 06 / 2026, pages 325 / 367 33 / 63 4 KYQRRRR 5 KYQRKKK 6 KYQRKRK 7 KYQRKKR 8 KYQRKRR

[0123] Next, the Group 2 peptides were synthesized by replacing an amino acid at position 3 of the SEQ ID NO: 1 peptide with arginine, by replacing an amino acid at position 4 of the SEQ ID NO: 1 peptide with glutamine, or by replacing any amino acid at positions 5 to 7 of the SEQ ID NO: 1 peptide with lysine or arginine (Table 2). [Table 2] Group 2 Peptides SEQ ID NO: Amino acid sequence(NC) 9 KYRQRKK 10 KYRQRKR 11 KYRQRRK 12 KYRQRRR 13 KYRQKKK 14 KYRQKRK 15 KYRQKKR 16 KYRQKRR

[0124] Next, the peptides of Group 3 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with lysine, by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with glutamine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 3). [Table 3] _______________Group 3 Peptides_______________ SEq ID NO: Amino acid sequence (NC) Petition 870260055118, dated 08 / 06 / 2026, pp. 326 / 367 34 / 63 17 KYKQRKK 18 KYKQRKR 19 KYKQRRK 20 KYKQRRR 21 KYKQKKK 22 KYKQKRK 23 KYKQKKR 24 KYKQKRR

[0125] Next, the Group 4 peptides were synthesized by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with glutamine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 4). [Table 4] Group 4 Peptides SEQ ID NO: Amino acid sequence(NC) 25 KYQQRKK 26 KYQQRKR 27 KYQQRRK 28 KYQQRRR 29 KYQQKKK 30 KYQQKRK 31 KYQQKKR 32 KYQQKRR

[0126] Next, the peptides of Group 5 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with arginine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 5). [Table 5] Group 5 Peptides Petition 870260055118, dated 08 / 06 / 2026, pp. 327 / 367 35 / 63 SEQ ID NO: Amino acid sequence (NC) 33 KYRRRKK 34 KYRRRKR 35 KYRRRRK 36 KYRRRRR 37 KYRRKKK 38 KYRRKRK 39 KYRRKKR 40 KYRRKRR

[0127] Next, the peptides of Group 6 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with lysine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 6). [Table 6] Group 6 Peptides SEQ ID NO: Amino acid sequence(NC) 41 KYKRRKK 42 KYKRRKR 43 KYKRRRK 44 KYKRRRR 45 KYKRKKK 46 KYKRKRK 47 KYKRKKR 48 KYKRKRR

[0128] Next, the peptides of Group 7 were synthesized by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with lysine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 7). Petition 870260055118, dated 08 / 06 / 2026, pp. 328 / 367 36 / 63 [Table 7] Group 7 Peptides SEQ ID NO: Amino acid sequence (NC) 49 KYQKRKK 50 KYQKRKR 51 KYQKRRK 52 KYQKRRR 53 KYQKKKK 54 KYQKKRK 55 KYQKKKR 56 KYQKKRR

[0129] Next, the peptides of Group 8 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with asparagine, by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with lysine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 8). [Table 8] Group 8 Peptides SEQ ID NO: Amino acid sequence (NC) 57 KYNKRKK 58 KYNKRKR 59 KYNKRRK 60 KYNKRRR 61 KYNKKKK 62 KYNKKRK 63 KYNKKKR 64 KYNKKRR

[0130] Next, the peptides of Group 9 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with asparagine, by Petition 870260055118, dated 08 / 06 / 2026, pp. 329 / 367 37 / 63 replacement of any amino acid in positions 5 to 7 of the peptide of SEQ ID NO: with lysine or arginine (Table 9). [Table 9] Group 9 Peptides SEQ ID NO: Amino acid sequence(NC) 65 KYNRRKK 66 KYNRRKR 67 KYNRRRK 68 KYNRRRR 69 KYNRKKK 70 KYNRKRK 71 KYNRKKR 72 KYNRKRR

[0131] Next, the peptides of Group 10 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with arginine, by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with asparagine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 10). [Table 10] Group 10 Peptides SEQ ID NO: Amino acid sequence(NC) 73 KYRNRKK 74 KYRNRKR 75 KYRNRRK 76 KYRNRRR 77 KYRNKKK 78 KYRNKRK 79 KYRNKKR 80 KYRNKRR Petition 870260055118, dated 08 / 06 / 2026, pp. 330 / 367 38 / 63

[0132] Next, the peptides of Group 11 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with lysine, by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with asparagine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 11). [Table 11] Group 11 Peptides SEQ ID NO: Amino acid sequence (NC) 81 KYKNRKK 82 KYKNRKR 83 KYKNRRK 84 KYKNRRR 85 KYKNKKK 86 KYKNKRK 87 KYKNKKR 88 KYKNKRR

[0133] Next, the peptides of Group 12 were synthesized by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with asparagine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: with lysine or arginine (Table 12). [Table 12] Group 12 Peptides SEQ ID NO: Amino acid sequence(NC) 89 KYQNRKK 90 KYQNRKR 91 KYQNRRK 92 KYQNRRR 93 KYQNKKK 94 KYQNKRK Petition 870260055118, dated 08 / 06 / 2026, pp. 331 / 367 39 / 63 95 KYQNKKR 96 KYQNKRR

