Canine leptospira, icterohaemorrhagia leptospira, canine coronavirus triple inactivated vaccine

Abstract

The application discloses a canine leptospira, icterohaemorrhagia leptospira and canine coronavirus triple inactivated vaccine. The application is prepared by adding adjuvant after inactivation of the canine leptospira, icterohaemorrhagia leptospira and canine coronavirus epidemic strain separated in China. The application relates to a pathogen separation culture, identification, inactivation method, production process, vaccine storage and immunization method. The canine triple inactivated vaccine is used for preventing canine leptospira disease, icterohaemorrhagia leptospira disease and canine coronavirus disease, and high antibodies can be generated after immunization of the canine, and the high antibodies have a good protective effect on virulent attack. The leptospira is a zoonosis, the canine is a companion animal of human, and the pet canine is in close contact with human, so the triple inactivated vaccine has good social benefits and important public health significance.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological products. The present application relates to the development and application of a triple inactivated vaccine of canine leptospira, icterohaemorrhagia leptospira and canine coronavirus disease. BACKGROUND

[0002] Canine leptospirosis is a zoonosis caused by pathogenic leptospira. The main serotypes that cause the disease in dogs are L. canicola and L. icterohaemorrhagia. After infection, the main symptoms in dogs are high fever, jaundice, hemorrhagic diathesis, abortion, etc. The disease mainly occurs in tropical and subtropical regions. Leptospira can infect dogs of all ages, with a latent period of 4-14 days. Acute cases can occur suddenly, with anorexia, vomiting, elevated body temperature, depression, dyspnea, jaundice, and hemorrhage. Generally, within 3 days of onset, the body collapses and dies. Subacute symptoms are characterized by fever, vomiting, anorexia, dehydration, and jaundice. The mucosa of sick dogs may have irregular hemorrhagic spots and jaundice. Chronic symptoms are mainly manifested as acute or subacute symptoms, mainly affecting the liver, kidneys, and gastrointestinal tract. Leptospirosis is one of the most widely prevalent zoonotic infectious diseases in the world. Canine animals are susceptible to leptospira, and domestic dogs live closely with humans and livestock. Therefore, it is of great public health significance to diagnose and prevent the infection and transmission of leptospira in humans and livestock.

[0003] Canine coronavirus disease is a viral infectious disease of dogs caused by canine coronavirus (CCV). Canine coronavirus is round or oval, with a diameter of 80-100 nm, and is characterized by long spicules of about 20 nm on the surface. The canine coronavirus genome is a single-stranded RNA virus, which uses a unique nested transcription during replication. Due to the high mismatch rate and recombination rate of the genome, there are many variant strains of coronavirus. Canine coronavirus can infect all breeds and ages of dogs (with severe damage to puppies), and is a frequently occurring, acute gastrointestinal infectious disease of dogs. The main source of infection is sick dogs, and the main route of transmission is through contaminated feed and water, and infection through the digestive tract. The disease has a rapid onset, rapid transmission, short course, and high mortality rate, and often mixed infection with canine parvovirus or rotavirus, which exacerbates the disease, resulting in rapid death due to acute diarrhea and vomiting. Clinically, the main symptoms are frequent vomiting, diarrhea, depression, and anorexia, which are important viral infectious diseases that harm the dog industry. Canine coronavirus disease is distributed and prevalent worldwide, and coronavirus is also an important pathogen of canine infectious respiratory syndrome (CIRD). Therefore, it is of great significance to prevent canine coronavirus disease.

[0004] The canine triple inactivated vaccine is prepared by using the canine leptospira, the leptospira icterohaemorrhagiae and the canine coronavirus epidemic strain isolated in China, through the culture of the strains, the inactivation method and the production process research.

[0005] At present, there are researches and products about canine leptospira vaccine at home and abroad, but there is no triple inactivated vaccine of canine leptospira, leptospira icterohaemorrhagiae and canine coronavirus. In order to achieve the purpose of preventing and controlling leptospira disease and canine coronavirus disease at one time, the canine triple inactivated vaccine has good market prospect and application value. SUMMARY

[0006] With the continuous improvement of people's living standards, the number of dogs is increasing, and pet dogs enter thousands of families. Dogs, as human companion animals, are in close contact with humans. Dogs are susceptible to leptospira and can easily carry and transmit leptospira pathogens, and can also transmit to susceptible populations contacted, so the prevention of leptospira in dogs has important public health significance. Canine coronavirus is widely distributed and susceptible to all breeds and ages of dogs, with a high incidence. The canine triple inactivated vaccine developed by the application can effectively prevent and control the occurrence and prevalence of canine leptospira disease, leptospira icterohaemorrhagiae disease and canine coronavirus disease.

[0007] In order to achieve the above purpose, the application adopts the following technical scheme:

[0008] The application provides a canine triple inactivated vaccine, which comprises inactivated canine leptospira, leptospira icterohaemorrhagiae and canine coronavirus, and a pharmaceutically acceptable adjuvant.

