Method for transforming corn
By using a specific combination of callus induction culture medium and heat shock treatment, combined with Agrobacterium infection and selection agent screening, the problems of high cost, long cycle and low efficiency of maize genetic transformation have been solved, and a stable and efficient maize genetic transformation method has been realized.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING DABEINONG BIOTECHNOLOGY CO LTD
- Filing Date
- 2016-10-12
- Publication Date
- 2026-06-09
AI Technical Summary
Existing maize genetic transformation methods suffer from problems such as high cost, seasonal limitations on material sourcing, long cycles, and unstable states. In particular, the preparation of suspension cell lines is cumbersome and has low transformation efficiency.
Primary callus tissue was obtained by inducing maize immature embryos with a callus induction medium containing dicamba, atrazine, and kinetin. Suspension cell lines were obtained through suspension culture. Heat shock treatment was used to improve Agrobacterium infection efficiency. Resistant callus tissue was screened using a selector, and finally, plants with stable expression were regenerated.
It achieves low-cost, rapid, and stable maize genetic transformation, shortens the experimental cycle, improves transformation efficiency and positive rate, reduces the demand for explants, and is suitable for large-scale genetic transformation.
Smart Images

Figure CN106520661B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for plant transformation, and more particularly to a method for transforming maize suspension cell lines to obtain transgenic plants. Background Technology
[0002] Maize (Zea mays L.) is one of the world's three major food crops and an important industrial raw material and bioenergy source, playing a pivotal role in food production in my country and worldwide. Among the many factors contributing to increased maize yield, the breeding of new varieties accounts for 40%. With the rapid development of molecular biology techniques, transgenic technology has begun to play a significant role in the breeding of new maize varieties. Transgenic maize has become the second most widely planted transgenic crop globally, after transgenic soybeans.
[0003] A suitable recipient system is a crucial step in maize genetic transformation, affecting the provision of appropriate recipient material and the regeneration of transformed cells into normal plants. To date, the most effective recipient materials for maize include immature embryos, embryo-induced callus, and callus obtained from cell suspension culture. Other methods include mature embryo-induced callus, embryogenic callus, protoplasts isolated from suspension cell lines, and shoot apical meristems. Meanwhile, the main methods for maize genetic transformation include Agrobacterium-mediated transformation, gene gun bombardment, electroporation, PEGylation, and pollen tube pathway methods, among which Agrobacterium-mediated transformation and gene gun bombardment are currently the most commonly used transgenic methods.
[0004] Currently, Agrobacterium-mediated genetic transformation of maize immature embryos is widely used, but it suffers from drawbacks such as high cost, seasonal limitations on material sourcing, and unstable cell state. Although there are successful cases of protoplasts and shoot tip meristems isolated from suspension cell lines induced by mature embryos, existing technologies generally employ gene gun bombardment of suspension cell lines. The preparation of suspension cell lines requires a lengthy subculture process to obtain Type II callus, and then the suspension cell lines are prepared from Type II callus. This process is not only cumbersome but also time-consuming. Transformants obtained by gene gun bombardment not only have high transgenic copy numbers, increasing the difficulty of subsequent trait screening, but also exhibit low and unstable transformation efficiency. Furthermore, suspension cell lines infected with Agrobacterium exhibit a defensive response, releasing reactive oxygen species, which easily leads to browning and death of callus, making it difficult to obtain resistant callus and subsequently regenerate stably expressing plants. Therefore, there is a need to develop a low-cost, readily available, short-cycle, and stable genetic transformation system. Summary of the Invention
[0005] The purpose of this invention is to provide a method for converting corn, which effectively overcomes the technical defects of existing technologies such as high cost, seasonal limitations on raw materials, long cycle, and unstable state.
[0006] To achieve the above objectives, the present invention provides a method for inducing maize callus, comprising inoculating maize embryos into a callus induction medium to induce primary callus, wherein the callus induction medium contains dicamba, chlorpyrifos, and kinetin.
[0007] Preferably, the concentration of dicamba is 0.2-10 mg / L, the concentration of atrazine is 0.2-10 mg / L, and the concentration of kinetin is 0.01-5 mg / L.
[0008] More preferably, the concentration of dicamba is 2 mg / L, the concentration of chlorhexidine is 2.2 mg / L, and the concentration of kinetin is 0.3 mg / L.
[0009] Furthermore, the callus induction culture medium also contains benzylaminopurine.
[0010] Preferably, the concentration of benzylaminopurine is 0.01-5 mg / L.
[0011] More preferably, the concentration of benzylaminopurine is 0.02 mg / L.
[0012] Furthermore, the callus induction culture medium contains a large amount of salt, a small amount of salt, organic matter, proline, hydrolyzed casein, aspartic acid, sucrose and 2,4-D.
[0013] Preferably, the callus induction culture medium comprises MS salt, N6 vitamin, proline 0.1-5 g / L, hydrolyzed casein 0.1-5 g / L, aspartic acid 0.1-5 g / L, sucrose 5-100 g / L, 2,4-D 0.1-5 mg / L, dicamba 0.2-10 mg / L, cyprodin 0.2-10 mg / L, kinetin 0.01-5 mg / L, and benzylaminopurine 0-5 mg / L.
[0014] Optionally, the callus induction culture medium comprises MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, cyprodin 2.2 mg / L, and kinetin 0.3 mg / L.
[0015] Optionally, the callus induction culture medium comprises MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
[0016] To achieve the above objectives, the present invention also provides a method for obtaining a maize suspension cell line, comprising suspending the primary callus obtained by the method for inducing maize callus in a suspension culture medium to obtain a maize suspension cell line.
[0017] Specifically, the method for obtaining the maize suspension cell line includes:
[0018] The primary callus obtained by the method for inducing maize callus is subjected to suspension culture and subculture in a first suspension culture medium to obtain suspension cell clusters.
[0019] The suspended cell clusters are cultured in a second suspension medium to obtain a suspended cell line.
[0020] More specifically, the method for obtaining the maize suspension cell line includes:
[0021] The primary callus obtained by the method for inducing maize callus is cultured in suspension in a first suspension culture medium for 10-25 days, and then subcultured 2-3 times to obtain suspension cell clusters.
[0022] The suspended cell clusters are cultured in a second suspension medium for 5-7 days to obtain a suspended cell line.
[0023] Based on the above technical solution, the first suspension culture medium contains MS salt or N6 salt, MS vitamin, proline 0.1-5 g / L, hydrolyzed casein 0.1-5 g / L, sucrose 5-100 g / L, dicamba 0.2-10 mg / L and 2,4-D 0.1-5 mg / L.
[0024] Preferably, the first suspension culture medium contains MS salt, MS vitamin, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 45 g / L, dicamba 1.5 mg / L and 2,4-D 1 mg / L.
[0025] Furthermore, the second suspension culture medium contains MS salt or N6 salt, MS vitamin, proline 0.1-5 g / L, hydrolyzed casein 0.1-5 g / L, sucrose 5-100 g / L and dicamba 0.2-10 mg / L.
[0026] Preferably, the second suspension culture medium contains MS salt, MS vitamin, 3 g / L proline, 1.5 g / L hydrolyzed casein, 30 g / L sucrose and 1.5 mg / L dicamba.
[0027] To achieve the above objectives, the present invention also provides a method for large-scale expansion of a corn suspension cell line, comprising subculturing the corn suspension cell line obtained by the method described above in a suspension culture medium to expand the corn suspension cell line.
[0028] Specifically, the method for mass expansion of the maize suspension cell line includes subculturing the maize suspension cell line obtained by the method for obtaining the maize suspension cell line in a second suspension culture medium to expand the maize suspension cell line.
[0029] Preferably, the second suspension culture medium contains MS salt or N6 salt, MS vitamin, proline 0.1-5 g / L, hydrolyzed casein 0.1-5 g / L, sucrose 5-100 g / L and dicamba 0.2-10 mg / L.
[0030] Specifically, the second suspension culture medium contains MS salts, MS vitamins, 3 g / L proline, 1.5 g / L hydrolyzed casein, 30 g / L sucrose, and 1.5 mg / L dicamba.
[0031] To achieve the above objectives, the present invention also provides a method for saving maize explants, comprising obtaining the primary callus tissue by the method for inducing maize callus tissue, obtaining the maize suspension cell line by the method for obtaining maize suspension cell line, and subculturing the maize suspension cell line in suspension culture medium to expand the maize suspension cell line.
[0032] To achieve the above objectives, the present invention also provides a method for improving Agrobacterium infection efficiency, comprising a corn suspension cell cluster pretreated with Agrobacterium infection, wherein the corn suspension cell cluster is derived from the corn suspension cell line obtained by the method for obtaining the corn suspension cell line, and the pretreatment includes heat shock treatment.
[0033] Furthermore, the heat shock treatment time is no more than 8 minutes.
[0034] Furthermore, the temperature of the heat treatment is 30-60°C.
[0035] Preferably, the temperature of the heat shock treatment is 42°C or 60°C.
[0036] More preferably, the heat shock treatment is performed in an oven at 60°C for 5 minutes.