[0134] Next, the peptides of Group 13 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with asparagine, by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with glutamine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 13). [Table 13] Group 13 Peptides SEQ ID NO: Amino acid sequence(NC) 97 KYNQRKK 98 KYNQRKR 99 KYNQRRK 100 KYNQRRR 101 KYNQKKK 102 KYNQKRK 103 KYNQKKR 104 KYNQKRR

[0135] Next, the Group 2 peptides were synthesized by replacing an amino acid at positions 3 and 4 of the SEQ ID NO: 1 peptide with asparagine, or by replacing any amino acid at positions 5 to 7 of the SEQ ID NO: 1 peptide with lysine or arginine (Table 14). [Table 14] Group 14 Peptides SEQ ID NO: Amino acid sequence (NC) 105 KYNNRKK 106 KYNNRKR 107 KYNNRRK 108 KYNNRRR Petition 870260055118, dated 08 / 06 / 2026, pp. 332 / 367 40 / 63 109 KYNNKKK 110 KYNNKRK 111 KYNNKKR 112 KYNNKRR

[0136] Next, the peptides of Group 15 were synthesized by replacing an amino acid at position 3 of the peptide with SEQ ID NO: 1 with arginine, by replacing an amino acid at position 4 of the peptide with SEQ ID NO: 1 with lysine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 15). [Table 15] Group 15 Peptides SEQ ID NO: Amino acid sequence (NC) 113 KYRKRKK 114 KYRKRKR 115 KYRKRRK 116 KYRKRRR 117 KYRKKKK 118 KYRKKRK 119 KYRKKKR 120 KYRKKRR

[0137] Finally, the peptides of Group 16 were synthesized by replacing an amino acid at positions 3 and 4 of the peptide with SEQ ID NO: 1 with lysine, or by replacing any amino acid at positions 5 to 7 of the peptide with SEQ ID NO: 1 with lysine or arginine (Table 16). [Table 16] Group 16 Peptides SEQ ID NO: Amino acid sequence (NC) 121 KYKKRKK 122 KYKKRKR Petition 870260055118, dated 08 / 06 / 2026, pp. 333 / 367 41 / 63 123 KYKKKRK 124 KYKKRRR 125 KYKKKKK 126 KYKKKRK 127 KYKKKKR 128 KYKKKRR EXAMPLE 1-2. CELL CULTURE

[0138] The cells were cultured in humidified air containing approximately 37% CO2 at 37°C. Furthermore, the same were used in the experiment. Human bone marrow mesenchymal stem cells (hBMSCs) were purchased and used from Lonza (LONZA, Switzerland). The hBMSCs were cultured in an alpha-MEM^-MEM culture medium (Invitrogen) containing 10% heat-inactivated bovine serum. EXAMPLE 1-3. SEPARATION AND CULTURE OF HUMAN-DERIVED DENTAL PULP CELLS

[0139] Human dental pulp cells were separated from the wisdom teeth of 10 adults (ages 18-22) at the School of Dentistry, Seoul National University. In detail, all experiments were performed after approval from the Institutional Review Board and informed consent from the patients. The wisdom teeth were fractured according to a method by Jung HS et al. (J Mol Histol.(2011)) to expose the dental pulps, and the dental pulp tissues were separated with forceps. Each of the separated dental pulp tissues was cut into small pieces with a razor blade, placed on a 60 mm plate, covered with a coverslip, and then cultured in a modified Dulbecco Eagle medium. It has been known that human dental pulp cells can differentiate into odontoblasts, osteoblasts, cementoblasts, and periodontal ligament cells under various conditions (Tissue Eng Part A. 2014 Apr; 20 (7-8): 1342-51). EXAMPLE 1-4. ANALYSIS OF REVERSE POLYMERASE TRANSCRIPTION CHAIN ​​REACTION (RT-PCR) AND REAL-TIME PCR. Petition 870260055118, dated 08 / 06 / 2026, pp. 334 / 367 42 / 63

[0140] Total RNA was extracted from human dental pulp cells (hDPCs) and human bone marrow mesenchymal stem cells (hBMSCs) using the TRIzol reagent. 2 μg of total RNA, 1 μL of reverse transcriptase, and 0.5 μg of oligo (oligo; dT) were used to synthesize cDNA. The synthesized cDNA was used in a real-time polymerase chain reaction. The real-time polymerase chain reaction was performed on an ABI PRISM 7500 sequence detection system (Applied Biosystems) and a SYBR GREEN PCR Master Mix (Takara, Japan). The real-time polymerase chain reaction was performed under conditions of 94 °C, 1 min; 95 °C, 15 sec; 60 °C, 34 sec for 40 cycles. The results were analyzed using a comparative cycle limit (CT) method. And the primers used are as follows (Table 17). [Table 17]<Listas completas de iniciadores PCR em tempo real humanos> Initiator Gene (5'-3') hDspp Direct CAACCATAGAGAAAGCAAACGCG Reverse mCTGTTGCCACTGCTGGGAC hNestin Direct AGCCCTGACCACTCCAGIt TAG Reverse CCCTCTATGGCTG IIICIIICTCT hBSP Direct GAATGGCCTGTGGC mCTCAA Reverse TCGGATGAGTCACTACTGCCC hGAPDH Direct CCATGGAGAAGGCTGGGG Reverse CAAAGTTCTCATGGATGACC EXAMPLE 1-5. IN VIVO TRANSPLANT AND ANALYSIS Histomorphological

[0141] Human dental pulp cells (hDPCs) were isolated and used for in vivo transplantation experiments. Human dental pulp cells (2 x 10⁶) were mixed with 100 mg of hydroxyapatite / tricalcium phosphate (HA / TCP) ceramic powder (Zimmer, USA) individually, or with the peptide of the invention (10 μg) with 0.5% fibrin gel, respectively, and then the prepared implant was transplanted into Petition 870260055118, dated 08 / 06 / 2026, pp. 335 / 367 43 / 63 mice with compromised immune systems (NIH-bg-nu-xid; Harlan Laboratories, Indianapolis, IN), and the mice were reared for 6 and 12 weeks.