[0009] The ratio of the canine leptospira, the leptospira icterohaemorrhagiae, the canine coronavirus and the adjuvant is 3:3:3:1. Preferably, the adjuvant is 605 adjuvant.

[0010] The preservation number of the canine leptospira is CGMCC NO:18505, the preservation number of the leptospira icterohaemorrhagiae is CGMCC NO:18506, and / or the preservation number of the canine coronavirus is CGMCC NO:18507.

[0011] The application provides a production method of the canine triple inactivated vaccine, and the production process flow comprises the following steps: strain isolation and identification, culture, determination of titer, toxin collection, inactivation, safety and potency test, proportioning of vaccine, addition of adjuvant, subpackaging, product test, labeling and packaging.

[0012] Culture method of canine leptospira and icterohaemorrhagia leptospira is established. Improved Korthof culture medium is used for subculture, culture temperature is 28-30 DEG C, culture time is 7-14d, and live bacteria count per milliliter can reach 10 9 / mL under 400 times observation and counting of dark field microscope.

[0013] Canine coronavirus is cultured and subcultured by using MDCK cell, monolayer cell is inoculated, and virus titer per milliliter can reach 10 6.8 TCID 50 .Biological and molecular biological identification of isolated strains of canine leptospira and icterohaemorrhagia leptospira.

[0014] Biological and molecular biological identification of isolated strains of canine coronavirus.

[0015] Leptospira bacteria are inactivated by adding 0.1M BEI in the proportion of 100:2.5 (V / V) at room temperature (about 25 DEG C) for 30h.

[0016] Canine coronavirus is inactivated by adding 0.1M BEI in the proportion of 100:2.0 (V / V) at room temperature (about 25 DEG C) for 30h.

[0017] Proportion of components of triple inactivated vaccine is 3:3:3:1 for icterohaemorrhagia leptospira, canine leptospira, canine virus and 605 adjuvant.

[0018] Triple inactivated vaccine is aseptically packed, and each bottle is 2.0mL. Triple inactivated vaccine is stored at 2-8 DEG C in dark, and storage period is 24 months.

[0019] The application provides application of the canine triple inactivated vaccine or the canine triple inactivated vaccine obtained by the production method of the canine triple inactivated vaccine in preparation of a medicine for preventing and / or treating canine leptospira disease, icterohaemorrhagia leptospira disease and / or canine coronavirus disease, and the vaccine can be used for various types of dogs, including pregnant dogs.

[0020] After immunization of the triple inactivated vaccine, 5 / 5 immunized dogs are protected by using the same strong virus attack.

[0021] Immunization procedure and immunization dose of the triple inactivated vaccine are as follows: 6-8 week old dogs are immunized for the first time, 2.0mL is injected subcutaneously in the neck each time, immunization is carried out twice with an interval of 2-3 weeks, and immunization period is one year, and the dogs are immunized once a year thereafter.

[0022] The application provides an isolated nucleic acid, and the nucleotide sequence is shown in SEQ ID NO:1, 2 or 3.

[0023] The application relates to biological material resource information.

[0024] The canine leptospira, jaundice hemorrhage leptospira, and canine coronavirus strains used in this vaccine production were independently isolated, identified, and preserved by our company. On September 18, 2019, they were deposited with the China General Microbiological Culture Collection Center of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, with accession numbers CGMCC NO:18505, CGMCC NO:18506, and CGMCC NO:18507, respectively.

[0025] Advantages of this invention:

[0026] 1. Highly targeted: The canine triple inactivated vaccine can simultaneously prevent canine leptospirosis, icteric hemorrhagic leptospirosis, and canine coronavirus disease.

[0027] 2. Simple production process: Each component of the canine trivalent inactivated vaccine can be produced separately, with low equipment requirements, making it suitable for large-scale industrial production.

[0028] 3. The production cost of the aforementioned canine trivalent inactivated vaccine is low, which is conducive to its widespread application in my country. Attached Figure Description

[0029] Figure 1 Electrophoretic pattern of Leptospira OmpLl gene amplification.

[0030] Figure 2 Gel electrophoresis pattern of canine coronavirus RNA. Detailed Implementation

[0031] 1. Isolation and identification of canine leptospira and jaundice-hemorrhage leptospira.

[0032] (1) Collection, culture and morphological identification:

[0033] Fresh canine urine, resembling that of infected dogs, was collected from dog farms in Hebei and Beijing using sterile containers. After being filtered through a 0.45 μm microporous membrane for sterilization, the urine was aseptically added to modified Korthof medium and incubated at 28–30 °C. The culture medium was examined under a dark-field microscope at 5, 7, 10, and 14 days. Leptospira were observed growing and then transferred to fresh modified Korthof medium for further culture. Further identification was performed after the leptospira showed good growth.

[0034] Based on the culture characteristics and morphological identification of the isolated strain, the isolate exhibited typical leptospiral morphology, with uniform refractive index. Both ends or one end were bent into a hook shape, demonstrating active motility and rotation along the long axis of the cell. The central portion of the cell was relatively rigid, while the ends were more flexible and exhibited torsional movement. Under a dark-field microscope, the cell resembled a string of shiny, fine beads.