[0037] Optionally, the pretreatment further includes ultrasonic treatment.
[0038] Based on the above technical solution, the method for improving Agrobacterium infection efficiency includes:
[0039] Pre-cultured corn suspension cell clusters were obtained by pre-culturing corn suspension cell clusters.
[0040] The pre-cultured corn suspension cell clusters are pretreated to obtain pretreated corn suspension cell clusters.
[0041] Agrobacterium infection of the pretreated corn suspension cell clusters;
[0042] The infected corn suspension cell clusters were co-cultured with the Agrobacterium to obtain co-cultured corn suspension cell clusters.
[0043] To achieve the above objectives, the present invention also provides an effective method for screening maize resistant callus, comprising culturing the co-cultured maize suspension cell clusters obtained by the method for improving Agrobacterium infection efficiency on a screening medium containing a selector and selecting resistant callus.
[0044] Furthermore, the selector is an antibiotic, herbicide, or sugar.
[0045] Specifically, the method for effectively screening maize resistant callus includes: culturing the co-cultured maize suspension cell clusters obtained by the method for improving Agrobacterium infection efficiency on a first screening medium containing diammonium phosphate, and then culturing them on a second screening medium containing diammonium phosphate to select resistant callus.
[0046] Preferably, the concentration of diammonium phosphate in the second screening medium is 50-100 mg / L.
[0047] Furthermore, the second screening medium comprises MS salt, MS vitamin, proline 0.1-5 g / L, sucrose 5-100 g / L, dicamba 0.2-10 mg / L, cyprodin 0.2-10 mg / L, termethin 20-500 mg / L, kinetin 0.01-5 mg / L, and diammonium phosphate 50-100 mg / L.
[0048] Preferably, the second screening medium comprises MS salt, MS vitamin, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 100 mg / L.
[0049] Based on the above technical solution, the concentration of diammonium phosphate in the first screening culture medium is 3-5 mg / L.
[0050] Preferably, the first screening medium comprises MS salt, MS vitamin, proline 0.1-5 g / L, sucrose 5-100 g / L, dicamba 0.2-10 mg / L, chlorhexidine 0.2-10 mg / L, termethin 20-500 mg / L, kinetin 0.01-5 mg / L, and diammonium phosphate 3-5 mg / L.
[0051] Alternatively, the first screening medium may include MS salt, MS vitamin, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 3 mg / L.
[0052] Alternatively, the first screening medium may include MS salt, MS vitamin, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L and diammonium phosphate 5 mg / L.
[0053] To achieve the above objectives, the present invention also provides a method for converting corn, comprising:
[0054] The primary callus obtained by the method for inducing maize callus is obtained by the method for obtaining maize suspension cell lines.
[0055] Agrobacterium infection of corn suspension cell clusters in the corn suspension cell line.
[0056] The infection of corn suspension cell clusters in the corn suspension cell line by Agrobacterium specifically refers to the infection of corn suspension cell clusters in the corn suspension cell line after Agrobacterium infection pretreatment, the pretreatment including heat shock treatment.
[0057] Furthermore, the heat shock treatment time is no more than 8 minutes.
[0058] Furthermore, the temperature of the heat treatment is 30-60°C.
[0059] Preferably, the temperature of the heat shock treatment is 42°C or 60°C.
[0060] More preferably, the heat shock treatment is performed in an oven at 60°C for 5 minutes.
[0061] Optionally, the pretreatment further includes ultrasonic treatment.
[0062] Based on the above technical solution, the method for converting corn includes:
[0063] The corn suspension cell clusters in the corn suspension cell line are pre-cultured to obtain pre-cultured corn suspension cell clusters;
[0064] The pre-cultured corn suspension cell clusters are pretreated to obtain pretreated corn suspension cell clusters.
[0065] Agrobacterium infection of the pretreated corn suspension cell clusters;
[0066] The infected corn suspension cell clusters were co-cultured with the Agrobacterium to obtain co-cultured corn suspension cell clusters.
[0067] To achieve the above objectives, the present invention also provides a method for producing maize plants with stable transformation, comprising:
[0068] The primary callus obtained by the method for inducing maize callus is obtained by the method for obtaining maize suspension cell lines.
[0069] Agrobacterium-mediated infection of corn suspension cell clusters in the described corn suspension cell line;
[0070] The infected corn suspension cell clusters were co-cultured with the Agrobacterium;
[0071] Resistant callus tissue was cultured and selected on a culture medium containing a selector.
[0072] The resistant callus regeneration is a maize plant.
[0073] The infection of corn suspension cell clusters in the corn suspension cell line by Agrobacterium specifically refers to the infection of corn suspension cell clusters in the corn suspension cell line after Agrobacterium infection pretreatment, the pretreatment including heat shock treatment.
[0074] Furthermore, the heat shock treatment time is no more than 8 minutes.
[0075] Furthermore, the temperature of the heat treatment is 30-60°C.
[0076] Preferably, the temperature of the heat shock treatment is 42°C or 60°C.
[0077] More preferably, the heat shock treatment is performed in an oven at 60°C for 5 minutes.
[0078] Optionally, the pretreatment further includes ultrasonic treatment.
[0079] Based on the above technical solution, the method for producing stable-transformation maize plants includes:
[0080] The corn suspension cell clusters in the corn suspension cell line are pre-cultured to obtain pre-cultured corn suspension cell clusters;
[0081] The pre-cultured corn suspension cell clusters are pretreated to obtain pretreated corn suspension cell clusters.
[0082] Agrobacterium infection of the pretreated corn suspension cell clusters.
[0083] Based on the above technical solution, the selector is an antibiotic, herbicide, or sugar.
[0084] The specific steps of culturing and selecting resistant callus on a culture medium containing a selector involve culturing co-cultured corn suspension cell clusters on a first selection medium containing diammonium phosphate, followed by culturing on a second selection medium containing diammonium phosphate to select resistant callus.
[0085] Preferably, the concentration of diammonium phosphate in the second screening medium is 50-100 mg / L.
[0086] Furthermore, the second screening medium comprises MS salt, MS vitamin, proline 0.1-5 g / L, sucrose 5-100 g / L, dicamba 0.2-10 mg / L, cyprodin 0.2-10 mg / L, termethin 20-500 mg / L, kinetin 0.01-5 mg / L, and diammonium phosphate 50-100 mg / L.
[0087] Preferably, the second screening medium comprises MS salt, MS vitamin, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 100 mg / L.
[0088] Based on the above technical solution, the concentration of diammonium phosphate in the first screening culture medium is 3-5 mg / L.
[0089] Preferably, the first screening medium comprises MS salt, MS vitamin, proline 0.1-5 g / L, sucrose 5-100 g / L, dicamba 0.2-10 mg / L, chlorhexidine 0.2-10 mg / L, termethin 20-500 mg / L, kinetin 0.01-5 mg / L, and diammonium phosphate 3-5 mg / L.
[0090] Alternatively, the first screening medium may include MS salt, MS vitamin, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 3 mg / L.
[0091] Alternatively, the first screening medium may include MS salt, MS vitamin, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L and diammonium phosphate 5 mg / L.
[0092] The cloned genes, expression cassettes, vectors (e.g., plasmids), proteins and protein fragments, as well as the transformed nuclear plants in this invention, can all be produced using standard methods.
[0093] This invention can be used to express any target gene in maize plants. The target gene can be a herbicide-resistant gene, a disease-resistant gene, or an insect-resistant gene, or a selection or evaluation marker, and contains a plant-operable promoter, coding region, and terminator region. Herbicide-resistant genes include the AHAS gene for resistance to imidazolinone or sulfonylurea herbicides, the PAT or bar gene for resistance to glyphosate herbicides, and the EPSPS gene for resistance to glyphosate herbicides, etc. Disease-resistant genes include antibiotic synthase genes, such as nitropyrrolizin synthase genes, plant-derived resistance genes, etc. Insect-resistant genes include Bacillus thuringiensis insecticidal genes. The target gene can also encode an enzyme related to a biochemical pathway, the expression of which can alter traits important in food, feed, nutrient, and / or pharmaceutical production. The target gene can be located on a plasmid. Plasmids suitable for use in this invention can contain more than one target gene and / or Agrobacterium can contain different plasmids carrying different target genes.
[0094] In this invention, "maize" refers to Zea mays, and the method is based on Agrobacterium-mediated transfer of the target gene into a suspended cell mass of maize, followed by regeneration into a transformed maize plant.
[0095] Transformed maize cells are cultured in the presence of a selector. Preferably, the cells are transformed with the glufosinate-amyltransferase (PAT) gene, and the transformed gene is cultured in the presence of diammonium phosphate. In a medium containing diammonium phosphate as a selector, the PAT-transformed maize cells grow selectively.
[0096] Transgenic plants containing heterologous nucleic acids (i.e., cells or tissues transformed according to the method of the present invention), as well as seeds and offspring produced by such transgenic plants, are the subject of this invention. Methods for culturing transformed cells into useful cultivars are well known to those skilled in the art. In vitro plant tissue culture techniques and whole-plant regeneration techniques are also well known. Accordingly, the term "seeds" includes the seeds of these transformed plants and the seeds produced by the offspring of the transformed plants. The term "plants" includes not only transformed and regenerated plants but also the offspring of transformed and regenerated plants produced by the method of the present invention.
