RNAi agents for inhibiting expression of 17β-hsd type 13 (hsd17b13), compositions and methods of use thereof
By developing an HSD17B13 gene-specific RNAi reagent and delivering it to hepatocytes using a targeted ligand, the lack of effective pharmacological reagents for treating NAFLD, NASH, and alcoholic liver disease in existing technologies has been solved. This has enabled the effective inhibition of HSD17B13 gene expression, reducing hepatic steatosis and liver damage.
Patent Information
- Application Number
- CN201980061674.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-08-22
- Filing Date
- 2019-09-18
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2040-01-10
AI Technical Summary
Currently, there is a lack of effective pharmacological agents for the treatment of diseases such as non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), liver fibrosis, and alcoholic liver disease, especially specific RNA interference (RNAi) agents for the HSD17B13 gene to inhibit the expression of related genes.
HSD17B13 gene-specific RNAi reagents, including double-stranded RNAi reagents, were developed. These reagents target the human HSD17B13 gene and conjugate with desialyl glycoprotein receptor ligands, selectively delivering the RNAi reagent to hepatocytes via receptor-mediated endocytosis to inhibit HSD17B13 gene expression.
It effectively inhibits HSD17B13 gene expression, reduces related disease symptoms, including NAFLD, NASH and alcoholic liver disease, reduces liver fat production, reduces liver damage and inflammation, and lowers the risk of disease.
Smart Images

Figure 32330 
Figure 48594 
Figure 63900
Abstract
Description
[0001] Cross Reference to Related Applications
[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 62 / 890,220, filed August 22, 2019, U.S. Provisional Patent Application Serial No. 62 / 773,707, filed November 30, 2018, and U.S. Provisional Patent Application Serial No. 62 / 733,320, filed September 19, 2018, the contents of each of which are incorporated herein by reference in their entirety.
[0003] Sequence Listing
[0004] The application contains a Sequence Listing which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy is named 30667-WO SEQLIST.txt and is 75 kb in size. TECHNICAL FIELD
[0005] The present disclosure relates to RNA interference (RNAi) agents, such as double- stranded RNAi agents, for inhibiting 17beta-hydroxysteroid dehydrogenase type 13 gene expression, compositions comprising 17beta-hydroxysteroid dehydrogenase type 13 RNAi agents, and methods of using the same. BACKGROUND
[0006] Hepatic lipid droplet protein 17beta-hydroxysteroid dehydrogenase type 13 (often referred to as HSD17B13, 17beta-HSD13, HSD17beta13, 17beta-HSD13, 17beta-HSD type 13, or 17-HSD13) is a member of the 17beta-hydroxysteroid dehydrogenase (17beta-HSD) family. The 17beta-HSD family consists of 14 enzymes that are involved in the reduction or oxidation of sex hormones, fatty acids, and bile acids. Tissue distribution, subcellular localization, and catalytic preference vary among the various family members. The 17beta-HSD family shows different substrate specificities, including steroids, lipids, and retinoids.
[0007] 17β-HSD13 protein is distributed in a wide range of tissues in the body and is encoded by the HSD17B13 gene (alternatively referred to as the 17β-HSD13 gene). Highest expression levels are known to be found in hepatocytes of the liver, while lower levels can be detected in the ovary, bone marrow, kidney, brain, lung, skeletal muscle, bladder, and testis. The function of 17β-HSD13 is not fully understood, however, some 17β-HSD family members, including 17β-HSD-4, -7, -10, and -12, have been shown to be involved in carbohydrate and fatty acid metabolism. This suggests that 17β-HSD13 can also play a role in lipid metabolic pathways. It has been reported that hepatic upregulation of 17β-HSD13 has been observed in patients with fatty liver, which supports a role for the enzyme in the pathogenesis of nonalcoholic fatty liver disease (NAFLD).
[0008] Wen Su et al. have previously identified 17β-HSD13 as a lipid droplet (LD)-associated protein in patients with NAFLD and reported that 17β-HSD13 is one of the most abundantly expressed LD proteins that specifically localize on the surface of LDs. (Wen Su et al., Comparative proteomic study reveals 17β-HSD13 as a pathogenic protein in nonalcoholic fatty live disease, 111 PNAS 11437-11442 (2014)). Further, it was found that levels of 17β-HSD13 are upregulated in the liver of patients and mice with NAFLD. Overexpression resulted in an increase in the number and size of LDs, while gene silencing of HSD17B13 attenuated oleic acid-induced LD formation in cultured hepatocytes. It has also been shown that liver overexpression of 17β-HSD13 protein in C57BL / 6 mice significantly increased lipogenesis and triglyceride (TG) content in the liver, leading to a fatty liver phenotype.
[0009] Additional evidence implicating HSD17B13 gene expression in the pathogenesis of NAFLD and nonalcoholic steatohepatitis (NASH) is provided by N.S. Abul-Husn et al., A Protein-Truncating HSD17B13 Variant and Protection from Chronic Liver Disease , 378 N. Eng. J. Med. 1096-1106 (2018). This group conducted a genome-wide association study that revealed a splice variant (rs72613567:TA) in HSD17B13 that was associated with decreased levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), indicating less liver damage and inflammation in patients with fatty liver. The splice variant produces a truncated deletion of the functional protein, suggesting that HSD17B13 normally generates a product that can contribute to hepatocyte damage.
[0010] NAFLD is a major health problem worldwide. NAFLD is an umbrella term that encompasses a continuum of liver conditions that differ in the severity of injury and resulting fibrosis. Among these, isolated hepatic steatosis (fatty liver) is generally referred to as NAFL, and NASH is usually defined as a more severe process with inflammation and hepatocyte damage (steatohepatitis). Generally, NASH is accompanied by fibrosis, which often progresses to cirrhosis. Patients with NAFL alone carry a lower risk of adverse outcomes, whereas the presence of NASH increases the risk of liver and non-liver related outcomes. Adverse liver outcomes associated with NASH include liver failure, cirrhosis, and hepatocellular carcinoma. Non-liver related adverse outcomes are often associated with increased cardiovascular disease and malignancy.
[0011] Globally, the prevalence of NAFLD is estimated to be about 25%. In the United States, the number of cases of NAFLD is projected to increase from 83.1 million (about 25% of the population) in 2015 to 100.9 million in 2030. NASH is projected to account for an increasing proportion of these cases, rising from 20% to 27% of adults with NAFLD. This rising prevalence of disease will undoubtedly result in an increased economic burden and will be accompanied by an increasing number of patients with end-stage liver disease and a sharp increase in hepatocellular carcinoma that require liver transplantation. A large percentage (about 35-50%) of hepatocellular carcinoma cases that arise in NASH occur in patients before cirrhosis and routine cancer screening are performed, compared to the incidence of other liver diseases. This often results in tumors that are larger and less amenable to curative therapy compared to tumors with other etiologies.
[0012] Alcohol-related liver disease (ARLD) is also prevalent worldwide and refers to progressive liver disease resulting from excessive long-term alcohol consumption. There are various disease states of ARLD and include alcoholic fatty liver (steatosis), alcoholic hepatitis, and cirrhosis.
[0013] Currently, there are no approved pharmacological agents for NASH or other diseases and conditions listed as NAFLD or ARLD. SUMMARY
[0014] There is a need for novel HSD17B13 gene-specific RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers), such as double-stranded RNAi agents, that are capable of selectively and effectively inhibiting the expression of the HSD17B13 gene. Further, there is a need for compositions comprising novel HSD17B13-specific RNAi agents for the treatment of diseases, such as, in particular, NAFLD, NASH, liver fibrosis, and alcoholic or non-alcoholic liver diseases, including cirrhosis.