[0142] After this, the sample tissues were collected and fixed in 4% paraformaldehyde, decalcified in 10% EDTA (pH 7.4), embedded in paraffin, stained with hematoxylin-eosin (HE) (Vector Labs), or subjected to immunohistochemical analysis. In the immunohistochemical analysis, proteins were detected with 1:150 diluted anti-DSP antibody as the primary antigen, and goat anti-rabbit IgG (Vector Labs) identified with biotin as the secondary antigen.

[0143] Collagen staining was conducted using a Masson Trichrome Marker Kit (Cat. 25088-100) from Polysciences, co.

[0144] Quantitative analysis of newly formed hard tissue was performed using the LS primer program (OLYMPUS Soft Imaging Solution, Muster, Germany). The proportion of newly formed hard tissue was calculated as the percentage of the area of ​​newly formed hard tissue in the total area. EXAMPLE 1-6. SCANNING ELECTRON MICROSCOPY ANALYSIS

[0145] Sample tissues were fixed in 2.5% Glutaraldehyde / 0.1 M Cacodylate buffer for 30 minutes and reacted in a solution containing 1% osmium tetroxide in 0.1 M Cacodylate buffer for 1 hour. Then, the sample tissues were rapidly dehydrated and dried using ethanol, and then the sample tissues were coated with gold and observed with a scanning electron microscope (S-4700, HITACHI, Tokyo, Japan). EXAMPLE 1-7. STATISTICAL ANALYSIS

[0146] Statistical analysis was performed using Student's t-test. All statistical analysis is performed using SPSS software version 19.0. EXAMPLE 2: EXPERIMENTAL RESULTS EXAMPLE 2-1. EFFECT OF PEPTIDES ON THE PROMOTION OF DENTIN OR DENTAL PULP TISSUE AND ON THE TREATMENT OF DENTIN OR DENTAL PULP DISEASES AT THE EXPRESSION LEVEL OF Petition 870260055118, dated 08 / 06 / 2026, pp. 336 / 367 44 / 63 DSPP GENE ODONTOBLAST DIFFERENTIATION MARKER

[0147] The Dspp gene is used as a marker for odontoblast cell differentiation and is known as an essential gene for dentin calcification. Therefore, it has been confirmed that the peptide of the present invention has an effect of promoting the expression of the Dspp gene, which is a marker gene for odontoblast differentiation, and of promoting odontoblast and dentin formation.

[0148] Human dental pulp cells (hDPCs) cultured in Example 3 were treated with the peptides (concentration of 10 μg / mL) from each group synthesized in Example 1-1, and cultured for 48 hours. Then, the mRNA levels of a Dspp gene, a marker of odontoblast differentiation, expressed in human dental pulp cells were measured, and a ratio of the measured Dspp mRNA level to a measured Dspp mRNA level in a control group was calculated, respectively (Tables 18 to 33).

[0149] And, the average value of the mRNA levels of the Dspp gene measured according to the peptides of each group in Tables 1 to 3 was compared for each group (Figure 1A). Specifically, the novel peptides of the present invention lacking the substitution or partial sequence of amino acid nucleotide sequences are grouped as shown in Tables 1 to 3, and the novel peptides of each group are used for expression of Dspp, a blast cell differentiation marker gene, in human dental pulp cells. As a result, showing the effect, a graph showing the average value of each group measured by quantitative real-time PCR of the Dspp mRNA level in human dental pulp cells is shown in Figure 1A. In this case, human dental pulp cells that were not treated with the peptide of the present invention were used as a control.

[0150] Furthermore, the average value of the mRNA levels of the Dspp gene measured according to the peptides of each group in Tables 4 to 16 was compared for each group (Figure 1B). Specifically, the novel peptides of the present invention that lack the substitution or partial sequencing of the amino acid base sequences are grouped as shown in Tables 4 to 16, and the novel peptides of Petition 870260055118, dated 08 / 06 / 2026, pages 337 / 367 45 / 63 of each group are expressed in the expression of Dspp, a blast cell differentiation marker gene, in human dental pulp cells. As a result, showing the effect, a graph showing the average value of each group measured by quantitative real-time PCR of the Dspp mRNA level in human dental pulp cells is shown in Figure 1B. In this case, human dental pulp cells that were not treated with the peptide of the present invention were used as a control.