[0035] Staining identification: all were Gram staining negative.

[0036] Typical C, S or L forms of leptospira were observed by Gram and silver staining.

[0037] Serum agglutination test was performed with jaundice hemorrhagic, canine, influenza typhus, autumn fever and Pomona type leptospira standard dog serum, respectively. The Hebei isolate showed obvious agglutination reaction with jaundice hemorrhagic type leptospira and negative reaction with other types of leptospira. The Beijing isolate showed obvious agglutination reaction with canine type leptospira and negative reaction with other types of leptospira.

[0038] (2) Molecular biology identification:

[0039] According to the published OmpLl gene sequence of leptospira, a pair of primers was designed and synthesized by Beijing Shengong, P1: 5'-AAGGAGAATTCAATGATCCGTAACA-3', P2: 5'-TTGATTGAATTCTTAGAGTTGGTGTTTATA-3'. The amplified fragment size was 961 bp (as shown in Figure 1

[0040] The culture solution of isolated and cultured leptospira was taken, centrifuged at 13000 r / min at 4℃ for 15 min, the bacterial body was collected, and the precipitate was suspended in distilled water, washed twice, and then the DNA template was extracted by bacterial genome DNA extraction kit for PCR amplification. The PCR amplification conditions were as follows: heating at 98℃ for 300 s, denaturation at 96℃ for 60 s, annealing at 55℃ for 30 s, extension at 72℃ for 60 s, cycling for 35 times, and finally extending at 72℃ for 10 min. The PCR amplification product was electrophoresed by 1% agarose gel, and observed in the gel imaging instrument. The results were all consistent with the expected bands.

[0041] Sequence determination and analysis: the amplified PCR product was sequenced by Shengong, the sequenced nucleotide sequence was analyzed by DNAstar software, and compared with the published same leptospira nucleotide sequence. The Hebei isolate had high homology with jaundice hemorrhagic type leptospira, with homology of 99%.

[0042] The Beijing isolate had high homology with canine type leptospira, with homology of 96%, and the homology between the two isolates was 87.3%.

[0043] Nucleotide sequence of Hebei strain jaundice hemorrhagic type leptospira (SEQ ID NO: 1)

[0044] Nucleotide sequence of Beijing strain canine type leptospira (SEQ ID NO: 2)

[0045] ​The results showed that the isolate from Hebei was identified as Leptospira jaundice-hemorrhage type in dogs, while the isolate from Beijing was identified as Leptospira canis type.

[0046] (3) Leptospira toxicity:

[0047] ① Virulence to guinea pigs: Nine guinea pigs weighing 120–180g were divided into three groups. Two groups were subcutaneously injected with 2.0mL of isolated *Leptospira canis* strain and *Leptospira ictericis* strain, respectively, after 7–14 days of culture (90–100 viable bacteria per field of view under a microscope at 400x magnification). The other three guinea pigs were injected with 2.0mL of physiological saline as a control. The guinea pigs were fed different diets and observed for 10 days after injection. Results showed that all challenged guinea pigs became ill and died during the observation period, while the control group survived.

[0048] ② Virulence test in dogs: Fifteen 6-8 week old Leptospira antibody-negative dogs were divided into three groups of five dogs each. Groups 1 and 2 were challenged with two isolated Leptospira strains, with each dog receiving a subcutaneous injection of 6.0 mL in the neck (under a microscope at 400x magnification, the viable bacterial count was 90-100 bacteria per field of view). Group 3 served as the control group and was treated with physiological saline. After 21 days of observation following challenge, 5 out of 5 dogs in both challenge groups developed the disease, with 4 out of 5 and 5 out of 5 dogs dying, respectively. All dogs in the control group survived. The results indicate that both canine Leptospira and jaundice-hemorrhagic Leptospira are highly virulent in dogs.

[0049] ③ Immunogenicity test of Leptospira ictericis in dogs: Ten 6-8 week old dogs that were negative for Leptospira antibodies were divided into two groups of five. One group was immunized with an inactivated vaccine prepared from a culture of Leptospira ictericis cultured for 7-14 days. Each dog was injected with 0.5 mL (before inactivation, the bacterial count was observed at 400x magnification under a microscope, with 90-100 bacteria per field of view; the vaccine was prepared by adding 605 adjuvant at a 9:1 ratio of antigen to adjuvant). The other five control dogs were injected simultaneously with physiological saline. A second injection was given 21 days later. 21 days after the second immunization, all dogs were challenged with 6.0 mL of a culture of Leptospira ictericis cultured for 7-14 days (the bacterial count was observed at 400x magnification under a microscope, with 90-100 bacteria per field of view). The dogs were observed for 21 days after challenge.

[0050] Results: During the observation period, none of the immunized dogs showed clinical symptoms of leptospirosis. In the control group, all five dogs showed clinical symptoms of leptospirosis 3 to 5 days after infection and died within 5 to 8 days after infection. Autopsy revealed typical leptospirosis pathological changes.