[0015] In general, the present disclosure features novel HSD17B13 gene-specific RNAi reagents, compositions comprising HSD17B13 RNAi reagents, and methods of using the HSD17B13 RNAi reagents and compositions comprising HSD17B13 RNAi reagents described herein for inhibiting HSD17B13 gene expression in vitro and / or in vivo. The HSD17B13 RNAi reagents described herein can selectively and effectively reduce, inhibit, or silence expression of the HSD17B13 gene in a subject, e.g., a human or animal subject.
[0016] The HSD17B13 RNAi reagents described can be used in methods of therapeutic treatment (including prophylactic and preventative treatment) of conditions and diseases associated with NAFLD, NASH, liver fibrosis, and alcoholic or non-alcoholic liver disease including cirrhosis. The methods disclosed herein include administering one or more HSD17B13 RNAi reagents to a subject, e.g., a human or animal subject, using any suitable method known in the art, e.g., subcutaneous injection or intravenous administration.
[0017] In one aspect, the present disclosure features an RNAi reagent for inhibiting HSD17B13 gene expression, wherein the RNAi reagent comprises a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand can be partially complementary, substantially complementary, or fully complementary to each other. The sense strand and the antisense strand of the RNAi reagents described herein can each be 16 to 49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 17 to 26 nucleotides in length. The sense strand and the antisense strand can be the same length or different lengths. In some embodiments, the sense strand and the antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21 to 24 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the antisense strand is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strand is independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. Upon delivery to a cell expressing HSD17B13, the RNAi reagents described herein inhibit expression of one or more HSD17B13 genes in vivo or in vitro.
[0018] The HSD17B13 RNAi agents disclosed herein target the human HSD17B13 gene (see, e.g., SEQ ID NO: 1). In some embodiments, the HSD17B13 RNAi agents disclosed herein target a portion of the HSD17B13 gene having a sequence disclosed in Table 1.
[0019] Tables 3 and 4 provide examples of sense strands and antisense strands of HSD17B13 RNAi agents that can be included in the HSD17B13 RNAi agents disclosed herein. Examples of HSD17B13 RNAi agent duplexes are provided in Table 5, and show chemical structures and schematic diagrams of certain HSD17B13 RNAi agents linked to targeting ligands comprising N-acetyl-galactosamine, depicted in Figures 1A to 10D and Figures 11A to 11E Examples of 19-nucleotide core segment sequences comprised by, or included in, the sense strands and antisense strands of the HSD17B13 RNAi agents disclosed herein are provided in Table 2.
[0020] In another aspect, the present disclosure features methods for delivering a HSD17B13 RNAi agent to a liver cell of a subject (e.g., a mammal) in vivo. Also described herein are compositions for use in such methods.
[0021] One or more HSD17B13 RNAi agents can be delivered to a target cell or tissue using any oligonucleotide delivery technique known in the art. In some embodiments, the HSD17B13 RNAi agents are delivered to a target cell or tissue by covalently linking or conjugating the RNAi agent to a targeting group, e.g., an asialoglycoprotein receptor ligand (i.e., a ligand comprising a compound having affinity for an asialoglycoprotein receptor that is abundantly expressed on hepatocytes in the liver). In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or consists essentially of a cluster of galactose or galactose derivatives. In some embodiments, the HSD17B13 RNAi agent is linked to a targeting group or targeting ligand comprising a galactose derivative, N-acetyl-galactosamine. In some embodiments, the cluster of galactose derivatives comprises or consists of a N-acetyl-galactosamine trimer or a N-acetyl-galactosamine tetramer.
[0022] In some embodiments, the HSD17B13 RNAi agents disclosed herein conjugated to a targeting group or targeting ligand comprising N-acetyl-galactosamine are selectively internalized by liver cells, and in particular hepatocytes, by receptor-mediated endocytosis or by other means.
[0023] In some embodiments, the targeting group is linked to the 3' end or 5' end of the sense strand of the HSD17B13 RNAi agents disclosed herein. In some embodiments, the targeting group is linked to the 5' end of the sense strand.
[0024] Examples of targeting ligands and targeting groups that can be used to deliver the HSD17B13 RNAi agents disclosed herein to hepatocytes are disclosed, for example, in International Patent Application Publication Nos. WO 2018 / 044350 and WO 2017 / 156012, which are incorporated herein by reference in their entireties. In some embodiments, the HSD17B13 RNAi agents described herein can be linked to one or more targeting ligands having the structure of: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, each as defined in Table 6 herein.
[0025] In some embodiments, the HSD17B13 RNAi agents described herein are linked at the 5' end of the sense strand to a targeting ligand comprising three N-acetyl-galactosamine moieties, wherein the targeting ligand has the structure of: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, each as defined in Table 6 herein.
[0026] In some embodiments, described herein are compositions comprising one or more HSD17B13 RNAi agents having the duplex structure disclosed in Table 5.
[0027] In another aspect, the present disclosure features a method for inhibiting expression of a HSD17B13 gene, wherein the method comprises administering to a subject or a cell of a subject an amount of a HSD17B13 RNAi agent capable of inhibiting expression of a HSD17B13 gene, wherein the HSD17B13 RNAi agent comprises a sense strand and an antisense strand, and wherein the antisense strand comprises the sequence of any one of the antisense strand nucleotide sequences in Table 2 or Table 3. In some embodiments, disclosed herein is a method of inhibiting expression of a HSD17B13 gene, wherein the method comprises administering to a subject or a cell an amount of a HSD17B13 RNAi agent capable of inhibiting expression of a HSD17B13 gene, wherein the HSD17B13 RNAi agent comprises a sense strand and an antisense strand, and wherein the sense strand comprises the sequence of any one of the sense strand nucleotide sequences in Table 2 or Table 4. In some embodiments, disclosed herein is a method for inhibiting expression of a HSD17B13 gene in a cell or a subject, wherein the method comprises administering to the cell or the subject a HSD17B13 RNAi agent having a sense strand comprising the sequence of any sequence in Table 4, and an antisense strand comprising the sequence of any sequence in Table 3. Also disclosed herein are compositions for use in such methods.
[0028] In a further aspect, the present disclosure features a method of treating (including preventing or prophylactic treatment) a disease or condition caused by NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease including cirrhosis, wherein the method comprises administering to a subject in need thereof a HSD17B13 RNAi agent having an antisense strand comprising the sequence of any sequence in Table 2 or 3. In some embodiments, described herein is a method of treating (including prophylactic treatment) a disease or condition caused by NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease including cirrhosis, wherein the method comprises administering to a subject in need thereof a HSD17B13 RNAi agent having a sense strand comprising the sequence of any sequence in Table 2 or 4. Also disclosed herein are compositions for use in such methods.
[0029] In some embodiments, described are compositions for delivering a HSD17B13 RNAi agent to liver cells, in particular hepatocytes, in vivo, comprising: a HSD17B13 RNAi agent linked or conjugated to a targeting group. In some embodiments, the targeting group is N-acetyl-galactosamine.
[0030] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3). In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3), wherein SEQ ID NO: 3 is at positions 1-21 (5' - 3') of the antisense strand.
[0031] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2), wherein a, c, g and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As will be clear to one of ordinary skill in the art, as shown in the modified nucleotide sequences disclosed herein, phosphorothioate linkages include replacement of the phosphodiester linkages normally present in an oligonucleotide (see, e.g., FIG. 1 showing all internucleoside linkages in the modified nucleotide sequences disclosed herein). In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2), wherein a, c, g and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As will be clear to one of ordinary skill in the art, as shown in the modified nucleotide sequences disclosed herein, phosphorothioate linkages include replacement of the phosphodiester linkages normally present in an oligonucleotide (see, e.g., FIG. 1 showing all internucleoside linkages in the modified nucleotide sequences disclosed herein). Figures 11A to 11E) In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand consisting essentially of, consisting essentially of, or comprising the nucleotide sequence (5' - 3') usCfsasUfcUfaUfcAfcUfuCfuUfaCfsg (SEQ ID NO: 2), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
[0032] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand consisting essentially of, consisting essentially of, or comprising the nucleotide sequence (5' - 3') usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As will be clear to one of ordinary skill in the art, as shown in the modified nucleotide sequences as disclosed herein, phosphorothioate linkages include replacement of the phosphodiester linkages normally present in an oligonucleotide (see, e.g., FIG. 1 showing all internucleoside linkages in an oligonucleotide). Figures 11A to 11E ) In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand consisting essentially of, consisting essentially of, or comprising the nucleotide sequence (5' - 3') usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
[0033] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6). In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6), wherein SEQ ID NO: 6 is at positions 1-21 (5' - 3') of the antisense strand.