[0151] The expression level of the Dspp gene was measured using RT-PCR and real-time PCR analysis as described in Example 1-4. In this particular case, the GAPDH gene was used as an internal control. The experiments were performed in triplicate, and then the mean values ​​and standard deviations thereof were taken as measured values. The base sequence of the primers is described in Table 17. [Table 18] Effects of group 1 peptides on the mRNA level of the Dspp gene. Dspp gene mRNA level SEQ ID NO: Mean Standard deviation 1 7.371 0.093 2 7.171 0.121 3 6.512 0.209 4 7.071 0.192 5 6.893 0.07 6 6.931 0.119 7 6.881 0.321 8 6.531 0.2025 [Table 19] Effects of group 2 peptides on the mRNA level of the Dspp gene. Dspp gene mRNA level SEQ ID NO: Mean Standard deviation Petition 870260055118, dated 08 / 06 / 2026, pages 338 / 367 46 / 63 9 7.543 0.132 10 6.996 0.352 11 7.385 0.271 12 7.548 0.327 13 6.655 0.377 14 6.839 0.241 15 6.764 0.289 16 7.739 0.357 [Table 20] Effects of group 3 peptides on the mRNA level of the Dspp gene. mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 17 7.712 0.219 18 7.319 0.192 19 7.931 0.192 20 7.553 0.299 21 7.893 0.132 22 7.412 0.372 23 9.171 0.381 24 8.512 0.411 [Table 21] Effects of group 4 peptides on the mRNA level of the Dspp gene. Dspp gene mRNA level SEQ ID NO: Mean Standard deviation 25 2.491 0.453 26 2.623 0.273 27 2.213 0.302 28 2.781 0.5 Petition 870260055118, dated 08 / 06 / 2026, pp. 339 / 367 47 / 63 29 2.926 0.292 30 2.011 0.311 31 2.432 0.52 32 2.303 0.299 [Table 22] Effects of group 5 peptides on the mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 33 3.615 0.53 34 3.727 0.495 35 3.017 0.293 36 3.256 0.444 37 3.303 0.671 38 2.099 0.506 39 3.412 0.279 40 3.109 0.395 [Table 23] Effects of group 6 peptides on the mRNA level of the Dspp gene. mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 41 2.937 0.333 42 2.808 0.501 43 2.435 0.432 44 2.517 0.296 45 3.051 0.433 46 2.733 0.198 47 2.439 0.287 48 2.602 0.333 Petition 870260055118, dated 08 / 06 / 2026, pages 340 / 367 48 / 63 [Table 24] Effects of group 7 peptides on the mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 49 1.631 0.137 50 1.803 0.208 51 1.569 0.111 52 1.949 0.327 53 1.422 0.09 54 1.638 0.214 55 2 0.396 56 1.909 0.55 [Table 25] Effects of group 8 peptides on the mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 57 2.415 0.375 58 2.677 0.601 59 2.463 0.222 60 2.089 0.163 61 1.909 0.307 62 2.752 0.482 63 2.373 0.394 64 1.829 0.201 [Table 26] Effects of group 9 peptides on the mRNA level of the Dspp gene. Dspp gene mRNA level SEQ ID NO: Mean Standard deviation 65 2.201 0.461 Petition 870260055118, dated 08 / 06 / 2026, pp. 341 / 367 49 / 63 66 2.072 0.366 67 2.452 0.509 68 2.343 0.419 69 1.899 0.382 70 1.947 0.247 71 2.052 0.233 72 1.739 0.188 [Table 27] Effects of group 10 peptides on the mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 73 2.208 0.366 74 2.105 0.273 75 2.624 0.522 76 2.394 0.432 77 1.939 0.337 78 2.109 0.159 79 2.403 0.601 80 2.636 0.573 [Table 28] Effects of group 11 peptides on the mRNA level of the Dspp gene. Dspp gene mRNA level SEQ ID NO: Mean Standard deviation 81 1.757 0.372 82 1.909 0.269 83 2.001 0.227 84 2.101 0.373 85 1.838 0.401 Petition 870260055118, dated 08 / 06 / 2026, pp. 342 / 367 50 / 63 86 1.736 0.317 87 1.888 0.444 88 1.539 0.132 [Table 29] Effects of group 12 peptides on the mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 89 1.635 0.214 90 1.797 0.323 91 1.913 0.333 92 1.498 0.111 93 1.892 0.274 94 1.487 0.099 95 1.939 0.295 96 2.011 0.199 [Table 30] Effects of group 13 peptides on the mRNA level of the Dspp gene. mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 97 1.515 0.107 98 1.479 0.106 99 1.737 0.207 100 1.599 0.166 101 1.674 0.109 102 1.855 0.299 103 1.737 0.107 104 1.878 0.201 [Table 31] Effects of group 14 peptides on the mRNA level of the Dspp gene. Petition 870260055118, dated 08 / 06 / 2026, pages 343 / 367 51 / 63 mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 105 1.664 0.085 106 1.673 0.207 107 1.935 0.372 108 1.495 0.091 109 1.756 0.201 110 1.595 0.099 111 1.918 0.175 112 1.699 0.143 [Table 32] Effects of group 15 peptides at the mRNA level of the Dspp gene mRNA level of the Dspp gene SEQ ID NO: Mean Standard deviation 113 1.778 0.205 114 1.849 0.337 115 1.707 0.199 116 1.693 0.075 117 1.929 0.193 118 2.015 0.151 119 2.121 0.337 120 1.878 0.116 Effects [Table 33] of group 16 peptides at the mRNA level of the Dspp gene Dspp gene mRNA level SEQ ID NO: Mean Standard deviation 121 2.024 0.298 122 1.979 0.303 Petition 870260055118, dated 08 / 06 / 2026, pp. 344 / 367 52 / 63 123 1.837 0.111 124 2.017 0.402 125 2.082 0.377 126 1.798 0.163 127 1.888 0.099 128 1.765 0.375