[0051] (4) Canine leptospira immunogenicity test: 10 6-8 weeks old leptospira antibody negative dogs were divided into two groups, 5 in each group. One group was immunized with inactivated vaccine prepared from 7-14 day cultured leptospira culture, 0.5 mL per dog (90-100 bacteria per visual field under microscope at 400 times magnification before inactivation; single dose vaccine was prepared by adding 605 adjuvant at 9:1 ratio of antigen to adjuvant). The other 5 control dogs were injected with normal saline instead. The second injection was given 21 days later. 21 days after the second injection, all dogs were challenged with 6 mL of 7-14 day cultured canine leptospira culture (90-100 bacteria per visual field under microscope at 400 times magnification). The observation lasted for 21 days after challenge.

[0052] Results: The immunized dogs were normal during the observation period and showed no leptospira symptoms. The control dogs showed leptospira clinical symptoms 3-6 days after challenge and died within 5-9 days after challenge. Autopsy showed typical leptospira pathological changes.

[0053] 2. Isolation and identification of canine coronavirus

[0054] (1) Isolation of canine coronavirus: Fresh feces were collected from a dog suspected of canine coronavirus disease in a pet hospital in Beijing, diluted 4 times with PBS (0.01 M, pH 7.6), centrifuged at 5 000 r / min for 10 min, and the supernatant was added with double-antibody for 4 h, filtered with a 0.2 μm filter to remove bacteria, inoculated into MDCK cells with a single layer, incubated at 37°C for 1 h, added with MEM medium containing 2% fetal bovine serum, and cultured at 37°C. Typical cell pathological changes (CPE) were observed after 3-4 days of culture, and the culture was harvested when the CPE reached more than 75% after 5-6 days of culture, and subcultured.

[0055] (2) Morphological characteristics of the virus: The harvested virus culture was centrifuged at 8 000 r / min for 10 min, and the supernatant was observed under an electron microscope. The results showed typical coronavirus characteristics.

[0056] (3) Serological identification of the virus: The isolated coronavirus strain could not agglutinate red blood cells of dogs, chickens, pigs, guinea pigs, sheep, rabbits, and humans, and had no red blood cell adsorption characteristics.

[0057] (4) Specific positive serum identification: The isolated coronavirus strain could be neutralized by CCV specific positive serum.

[0058] (5) RT-PCR amplification identification of the virus:

[0059] ① Primer design: According to the published nucleotide sequence of S gene of CCV, a pair of primers were designed and synthesized by Beijing Shengong Biotech Co. Ltd. CCVF1 5'-CCATTAATAGTGAACTGTTAGG-3', CCVF2 5'-CTAAAT

[0060] GTTCTGTACTATTGAACGCC-3'. The amplified fragment was 514 bp in size.

[0061] ② Virus RNA extraction: According to the kit operation, the PCR amplification procedure was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 53.5℃ annealing for 45 s, 72℃ extension for 45 s, 35 cycles; 72℃ extension for 10 min. The product was identified by 1% agarose gel electrophoresis, and observed by ultraviolet gel imaging system. The results showed that the amplified band was consistent with the designed size (as shown in Figure 2

[0062] ③ Sequence determination: The amplified virus PCR product was sequenced by Shengong, and compared with the published nucleotide sequence of the same strain of CCV virus. The homology of the isolated virus with other CCV virus strains was 96%, indicating that the isolated virus was a strain of CCV virus. Nucleotide sequence of Beijing strain of coronavirus (SEQ ID NO: 3)

[0063] ④ Virus virulence identification: 10 susceptible dogs of 6-8 weeks old with negative CCV antigen and antibody were used, of which 5 dogs were attacked by CCV virus of 6x106.0 TCID50 / mL, and the other 5 dogs were injected with physiological saline as control. The observation was carried out for 21 days after the attack. The results showed that 5 / 5 dogs in the attack group showed symptoms of coronavirus disease, and the control dogs were all alive.

[0064] ⑤ Virus immunogenicity: 20 susceptible dogs of 6-8 weeks old with negative CCV antigen and antibody were divided into 4 groups, 5 dogs in each group. The virus titer before inactivation of group 1 was 1x106.0 TCID50, the virus titer before inactivation of group 2 was 1x105.0 TCID50, and the virus titer before inactivation of group 3 was 1x104.0 TCID50. The antigen and adjuvant after inactivation were added into 605 adjuvant at a ratio of 9:1 to prepare the vaccine, which was injected subcutaneously on the neck for immunization test, and the immunization dose was 1 mL per dog per time. Each group was repeatedly injected with the same dose 21 days later. Another 5 dogs were injected with physiological saline as control dogs. All the dogs were attacked by CCV strain of 6 mL (1x106.0 TCID50) 21 days after the second injection, and the observation was carried out for 21 days after the attack.

[0065] ​Results: The first group and the second group of immune dogs had no any clinical symptoms, the protection rate was 5 / 5; the third group of immune dogs after challenge, one appeared CCV clinical symptoms, the protection rate was 4 / 5. Control dogs after challenge showed CCV clinical symptoms, one of the dogs died on the 9th day after challenge, and the autopsy was typical CCV lesions.