[0034] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5), wherein a, c, g and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As will be clear to one of ordinary skill in the art, phosphorothioate linkages, as shown in the modified nucleotide sequences disclosed herein, include a substitution of the phosphodiester linkages normally present in an oligonucleotide (see, e.g., FIG. 1 showing all internucleoside linkages). Figures 11A to 11E In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence differing by no more than 1 nucleotide from the nucleotide sequence (5' - 3') usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5), wherein a, c, g and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As will be clear to one of ordinary skill in the art, phosphorothioate linkages, as shown in the modified nucleotide sequences disclosed herein, include a substitution of the phosphodiester linkages normally present in an oligonucleotide (see, e.g., FIG. 1 showing all internucleoside linkages).
[0035] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence of (5' - 3') usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As will be clear to one of ordinary skill in the art, as shown in the modified nucleotide sequences disclosed herein, phosphorothioate linkages include replacement of the phosphodiester linkages normally present in oligonucleotides (see, e.g., FIG. 1 showing all internucleoside linkages in the modified nucleotide sequences disclosed herein). Figures 11A to 11E In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence of (5' - 3') usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
[0036] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3); and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8). In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5' - 3') UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3), wherein all or substantially all of the nucleotides are modified nucleotides; and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5' - 3') CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8), wherein all or substantially all of the nucleotides are modified nucleotides.
[0037] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6); and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or 1 nucleobases from the nucleotide sequence (5' - 3') GCCUAGGACAUUUUUGIAUCA (SEQ ID NO: 11), wherein I represents an inosine (hypoxanthine) nucleotide. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5' - 3') UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6), wherein all or substantially all of the nucleotides are modified nucleotides; and a sense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5' - 3') GCCUAGGACAUUUUUGIAUCA (SEQ ID NO: 11), wherein I represents an inosine (hypoxanthine) nucleotide, and wherein all or substantially all of the nucleotides are modified nucleotides.
[0038] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence (5' - 3') usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2); and a sense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence (5' - 3') cguaagaaGfUfCfugauagauga (SEQ ID NO: 9), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence (5' - 3') usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2); and a sense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence (5' - 3') cguaagaaGfUfCfugauagauga (SEQ ID NO: 9), and wherein the sense strand further includes inverted deoxyribosyl residues at the 3' end and 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' end, wherein the targeting ligand includes N-acetyl-galactosamine.
[0039] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10), wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10), and wherein the sense strand further includes inverted deoxyribonucleotide residues at the 3' end and 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' end, wherein the targeting ligand includes N-acetyl-galactosamine.
[0040] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12), and wherein the sense strand further includes inverted deoxyribonucleotide residues at the 3' terminal end and the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' terminal end, wherein the targeting ligand includes N-acetyl-galactosamine.
[0041] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), and wherein the sense strand further includes inverted deoxyribonucleotide residues at the 3' terminal end and the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' terminal end, wherein the targeting ligand includes N-acetyl-galactosamine.
[0042] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7); and a sense strand that consists of, consists essentially of, or comprises the modified nucleotide sequence (5' - 3') gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), and wherein the sense strand further includes inverted abasic residues at the 3' terminus and 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' terminus, wherein the targeting ligand includes N-acetyl-galactosamine.
[0043] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5' - 3'):
[0044] UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3); or
[0045] UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6);
[0046] wherein the HSD17B13 RNAi agent further includes a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides.
[0047] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand consisting essentially of, consisting essentially of, or comprising a nucleotide sequence differing by 0 or 1 nucleotides from one of the following nucleotide sequences (5' 3'):
[0048] UCAUCUAUCAGACUUCUUACG (SEQ ID NO:3); or
[0049] UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO:6);
[0050] wherein the HSD17B13 RNAi agent further includes a sense strand at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further includes inverted deoxyabasic residues at the 3' end and 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' end, wherein the targeting ligand includes N-acetyl-galactosamine.
[0051] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand consisting essentially of, consisting essentially of, or comprising a nucleotide sequence differing by 0 or 1 nucleotides from one of the following nucleotide sequences (5' 3'):
[0052] UCAUCUAUCAGACUUCUUACG (SEQ ID NO:3); or
[0053] UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO:6);
[0054] wherein the HSD17B13 RNAi agent further includes a sense strand at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further includes inverted deoxyabasic residues at the 3' end and 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' end, wherein the targeting ligand includes N-acetyl-galactosamine; and wherein the respective antisense strand sequences are at positions 1-21 of the antisense strand.
[0055] In some embodiments, an HSD17B13 RNAi agent disclosed herein includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist essentially of, consist essentially of, or comprise a nucleotide sequence differing by 0 or 1 nucleotides from one of the following pairs of nucleotide sequences (5' 3'):
[0056] UCAUCUAUCAGACUUCUUACG (SEQ ID NO:3) and CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO:8); or
[0057] UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO:6) and GCCUAGGACAUUUUUGIAUCA (SEQ ID NO:11), wherein I represents an inosine (hypoxanthine) nucleotide;
[0058] wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides.
[0059] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise a nucleotide sequence differing by 0 or 1 nucleotides from one of the following pairs of nucleotide sequences (5' 3'):
[0060] UCAUCUAUCAGACUUCUUACG (SEQ ID NO:3) and CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO:8); or
[0061] UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO:6) and GCCUAGGACAUUUUUGIAUCA (SEQ ID NO:11), wherein I represents an inosine (hypoxanthine) nucleotide;
[0062] wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted abasic residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.
[0063] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence differing by 0 or 1 nucleotides from one of the following nucleotide sequences (5' 3'):
[0064] usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO:2);
[0065] usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2);
[0066] usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5);
[0067] usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7);
[0068] wherein a, c, g, and u represent 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and wherein the HSD17B13 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
[0069] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise an antisense strand consisting essentially of, consisting of, or comprising a modified nucleotide sequence differing by 0 or 1 nucleotides from one of the following nucleotide sequences (5' 3'):
[0070] usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2);
[0071] usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4);
[0072] usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5);
[0073] usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7);
[0074] wherein the HSD17B13 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides; wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted abasic residues at the 3' terminus and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' terminus, wherein the targeting ligand comprises N-acetyl-galactosamine.
[0075] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise an antisense strand and a sense strand consisting essentially of, consisting of, or comprising a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following pairs of nucleotide sequences (5' 3'):
[0076] usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO:2) and
[0077] cguaagaaGfUfCfugauagauga (SEQ ID NO:9);
[0078] usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4) and
[0079] cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10);
[0080] usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO:5) and
[0081] gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12);
[0082] usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO:5) and
[0083] gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13); or
[0084] usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO:7) and
[0085] gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13);
[0086] wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.
[0087] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise an antisense strand and a sense strand consisting essentially of, consisting of, or comprising one of the following pairs of nucleotide sequences (5' 3'):
[0088] usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2) and
[0089] cguaagaaGfUfCfugauagauga (SEQ ID NO: 9);
[0090] usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4) and
[0091] cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10);
[0092] usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5) and
[0093] gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12);
[0094] usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5) and
[0095] gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13); or
[0096] usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7) and
[0097] gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13);
[0098] wherein a, c, g, i, and u represent 2'-0-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and wherein the sense strand further comprises inverted deoxyribonucleotide residues at the 3' end and 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.