[0097] Successfully transformed plants can be screened from plants produced by the method of this invention. To develop improved plant and seed lines, seeds and progeny plants of the regenerated plants of this invention can be continuously screened and selected to ensure the persistence of the transgene and integrated nucleic acid sequence. Therefore, the desired transgene nucleic acid sequence can be transferred (i.e., introgressed or crossbred) into other genetic lines such as certain original species or commercially useful lines or varieties. Methods for introgressing the target gene into genetic plant lines can be achieved through various techniques known in the art, including conventional breeding, protoplast fusion, nuclear transfer, and chromosome transfer. Breeding methods and techniques are also known in the art. The transgenic plants and inbred lines obtained according to this invention can be used to produce commercially valuable hybrid plants and crops.
[0098] This invention provides a method for converting corn, which has the following advantages:
[0099] 1. Stability. The method for transforming maize in this invention can mass-produce suspension cell lines under laboratory conditions, overcoming the limitations of field materials that are restricted by weather conditions and cannot accurately predict explant harvest. This ensures that maize genetic transformation is not affected by seasonality and meets the need for stable transformation year-round.
[0100] 2. Short cycle. The method for transforming maize in this invention can quickly obtain a suspension cell line from the primary callus induced by maize embryos, without the need for long-term subculturing on solid culture medium to obtain Type II callus, and then obtaining a suspension cell line from Type II callus. Therefore, the experimental cycle is shortened from 6 months to 40-50 days, and the operation is simple, convenient, and has good reproducibility.
[0101] 3. This invention is the first to obtain a suspension cell line from maize embryos. Preferably, the callus obtained from the callus induction medium CIM-D has obvious protrusions on its surface, bright color, and significantly improved growth rate, which is beneficial for the direct preparation of maize suspension cell lines. Then, the maize suspension cell line is transformed by Agrobacterium infection. Preferably, the maize suspension cell line after pretreatment (i.e., heat treatment at 60°C for 5 minutes) can significantly improve the Agrobacterium infection efficiency. The maize suspension cell line regenerates seedlings after screening. Preferably, the positive rate and transformation efficiency are highest when the concentration of diammonium phosphate in the screening medium S2 reaches 100 mg / L.
[0102] 4. High conversion efficiency. The conversion efficiency of the method for converting corn in this invention can reach about 30%, the transgenic positivity rate can reach about 90%, and the single copy rate is about 40%.
[0103] 5. Low conversion cost. Because the method for converting maize in this invention can provide a large number of excellent maize suspension cell lines, it significantly reduces the pressure on the supply of maize explants (embryos), thereby greatly reducing the human and material resources required for explant culture and enabling large-scale genetic conversion.
[0104] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0105] Figure 1 This is a flowchart illustrating the construction process of the recombinant cloning vector DBN01-T in the method for transforming maize according to the present invention.
[0106] Figure 2 This is a flowchart illustrating the construction process of the recombinant expression vector DBN100001 for the method of transforming maize according to the present invention.
[0107] Figure 3 This is a diagram showing the morphology of callus induced by the method for transforming corn according to the present invention.
[0108] Figure 4 These are effect diagrams of multiple corn suspension cell clusters in the method for converting corn according to the present invention;
[0109] Figure 5 This is an image showing the effect of a corn suspension cell line using the method for transforming corn according to the present invention;
[0110] Figure 6 This image shows the transient expression of the red fluorescent protein DsRed in a corn suspension cell mass using the method for transforming corn according to the present invention.
[0111] Figure 7 This image shows the effect of a transgenic positive maize plant produced by the method for transforming maize according to the present invention. Detailed Implementation
[0112] The technical solution of the method for converting corn according to the present invention is further illustrated below through specific embodiments.
[0113] First embodiment: Construction of recombinant expression vector and transformation of recombinant expression vector into Agrobacterium.
[0114] 1. Construct a recombinant cloning vector containing the target gene.
[0115] The PAT nucleotide sequence was ligated into the cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), following the instructions for the Promega pGEM-T vector, to obtain the recombinant cloning vector DBN01-T. The construction process is as follows: Figure 1As shown (where Amp represents the ampicillin resistance gene; f1 represents the replication origin of phage f1; LacZ is the LacZ start codon; SP6 is the SP6 RNA polymerase promoter; T7 is the T7 RNA polymerase promoter; PAT is the nucleotide sequence of the glufosinate acetyltransferase gene (SEQ ID NO:1); MCS is the multiple cloning site).
[0116] The recombinant cloning vector DBN01-T was then transformed into E. coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) using a heat shock method. The heat shock conditions were as follows: 50 μL of E. coli T1 competent cells, 10 μL of plasmid DNA (recombinant cloning vector DBN01-T), water bath at 42°C for 30 seconds; shaking culture at 37°C for 1 hour (shaking on a shaker at 200 rpm); and growth overnight on LB agar plates coated with IPTG (isopropyl thio-β-D-galactopyranoside) and X-gal (5-bromo-4-chloro-3-indole-β-D-galactopyranoside) and ampicillin (100 mg / L) (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L, pH adjusted to 7.5 with NaOH). White colonies were picked and cultured overnight at 37°C in LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 100 mg / L ampicillin, pH adjusted to 7.5 with NaOH). Plasmids were extracted using the alkaline method: the bacterial culture was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated cells were resuspended in 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA, 50 mM glucose, pH 8.0); 200 μL of freshly prepared solution II (0.2 M... Add NaOH and 1% SDS (sodium dodecyl sulfate), invert the tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12000 rpm for 5 min, add 2 volumes of anhydrous ethanol to the supernatant, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12000 rpm for 5 min, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use.
[0117] After the extracted plasmids were identified by enzyme digestion, the positive clones were sequenced for verification. The results showed that the PAT nucleotide sequence inserted into the recombinant cloning vector DBN01-T was the nucleotide sequence shown in SEQ ID NO:1 in the sequence listing.
[0118] Following the method described above for constructing the recombinant cloning vector DBN01-T, the DsRed nucleotide sequence was ligated into the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T. Enzyme digestion and sequencing verified that the DsRed nucleotide sequence inserted into the recombinant cloning vector DBN02-T was the nucleotide sequence shown in SEQ ID NO:2 of the sequence listing.
[0119] 2. Construct a recombinant expression vector containing the target gene.
[0120] The recombinant cloning vectors DBN02-T and DBNBC-01 (vector backbone: based on pCAMBIA3300 modified (CAMBIA can provide)) were digested with restriction endonucleases KpnI and PvuI, respectively. The excised DsRed nucleotide sequence was inserted into the expression vector DBNBC-01. Constructing the vector using conventional restriction enzyme digestion methods is well-known to those skilled in the art, resulting in the recombinant expression vector DBNBC-01-DsRed. Subsequently, DBN01-T and the aforementioned recombinant expression vector DBNBC-01-DsRed were digested with restriction endonucleases SacI and SnaBI, respectively. The excised PAT nucleotide sequence was inserted into the expression vector DBNBC-01-DsRed. Constructing the vector using conventional restriction enzyme digestion methods is well-known to those skilled in the art, resulting in the recombinant expression vector DBN100001. The construction process is as follows: Figure 2 As shown (Kan: kanamycin gene sequence; RB: right border; pr35S: cauliflower mosaic virus 35S promoter sequence (SEQ ID NO:3); DsRed: nucleotide sequence of red fluorescent protein (SEQ ID NO:2); tNos: terminator sequence of carmine synthase gene (SEQ ID NO:4); prUbi: promoter sequence of maize ubiquitin gene (SEQ ID NO:5); PAT: nucleotide sequence of glufosinate acetyltransferase (SEQ ID NO:1); t35S: cauliflower mosaic virus 35S terminator sequence (SEQ ID NO:6); LB: left border).
[0121] The recombinant expression vector DBN100001 was transformed into E. coli T1 competent cells using a heat shock method. The heat shock conditions were as follows: 50 μL of E. coli T1 competent cells, 10 μL of plasmid DNA (recombinant expression vector DBN100001), incubated at 42°C for 30 seconds; cultured at 37°C with shaking for 1 hour (shaking at 200 rpm); then cultured on LB agar plates containing 50 mg / L kanamycin (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, pH adjusted to 7.5 with NaOH) at 37°C for 12 hours. White colonies were picked and cultured overnight at 37°C on LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 50 mg / L kanamycin, pH adjusted to 7.5 with NaOH). The plasmid was extracted using an alkaline method. After enzyme digestion and identification, positive clones were sequenced and identified, and the results showed that the PAT nucleotide sequence and DsRed nucleotide sequence were correctly inserted into the recombinant expression vector DBN100001.