[0066] 3. Preparation of triple inactivated vaccine:

[0067] Mix according to the ratio of canine leptospira: leptospira icterohaemorrhagiae: canine coronavirus inactivated antigen 3:3:3 to form total antigen.

[0068] Add 605 adjuvant according to the ratio of total antigen: adjuvant 9:1 (v:v), mix thoroughly, quantitatively distribute, 2.0 mL per bottle, seal the bottle mouth, label, and store at 2-8℃.

[0069] 4. Test of triple inactivated vaccine finished product

[0070] (1) Appearance test: observe the color and character of the vaccine, observe that there should be no sediment at the bottom, and there should be no separation and precipitation.

[0071] (2) pH value determination: according to the current "Veterinary Pharmacopoeia of the People's Republic of China" 2015 edition appendix III, the pH value is 6.4-7.2.

[0072] (3) Stability test: take 10 mL of vaccine and add it to a centrifuge tube, centrifuge at 3000 r / min for 15 minutes, and there should be no precipitation and separation.

[0073] (4) Sterile test: according to the current "Veterinary Pharmacopoeia of the People's Republic of China" 2015 edition appendix III, there should be no bacteria, mold, mycoplasma.

[0074] (5) Safety test of triple inactivated vaccine finished product

[0075] ① Single dose of different injection routes safety test

[0076] Use 15 6-8 week old healthy susceptible dogs negative for canine leptospira, leptospira icterohaemorrhagiae and canine coronavirus antigen antibody, randomly divide them into 3 groups, 5 in each group, 1 and 2 groups are injected with triple inactivated vaccine 1 dose (2.0 mL) respectively by neck muscle and subcutaneously, and 3 group of dogs are injected with normal saline as blank control. Observe for 21 days after injection, observe the changes of all dogs in local reaction, spirit, appetite, body temperature and feces, etc.

[0077] The results of subcutaneous and intramuscular injection show that subcutaneous injection has no stimulation and mild adverse reaction to dogs, and intramuscular injection has mild redness and swelling at the injection site, which completely disappears in 2-3 days. Therefore, the subcutaneous injection method is selected for immunization of the vaccine.

[0078] 2. Single dose repeated injection safety test

[0079] Ten 6-8 week old healthy susceptible dogs, which were negative for Leptospira canicola, Leptospira icterohaemorrhagiae and canine coronavirus antigen antibody, were randomly divided into two groups, 5 dogs in each group. One immunization dose (2.0 mL) of the triple inactivated vaccine was injected subcutaneously in the neck of the dogs in each group, and the injection was repeated once every 21 days for a total of 3 times. Another 5 dogs were injected with normal saline as a blank control. After the three injections, the dogs were observed for 21 days to observe the changes in local reactions, spirit, appetite, body temperature and feces of all dogs.

[0080] Results: All dogs did not have any adverse clinical reactions after three injections, indicating that three single dose repeated injections were safe for dogs without any adverse reactions.

[0081] 3. Overdose injection safety test

[0082] Ten 6-8 week old healthy susceptible dogs, which were negative for Leptospira canicola, Leptospira icterohaemorrhagiae and canine coronavirus antigen antibody, were randomly divided into two groups, 5 dogs in each group. Two immunization doses (4.0 mL) of the triple inactivated vaccine were injected subcutaneously in the neck of the dogs in each group, and another 5 dogs were injected with normal saline as a control. After the injection, the dogs were observed for 21 days to observe the changes in local reactions, spirit, appetite, body temperature and feces of the dogs.

[0083] Results: The dogs injected with the vaccine only had mild redness and swelling at the injection site, which gradually disappeared after 2-3 days, and there were no other adverse clinical reactions, indicating that the vaccine was safe for dogs without obvious adverse reactions.

[0084] 4. Safety test on pregnant dogs

[0085] Ten pregnant female dogs were randomly divided into two groups, 5 dogs in each group. Two immunization doses (4.0 mL) of the triple inactivated vaccine were injected subcutaneously in the neck of the dogs in each group about 30 days before delivery, and another control group of dogs were injected with normal saline as a control. After the injection, the clinical changes of the female dogs were observed until delivery, including whether there were premature delivery, abortion, stillbirth, weak offspring, etc., as well as the survival and growth and development of the puppies.

[0086] Results: All dogs were normal delivery and development, without abortion and stillbirth, and the puppies survived and grew normally. This indicates that the vaccine is safe for pregnant female dogs when injected at twice the dose.