[0099] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand that includes a nucleobase sequence that differs by 0 or 1 nucleobases from a nucleotide sequence selected from the following (5' 3'):
[0100] UCAUCUAUCAGACUUCUUA (SEQ ID NO:26); or
[0101] UGAUCCAAAAAUGUCCUAG (SEQ ID NO:41).
[0102] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand that includes a nucleobase sequence that differs by 0 or 1 nucleobases from a nucleotide sequence selected from the following (5' 3'):
[0103] UCAUCUAUCAGACUUCUUA (SEQ ID NO:26); and
[0104] UGAUCCAAAAAUGUCCUAG (SEQ ID NO:41);
[0105] wherein all or substantially all of the nucleotides are modified nucleotides.
[0106] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand that includes a nucleobase sequence that differs by 0 or 1 nucleobases from a nucleotide sequence selected from the following (5' 3'):
[0107] UCAUCUAUCAGACUUCUUA (SEQ ID NO:26); or
[0108] UGAUCCAAAAAUGUCCUAG (SEQ ID NO:41);
[0109] wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 26 or SEQ ID NO: 41 is at nucleotide positions 1-19 (5' 3') of the antisense strand, respectively.
[0110] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand and a sense strand each including a nucleobase sequence that differs by 0 or 1 nucleobases from a nucleotide sequence pair selected from the following (5' 3'):
[0111] UCAUCUAUCAGACUUCUUA (SEQ ID NO: 26) and UAAGAAGUCUGAUAGAUGA (SEQ ID NO: 67);
[0112] UGAUCCAAAAAUGUCCUAG (SEQ ID NO: 41) and CUAGGACAUUUUUGIAUCA (SEQ ID NO: 86), wherein (I) represents an inosine nucleotide.
[0113] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand and a sense strand each including a nucleobase sequence that differs by 0 or 1 nucleobases from a nucleotide sequence pair selected from the following (5' 3'):
[0114] UCAUCUAUCAGACUUCUUA (SEQ ID NO: 26) and UAAGAAGUCUGAUAGAUGA (SEQ ID NO: 67);
[0115] UGAUCCAAAAAUGUCCUAG (SEQ ID NO: 41) and CUAGGACAUUUUUGIAUCA (SEQ ID NO: 86), wherein (I) represents an inosine nucleotide; and
[0116] wherein all or substantially all of the nucleotides are modified nucleotides.
[0117] In some embodiments, the compositions described herein comprising one or more HSD17B13 RNAi agents are packaged into a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the compositions described herein are administered parenterally, for example, by subcutaneous injection.
[0118] As used herein, the terms "oligonucleotide" and "polynucleotide" mean a polymer of linked nucleosides, which can each independently be modified or unmodified.
[0119] As used herein, "RNAi agent" (also referred to as "RNAi trigger") means a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can act through an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway machinery of a mammalian cell (the RNA-induced silencing complex or RISC)) or through any alternative mechanism or pathway. While it is believed that, as the term is used herein, an RNAi agent acts primarily through an RNA interference mechanism, the disclosed RNAi agents are not bound or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA to be targeted (i.e., the HSD17B13 mRNA). The RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.
[0120] As used herein, the term "silence," "reduce," "inhibit," "down-regulate," or "knockdown," when referring to expression of a given gene, means that the expression of the gene is reduced when a cell, cell population, tissue, organ, or subject is treated with an RNAi agent described herein, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from mRNA in the cell, cell population, tissue, organ, or subject, as compared to a second cell, cell population, tissue, organ, or subject that is not so treated.
[0121] As used herein, the terms "sequence" and "nucleotide sequence" mean the succession or order of nucleobases or nucleotides, described using standard nomenclature, with consecutive letters.
[0122] As used herein, a "base," "nucleotide base," or "nucleobase" is a heterocyclic pyrimidine or purine compound of which it is a component of a nucleotide, and includes the primary purine bases adenine and guanine, as well as the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, wobble bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases, including phosphoramidite compounds comprising modified nucleobases, is known in the art.
[0123] As used herein, and unless otherwise specified, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., the sense strand or a targeting mRNA of an RNAi agent) in relation to a second nucleobase or nucleotide sequence (e.g., the antisense strand or a single-stranded antisense oligonucleotide of an RNAi agent) means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pairing hydrogen bonds under mammalian physiological conditions (or otherwise appropriate in vivo or in vitro conditions)) and form a duplex or double helix structure with an oligonucleotide comprising the second nucleotide sequence under certain standard conditions. One of ordinary skill in the art will be able to select the most appropriate set of conditions for hybridization testing. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimics at least to the extent that the above-mentioned hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, a and Af as defined herein are complementary to U (or T) and equivalent to A for purposes of determining identity or complementarity.
[0124] As used herein, "fully complementary" or "completely complementary" means that in a hybridizing pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in the contiguous sequence of a first oligonucleotide hybridize with the same number of bases in the contiguous sequence of a second oligonucleotide. The contiguous sequence can comprise all or a portion of the first nucleotide sequence or the second nucleotide sequence.
[0125] As used herein, "partially complementary" means that in a hybridizing pair of nucleobase or nucleotide sequence molecules, at least 70% but not all of the bases in the contiguous sequence of a first oligonucleotide hybridize with the same number of bases in the contiguous sequence of a second oligonucleotide. The contiguous sequence can comprise all or a portion of the first nucleotide sequence or the second nucleotide sequence.
[0126] As used herein, "substantially complementary" means that at least 85% but not all of the bases in an adjacent sequence of a first oligonucleotide hybridize to the same number of bases in an adjacent sequence of a second oligonucleotide in a hybridizing pair of nucleobase or nucleotide sequence molecules. The adjacent sequence can comprise all or a portion of the first or second nucleotide sequence.
[0127] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matches between a sense strand and an antisense strand of an RNAi agent, or between an antisense strand of an RNAi agent and a sequence of an HSD17B13 mRNA.
[0128] As used herein, the term "substantially identical" or "substantial identity," when applied to nucleic acid sequences, means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity, or more, e.g., at least 90%, at least 95%, or at least 99% identity, as compared to a reference sequence. The percent sequence identity is determined by comparing two optimally aligned sequences over a comparison window, as described below. The percent sequence identity is calculated by determining the number of positions at which the identical type of nucleic acid base occurs in both sequences within the window of comparison, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent sequence identity. The present application disclosed herein encompasses nucleotide sequences that are substantially identical to the nucleotide sequences disclosed herein.
[0129] As used herein, the terms "treat," "treatment," and the like, mean methods or steps taken to provide relief or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include prevention, management, prophylactic treatment, and / or inhibition or reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject.
[0130] As used herein, the phrase "introduced into a cell," when referring to an RNAi agent, means that the RNAi agent is functionally delivered into the cell. The phrase "functionally delivered" means that the RNAi agent is delivered to the cell in a manner such that the RNAi agent has the intended biological activity, e.g., sequence-specific inhibition of gene expression.
[0131] As used herein, the use of symbols means that any one or more groups can be attached thereto, unless otherwise specified, in accordance with the scope of the application described herein.
[0132] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the order of bonding or the nature of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereomers" and those that are mirror images of one another are called "enantiomers," or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."
[0133] As used herein, for each structure in which there is an asymmetric center, and thus the potential for enantiomers, diastereomers, or other stereoisomeric forms, each structure disclosed herein is intended to represent all such possible isomers, including optical and racemic mixtures thereof, unless specifically identified as having a particular configuration in the structure. For example, structures disclosed herein are intended to encompass diastereomers as well as mixtures of single stereoisomers.