[0122] 3. Transformation of Agrobacterium with recombinant expression vector
[0123] The correctly constructed recombinant expression vector DBN100001 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) using liquid nitrogen. The transformation conditions were as follows: 100 μL Agrobacterium LBA4404, 3 μL plasmid DNA (recombinant expression vector); incubated in liquid nitrogen for 10 minutes, followed by a 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated into LB tubes and cultured at 28°C and 200 rpm for 2 hours; then plated onto LB agar plates containing 50 mg / L rifampicin and 100 mg / L kanamycin until positive single colonies grew. Single colonies were picked, cultured, and their plasmids were extracted. Restriction digestion verification results showed that the recombinant expression vector DBN100001 had a completely correct structure.
[0124] Second embodiment: Obtaining transgenic maize plants
[0125] 1. Extraction of corn embryos
[0126] Sow the seeds of the maize variety Q319 in a greenhouse or field. After the maize plants have grown and been pollinated, harvest the female ears of maize 7-12 days later. Soak the ears in 75% (v / v) alcohol for 5 minutes and then remove the embryos. Select transparent embryos with a length of 0.6-1.2 mm for later use.
[0127] 2. Screening of callus induction culture media
[0128] The extracted maize embryos were inoculated onto five different callus induction media to induce callus formation. The embryos were cultured in the dark at 28°C for 10-14 days, preferably 14 days. The callus induction rate and morphology were recorded, and the results are shown in Table 2. Each callus induction medium was used in triplicate, with 100 embryos inoculated per replicate. The five different callus induction media were designed based on the basic callus induction medium CIM (MS salt 4.3 g / L, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1.5 mg / L, plant gel 3 g / L, pH 5.8), with different combinations of hormones of various types and concentrations designed. Specific information is shown in Table 1.
[0129] Table 1. Detailed information on five different callus induction culture media.
[0130]
[0131] Table 2. Experimental results of callus induction rate and callus morphology under five different callus induction culture media.
[0132]
[0133] The results in Tables 1 and 2 above indicate that the conventional callus induction medium CIM contains 1.5 mg / L of 2,4-D, but the induction efficiency is low, growth is slow, and embryogenicity is poor, failing to meet experimental requirements. Callus induction medium CIM-A, which is based on CIM with the addition of 2 mg / L of Dicamba, significantly improves callus induction rate, but callus growth remains slow, and the surface is smooth with few protrusions, making it unsuitable for preparing suspension cell lines. Callus induction medium CIM-B, which is based on CIM-A with the addition of 2.2 mg / L of Picloram, shows that... Although it cannot significantly increase the callus induction rate, it can improve the quality of callus induction, gradually forming embryogenic callus with surface protrusions after induction culture. The callus induction medium CIM-C is based on the callus induction medium CIM-B with the addition of 0.3 mg / L kinetin (KT). CIM-C significantly improves the callus induction rate, yielding a large amount of embryogenic callus suitable for preparing suspension cell lines after induction culture. The callus induction medium CIM-D is based on the callus induction medium CIM-C with the addition of 0.02 mg / L benzylaminopurine (BAP). The callus induction rate of CIM-D can reach as high as 97.66%, significantly higher than the other four treatments, and... Figure 3 As shown, the callus surface after induction culture has obvious protrusions, a fresh color, and a significantly increased growth rate, and can be used to prepare maize suspension cell lines.
[0134] Based on the screening results, the callus induction medium CIM-D (MS salt 4.3 g / L, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, Dicamba 2 mg / L, 2,4-D 1.5 mg / L, Picloram 2.2 mg / L, KT 0.3 mg / L, BAP 0.02 mg / L, plant gel 3 g / L, pH 5.8) was selected to induce the culture of maize embryos and obtain primary callus tissue.
[0135] In the callus induction medium of this embodiment, the concentrations of proline, hydrolyzed casein, aspartic acid, sucrose, Dicamba, 2,4-D, and Picloram are 0.1-5 g / L, 0.1-5 g / L, 0.01-5 g / L, 0.2-10 mg / L, 0.1-5 mg / L, 0.2-10 mg / L, 0.01-5 mg / L, and 0-5 mg / L. All of the above components can be arbitrarily combined within their concentration ranges, but the specific concentrations are as follows: CIM-D (MS salt 4.3 g / L, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, Dicamba 2 mg / L, 2,4-D 1.5 mg / L, Picloram. The preferred concentrations are 2.2 mg / L, KT 0.3 mg / L, BAP 0.02 mg / L, plant gel 3 g / L, and pH 5.8.
[0136] 3. Preparation of maize suspension cell lines
[0137] Initiation of the maize suspension cell line: The obtained primary callus tissue with obvious surface protrusions and bright yellow color was transferred to a sterile Erlenmeyer flask (150 mL) containing 75 mL of SUS-1 suspension culture medium (MS salt 4.3 g / L, MS vitamin, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 45 g / L, Dicamba 1.5 mg / L, 2,4-D 1 mg / L, pH 5.8). 5-8 primary callus tissues were inoculated into each Erlenmeyer flask. Under dark culture conditions at 28-30℃, the sealed Erlenmeyer flasks were placed on a constant temperature shaker with a rotation speed of 100-150 r / min for shaking culture.
[0138] In the SUS-1 suspension culture medium described in this embodiment, the MS salt can also be N6 salt (concentration of 3.95 g / L), the concentration of proline can be 0.1-5 g / L, the concentration of hydrolyzed casein can be 0.1-5 g / L, the concentration of sucrose can be 5-100 g / L, the concentration of Dicamba can be 0.2-10 mg / L, and the concentration of 2,4-D can be 0.1-5 mg / L. The above components can be combined arbitrarily within their concentration ranges, but the SUS-1 suspension culture medium (MS salt 4.3 g / L, MS vitamin, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 45 g / L, Dicamba 1.5 mg / L, 2,4-D 1 mg / L, pH 5.8) is preferred.
[0139] Obtaining the maize suspension cell line: After culturing the primary callus in suspension for 10-25 days, the first subculture is performed, preferably after 20 days. During subculture, browned and dead cells are removed, and vigorous, firm, and bright yellow new cells are retained in the original Erlenmeyer flask. While retaining half of the original SUS-1 suspension culture medium, new maize suspension culture medium SUS-1 is added to the 75 mL mark of the Erlenmeyer flask. The flask is then placed in the dark at 28-30℃ on a constant-temperature shaker at 100-150 rpm to obtain a large amount of cell tissue. Subculture is then performed weekly thereafter. Each subculture requires removing browned and dead cells, retaining new cells, and retaining half of the original SUS-1 suspension culture medium. New SUS-1 is added to the 75 mL mark of the Erlenmeyer flask. The flask is then placed in the dark at 28-30℃ on a constant-temperature shaker at 100-150 rpm to obtain a large amount of cell tissue. After the newly formed callus tissue is cultured in suspension for 35-45 days, preferably 40 days, multiple loosely structured suspension cell clusters (such as...) gradually form. Figure 4 (As shown), the suspended cell clusters were transferred to new sterile Erlenmeyer flasks (150 mL) containing 75 mL of SUS-2 suspension culture medium (MS salt 4.3 g / L, MS vitamins, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 30 g / L, Dicamba 1.5 mg / L, pH 5.8). 20-30 cells of the suspended cell clusters were inoculated into each flask. After dark incubation at 28-30°C, the sealed Erlenmeyer flasks were placed on a constant-temperature shaker at 100-150 rpm for 5-7 days. Multiple suspended cell clusters then formed a well-dispersed and rapidly proliferating maize suspension cell line (e.g., ...). Figure 5 As shown in the figure, the entire preparation cycle of the corn suspension cell line is 40-50 days.
[0140] Subculture of the maize suspension cell line: The prepared maize suspension cell line was subcultured once a week. Each time, the suspension cell line in each Erlenmeyer flask was transferred evenly to three new sterile Erlenmeyer flasks containing 75 mL of SUS-2 suspension culture medium. The sealed Erlenmeyer flasks were placed on a constant temperature shaker at 100-150 r / min under dark culture conditions at 28-30℃ to obtain geometrically expanded maize suspension cell lines for later use.
[0141] In the SUS-2 suspension culture medium of this embodiment, the MS salt can also be N6 salt (concentration of 3.95 g / L), the concentration of proline can be 0.1-5 g / L, the concentration of hydrolyzed casein can be 0.1-5 g / L, the concentration of sucrose can be 5-100 g / L, and the concentration of Dicamba can be 0.2-10 mg / L. The above components can be combined arbitrarily within their concentration ranges, but the SUS-2 suspension culture medium (MS salt 4.3 g / L, MS vitamin, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 30 g / L, Dicamba 1.5 mg / L, pH 5.8) is preferred.
[0142] 4. Agrobacterium-mediated genetic transformation of maize suspension cell lines
[0143] Pre-culture: The suspension cell clusters prepared from the aforementioned maize suspension cell line were inoculated onto PRE medium (MS salt 4.3 g / L, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.79 g / L, sucrose 30 g / L, 2,4-D 2 mg / L, plant gel 3 g / L, pH 5.8) and pre-cultured in the dark at 28-30℃ for 4-7 days, preferably 5 days. Pre-culture enhanced the viability of the maize suspension cell clusters, helping to overcome the tendency for browning and cell death.