[0087] (2) Immune efficacy test of the triple inactivated vaccine on dogs

[0088] Thirty 6-8 week old Beagles, negative for canine leptospirosis, icteric hemorrhage leptospirosis, and canine coronavirus antigen and antibody, were randomly divided into two groups. One group received a subcutaneous injection of one dose (2.0 mL) of a triple inactivated vaccine in the neck, while the other group served as a control group by injecting saline. A second immunization was administered 21 days after the first immunization. Twenty-one days after the second immunization, five immunized dogs and five control dogs were simultaneously challenged with 6 mL of icteric hemorrhage leptospirosis (90-100 viable bacteria per field under 400x magnification), 6 mL of canine leptospirosis (90-100 viable bacteria per field under 400x magnification), and 6 × 10⁶ TCID₅₀ canine coronavirus, respectively. The dogs were observed for 21 days post-challenge, with clinical symptoms such as body temperature, appetite, mental state, and fecal matter, as well as pathological changes observed at necropsy.

[0089] Results: After immunization with the trivalent inactivated vaccine, dogs showed 5 / 5 protection against challenge with virulent canine leptospirosis with jaundice and hemorrhagic leptospirosis, and virulent canine coronavirus.

[0090] (3) Minimum immunization dose of trivalent inactivated vaccine

[0091] Thirty healthy 6-8 week old beagles, negative for canine leptospirosis, icteric hemorrhage leptospirosis, and canine coronavirus antigen and antibody, were randomly divided into 6 groups of 5 dogs each. Each group received a trivalent inactivated vaccine via subcutaneous injection in the neck. Group 1 received 1.0 mL of vaccine per dog, Group 2 received 1.5 mL per dog, and Group 3 received 2.0 mL per dog. The other three groups received vaccine-saline as a control group. A second immunization was administered 21 days after the first immunization. 21 days after the second immunization, 5 immunized dogs and 5 control dogs were challenged simultaneously with 6 mL of icteric hemorrhage leptospirosis (90-100 viable bacteria per field under 400x magnification), 6 mL of canine leptospirosis (90-100 viable bacteria per field under 400x magnification), and 6 × 10⁶ TCID⁵ of virulent canine coronavirus, respectively. Dogs were observed for 21 days after the viral challenge, and their clinical symptoms, such as body temperature, appetite, mental state, and feces, as well as anatomical pathological changes, were monitored.

[0092] Results: The immunization protection rate of the first group of dogs was 4 / 5, while the immunization protection rates of the second and third groups were both 5 / 5. This indicates that the minimum immunization dose of this trivalent inactivated vaccine is 1.0 mL of vaccine per dog, and to achieve better immunization protection, the recommended immunization dose is 2.0 mL.

[0093] (4) Antibody growth and decline patterns, immunization schedule and immunization period in dogs after immunization with the trivalent inactivated vaccine

[0094] 30 beagles of 6-8 weeks old, which were negative to Leptospira canicola, L. icterohaemorrhagiae and canine coronavirus antigens, were divided into test group (15 dogs) and control group (15 dogs). The dogs in test group were injected with one dose of triple inactivated vaccine subcutaneously in the neck. The dogs were injected again with the same dose 21 days after the first injection. The blood samples were collected 7d, 14d, 21d after the first injection and 7d, 14d, 21d, 30d, 60d, 120d, 180d, 240d, 300d, 360d, 420d after the second injection, respectively. The serum was separated and the antibody MAT value against Leptospira canicola and L. icterohaemorrhagiae and the serum antibody SN value against canine coronavirus were detected, respectively. The dogs were attacked by L. icterohaemorrhagiae (6mL, 90-100 live bacteria per visual field under microscope with 400 times magnification), Leptospira canicola (6mL, 90-100 live bacteria per visual field under microscope with 400 times magnification) and canine coronavirus (6x106 TCID50) at 420 days after the injection. The dogs were observed for 21 days after the attack. The body temperature, appetite, spirit, feces and pathological changes were observed.

[0095] The antibody detection results showed that the antibodies against Leptospira canicola and L. icterohaemorrhagiae were produced 7 days after the first injection. The antibody MAT value continued to increase after the second injection and reached the peak value (1:2560) at 30 days. The antibodies were still above the protective level at 420 days. The antibodies against canine coronavirus were produced 7 days after the first injection. The SN antibody value reached the protective antibody at 14 days after the second injection and reached the peak value (1:256) at 21 days. The antibodies were still above the protective level at 420 days after the injection.

[0096] The attack results showed that the protection rate against L. icterohaemorrhagiae was 4 / 5, the protection rate against Leptospira canicola was 5 / 5 and the protection rate against canine coronavirus was 5 / 5.

[0097] The determination of the immunization procedure showed that the antibodies were produced 7 days after the first injection of the triple inactivated vaccine to the dogs of 6-8 weeks old. The antibodies reached the peak value 21 days after the second injection. The antibodies maintained a high level at 420 days after the injection. The immunization procedure was determined as follows: the dogs of 6-8 weeks old were immunized twice with an interval of 21 days. The dogs were immunized once a year after that.

[0098] The determination of the immunization period showed that the antibody titer maintained a high level at 420 days after the second injection of the triple inactivated vaccine. The immune protection was achieved in the attack test. In order to ensure the immune effect, the immunization period was determined as 1 year (360 days).