[0152] Figure 1A is a graph showing the results of comparing the expression levels of dentin sialophosphoprotein (Dspp), an odontoblast differentiation marker gene, in human dental pulp cells (hDPCs) treated with the novel peptide of the present invention. Referring to Figure 1A and Tables 18 through 20, compared with the mRNA level of the Dspp gene, an odontoblast differentiation marker, measured in human dental pulp cells (control) not treated with the peptide of the present invention, when treated with the peptide of the present invention, it can be seen that all mRNA levels of the Dspp gene increased by approximately 6 to 8 times. Especially when treated with the peptide from group 3, the highest mRNA expression value of Dspp was shown.Figure 1B is another graph showing the result of comparing the expression levels of Dspp, an odontoblast differentiation marker gene, in human dental pulp cells (hDPCs) treated with the novel peptide of the present invention. Referring to Figure 1B and Tables 21 through 33, compared with the mRNA level of the Dspp gene, a differentiation marker, measured in human dental pulp cells (control) without treatment with the peptide of the present invention, when the peptide of the present invention is treated, it can be seen that all mRNA levels of the Dspp gene increased by approximately 1.5 to 3 times. EXAMPLE 2-2: EFFECTS OF PEPTIDES TO PROMOTE DENTIN OR DENTAL PULP TISSUE REGENERATION AND TREATMENT OF DENTAL PULP DISEASES AT LEVELS OF EXPRESSION OF THE ODONTOBLAST DIFFERENTIATION MARKER GENE, NESTIN

[0153] The results of Example 2-1 showed that the peptides of the present Petition 870260055118, dated 08 / 06 / 2026, pp. 345 / 367 53 / 63 invention can increase the level of Dspp mRNA, for example, all peptide groups can increase the level of Dspp gene mRNA by more than 1.5 times, and even more than 3 times, and in particular, the peptides from Group 1 and Group 3 can increase the level of Dspp mRNA by at least 6 times or more.

[0154] In this way, it was examined whether the peptides from Group 1 and Group 3 can increase the mRNA levels of other odontoblast differentiation marker genes, Nestin.

[0155] In summary, the experiments were performed in the same manner and in similar ways to Example 2-1, except that the following primers were used. The effects of the peptides of the present invention on the expression levels of Nestin genes were measured, and the calculated mean values ​​were compared between the groups (Figure 1C). In this particular case, human dental pulp cells that were not treated with any of the peptides of the present invention were used as a control group.

[0156] Figure 1C is a graph showing the results of comparing the expression levels of Nestin, a marker gene for odontoblast differentiation, in human dental pulp cells (hDPCs) treated with the peptide of the present invention. As shown in Figure 1C, in relation to the group treated with the peptide of the present invention (Groups 1, 2, 3) compared to the control group, it can be seen that the expression level of the Nestin gene, which is a marker of odontoblast differentiation, increased by 5 times or more.

[0157] The exposed Dspp and Nestin genes are known to be involved in odontoblast differentiation and dentin mineralization, which suggests that the peptides of the present invention may exhibit the effect of promoting dentin regeneration. EXAMPLE 2-3. EFFECT OF OSTEOBLAST AND / OR CEMENTOBLAST PROMOTING PEPTIDE AND PERIODONTAL DISEASE TREATMENT ON BSP GENE EXPRESSION LEVELS, A MARKER GENE FOR OSTEOBLAST AND CEMENTOBLAST DIFFERENTIATION. Petition 870260055118, dated 08 / 06 / 2026, pp. 346 / 367 54 / 63

[0158] The BSP gene is used as a marker to differentiate osteoblasts and cementoblasts, and is known as an essential gene for bone and cementum calcification. Therefore, in order to confirm the effect of the novel peptide of the present invention on the expression of the BSP gene, bone stem cells and a cementum cell differentiation marker gene, human-derived mesenchymal stem cells cultured by performing the method of Example 1-2 set forth (after treatment of each peptide group in human bone marrow mesenchymal stem cells (hBMSCs)), the expression of the BSP gene was confirmed by real-time PCR.

[0159] In summary, except for the use of a different primer, the same method and methods similar to Example 2-1 were performed to measure the effect of the peptide of the present invention on the expression level of the BSP gene, and was measured for each group. The average level was compared (Figure 2A, Figure 2B). Specifically, in the novel peptides of the present invention grouped as shown in Tables 1 to 3, each group of novel peptides expresses the bone and cementum differentiation marker gene BSP (Bone Sialoprotein) in human-derived mesenchymal stem cells (hBMSCs). As a result of this, showing the effect, the result of measuring the BSP mRNA level in human-derived mesenchymal stem cells by quantitative real-time PCR is shown in Figure 2A.Furthermore, in the novel peptides of the present invention grouped as shown in Tables 4 to 16, in order to show the effect of each group of novel peptides on the expression of BSP, a bone and cementum differentiation marker gene, in human-derived mesenchymal stem cells, the result of measuring the level of BSP mRNA in the derived mesenchymal stem cells by quantitative real-time PCR is shown in Figure 2B.

[0160] At this point, the peptide was treated at a concentration of 10 μg / mL. And, as a control, human bone marrow mesenchymal stem cells not treated with the peptide of the present invention were used.