[0144] In the PRE medium described in this embodiment, the concentration of proline can be 0.1-5 g / L, the concentration of hydrolyzed casein can be 0.1-5 g / L, the concentration of aspartic acid can be 0.1-5 g / L, the concentration of sucrose can be 5-100 g / L, and the concentration of 2,4-D can be 0.1-5 mg / L. The above components can be combined arbitrarily within their concentration ranges, but the PRE medium (MS salt 4.3 g / L, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.79 g / L, sucrose 30 g / L, 2,4-D 2 mg / L, plant gel 3 g / L, pH 5.8) is preferred.
[0145] Pretreatment: The pre-cultured maize suspension cell clusters were subjected to six different pretreatments before Agrobacterium infection: Pretreatment 1 (no pretreatment), Pretreatment 2 (heat treatment in a 42℃ water bath for 5 minutes), and Pretreatment 3 (heat treatment in a 60℃ oven for 5 minutes). Each pretreatment was repeated three times. The number of maize suspension cell clusters pretreated in each repetition is shown in Table 3. The maize suspension cell clusters after the three pretreatments were used for subsequent Agrobacterium infection. The maize suspension cell clusters used for subsequent Agrobacterium infection exhibited strong activity and were able to recover growth even when a defensive reaction occurred and reactive oxygen species were released during Agrobacterium infection.
[0146] Preparation of Agrobacterium tumefaciens bacterial suspension: A single colony of Agrobacterium tumefaciens containing DBN100001 was picked and streaked onto a solid YP culture plate containing 50 mg / L kanamycin (10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, 50 mg / L kanamycin, 15 g / L agar powder). The plate was incubated at 28°C in the dark for 2-3 days. The bacterial plaques from the solid YP culture plate were scraped off, and the plate was incubated for another day on a new solid YP culture plate. Colonies incubated for a total of 3-4 days were collected and suspended in 5 mL of liquid INF infection medium (MS salt 4.3 g / L, N6 vitamins, Dicamba 1.5 mg / L, proline 0.5 mg / L, sucrose 30 g / L, inositol 0.1 g / L, acetylsuccinone (AS) 50 mg / L, pH 5.4). The Agrobacterium tumefaciens bacterial suspension was mixed thoroughly, and the concentration was adjusted to OD. 660 =0.5-0.6.
[0147] Agrobacterium infection of corn suspension cell clusters: The three types of pretreated corn suspension cell clusters were immersed in Agrobacterium bacterial solution (20-30 mL) for 5-25 min, preferably 25 min; after infection, the Agrobacterium bacterial solution was aspirated, and then the three types of corn suspension cell clusters were transferred to filter paper and air-dried in a clean bench for 5-20 min.
[0148] Co-culturing of Agrobacterium and maize suspension cell clusters: The three types of maize suspension cell clusters, after infection and air-drying, were transferred to co-culture medium (MS salt 4.3 g / L, N6 vitamin, proline 0.5 g / L, sucrose 30 g / L, 2,4-D 2 mg / L, acetylsuccinone 50 mg / L, sorbitol 36 g / L, plant gel 3 g / L, pH 5.4) and incubated in the dark at 20-28℃ for at least 2 days, preferably 5 days. After 5 days of co-culture, the transient expression of the red fluorescent protein DsRed in the three types of co-cultured maize suspension cell clusters was observed using a fluorescence microscope. The experimental results are shown in Table 3 and... Figure 6 As shown.
[0149] Table 3. Experimental results of transient expression of DsRed protein in maize suspension cell clusters with three different pretreatments after co-culture.
[0150]
[0151] Table 3 shows that the transient expression rate of the red fluorescent protein DsRed obtained after pretreatment 3 (i.e., heat treatment in a 60℃ oven for 5 minutes) was significantly higher than that of the other two pretreatments, reaching as high as about 75%, indicating the highest Agrobacterium infection efficiency. Therefore, based on the screening results, the maize suspension cell clusters obtained after co-culture and pretreatment 3 were selected for the following experiments.
[0152] In the co-culture medium described in this embodiment, the concentration of proline can be 0.1-5 g / L, the concentration of sucrose can be 5-100 g / L, the concentration of 2,4-D can be 0.1-5 mg / L, the concentration of acetylsuccinone can be 10-100 g / L, and the concentration of sorbitol can be 5-60 g / L. The above components can be combined arbitrarily within their concentration ranges, but the co-culture medium (MS salt 4.3 g / L, N6 vitamin, proline 0.5 g / L, sucrose 30 g / L, 2,4-D 2 mg / L, acetylsuccinone 50 mg / L, sorbitol 36 g / L, plant gel 3 g / L, pH 5.4) is preferred.
[0153] Screening of maize suspension cell clusters: Maize suspension cell clusters obtained after co-culture and pretreatment 3 were sequentially transferred to screening media S1 and S2 for two screenings of diammonium phosphate tolerance. Screening medium S1 (MS salt 4.3 g / L, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, Dicamba 2.5 mg / L, Picloram 2.2 mg / L, plant gel 3 g / L, termethin 200 mg / L, KT 0.2 mg / L, pH 5.8) contained diammonium phosphate at concentrations of 3 mg / L and 5 mg / L, respectively. Screening medium S2 (MS salt 4.3 g / L, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, Dicamba 2.5 mg / L, Picloram 2.2 mg / L, plant gel 3 g / L, termethin 200 mg / L, KT 0.2 mg / L) contained diammonium phosphate at concentrations of 3 mg / L and 5 mg / L, respectively. The eight treatments (0.2 mg / L, pH 5.8) contained 5 mg / L, 10 mg / L, 50 mg / L and 100 mg / L of dipropionylphosphonate, respectively. The specific combination information of the eight treatments is shown in Table 4. The number of corn suspension cell clusters screened for each treatment is shown in Table 5.
[0154] Table 4. Specific combinations of eight different screening treatments for maize suspension cell clusters
[0155]
[0156] The screening process consisted of two stages: First, the maize suspension cell clusters obtained after co-culture and pretreatment 3 were transferred to screening medium S1 and cultured in the dark at 28-30℃ for 7-10 days, preferably 10 days. Then, the maize suspension cell clusters screened in screening medium S1 were transferred to screening medium S2 and cultured in the dark at 28-30℃ for 25-35 days, preferably 30 days. This two-stage screening resulted in selective growth of the transformed cells. Following the screening treatment combinations in Table 4, eight maize-resistant callus tissues were obtained after screening.
[0157] Plant regeneration from maize resistant callus: Eight types of maize resistant callus were transferred to regeneration medium containing N6 macroelements, B5 microelements, MS iron salts, N6 organic components, hydrolyzed casein 0.5 g / L, sucrose 30 g / L, KT 2.5 mg / L, inositol 0.1 g / L, plant gel 3 g / L, naphthaleneacetic acid (NAA) 0.25 mg / L, and BAP. The plants were cultured on MS medium (0.5 mg / L salt, 200 mg / L vitamins, pH 5.8) at 25-30℃ under light (light / dark ratio 16:8) for one month to differentiate. The resulting eight seedlings were then transferred to rooting medium (MS salt 2.15 g / L, MS vitamins, 15 g / L sucrose, 0.5 mg / L indole-3-acetic acid (IAA), 1 mg / L NAA, 3 g / L plant gel, pH 5.8) and cultured at 25-30℃ under light (light / dark ratio 16:8) until approximately 10 cm tall, then transferred to a greenhouse. In the greenhouse, the plants were cultured at 28℃ for 16 hours daily, followed by 8 hours at 20℃, resulting in eight transgenic plantlets.
[0158] In the above regeneration medium, the concentrations of N6 macroelements, B5 microelements, MS iron salts, and N6 organic components were all 1:1. The N6 macroelements included 2.83 g / L KNO3, 0.463 g / L (NH4)2SO4, 0.166 g / L CaCl2·2H2O, 0.185 g / L MgSO4·7H2O, and 0.4 g / L KH2PO4; the B5 microelements included 0.75 mg / L KI, 3.0 mg / L H3BO3, 10 mg / L MnSO4·4H2O, 2.0 mg / L ZnSO4·7H2O, 0.25 mg / L Na2MoSO4·2H2O, 0.025 mg / L CoCl2·6H2O, and 0.025 mg / L CuSO4·5H2O; and the MS iron salts included 37.3 mg / L Na2-EDTA and 27.8 mg / L... FeSO4·7H2O; N6 organic components include 2 mg / L glycine, 0.5 mg / L niacin, 1 mg / L vitamin B1 and 0.5 mg / L vitamin B6.
[0159] In the regeneration medium described in this embodiment, the concentration of hydrolyzed casein can be 0.1-5 g / L, the concentration of sucrose can be 5-100 g / L, the concentration of KT can be 0.01-5 mg / L, and the concentration of termethin can be 20-500 mg / L. The above components can be combined arbitrarily within their concentration ranges, but the regeneration medium (N6 macroelements, B5 microelements, MS iron salts, N6 organic components, hydrolyzed casein 0.5 g / L, sucrose 30 g / L, KT 2.5 mg / L, inositol 0.1 g / L, plant gel 3 g / L, naphthaleneacetic acid (NAA) 0.25 mg / L, BAP 0.5 mg / L, termethin 200 mg / L, pH 5.8) is preferred.