[0099] (5) Passive immunity and immunization period test of puppies through maternal antibodies

[0100] Randomly select 5 puppies from each of the 3 litters of puppies born to the dogs immunized with the triple inactivated vaccine, for a total of 15 puppies, and collect blood from each of the 15 puppies at 7 days, 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, 56 days, 63 days, and 70 days after birth to detect the MAT values of antibodies against Leptospira icterohaemorrhagiae and Canine leptospira and the SN of neutralizing antibodies against canine coronavirus.

[0101] The results of antibody detection at different times after birth of the 15 puppies show that the protective maternal antibodies against Leptospira icterohaemorrhagiae and Canine leptospira obtained by the puppies can be maintained for 56 days after birth (MAT value >= 1:320), and then rapidly decrease; the protective maternal antibodies against canine coronavirus obtained by the puppies can be maintained for 63 days after birth (SN value >= 1:60), and then rapidly decrease.

[0102] The puppies born to the dogs immunized with the triple inactivated vaccine can obtain passive immunoprotection through maternal antibodies, and the duration of the protective antibodies is 56 days after birth, and the antibody titers rapidly decrease after 56 days. Therefore, in order to enable the puppies to produce fully protective antibodies, the first immunization date of the puppies is determined to be 6-8 weeks after birth.

[0103] (6) Routine inspection of the three batches of vaccines during storage

[0104] The three batches of vaccines are stored at 2-8°C, and random samples are taken at 3, 6, 9, 12, 18, 24, and 30 months after storage for detection of physical properties, appearance, dosage form, pH value, and stability according to the quality standards, and an immunoprotection test is performed at 30 months after storage.

[0105] Appearance inspection: The three batches of vaccines are all transparent liquids without precipitation, stratification, or separation.

[0106] pH value determination: The pH values of the three batches of vaccines are 6.4, 6.5, and 7.2, respectively, as determined according to the current Appendix III of the Veterinary Pharmacopoeia of the People's Republic of China, 2015 edition.

[0107] Stability detection: 10 mL of the vaccine is taken into a centrifuge tube and centrifuged at 3000 r / min for 15 minutes, and no separation or stratification occurs.

[0108] Sterile test: The three batches of vaccines are all free of growth of other bacteria, molds, and mycoplasma, as determined according to the current Appendix III of the Veterinary Pharmacopoeia of the People's Republic of China, 2015 edition.

[0109] (7) Safety inspection of the three batches of vaccines during the storage period

[0110] The 2-8℃ stored 30 months three batches of vaccines, each batch of vaccine respectively in the neck of 6-8 day-old dogs subcutaneously inoculated 5, 2 mL / only, detection of 24 h, 48 h, 7 days after injection of body temperature changes, continuous observation for 21 days.

[0111] Results: All dogs after injection were no adverse clinical reaction, all healthy, indicating that the triple inactivated vaccine stored for 30 months after immunization of dogs safe, no adverse side effects.

[0112] (8) three batches of vaccine potency test

[0113] The 2-8℃ stored 30 months three batches of vaccines, each batch of vaccine respectively in the neck of 6-8 week-old dogs subcutaneously inoculated 15, 2.0 mL / only, 21 days interval according to the same method and dose of immunization 1 times, 21 days after the second immunization respectively with jaundice hemorrhagic type of Leptospira bacteria 6 mL (microscope observation under 400 times magnification, each field of 90-100 live bacteria), canine leptospira bacteria 6 mL (microscope observation under 400 times magnification, each field of 90-100 live bacteria), canine coronavirus strong 4 x 106TCID50 attack. After 21 days of observation, the observation of each group of dogs temperature, appetite, spirit, feces and pathological changes of clinical symptoms and dissection, calculate the protection rate of attack.

[0114] Attack results: three batches of vaccines stored at 2-8℃ for 30 months can provide better protection to dogs, the attack protection rate reached 5 / 5 protection.

[0115] The above shows that: three batches of vaccines stored at 2-8℃ for 30 months to dogs safe, reliable, stable, effective. In order to provide better protection for target animals, the storage period of the vaccine is 24 months.

[0116]