[0161] Figure 2A is a graph showing the results of the level comparison. Petition 870260055118, dated 08 / 06 / 2026, pages 347 / 367 55 / 63 of the expression of the BSP gene, a bone and cementum differentiation marker gene, in human mesenchymal stem cells (hBMSCs) treated with the peptide of the present invention. As shown in Figure 2A, in relation to the group treated with the peptide of the present invention (Groups 1, 2, 3), it can be seen that the expression of the BSP gene increased by about 9 to 13 times or more, compared to the control. In particular, when treated with the peptide from group 3, the highest value of BSP mRNA expression was shown.

[0162] Figure 2B is a graph showing the results of comparing the expression level of the BSP gene, a bone and cementum differentiation marker gene, in human mesenchymal stem cells (hBMSCs) treated with the peptide of the present invention. As shown in Figure 2B, in relation to the group treated with the peptide of the present invention (Group 4 to Group 16), it can be seen that the expression of the BSP gene increased by about 3 to 9 times or more, and 12 times or more, when compared to the control. In particular, when treated with the peptide from group 11, the highest value of BSP mRNA expression was shown.

[0163] As the BSP gene is used as a marker to differentiate osteoblasts and cementoblasts and is known as a gene involved in the process of bone and cementum calcification, it was analyzed that the peptide provided in the present invention would have a bone and cementum regeneration promoting effect. EXAMPLE 2-4. FORMATION OF HUMAN DENTAL PULP CELL HARD TISSUE (HDPCS) BY NOVEL PEPTIDES IN VIVO FOR 6 WEEKS (1) HISTOMORPHOLOGICAL ANALYSIS

[0164] Figure 1A, Figure 1B, Figure 1C, Figure 2A, and Figure 2B, based on the results of in vitro experiments, in order to measure the effect of the peptide of the present invention on the formation of hard tissue in vivo, described in Examples 1-5 above, in the manner described, human dental pulp cells (hDPCs) and 100 mg of hydroxyapatite / tricalcium phosphate (HA / TCP) were mixed with 0.5 μg of gel of Petition 870260055118, dated 08 / 06 / 2026, pages 348 / 367 56 / 63 fibrin, respectively, with 10 μg of peptides from group 3 (e.g., SEQ ID NO: 24) to prepare an implant. The implant was transplanted into the subcutaneous tissue of a mouse with a compromised immune system. At this time, as a control, a transplanted implant containing no peptide of the present invention was used. After 6 weeks of transplantation, as described in Example 1-5 above, a sample was taken and then the newly formed hard tissue was quantitatively analyzed using the LS primer program, and the results are shown in Figure 3.

[0165] Figure 3 shows the results of measuring the amount of newly formed hard tissue using human dental pulp cells (hDPCs) for 6 weeks in vivo. As shown in Figure 3, the rate of hard tissue formation after 6 weeks of transplantation was increased by approximately 2 times or more in the group treated with the novel peptide (Group 3, 29.6%), compared to the control (Control, 13.5%).

[0166] Figure 4 is a microscopic image showing the histomorphological analysis of hard tissue formed using human dental pulp cells (hDPCs) for 6 weeks in vivo. A to D show the results of transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 6 weeks in a mouse with compromised immune systems, and E to H show the results of transplantation of hDPCs and 100 mg of HA / TCP with 0.5% fibrin gel, respectively, along with 10 μg of the group 3 peptide, in a mouse with compromised immune systems for 6 weeks (scale bar: A, E 500 ^; B, F 200 ^; C, G 100 µm; D, H 50 µm).

[0167] As shown in Figure 4, resulting from histomorphological analysis using hematoxylin-eosin staining, in the control group (Figure 4A to Figure 4D) which does not contain the peptide of the present invention and in a group containing the peptide of the present invention (Figure 4E to Figure 4H), it was observed that bone-like tissue and dentin-pulp-like tissue were formed in the tissue substrate. Petition 870260055118, dated 08 / 06 / 2026, pp. 349 / 367 57 / 63 calcified around HA / TCP particles. (2) ANALYSIS OF STAINING WITH COLLAGEN

[0168] Collagen is the most abundant organic matrix in dentin, bone, and cementum, and serves to accommodate deposited minerals. In this way, collagen staining was performed to confirm the accumulation of collagen protein in the calcified tissue formed in each experimental group of the histomorphological analysis.

[0169] Figure 5 shows microscopic images showing the level of collagen formation in hard tissue formed using human dental pulp cells (hDPCs) for 6 weeks in vivo. A to D show the results of transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 6 weeks in an immune-compromised mouse, and E to H show the results of transplantation of hDPCs and 100 mg of HA / TCP with 0.5% fibrin gel, respectively, along with 10 μg of peptide from group 3, in an immune-compromised mouse for 6 weeks (scale bar: A, E 500; B, F 200; C, G 100; D, H 50). The hard tissue formed was stained by the collagen staining method (Masson's trichrome stain).

[0170] As shown in Figure 5, compared with the control group (Figures 5A to 5D), in the group containing the peptide of the present invention (Figures 5E to 5H), it was confirmed that the level of collagen formation was increased. (3) IMMUNOHISTOCHEMICAL ANALYSIS

[0171] The expression of DSP, a specific odontoblast differentiation marker gene, was confirmed by immunohistochemical analysis.