[0160] Third embodiment: Verification of transgenic maize plants using TaqMan.
[0161] Approximately 100 mg of leaves from each of eight transgenic maize plants were collected as samples. Genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit, and the copy number of the PAT gene was detected by Taqman probe-based quantitative PCR. Wild-type maize plants were used as controls, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.
[0162] The specific method for detecting the PAT gene copy number is as follows:
[0163] Step 11: Take 100 mg of leaves from 8 kinds of transgenic maize plants and wild-type maize plants respectively, grind them into homogenates in a mortar with liquid nitrogen, and take 3 replicates for each sample.
[0164] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.
[0165] Step 13: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);
[0166] Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;
[0167] Step 15: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type maize plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:
[0168] The following primers and probes are used to detect the PAT gene:
[0169] Primer 1: CAGTTGAGATTAGGCCAGCTACAG is shown in SEQ ID NO:7 in the sequence listing;
[0170] Primer 2: TTCACTGTAGACGTCTCAATGTAATGG is shown in SEQ ID NO:8 in the sequence listing;
[0171] Probe 1: CAGCTGATATGGCCGCGGTTTGTG is shown as SEQ ID NO:9 in the sequence listing;
[0172] The PCR reaction system is as follows:
[0173]
[0174] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.
[0175] The PCR reaction conditions are as follows:
[0176]
[0177] The data was analyzed using SDS2.3 software (Applied Biosystems).
[0178] Experimental results show that: Figure 7As shown in Table 5, the PAT gene can be integrated into the chromosome set of the tested maize plants, thus obtaining transgenic positive plants with stable expression. Screening treatments 1 and 5, 2 and 6, 3 and 7, and 4 and 8 all exhibit the same pattern: when the concentration of diammonium phosphate in screening medium S2 remains constant, the concentration of diammonium phosphate in screening medium S1 (3 mg / L and 5 mg / L) has no significant effect on the positive rate and transformation efficiency. The positive rate and transformation efficiency of screening treatments 1 and 5 are only about 5% and 0.3%, respectively, indicating that a concentration of 5 mg / L is optimal. The selection medium S2 for diammonium phosphate (DAP) was ineffective in screening resistant callus tissue to obtain positive plants. The positive rate and transformation efficiency of screening treatments 1-4 and 5-8 showed a gradually increasing trend, indicating that when the DAP concentration in selection medium S1 remained constant, both the positive rate and transformation efficiency increased with increasing DAP concentration in selection medium S2 (5 mg / L, 10 mg / L, 50 mg / L, and 100 mg / L). When the DAP concentration in selection medium S2 reached 100 mg / L, the positive rate reached approximately 90%, and the transformation efficiency reached approximately 30%. Therefore, overall, the DAP concentration in selection medium S1 had no significant effect on the positive rate and transformation efficiency, while the DAP concentration in selection medium S2 had a significant effect on both.
[0179] Table 5. Experimental results of transgenic plants obtained from maize suspension cell clusters under 8 different screening treatments.
[0180]
[0181] In Table 5, the number of screening cell clusters refers to the number of maize suspension cell clusters obtained after co-culture and pretreatment 3 for screening; the total number of resistant calluses refers to the number of resistant calluses with a red fluorescence volume ratio of not less than 50% obtained after two stages of screening treatment; the number of seedlings refers to the number of plants obtained from the regeneration of resistant callus tissue; the number of positive plants refers to the number of transgenic plants with integrated T-DNA regions in their genome obtained after Taqman detection; and the Taqman single copy number refers to the number of transgenic plants with one copy of T-DNA regions in their genome obtained after Taqman detection. The formulas for calculating seedling rate, positive rate, single copy rate, and transformation efficiency are shown below:
[0182] Seedling survival rate = Number of seedlings / Total number of resistant calluses × 100%
[0183] Positive rate = (Number of positive plants / Number of seedlings) × 100%
[0184] Single copy rate = (Number of TaqMan single copies / Number of positive plants) × 100%
[0185] Transformation efficiency = (Number of positive plants / Number of cell clusters treated with screening) × 100%
[0186] In the screening medium S1 of the second and third embodiments, the concentration of proline can be 0.1-5 g / L, the concentration of sucrose can be 5-100 g / L, the concentration of Dicamba can be 0.2-10 mg / L, the concentration of Picloram can be 0.2-10 mg / L, the concentration of termethin can be 20-500 mg / L, the concentration of KT can be 0.01-5 mg / L, and the concentration of diammonium phosphate can be 3-5 mg / L. The above components can be arbitrarily combined within their concentration ranges, but the screening medium S1 containing diammonium phosphate at a concentration of 3 mg / L or 5 mg / L (MS salt 4.3 g / L, MS vitamin, proline 1.38 g / L, sucrose 30 g / L, Dicamba 2.5 mg / L, Picloram 2.2 mg / L, plant gel 3 g / L, termethin 200 mg / L, KT 0.2 mg / L, pH 5.8) is preferred.
[0187] In the screening medium S2 of the second and third embodiments, the concentration of proline can be 0.1-5 g / L, the concentration of sucrose can be 5-100 g / L, the concentration of Dicamba can be 0.2-10 mg / L, the concentration of Picloram can be 0.2-10 mg / L, the concentration of termethin can be 20-500 mg / L, the concentration of KT can be 0.01-5 mg / L, and the concentration of diammonium phosphate can be 50-100 mg / L. The above components can be arbitrarily combined within their concentration ranges, but the screening medium S2 containing 100 mg / L diammonium phosphate (MS salt 4.3 g / L, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, Dicamba 2.5 mg / L, Picloram 2.2 mg / L, plant gel 3 g / L, termethin 200 mg / L, KT 0.2 mg / L, pH 5.8) is preferred.
[0188] In summary, the method for transforming maize according to this invention can mass-produce suspension cell lines under laboratory conditions, thus making maize genetic transformation unaffected by seasonality and meeting the need for stable transformation year-round. Furthermore, suspension cell lines can be rapidly obtained from maize immature embryos, shortening the experimental cycle from 6 months to 40-50 days. The operation is simple, convenient, and highly reproducible. Simultaneously, this invention is the first to rapidly obtain suspension cell lines from maize immature embryos, then use Agrobacterium-mediated transformation to generate seedlings. The transformation efficiency can reach approximately 30%, and the transgenic positivity rate can reach approximately 90%, with a single copy rate of approximately 50%. Because it significantly reduces the pressure on the supply of maize explants (immature embryos), it greatly reduces the manpower and material resources required for explant cultivation.
[0189] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A method for inducing maize callus tissue, characterized in that, The method involves inoculating maize immature embryos onto a callus induction medium to induce primary callus formation. The callus induction medium contains 2,4-D, dicamba, thiamethoxam, kinetin, and benzylaminopurine. The concentration of 2,4-D is 1.5 mg / L, the concentration of dicamba is 2 mg / L, the concentration of thiamethoxam is 2.2 mg / L, the concentration of kinetin is 0.3 mg / L, and the concentration of benzylaminopurine is 0.02 mg / L.
2. The method for inducing maize callus according to claim 1, characterized in that, The callus induction culture medium also contains a large amount of salt, trace amounts of salt, organic matter, proline, hydrolyzed casein, aspartic acid, and sucrose.
3. The method for inducing maize callus according to claim 2, characterized in that, The callus induction culture medium contains MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
4. A method for obtaining a maize suspension cell line, characterized in that, include: Maize embryos were inoculated onto a callus induction medium to induce primary callus formation. The callus induction medium contained 2,4-D, dicamba, thiamethoxam, kinetin, and benzylaminopurine. The concentration of 2,4-D was 1.5 mg / L, the concentration of dicamba was 2 mg / L, the concentration of thiamethoxam was 2.2 mg / L, the concentration of kinetin was 0.3 mg / L, and the concentration of benzylaminopurine was 0.02 mg / L. The primary callus tissue is cultured in suspension medium to obtain a maize suspension cell line, comprising: The nascent callus tissue is cultured and subcultured in a first suspension culture medium to obtain suspension cell clusters. The first suspension culture medium contains 0.2-10 mg / L of dicamba and 0.1-5 mg / L of 2,4-D. The suspended cell clusters are cultured in a second suspension culture medium to obtain a suspended cell line, the second suspension culture medium containing 0.2-10 mg / L of dicamba.
5. The method for obtaining a maize suspension cell line according to claim 4, characterized in that, The callus induction culture medium contains a large amount of salt, a trace amount of salt, organic matter, proline, hydrolyzed casein, aspartic acid and sucrose.
6. The method for obtaining a maize suspension cell line according to claim 5, characterized in that, The callus induction culture medium contains MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
7. The method for obtaining a maize suspension cell line according to any one of claims 4-6, characterized in that, include: The nascent callus tissue is cultured in a first suspension culture medium for 10-25 days, and then subcultured 2-3 times to obtain suspension cell clusters. The suspended cell clusters are cultured in a second suspension medium for 5-7 days to obtain a suspended cell line.