[0134] As used in the claims, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. When used in the foregoing claims, the phrase "consisting essentially of" shall mean that the claim is limited to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the invention.
[0135] Those of ordinary skill in the art will readily understand and appreciate that the compounds and compositions disclosed herein can have certain atoms (e.g., N, O, or S atoms) that are in a protonated or deprotonated state, depending on the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, can be protonated or deprotonated. As those of ordinary skill in the art will readily understand, the disclosure herein contemplates encompassing the disclosed compounds and compositions regardless of their protonated state based on the environment (e.g., pH). Accordingly, the compounds described herein having labile protons or basic atoms are also to be understood to represent the salt forms of the corresponding compounds. The compounds described herein can be in the form of a free acid, a free base, or a salt. The pharmaceutically acceptable salts of the compounds described herein are to be understood to be within the scope of the present invention.
[0136] As used herein, the term "linked" or "conjugated" when referring to a linkage between two compounds or molecules means that the two compounds or molecules are joined by a covalent bond. Unless otherwise indicated, as used herein, the terms "linked" and "conjugated" can refer to a linkage between a first compound and a second compound with or without any intervening atoms or groups of atoms.
[0137] As used herein, the term "includes" is used herein to mean "includes but is not limited to," and, when
[0138] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although suitable methods and materials are described below, methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0139] Other objects, features, aspects and advantages of the present application will become apparent to one skilled in the art from the following detailed description, accompanying drawings and claims. BRIEF DESCRIPTION OF DRAWINGS
[0140] Figures 1A to 1D . Chemical structure representation of HSD17B13 RNAi agent AD06214 conjugated to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s at the 5' end of the sense strand, shown as the free acid.
[0141] Figures 2A to 2D . Chemical structure representation of HSD17B13 RNAi agent AD06280 conjugated to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s at the 5' end of the sense strand, shown as the free acid.
[0142] Figures 3A to 3D . Chemical structure representation of HSD17B13 RNAi agent AD06187 conjugated to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s at the 5' end of the sense strand, shown as the free acid.
[0143] Figures 4A to 4D . Chemical structure representation of HSD17B13 RNAi agent AD06276 conjugated to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s at the 5' end of the sense strand, shown as the free acid.
[0144] Figures 5A to 5D . Chemical structure representation of HSD17B13 RNAi agent AD06277 conjugated to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s at the 5' end of the sense strand, shown as the free acid.
[0145] Figures 6A to 6D . Chemical structure representation of HSD17B13 RNAi agent AD06214 conjugated at the 5' end of the sense strand to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s, shown as a sodium salt form.
[0146] Figures 7A to 7D . Chemical structure representation of HSD17B13 RNAi agent AD06280 conjugated at the 5' end of the sense strand to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s, shown as a sodium salt form.
[0147] Figures 8A to 8D . Chemical structure representation of HSD17B13 RNAi agent AD06187 conjugated at the 5' end of the sense strand to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s, shown as a sodium salt form.
[0148] Figures 9A to 9D . Chemical structure representation of HSD17B13 RNAi agent AD06276 conjugated at the 5' end of the sense strand to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s, shown as a sodium salt form.
[0149] Figures 10A to 10D . Chemical structure representation of HSD17B13 RNAi agent AD06277 conjugated at the 5' end of the sense strand to a tridentate N-acetyl-galactosamine targeting ligand of (NAG37)s, shown as a sodium salt form.
[0150] Figure 11A . Schematic representation of the modified sense and antisense strands of HSD17B13 RNAi agent AD06214 conjugated to a N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6; Figures 1 and 6). In the Figures 11A to 11E following abbreviations are used: a, c, g, i, and u are 2'-0-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted deoxyabasic residue; (NAG37)s is a tridentate N-acetyl-galactosamine targeting ligand having the structure shown in Table 6. Figure 11A SEQ ID NO: 2 and 14 are disclosed.
[0151] Figure 11B. Schematic of modified sense and antisense strands of HSD17B13 RNAi agent AD06280 conjugated to an N-acetyl-galactosamine tridentate ligand with the structure (NAG37)s (see Table 6) (see Tables 3-5). Figure 11B SEQ ID NO: 4 and 15 are disclosed.
[0152] Figure 11C . Schematic of modified sense and antisense strands of HSD17B13 RNAi agent AD06187 conjugated to an N-acetyl-galactosamine tridentate ligand with the structure (NAG37)s (see Table 6) (see Tables 3-5). Figure 11C SEQ ID NO: 5 and 16 are disclosed.
[0153] Figure 11D . Schematic of modified sense and antisense strands of HSD17B13 RNAi agent AD06276 conjugated to an N-acetyl-galactosamine tridentate ligand with the structure (NAG37)s (see Table 6) (see Tables 3-5). Figure 11D SEQ ID NO: 5 and 17 are disclosed.
[0154] Figure 11E . Schematic of modified sense and antisense strands of HSD17B13 RNAi agent AD06277 conjugated to an N-acetyl-galactosamine tridentate ligand with the structure (NAG37)s (see Table 6) (see Tables 3-5). Figure 11D SEQ ID NO: 7 and 17 are disclosed. DETAILED DESCRIPTION
[0155] RNAi Agents
[0156] Described herein are RNAi agents for inhibiting expression of the HSD17B13 gene (referred to herein as HSD17B13 or 17β-HSD13 RNAi agents, or HSD17B13 or 17β-HSD13 RNAi triggers). Each HSD17B13 RNAi agent comprises a sense strand and an antisense strand. Each of the sense and antisense strands can be 16 to 49 nucleotides in length. The sense and antisense strands can be the same length, or they can be different lengths. In some embodiments, each of the sense and antisense strands is independently 17 to 27 nucleotides in length. In some embodiments, each of the sense and antisense strands is independently 19-21 nucleotides in length. In some embodiments, each of the sense and antisense strands is 21-26 nucleotides in length. In some embodiments, each of the sense and antisense strands is 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, each of the sense and antisense strands is 21 nucleotides in length. In some embodiments, each of the sense and antisense strands of an RNAi agent is independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length. In some embodiments, a double stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0157] Tables 2, 3, and 4 provide examples of nucleotide sequences used to form HSD17B13 RNAi agents. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2, 3, and 4 are shown in Table 5, and are also depicted in Figures 1A to 10D and Figures 11A to 11E .
[0158] In some embodiments, a region of perfect complementarity, substantial complementarity, or partial complementarity between the sense and antisense strands is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., the region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).
[0159] The sense strand of an HSD17B13 RNAi agent described herein includes at least 16 contiguous nucleotides that are at least 85% identical to a core segment sequence (also referred to herein as a "core segment" or "core sequence") of the same number of nucleotides in an HSD17B13 mRNA. In some embodiments, the sense strand core segment sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to the core segment sequence in the antisense strand, and thus, the sense strand core segment sequence is typically perfectly or at least about 85% identical to the same length of nucleotide sequence present in the HSD17B13 mRNA target (sometimes referred to, for example, as a target sequence). In some embodiments, the sense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core segment is 17 nucleotides in length. In some embodiments, the sense strand core segment is 19 nucleotides in length.
[0160] The antisense strand of an HSD17B13 RNAi agent described herein includes at least 16 contiguous nucleotides that are at least 85% complementary to a core segment of the same number of nucleotides in an HSD17B13 mRNA, and to a core segment of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (perfectly) complementary or at least about 85% (substantially) complementary to the same length of nucleotide sequence present in the HSD17B13 mRNA target (e.g., a target sequence). In some embodiments, the antisense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core segment is 19 nucleotides in length. In some embodiments, the antisense strand core segment is 17 nucleotides in length. The sense strand core segment sequence can be the same length as the corresponding antisense core sequence, or it can be a different length.