[0172] Figure 6 is an immunostaining figure showing the analysis of the expression level of DSP, a marker for blast cell differentiation, using the immunostaining method, in hard tissue formed using human dental pulp cells (hDPCs) for 6 weeks in vivo. A to D show the results of transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP. Petition 870260055118, dated 08 / 06 / 2026, pages 350 / 367 Figures 58 / 63 in a 0.5% fibrin gel for 6 weeks in an immune-compromised mouse and E through H show the results of transplantation of hDPCs and 100 mg of HA / TCP with 0.5% fibrin gel, respectively, along with 10 μg of group 3 peptide, in an immune-compromised mouse for 6 weeks. A and B were immunolabeled using anti-DSP antibody. C is a negative control from immunohistochemical analysis treated only with secondary antibodies. Arrows marked A and B indicate DSP expression in newly formed calcified tissue. The scale bar is 50 μm.

[0173] As shown in Figure 6, the control group (Figure 6A) was weakly expressed in DSP in innovatively formed dentin-pulp type tissue, but the calcified tissue in which DSP was innovatively formed in the group containing the peptide of the present invention (Figure 6B) was strongly expressed. Figure 6C shows that, in immunohistochemical analysis, the negative control group treated with secondary antibody was not stained with DSP. EXAMPLE 2-5. FORMATION OF HUMAN DENTAL PULP CELL HARD TISSUE (HDPCS) BY NOVEL PEPTIDES IN VIVO OVER 12 WEEKS

[0174] Except for the creation of the mouse implanted for 12 weeks, the method of Example 2-4 was performed to analyze hard tissue formation in human dental pulp cells.

[0175] Figure 7 shows the results of measuring the amount of newly formed hard tissue using human dental pulp cells (hDPCs) for 12 weeks in vivo. As shown in Figure 7, the rate of hard tissue formation after 12 weeks of transplantation was increased by approximately 2 times or more in the group treated with the novel peptide (Group 3, 39.5%), compared to the control (Control, 23.7%).

[0176] Figure 8 is a microscopic image showing the histomorphological analysis of hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo, A to D show the results of transplantation of a Petition 870260055118, dated 08 / 06 / 2026, pp. 351 / 367 Figures 59 / 63 show the control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 12 weeks in an immune-compromised mouse, and E through H show the results of transplantation of hDPCs and 100 mg of HA / TCP with 0.5% fibrin gel, respectively, along with 10 μg of peptide from group 3, in an immune-compromised mouse for 12 weeks (scale bar: A, E 500 ^; B, F 200 ^; C, G 100 ^; D, H 50 ^).

[0177] As shown in Figure 8, resulting from histomorphological analysis using hematoxylin-eosin staining, similar to the case in Figure 4 (6 weeks post-transplant) in the control group (Figure 8A to Figure 8D) which does not contain the peptide of the present invention and a group which contains the peptide of the present invention (Figure 8E to Figure 8H), it was observed that bone-like tissue and dentin-pulp-like tissue were formed in the substrate of the calcified tissue around the HA / TCP particles. (2) ANALYSIS OF STAINING WITH COLLAGEN

[0178] Collagen staining was performed to confirm the accumulation of collagen protein in the calcified tissue formed in each experimental group of the histomorphological analysis of Example 2-5.

[0179] Figure 9 shows microscopic images showing the level of collagen formation in hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo. A to D show the results of transplanting a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 12 weeks in a mouse with a compromised immune system. E to H show the results of transplanting hDPCs and 100 mg of HA / TCP with 0.5% fibrin gel, respectively, along with 10 μg of the group 3 peptide, in a mouse with a compromised immune system for 12 weeks (scale bar: A, E 500 ^; B, F 200 ^; C, G 100 ^; D, H 50 µm). The hard tissue formed was stained using the collagen staining method (Masson's trichrome stain).

[0180] As shown in Figure 9, when compared with the control group Petition 870260055118, dated 08 / 06 / 2026, pp. 352 / 367 In groups 60 / 63 (figures 9A to 9D), and in the group containing the peptide of the present invention (figures 9E to 9H), it was confirmed that the level of collagen formation was increased. (3) IMMUNOHISTOCHEMICAL ANALYSIS

[0181] The expression of DSP, a specific odontoblast differentiation marker gene, was confirmed by immunohistochemical analysis.

[0182] Figure 10 is an immunostaining figure showing the analysis of the expression level of DSP, a marker for blast cell differentiation, using the immunostaining method, in hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo. A to D show the results of transplantation of a control implant prepared by mixing hDPCs and 100 mg of HA / TCP in a 0.5% fibrin gel for 12 weeks in an immune-compromised mouse, and E to H show the results of transplantation of hDPCs and 100 mg of HA / TCP with 0.5% fibrin gel, respectively, along with 10 μg of group 3 peptide, in an immune-compromised mouse for 6 weeks. A and B were immunostained using anti-DSP antibody. C is a negative control of the immunohistochemical analysis treated only with secondary antibodies. The arrows marked A and B indicate the expression of DSP in newly formed calcified tissue.The scale bar is 50 μm.

[0183] As shown in Figure 10, the control group (Figure 10A) was weakly expressed in DSP in the innovatively formed dentin-pulp type tissue, but the calcified tissue in which DSP was innovatively formed in the group containing the peptide of the present invention (Figure 10B) was strongly expressed. Figure 10C shows that, in the immunohistochemical analysis, the negative control group treated with the secondary antibody was not stained with DSP.