[0117] <110>Beijing huaxia xingyang biological technology co., LTD Beijing shengtai technology co., LTD <120>Canine leptospira, jaundice hemorrhagic type of Leptospira, canine coronavirus triple inactivated vaccine <160>3 <210>1 <211>961 <212>DNA <213>L. icterohemorrhagia <400>1 atgatatgta acataagtaa ggcattgctc attttagccg tagcattatc ttcggctgca 60 agcttaagtg caactacata tgcaattgta ggatttgggt tacagttaga cctaggacaa 120 ttaggaggaa ctatcactaa agatggttta gacgctgcca ctcattatgg accagttcga 180 tcgtccaata cctgcaccgt aggtccaagt gatcctgctt gtaatcaaaa cccagcaaaa 240 cctacaggtg aaggaaatta tataggagtt gctcctagaa atcggattcc tgctgaaggc 300 agattaatca cccttgatag aaccactggt ggtgccatca atgcaagaag cactaaaggc 360 gccatggtcg gacctaattt gatggtaggt tatgagtccg actttggtaa atatttttcc 420 tggagagttg ctgcaggtaa tactcaaaaa tcttccggag gtgttacaat tccagacatc 480 gctggttata atattgtaga tatgacctgg ccacatagtt ctatcgtcat tcctgcagcc 540 gttggtatca aattgaatgt tactgaagac gctgcaatat atgccatatg gtttaaacta 600 ttccaatggt ggatggagtt aaaatggatc taacaatatc aaaggtggtt acgatatttt 660 aactgcagcg ggagcgggag ctgttgcgaa tttcaccagc gatccttccg atccagtcac 720 GACATCTACG ATAGCGATTG ATAGCGATTC ATCGTTGCTA CCGTTATCGG TAAAGCGTA 60 TCAGGCTAGA GAAAGCGATT TTAGTTATTG TGGATTGCT CTTACTTTTC CATTGGAAC 780 TGCCTATGCA GTTGATACAC TCAATCTGG TCCAGGAGCT ACAGCCTTTT CTCCTTTTC 900 AGCATATCCG ATCGTTGTCG GTGGACAAAT CTACAGATTC GGCCGTAACC ACAGACTCTA 960 C 961 <210>2 <211>961 <212>DNA <213>L. canicola <400>2 ATGATCCGTC TCAT AAGTAAGGCTTTGCTCAT AATAGCCGATGGGTTATCTTCGGCTGCA 60 AGCCTAAGTG CAAT A ACATATGCAATTGTAGGATTTGGGTTACAGTTAGACCTAGGACA A 120 T TAGCTCGAAC CATCACCAAA GACGGTTTAA CGCTGCCACT CAAATTGGACCAGTT CGAT 180 CGTCCAATAC CTGCACC GTA GGTCCAAGTG ATCCTGCTTGT CCTTAAAACC CAGCCGAAC 240 CTACAGGTGA AGGAAATTAAT ATGGAGTTGC TCCTAGAATT GCGATTCCCT GCTGAAAACA 300 GATTAATCAC CCTTGATAGA ACCACTGGTG GTGCCATCAAT GCAAGAAGCA CTAATCCGG 360 ccatggtcgc tccaaatttg atggtaggtt atgagtccga ctttggtaaa taatttaact 420 ggagagttgc tgcagaatat actccaaaaa tttccggagg cgttacaaag gcggacatcg 480 ctggttataa tattgtagat atgacctggg ctttagttct atcgtcattc ctgcaaccgt 540 tggtatcaaa ttgaatgtta ctgaagacgc tgcaatatat atgggagcag gtttaaacta 600 tttcaatggt ggatggagtt taaatggatc taacaatatc aaaggtggtt acgcgcgttt 660 aactgcagcc ggagcgggag ctgttgcgaa tttactgagc ctacgaaccg atccagtaac 720 tactcgtgaa cacgttcgat ttagaacttc tggaattgct ccaaactttt taattggaac 780 tcaggccaga gtaaccgatt aaggacacga attcattgaa ttagaaacga tcatgtctgc 840 tgcgtatgca gttggtccaa ctcaatctgt tggaagagct acgaaccttt acacttttcc 900 agcatagagg atcgttgtcg gtgaataaat ctacagattc ggttataaac acgaactctt 960 a 961 <210>3 <211>513 <212>DNA <213>Canine coronavirus <400>3 ctgttttgtc aaacgtgttg attggtcaat tgtgtaccct tttattgaca acgaagaaaa 60 gatcaataag ctggtcgcat agtacagtca catgtcatga aagctgctct gaaaattttt 120 aatcctgctg caattcacga tgtgggtaat cccaaaggca tccgttgtgc tacaacacca 180 ataccatggt tttgttatga ccgtgatcct attaataaca atgttagatg tctggagtat 240 gactatatgg tacatggtca aatgaatggt cttatgttgt tttggaactg taatgtggac 300 atgtacccag agttctcaat tgtttgtagg tttgatactc gaactcgctc taaattatct 360 ttagaaggtt gtaatggtgg tgcattgtat gtaaacaatc atgctttcca cacaccagct 420 tatgatagaa gagcatttgc taagcttaaa ccaatgccat tcttctacta tgatgatagg 480 tagttgtgaa cttgttgatg ggcaattaaa cta 513

Claims

1. A canine triple inactivated vaccine, characterized in that, It contains inactivated canine leptospira, icteric hemorrhage leptospira, and canine coronavirus, as well as pharmaceutically acceptable adjuvants; The canine leptospira has the accession number CGMCC NO:18505, the jaundice-hemorrhagic leptospira has the accession number CGMCC NO:18506, and the canine coronavirus has the accession number CGMCC NO:18507. The ratio of canine leptospira: jaundice hemorrhage leptospira: canine coronavirus: adjuvant is 3:3:3:

1.

2. The canine triple inactivated vaccine according to claim 1, wherein the adjuvant is 605 adjuvant.

3. Use of the canine trivalent inactivated vaccine according to any one of claims 1-2 in the preparation of a medicament for the prevention of canine leptospirosis, icteric hemorrhagic leptospirosis and / or canine coronavirus disease.

Images