[0161] The sense strand and the antisense strand of the HSD17B13 RNAi agent anneal to form a duplex. The sense strand and the antisense strand of the HSD17B13 RNAi agent can be partially complementary, substantially complementary, or fully complementary to each other. Within the region of complementary duplex, the sense strand core segment sequence is at least 85% complementary or 100% complementary to the antisense core segment sequence. In some embodiments, the sense strand core segment sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core segment sequence (i.e., the sense and antisense core segment sequences of the HSD17B13 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).
[0162] In some embodiments, the antisense strand of the HSD17B13 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of the HSD17B13 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.
[0163] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3’ end, the 5’ end, or both the 3’ and 5’ end of the core segment sequence. The additional nucleotides of the antisense strand, if present, can or can not be complementary to the corresponding sequence in the HSD17B13 mRNA. The additional nucleotides of the sense strand, if present, can or can not be identical to the corresponding sequence in the HSD17B13 mRNA. The additional nucleotides of the antisense strand, if present, can or can not be complementary to the additional nucleotides of the corresponding sense strand, if present.
[0164] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of a sense strand core segment sequence and / or an antisense strand core segment sequence. The extension nucleotides on the sense strand can or can not be complementary to the nucleotides (or core segment sequence nucleotides or extension nucleotides) in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand can or can not be complementary to the nucleotides (or core segment nucleotides or extension nucleotides) in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain a 3' and 5' extension. In some embodiments, one or more 3' extension nucleotides of one strand base pair with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, the HSD17B13 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extension nucleotides are unpaired and form overhangs. As used herein, an "overhang" refers to one or more segments of unpaired nucleotides located at the end of a sense strand or an antisense strand that do not form part of the hybridized or duplex portion of the RNAi agent disclosed herein.
[0165] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand with a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the HSD17B13 RNAi agent comprises an antisense strand with a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding HSD17B13 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding HSD17B13 mRNA sequence.
[0166] In some embodiments, the HSD17B13 RNAi agent comprises a sense strand with a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or equivalent to nucleotides in the HSD17B13 mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, but is not limited thereto: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3').
[0167] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the HSD17B13 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise a nucleotide corresponding to or identical to a nucleotide in the HSD17B13 mRNA sequence. In some embodiments, the sense strand 5' extension is one of, but not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5' to 3').
[0168] Examples of sequences used to form HSD17B13 RNAi agents are provided in Tables 2, 3, and 4. In some embodiments, the antisense strand of a HSD17B13 RNAi agent comprises the sequence of any sequence in Table 2 or 3. In certain embodiments, the antisense strand of a HSD17B13 RNAi agent comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the antisense strand of a HSD17B13 RNAi agent comprises the sequence of nucleotides (5' end 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 119, 2-19, 1-20, 2-20, 1-21, or 2-21 of any sequence in Table 2 or 3. In some embodiments, the sense strand of a HSD17B13 RNAi agent comprises the sequence of any sequence in Table 2 or 4. In some embodiments, the sense strand of a HSD17B13 RNAi agent comprises the sequence of nucleotides (5' end 3' end) 1-18, 1-19, 1-20, 121, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any sequence in Table 2 or Table 4. In certain embodiments, the sense strand of a HSD17B13 RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 4.
[0169] In some embodiments, the sense strand and the antisense strand of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense strand and the antisense strand of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, both ends of the RNAi agent form a blunt end. In some embodiments, neither end of the RNAi agent is a blunt end. As used herein, "blunt end" refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).
[0170] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form a frayed end. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang), but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides can be on the sense strand or the antisense strand, resulting in a 3' or 5' overhang. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Typically, when present, overhangs are at the 3' terminus of the sense strand, the antisense strand, or both the sense strand and the antisense strand.
[0171] The HSD17B13 RNAi agents disclosed herein can also comprise one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the HSD17B13 RNAi agent are modified nucleotides. The HSD17B13 RNAi agents disclosed herein can further comprise one or more modified internucleoside linkages, such as one or more phosphorothioate linkages. In some embodiments, the HSD17B13 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, the 2'-modified nucleotides are combined with modified internucleoside linkages.
[0172] In some embodiments, the HSD17B13 RNAi agents are prepared or provided as a salt, a mixed salt, or as a free acid. In some embodiments, the HSD17B13 RNAi agents are prepared as sodium salts. Such forms are well known in the art and are within the scope of the application disclosed herein.
[0173] Modified nucleotides
[0174] When used in various oligonucleotide constructs, modified nucleotides can preserve the activity of the compounds in cells, while increasing the serum stability of these compounds, and can also minimize the potential to activate interferon activity in humans upon administration of the oligonucleotide constructs.
[0175] In some embodiments, the HSD17B13 RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, a modified nucleotide can include, but is not limited to, a deoxyribonucleotide, a nucleotide mimic, an abasic nucleotide, a 2'-modified nucleotide, an inverted nucleotide, a nucleotide comprising a modified nucleobase, a bridged nucleotide, a peptide nucleic acid (PNA), a 2',3'-seco nucleotide mimic (unlocked nucleobase analog), a locked nucleotide, a 3'-0-methoxy (2' internucleosidic linkage) nucleotide, a 2'-F- arabinonucleotide, a 5'-Me, 2'-fluoro nucleotide, a morpholino nucleotide, a vinyl phosphonate deoxyribonucleotide, a vinyl phosphonate-containing nucleotide, and a cyclopropyl phosphonate-containing nucleotide. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-0-methyl nucleotides, 2'-fluoro nucleotides (also referred to herein as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-0-2-methoxyethyl) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. All positions in a given compound need not be uniformly modified. Rather, a single HSD17B13 RNAi agent, or even a single nucleotide thereof, can incorporate more than one modification. The sense and antisense strands of the HSD17B13 RNAi agent can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.
[0176] Modified nucleobases include synthetic and naturally occurring nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, such as 2- aminopropyladenine, 5-propynyluracil or 5-propynylcytosine, 5-methylcytosine (5-me-C), 5- hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6- methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2- methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5- propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.
[0177] In some embodiments, the 5' and / or 3' end of the antisense strand can include an abasic residue (Ab), which can also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Patent No. 5,998,203.) In some embodiments, an abasic residue can be placed internally within a nucleotide sequence. In some embodiments, an Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, a UUAb, UAb or Ab is added to the 3' end of the sense strand. In some embodiments, an abasic (deoxyribo) residue can be replaced with a ribitol (abasic ribose) residue.
[0178] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (i.e., unmodified) in both the sense strand and the antisense strand. As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides.
[0179] Modified internucleoside linkages
[0180] In some embodiments, one or more nucleotides of the HSD17B13 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (denoted herein as lower case "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methyl- or 3'-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-amino phosphoramidates, aminoalkyl phosphoramidates, or thio-carb amo phosphoramidates), thioalkylphosphonates, thioalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3'-5' linkages, 2'-5' linked boranophosphates, or boranophosphates having inverted polarity wherein the 3'-5' linkage is linked 5'-3' or the 2'-5' linkage is linked 5'-2'. In some embodiments, the modified internucleoside linkages or backbones lack a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. In some embodiments, the modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene
[0181] In some embodiments, the sense strand of the HSD17B13 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the HSD17B13 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of the HSD17B13 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the HSD17B13 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.
[0182] In some embodiments, the sense strand of the HSD17B13 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are at the 5' end of the sense strand and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate internucleoside linkages between nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5' and 3' ends and an optionally present inverted abasic residue terminal cap. In some embodiments, the targeting ligand is attached to the sense strand via a phosphorothioate linkage.
[0183] In some embodiments, the antisense strand of the HSD17B13 RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 5' end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphorothioate internucleoside linkages are between positions 1-4 from the 5' end of the antisense strand and the fourth phosphorothioate internucleoside linkage is between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the HSD17B13 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.