[0184] Summarizing the results of Examples 2-4 and 2-5, it was found that the novel peptide of the present invention exhibits an effect capable of promoting the regeneration of dentin / pulp tissue complexes and bone / cementum-like tissues. Petition 870260055118, dated 08 / 06 / 2026, pages 353 / 367 61 / 63 EXAMPLE 2-6. CELL ANALYSIS USING SCANNING ELECTRON MICROSCOPY OF TRANSPLANTED TISSUE

[0185] Scanning electron microscopy analysis of the method in Example 16 was performed to confirm the differentiation of human dental pulp cells (hDPCs) into odontoblast or osteoblast / cementoblast in the control group and in the experimental group treated with the novel peptide for 12 weeks after transplantation was performed.

[0186] After 12 weeks, scanning electron microscopy analysis was performed using the method of Example 1-6 in order to confirm the differentiation of human dental pulp cells (hDPCs) into odontoblasts or osteoblasts / cementoblasts between the experimental group treated with the novel peptide and the control group.

[0187] Figure 11 is an image showing the analysis of hard tissue formed using human dental pulp cells (hDPCs) for 12 weeks in vivo using scanning electron microscopy (SEM), where A is hDPCs and 100 mg of HA / TCP prepared by mixing 0.5% fibrin gel with a control implant, B and C were hDPCs and 100 mg of HA / TCP with 10 μg of peptides from group 3, respectively, mixed with 0.5% fibrin gel. This shows the result of implantation in a mouse with a compromised immune system for 12 weeks. The scale bar is 10 μm. The hard tissue formed was observed by the cells using scanning electron microscopy.

[0188] In the control group treated with hDPCs only, some odontoblast-like cells with incomplete odontoblastic processes were formed around the hard tissue formed (Figure 11A). In the group treated with the peptide of the present invention (e.g., group 3 peptide), odontoblast-like cells were observed along the hard tissue formed, and the odontoblastic processes were also extended towards the hard tissue formed (Figure 11B). Furthermore, in the group treated with the peptide of the present invention, it was confirmed that it exhibits the characteristics of typical osteoblasts / cementoblasts with a shape Petition 870260055118, dated 08 / 06 / 2026, pages 354 / 367 62 / 63 cubic attached to the surface of the formed hard tissue (figure 11C).

[0189] Therefore, it was found that the peptide of the present invention can more effectively form odontoblasts and osteoblasts / cementoblasts. EXAMPLE 2-7. TUBULE OBTURATION TEST DENTIN IN VIVO

[0190] In the premolar of a 12-month-old adult dog, a dental bur was used to remove enamel from the cervical region and expose the dentin. The exposed dentin premolar was thoroughly rinsed to completely remove enamel-dentin fragments generated during vortex formation, followed by moisture removal.

[0191] 1.5 pg of the peptide (SEQ ID NO: 24) (group 3) according to the present invention was applied to the entrance of the dentinal tubule at the site with exposed dentin and, after 3 weeks, the adult dog was euthanized to extract the teeth. Then, a specimen of the extracted tooth was prepared using a diamond saw.

[0192] And, in order to confirm the effect of the novel peptide according to the present invention on the obturation of the exposed dentinal tubule of damaged dentin, the ability to close the dentinal tubule was evaluated by scanning electron microscopy and the results are shown in Figure 12.

[0193] Specifically, as shown in Figure 12A and Figure 12E, after cutting the lower part of the dentin lesion site, the lower surface (box part) of the cut surface was observed. Scanning electron microscopy confirmed that the untreated control group exposed the dentinal tubules of the lower part of the damaged dentin (Figure 12A to Figure 12D). On the other hand, in the experimental group treated with peptides, it can be seen that the exposed dentinal tubules were closed by physiological remineralization (Figure 12E to Figure 12H). EXAMPLE 2-8. OBSERVATION OF THE DAMAGED SITE ON THE DENTIN SURFACE IN VIVO

[0194] A specimen of teeth extracted from adult dogs was prepared by Petition 870260055118, dated 08 / 06 / 2026, pages 355 / 367 63 / 63 same method as Example 2-7.

[0195] And, to confirm the effect of the novel peptide according to the present invention on the obturation of the dentinal tubule on the surface of damaged dentin, the ability to close the dentinal tubules in the surface area was evaluated by means of scanning electron microscopy, and the results are shown in figure 13.

[0196] As a result of observation by scanning electron microscopy, it can be confirmed that the dentinal tubules are exposed on the damaged dentin surface of the untreated control group (Figure 13A to Figure 13D). On the other hand, in the experimental group treated with the peptide, it can be seen that most of the exposed dentinal tubules were closed (Figure 13E to Figure 13H).

[0197] This study was supported by the Korea Evaluation Institute of Industrial Technology (KEIT) and funded by the Ministry of Trade, Industry & Energy in 2017 (10078369, “Development of desensitizer using functional peptide inducing dentin regeneration”).

[0198] Although one or more embodiments of the present invention have been described in relation to the figures, it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the present invention. Petition 870260055118, dated 08 / 06 / 2026, pp. 356 / 367

Claims

1 / 1 CLAIMS 1. Isolated synthetic peptide, characterized by consisting of any amino acid sequence of SEQ ID NOS: 2 to 24.

2. Peptide, according to claim 1, characterized in that the peptide promotes the regeneration of hard tissue or dental pulp tissue.

3. Peptide, according to claim 1, characterized in that the peptide has a modification selected from the group consisting of an N- or C-terminal acetylation, amidation, or methylation; an introduction of a D-amino acid; a peptide bond modification selected from the group consisting of CH2NH, CH2-S, CH2-S=O, and CH2-CH2; a main chain modification; and a side chain modification. Petition 870260055118, dated 08 / 06 / 2026, pp. 366 / 367