8. The method for obtaining a maize suspension cell line according to claim 7, characterized in that, The first suspension culture medium contains MS salts, MS vitamins, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 45 g / L, dicamba 1.5 mg / L and 2,4-D 1 mg / L.
9. The method for obtaining a maize suspension cell line according to claim 7, characterized in that, The second suspension culture medium contains MS salts, MS vitamins, 3 g / L proline, 1.5 g / L hydrolyzed casein, 30 g / L sucrose, and 1.5 mg / L dicamba.
10. A method for massively expanding maize suspension cell lines or saving maize explants, characterized in that, include: Maize embryos were inoculated onto a callus induction medium to induce primary callus formation. The callus induction medium contained 2,4-D, dicamba, thiamethoxam, kinetin, and benzylaminopurine. The concentration of 2,4-D was 1.5 mg / L, the concentration of dicamba was 2 mg / L, the concentration of thiamethoxam was 2.2 mg / L, the concentration of kinetin was 0.3 mg / L, and the concentration of benzylaminopurine was 0.02 mg / L. The primary callus tissue is cultured in suspension medium to obtain a maize suspension cell line, including: The nascent callus tissue is cultured and subcultured in a first suspension culture medium to obtain suspension cell clusters. The first suspension culture medium contains 0.2-10 mg / L of dicamba and 0.1-5 mg / L of 2,4-D. The suspended cell clusters are cultured in a second suspension culture medium to obtain a suspended cell line, wherein the second suspension culture medium contains 0.2-10 mg / L of dicamba. The corn suspension cell line was subcultured in a second suspension culture medium to expand the corn suspension cell line, the second suspension culture medium containing 0.2-10 mg / L of dicamba.
11. The method for massively expanding maize suspension cell lines or saving maize explants according to claim 10, characterized in that, The callus induction culture medium contains a large amount of salt, a trace amount of salt, organic matter, proline, hydrolyzed casein, aspartic acid and sucrose.
12. The method for massively expanding maize suspension cell lines or saving maize explants according to claim 11, characterized in that, The callus induction culture medium contains MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
13. The method for massively expanding maize suspension cell lines or saving maize explants according to claim 10, characterized in that, The second suspension culture medium contains MS salts, MS vitamins, 3 g / L proline, 1.5 g / L hydrolyzed casein, 30 g / L sucrose, and 1.5 mg / L dicamba.
14. A method for improving the infection efficiency of Agrobacterium, characterized in that, include: Maize embryos were inoculated onto a callus induction medium to induce primary callus formation. The callus induction medium contained 2,4-D, dicamba, thiamethoxam, kinetin, and benzylaminopurine. The concentration of 2,4-D was 1.5 mg / L, the concentration of dicamba was 2 mg / L, the concentration of thiamethoxam was 2.2 mg / L, the concentration of kinetin was 0.3 mg / L, and the concentration of benzylaminopurine was 0.02 mg / L. The primary callus tissue is cultured and subcultured in a first suspension culture medium to obtain corn suspension cell clusters. The first suspension culture medium contains 0.2-10 mg / L of dicamba and 0.1-5 mg / L of 2,4-D. The corn suspension cell clusters are pre-cultured to obtain pre-cultured corn suspension cell clusters; The pre-cultured corn suspension cell clusters are pretreated to obtain pretreated corn suspension cell clusters. Agrobacterium infects the pretreated corn suspension cell clusters. The pretreatment includes heat shock treatment, the heat shock treatment time is no more than 8 minutes, and the heat shock treatment temperature is 30-60℃. The infected corn suspension cell clusters were co-cultured with the Agrobacterium to obtain co-cultured corn suspension cell clusters.
15. The method for improving Agrobacterium infection efficiency according to claim 14, characterized in that, The callus induction culture medium contains a large amount of salt, a small amount of salt, organic matter, proline, hydrolyzed casein, aspartic acid, sucrose and 2,4-D.
16. The method for improving Agrobacterium infection efficiency according to claim 15, characterized in that, The callus induction culture medium contains MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
17. The method for improving Agrobacterium infection efficiency according to any one of claims 14-16, characterized in that, The nascent callus tissue is cultured in suspension in the first suspension culture medium for 10-25 days, and then subcultured 2-3 times to obtain corn suspension cell clusters.
18. The method for improving Agrobacterium infection efficiency according to claim 17, characterized in that, The first suspension culture medium contains MS salts, MS vitamins, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 45 g / L, dicamba 1.5 mg / L and 2,4-D 1 mg / L.
19. The method for improving Agrobacterium infection efficiency according to claim 14, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
20. The method for improving Agrobacterium infection efficiency according to claim 15, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
21. The method for improving Agrobacterium infection efficiency according to claim 16, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
22. The method for improving Agrobacterium infection efficiency according to claim 17, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
23. The method for improving Agrobacterium infection efficiency according to claim 18, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
24. The method for improving Agrobacterium infection efficiency according to any one of claims 19-23, characterized in that, The heat shock treatment is performed in an oven at 60°C for 5 minutes.
25. The method for improving Agrobacterium infection efficiency according to claim 14, characterized in that, The pretreatment also includes ultrasonic treatment.
26. The method for improving Agrobacterium infection efficiency according to claim 15, characterized in that, The pretreatment also includes ultrasonic treatment.
27. The method for improving Agrobacterium infection efficiency according to claim 16, characterized in that, The pretreatment also includes ultrasonic treatment.
28. The method for improving Agrobacterium infection efficiency according to claim 17, characterized in that, The pretreatment also includes ultrasonic treatment.
29. The method for improving Agrobacterium infection efficiency according to claim 18, characterized in that, The pretreatment also includes ultrasonic treatment.
30. A method for effectively screening maize resistant callus, characterized in that, include: Maize embryos were inoculated onto a callus induction medium to induce primary callus formation. The callus induction medium contained 2,4-D, dicamba, thiamethoxam, kinetin, and benzylaminopurine. The concentration of 2,4-D was 1.5 mg / L, the concentration of dicamba was 2 mg / L, the concentration of thiamethoxam was 2.2 mg / L, the concentration of kinetin was 0.3 mg / L, and the concentration of benzylaminopurine was 0.02 mg / L. The primary callus tissue is cultured and subcultured in a first suspension culture medium to obtain corn suspension cell clusters. The first suspension culture medium contains 0.2-10 mg / L of dicamba and 0.1-5 mg / L of 2,4-D. The corn suspension cell clusters are pre-cultured to obtain pre-cultured corn suspension cell clusters; The pre-cultured corn suspension cell clusters are pretreated to obtain pretreated corn suspension cell clusters. Agrobacterium infects the pretreated corn suspension cell clusters. The pretreatment includes heat shock treatment, the heat shock treatment time is no more than 8 minutes, and the heat shock treatment temperature is 30-60℃. The infected corn suspension cell clusters were co-cultured with the Agrobacterium to obtain the co-cultured corn suspension cell clusters; The co-cultured maize suspension cell clusters were cultured on a screening medium containing a selector, and resistant callus tissue was selected.
31. The method for effectively screening maize resistant callus according to claim 30, characterized in that, The callus induction culture medium contains a large amount of salt, a trace amount of salt, organic matter, proline, hydrolyzed casein, aspartic acid and sucrose.
32. The method for effectively screening maize resistant callus according to claim 31, characterized in that, The callus induction culture medium contains MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
33. The method for effectively screening maize resistant callus according to any one of claims 30-32, characterized in that, The nascent callus tissue is cultured in suspension in the first suspension culture medium for 10-25 days, and then subcultured 2-3 times to obtain corn suspension cell clusters.
34. The method for effectively screening maize resistant callus according to claim 33, characterized in that, The first suspension culture medium contains MS salts, MS vitamins, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 45 g / L, dicamba 1.5 mg / L and 2,4-D 1 mg / L.
35. The method for effectively screening maize resistant callus according to claim 30, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
36. The method for effectively screening maize resistant callus according to claim 31, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
37. The method for effectively screening maize resistant callus according to claim 32, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
38. The method for effectively screening maize resistant callus according to claim 33, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
39. The method for effectively screening maize resistant callus according to claim 34, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
40. The method for effectively screening maize resistant callus according to any one of claims 35-39, characterized in that, The heat shock treatment is performed in an oven at 60°C for 5 minutes.
41. The method for effectively screening maize resistant callus according to claim 30, characterized in that, The pretreatment also includes ultrasonic treatment.
42. The method for effectively screening maize resistant callus according to claim 31, characterized in that, The pretreatment also includes ultrasonic treatment.
43. The method for effectively screening maize resistant callus according to claim 32, characterized in that, The pretreatment also includes ultrasonic treatment.
44. The method for effectively screening maize resistant callus according to claim 33, characterized in that, The pretreatment also includes ultrasonic treatment.
45. The method for effectively screening maize resistant callus according to claim 34, characterized in that, The pretreatment also includes ultrasonic treatment.
46. The method for effectively screening maize resistant callus according to claim 40, characterized in that, The pretreatment also includes ultrasonic treatment.
47. The method for effectively screening maize resistant callus according to claim 30, characterized in that, The selector is an antibiotic, herbicide, or sugar.