[0184] Capping residues or moieties
[0185] In some embodiments, the sense strand can include one or more capping residues or moieties, sometimes referred to in the art as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of the nucleotide sequence of an RNAi agent disclosed herein. In some cases, a capping residue can provide certain beneficial properties to the RNAi agent, such as protection from exonuclease degradation. In some embodiments, an inverted abasic residue (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table A). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues as well as carbon chains, such as terminal C3H7 (propyl), C6H 13 ( hexyl), or C 12 H 25 (dodecyl) groups. In some embodiments, a capping residue is present at the 5' terminus, the 3' terminus, or both the 5' and 3' termini of the sense strand. In some embodiments, the 5' end and / or the 3' end of the sense strand can include more than one inverted abasic deoxyribose moiety as a capping residue.
[0186] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near one or more termini of the sense strand of the RNAi agent allows for enhanced activity or other desirable properties of the RNAi agent.
[0187] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the nucleotide sequence of the targeting ligand and the sense strand of the RNAi agent. The inverted abasic residues can be connected via a phosphoester, a phosphorothioate (e.g., shown as (invAb)s herein), or other internucleoside linkage. In some embodiments, inclusion of one or more inverted abasic residues at or near one or more termini of the sense strand of the RNAi agent can allow for enhanced activity or other desirable properties of the RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core segment sequence or the 3' end of the antisense strand sequence can include an inverted abasic residue. Inverted abasic deoxyribose residues are shown in the chemical structures in Table 6 below and in Figures 1A to 10D
[0188] HSD17B13 RNAi agents
[0189] The HSD17B13 RNAi agents disclosed herein are designed to target specific positions on the HSD17B13 gene (SEQ ID NO: 1). As defined herein, an antisense strand sequence is designed to target the HSD17B13 gene at a given position on the gene when the 5' terminal nucleobase of the antisense strand, when base paired with the gene, is aligned with a position that is 21 nucleotides downstream (toward the 3' end) from the position on the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the HSD17B13 gene at position 499 requires that, when base paired with the gene, the 5' terminal nucleobase of the antisense strand is aligned with position 519 of the HSD17B13 gene.
[0190] As provided herein, the HSD17B13 RNAi agent does not require that the nucleobase at position 1 (5'→ 3') of the antisense strand be complementary to the gene, provided that the antisense strand and the gene are at least 85% complementary (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary) across a core segment sequence spanning at least 16 contiguous nucleotides. For example, for the HSD17B13 RNAi agent disclosed herein designed to target position 499 of the HSD17B13 gene, the 5' terminal nucleobase of the antisense strand of the HSD17B13 RNAi agent must align with position 519 of the gene; however, the 5' terminal nucleobase of the antisense strand can but does not require complementarity to position 519 of the HSD17B13 gene, provided that the antisense strand and the gene are at least 85% complementary (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary) across a core segment sequence spanning at least 16 contiguous nucleotides. As shown by the various examples disclosed herein, the gene through the specific binding site of the antisense strand of the HSD17B13 RNAi agent (e.g., whether the HSD17B13 RNAi agent is designed to target the HSD17B13 gene at position 499, position 791, position 513, or some other position) is important for the level of inhibition achieved by the HSD17B13 RNAi agent.
[0191] In some embodiments, the HSD17B13 RNAi agents disclosed herein target the HSD17B13 gene at or near the positions of the HSD17B13 gene sequence set forth in Table 1. In some embodiments, the antisense strand of the HSD17B13 RNAi agents disclosed herein comprises a core segment sequence that is fully complementary, substantially complementary, or at least partially complementary to the target HSD17B13 19-mer sequences disclosed in Table 1.
[0192] Table 1. HSD17B13 19-mer mRNA target sequences (taken from Homo sapiens (human) (SEQ ID NO: 1) homo sapiens )Hydroxysteroid 17-beta dehydrogenase 13 (HSD17B13), transcript variant A, GenBank NM_178135.4 (SEQ ID NO: 1)
[0193]
[0194] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand, wherein position 19 of the antisense strand (5' 3') is capable of forming a base pair with position 1 of a 19mer target sequence disclosed in Table 1. In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand, wherein position 1 of the antisense strand (5' 3') is capable of forming a base pair with position 19 of a 19mer target sequence disclosed in Table 1.
[0195] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand, wherein position 2 of the antisense strand (5' 3') is capable of forming a base pair with position 18 of a 19mer target sequence disclosed in Table 1. In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand, wherein positions 2 to 18 of the antisense strand (5' 3') are each capable of forming a base pair with a respective complementary base located at positions 18 to 2, respectively, of a 19mer target sequence disclosed in Table 1.
[0196] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5' end 3' end) can be fully complementary to the HSD17B13 gene, or can not be complementary to the HSD17B13 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end 3' end) is a U, an A, or a dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end 3' end) forms an A:U or U:A base pair with the sense strand.
[0197] In some embodiments, the antisense strand of the HSD17B13 RNAi agent comprises the sequence of nucleotides (from the 5' end 3' end) 2-18, 2-19, 2-20, or 2-21 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of the HSD17B13 RNAi agent comprises the sequence of nucleotides (from the 5' end 3' end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 2-19, 2-18, or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
[0198] In some embodiments, the HSD17B13 RNAi agent comprises: (i) an antisense strand comprising the sequence of nucleotides (from the 5' end 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from the 5' end 3' end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 2-19, 2-18, or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
[0199] In some embodiments, the HSD17B13 RNAi agents include the core 19-mer nucleotide sequences set forth in Table 2 below.
[0200] Table 2. Antisense and sense core segment base sequences for HSD17B13 RNAi agents (N = any nucleobase; I = inosine (inosine nucleotide))
[0201]
[0202] The sense and antisense strands of the HSD17B13 RNAi agents comprising or consisting of the sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the HSD17B13 RNAi agents having sense and antisense strand sequences comprising or consisting of the sequences in Table 2 are all or substantially all modified nucleotides.
[0203] In some embodiments, the antisense strand of the HSD17B13 RNAi agents disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the HSD17B13 RNAi agents disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.
[0204] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.
[0205] The antisense strands of certain modified HSD17B13 RNAi agents are provided in Table 3, along with their potential unmodified nucleobase sequences. The sense strands of certain modified HSD17B13 RNAi agents are provided in Table 4, along with their potential unmodified nucleobase sequences. Each nucleotide in each of the potential base sequences listed in Tables 3 and 4 above and Table 2 can be a modified nucleotide when forming the HSD17B13 RNAi agents.
[0206] The HSD17B13 RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0207] In some embodiments, an antisense strand of a HSD17B13 RNAi agent comprises the nucleotide sequence of any sequence in Table 2 or Table 3.
[0208] In some embodiments, a HSD17B13 RNAi agent comprises or consists of a duplex having the nucleobase sequence of a sense strand and an antisense strand of any sequence in Table 2, Table 3, or Table 4.
[0209] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.