48. The method for effectively screening maize resistant callus according to claim 31, characterized in that, The selector is an antibiotic, herbicide, or sugar.
49. The method for effectively screening maize resistant callus according to claim 32, characterized in that, The selector is an antibiotic, herbicide, or sugar.
50. The method for effectively screening maize resistant callus according to claim 33, characterized in that, The selector is an antibiotic, herbicide, or sugar.
51. The method for effectively screening maize resistant callus according to claim 34, characterized in that, The selector is an antibiotic, herbicide, or sugar.
52. The method for effectively screening maize resistant callus according to claim 30, characterized in that, include: The co-cultured maize suspension cell clusters were cultured on a first screening medium containing diammonium phosphate, and then on a second screening medium containing diammonium phosphate to select resistant callus tissue.
53. The method for effectively screening maize resistant callus according to claim 52, characterized in that, The second screening medium included MS salts, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 100 mg / L.
54. The method for effectively screening maize resistant callus according to claim 52, characterized in that, The first screening medium included MS salts, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 3 mg / L.
55. The method for effectively screening maize resistant callus according to claim 52, characterized in that, The first screening medium included MS salts, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 5 mg / L.
56. A method for converting corn, characterized in that, include: Maize embryos were inoculated onto a callus induction medium to induce primary callus formation. The callus induction medium contained 2,4-D, dicamba, thiamethoxam, kinetin, and benzylaminopurine. The concentration of 2,4-D was 1.5 mg / L, the concentration of dicamba was 2 mg / L, the concentration of thiamethoxam was 2.2 mg / L, the concentration of kinetin was 0.3 mg / L, and the concentration of benzylaminopurine was 0.02 mg / L. The primary callus tissue is cultured and subcultured in a first suspension culture medium to obtain corn suspension cell clusters. The first suspension culture medium contains 0.2-10 mg / L of dicamba and 0.1-5 mg / L of 2,4-D. The corn suspension cell clusters are pre-cultured to obtain pre-cultured corn suspension cell clusters; Agrobacterium infection of the corn suspension cell clusters; The infected corn suspension cell clusters were co-cultured with the Agrobacterium to obtain co-cultured corn suspension cell clusters.
57. The method for converting corn according to claim 56, characterized in that, The callus induction culture medium contains a large amount of salt, a trace amount of salt, organic matter, proline, hydrolyzed casein, aspartic acid and sucrose.
58. The method for converting corn according to claim 57, characterized in that, The callus induction culture medium contains MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
59. The method for converting corn according to any one of claims 56-58, characterized in that, The nascent callus tissue is cultured in suspension in the first suspension culture medium for 10-25 days, and then subcultured 2-3 times to obtain corn suspension cell clusters.
60. The method for converting corn according to claim 59, characterized in that, The first suspension culture medium contains MS salts, MS vitamins, proline 3 g / L, hydrolyzed casein 1.5 g / L, sucrose 45 g / L, dicamba 1.5 mg / L and 2,4-D 1 mg / L.
61. The method for converting corn according to claim 56, characterized in that, The Agrobacterium-infected corn suspension cell clusters are corn suspension cell clusters that have undergone Agrobacterium-infected pretreatment, and the pretreatment includes heat shock treatment.
62. The method for converting corn according to claim 57, characterized in that, The Agrobacterium-infected corn suspension cell clusters are corn suspension cell clusters that have undergone Agrobacterium-infected pretreatment, and the pretreatment includes heat shock treatment.
63. The method for converting corn according to claim 58, characterized in that, The Agrobacterium-infected corn suspension cell clusters are corn suspension cell clusters that have undergone Agrobacterium-infected pretreatment, and the pretreatment includes heat shock treatment.
64. The method for converting corn according to claim 59, characterized in that, The Agrobacterium-infected corn suspension cell clusters are corn suspension cell clusters that have undergone Agrobacterium-infected pretreatment, and the pretreatment includes heat shock treatment.
65. The method for converting corn according to claim 60, characterized in that, The Agrobacterium-infected corn suspension cell clusters are corn suspension cell clusters that have undergone Agrobacterium-infected pretreatment, and the pretreatment includes heat shock treatment.
66. The method for converting corn according to any one of claims 61-65, characterized in that, The heat shock treatment time shall not exceed 8 minutes.
67. The method for converting corn according to any one of claims 61-65, characterized in that, The temperature of the heat shock treatment is 30-60℃.
68. The method for converting corn according to claim 67, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
69. The method for converting corn according to claim 68, characterized in that, The heat shock treatment is performed in an oven at 60°C for 5 minutes.
70. The method for converting corn according to claim 56, characterized in that, The pretreatment also includes ultrasonic treatment.
71. The method for converting corn according to claim 57, characterized in that, The pretreatment also includes ultrasonic treatment.
72. The method for converting corn according to claim 58, characterized in that, The pretreatment also includes ultrasonic treatment.
73. The method for converting corn according to claim 59, characterized in that, The pretreatment also includes ultrasonic treatment.
74. The method for converting corn according to claim 60, characterized in that, The pretreatment also includes ultrasonic treatment.
75. A method for producing maize plants with stable transformation, characterized in that, include: Maize embryos were inoculated onto a callus induction medium to induce primary callus formation. The callus induction medium contained 2,4-D, dicamba, thiamethoxam, kinetin, and benzylaminopurine. The concentration of 2,4-D was 1.5 mg / L, the concentration of dicamba was 2 mg / L, the concentration of thiamethoxam was 2.2 mg / L, the concentration of kinetin was 0.3 mg / L, and the concentration of benzylaminopurine was 0.02 mg / L. The primary callus tissue is cultured and subcultured in a first suspension culture medium to obtain corn suspension cell clusters. The first suspension culture medium contains 0.2-10 mg / L of dicamba and 0.1-5 mg / L of 2,4-D. The corn suspension cell clusters are pre-cultured to obtain pre-cultured corn suspension cell clusters; Agrobacterium infection of the corn suspension cell clusters; The infected corn suspension cell clusters were co-cultured with the Agrobacterium; Resistant callus tissue was cultured and selected on a culture medium containing a selector. The resistant callus regeneration is a maize plant.
76. The method for producing stable-transformation maize plants according to claim 75, characterized in that, The callus induction culture medium contains a large amount of salt, a trace amount of salt, organic matter, proline, hydrolyzed casein, aspartic acid and sucrose.
77. The method for producing stable-transformation maize plants according to claim 76, characterized in that, The callus induction culture medium contains MS salt, N6 vitamin, proline 0.5 g / L, hydrolyzed casein 0.1 g / L, aspartic acid 0.2 g / L, sucrose 30 g / L, 2,4-D 1.5 mg / L, dicamba 2 mg / L, chlorhexidine 2.2 mg / L, kinetin 0.3 mg / L, and benzylaminopurine 0.02 mg / L.
78. The method for producing stable-transformation maize plants according to any one of claims 75-77, characterized in that, The Agrobacterium-infected corn suspension cell clusters are corn suspension cell clusters that have undergone Agrobacterium-infected pretreatment, and the pretreatment includes heat shock treatment.
79. The method for producing stable-transformation maize plants according to claim 78, characterized in that, The heat shock treatment time shall not exceed 8 minutes.
80. The method for producing stable-transformation maize plants according to claim 78, characterized in that, The temperature of the heat shock treatment is 30-60℃.
81. The method for producing stable-transformation maize plants according to claim 80, characterized in that, The temperature of the heat shock treatment is 42°C or 60°C.
82. The method for producing stable-transformation maize plants according to claim 81, characterized in that, The heat shock treatment is performed in an oven at 60°C for 5 minutes.
83. The method for producing stable-transformation maize plants according to any one of claims 75-77, characterized in that, The pretreatment also includes ultrasonic treatment.
84. The method for producing stable-transformation maize plants according to any one of claims 75-77, characterized in that, The selector is an antibiotic, herbicide, or sugar.
85. The method for producing stable-transformation maize plants according to claim 75, characterized in that, The process of culturing and selecting resistant callus on a culture medium containing a selector involves culturing co-cultured maize suspension cell clusters on a first selection medium containing diammonium phosphate, followed by culturing on a second selection medium containing diammonium phosphate to select resistant callus.
86. The method for producing stable-transformation maize plants according to claim 85, characterized in that, The second screening medium included MS salts, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 100 mg / L.
87. The method for producing stable-transformation maize plants according to claim 85, characterized in that, The first screening medium included MS salts, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 3 mg / L.
88. The method for producing stable-transformation maize plants according to claim 85, characterized in that, The first screening medium included MS salts, MS vitamins, proline 1.38 g / L, sucrose 30 g / L, dicamba 2.5 mg / L, cyprodin 2.2 mg / L, termethin 200 mg / L, kinetin 0.2 mg / L, and diammonium phosphate 5 mg / L.
Citation Information
Patent Citations
Method for inducing somatic embryos of corn
CN102172217A
Method for transforming exogenous gene by using maize coleoptile joint induced calluses
CN103194485A
Maize transformation method
CN103409460A
Efficient transgenic method for maize skeleton inbred lines
CN104745622A
Fertile, transgenic maize plants and methods for their production
WO1995006128A2