[0210] As used in Table 3 and Table 4, the following symbols are used to indicate modified nucleotides and linking groups:
[0211] A = adenosine-3'-phosphate;
[0212] C = cytidine-3'-phosphate;
[0213] G = guanosine-3'-phosphate;
[0214] U = uridine 3'-phosphate
[0215] I = inosine 3'-phosphate
[0216] a = 2'-O-methyladenosine-3'-phosphate
[0217] as = 2'-O-methyladenosine-3'-phosphorothioate
[0218] c = 2'-O-methylcytidine-3'-phosphate
[0219] cs = 2'-O-methylcytidine-3'-phosphorothioate
[0220] g = 2'-O-methylguanosine-3'-phosphate
[0221] gs = 2'-O-methylguanosine-3'-phosphorothioate
[0222] t = 2'-O-methyl-5-methyluridine-3'-phosphate
[0223] ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate
[0224] u = 2'-O-methyluridine-3'-phosphate
[0225] us = 2'-O-methyluridine-3'-phosphorothioate
[0226] i = 2'-O-methylinosine-3'-phosphate
[0227] is = 2'-O-methylinosine-3'-phosphorothioate
[0228] Af = 2'-fluoro-adenosine-3'-phosphate
[0229] Afs = 2'-fluoro-adenosine-3'-phosphorothioate
[0230] Cf = 2'-fluoro-cytidine-3'-phosphate
[0231] Cfs = 2'-fluoro-cytidine-3'-phosphorothioate
[0232] Gf = 2'-fluoro-guanosine-3'-phosphate
[0233] Gfs = 2'-fluoro-guanosine-3'-phosphorothioate
[0234] Tf = 2'-fluoro-5'-methyluridine-3'-phosphate
[0235] Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate
[0236] Uf = 2'-fluoro-uridine-3'-phosphate
[0237] Ufs = 2'-fluoro-uridine-3'-phosphorothioate
[0238] A UNA = 2',3'-seco-adenosine-3'-phosphate
[0239] A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate
[0240] C UNA = 2',3'-seco-cytidine-3'-phosphate
[0241] C UNA s = 2',3'-seco-cytidine-3'-phosphorothioate
[0242] G UNA = 2',3'-seco-guanosine-3'-phosphate
[0243] G UNA s = 2',3'-cyclic- guanosine 3'-thiophosphate
[0244] U UNA = 2',3'-cyclic- uridine-3'-phosphate
[0245] U UNA s = 2',3'-cyclic- uridine-3'-thiophosphate
[0246] a_2N = see Table 6
[0247] a_2Ns = see Table 6
[0248] (invAb) = inverted abasic deoxyribonucleotide, see Table 6
[0249] (invAb)s = inverted abasic deoxyribonucleotide-5'-thiophosphate, see Table 6
[0250] As will be readily appreciated by one of ordinary skill in the art, unless otherwise indicated by the sequence (e.g., by a thiophosphate linkage“s”), when present in an oligonucleotide, nucleotide monomers are connected to one another by 5'-3'-phosphodiester linkages. As will be clear to one of ordinary skill in the art, as shown in the modified nucleotide sequences disclosed herein, thiophosphate linkages include replacement of the phosphodiester linkages normally present in an oligonucleotide (see, e.g., the chemical structures shown in Figures 1A to 10D , and the schematic shown in Figures 11A to 11E , showing all of the internucleoside linkages in certain HSD17B13 RNAi agents). Further, as will be readily appreciated by one of ordinary skill in the art, the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the corresponding 3' position of the given monomer rather than an exocyclic phosphate moiety. Additionally, for the embodiments disclosed herein, inverted abasic residues are inserted such that the 3' position of the deoxyribose is connected at the 3' end of the preceding monomer on the corresponding strand when the corresponding strand 5'→3' is viewed (see, e.g., Figures 1A to 10D , and Table 6). Moreover, as will be readily appreciated and understood by one of ordinary skill in the art, although the thiophosphate chemical structures depicted herein typically show an anion on the sulfur atom, the present application disclosed herein encompasses all thiophosphate tautomers (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Such understanding by one of ordinary skill in the art is used when describing the HSD17B13 RNAi agents and compositions of HSD17B13 RNAi agents disclosed herein, unless otherwise explicitly indicated herein.
[0251] Certain examples of targeting ligands, targeting groups, and linking groups for use with the HSD17B13 RNAi agents disclosed herein are provided in Table 6 below. More specifically, targeting groups and linking groups, which can together form a targeting ligand, include the following, for which the chemical structure is provided in Table 6 below: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and / or antisense strand can have any of the targeting ligands, targeting groups, or linking groups listed herein conjugated to the 5' and / or 3' end of the sequence, as well as other groups.
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260] The HSD17B13 RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over an adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0261] In some embodiments, the antisense strand of a HSD17B13 RNAi reagent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of a HSD17B13 RNAi reagent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.
[0262] In some embodiments, the antisense strand of a HSD17B13 RNAi reagent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the antisense strand of a HSD17B13 RNAi reagent comprises the nucleotides (from 5' end 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2 or Table 3. In certain embodiments, the antisense strand of a HSD17B13 RNAi reagent comprises or consists of the modified sequence of any of the modified sequences in Table 3.
[0263] In some embodiments, the sense strand of a HSD17B13 RNAi reagent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of a HSD17B13 RNAi reagent comprises the nucleotides (from 5' end 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21 of any of the sequences in Table 2 or Table 4. In certain embodiments, the sense strand of a HSD17B13 RNAi reagent comprises or consists of the modified sequence of any of the modified sequences in Table 4.
[0264] For a HSD17B13 RNAi reagent disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end 3' end) can be fully complementary to the HSD17B13 gene, or can not be complementary to the HSD17B13 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end 3' end) is U, A, or dT (or a modified form thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end 3' end) forms an A:U or U:A base pair with the sense strand.
[0265] The sense strand containing the sequence listed in Table 2 or Table 4 can hybridize with any of the antisense strands containing the sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over an adjacent 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the HSD17B13 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3. Certain representative sequence pairings are exemplified by duplex ID No. shown in Table 5.
[0266] In some embodiments, the HSD17B13 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID Nos. presented herein. In some embodiments, the HSD17B13 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any duplex represented by any duplex ID No. presented herein. In some embodiments, the HSD17B13 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any duplex represented by any duplex ID No. presented herein, and a targeting group and / or a linking group, wherein the targeting group and / or linking group is covalently attached (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, the HSD17B13 RNAi agent comprises the modified nucleotide sequences of the sense strand and antisense strand of any duplex ID No. presented herein. In some embodiments, the HSD17B13 RNAi agent comprises the modified nucleotide sequences of the sense strand and antisense strand of any duplex ID No. presented herein, and a targeting group and / or a linking group, wherein the targeting group and / or linking group is covalently attached to the sense strand or the antisense strand.
[0267] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any antisense strand / sense strand duplex of Table 2 or Table 5, and further comprises a targeting group or a targeting ligand. In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any antisense strand / sense strand duplex of Table 2 or Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.
[0268] The targeting group, with or without a linker, can be attached to the 5' end or 3' end of any of the sense strands and / or antisense strands disclosed in Tables 2, 3, and 4. The linker, with or without a targeting group, can be attached to the 5' end or 3' end of any of the sense strands and / or antisense strands disclosed in Tables 2, 3, and 4.
[0269] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes of Table 2 or Table 5, and further comprises a targeting ligand selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, each as defined in Table 6. In some embodiments, the targeting ligand is (NAG25) or (NAG25)s as defined in Table 6. In other embodiments, the targeting ligand is (NAG37) or (NAG37)s as defined in Table 6.
[0270] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.
[0271] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes of Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.
[0272] In some embodiments, the HSD17B13 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Table 5.
[0273] Table 5. HSD17B13 RNAi agent duplexes with corresponding sense and antisense strand ID numbers
[0274]
[0275]
[0276] In some embodiments, the HSD17B13 RNAi agents are prepared or provided as salts, mixed salts, or free acids. Upon delivery to cells expressing the HSD17B13 gene, the RNAi agents described herein inhibit or knockdown expression of one or more HSD17B13 genes in vivo and / or in vitro.
[0277] Targeting ligands or groups, linking groups, and delivery vehicles
[0278] In some embodiments, the HSD17B13 RNAi agents are conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linking groups, targeting ligands, delivery polymers, or delivery vehicles. The non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agents. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide groups can be covalently linked to the 3’ end and / or 5’ end of the sense strand and / or the antisense strand. In some embodiments, the HSD17B13 RNAi agents contain a non-nucleotide group linked to the 3’ end and / or 5’ end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5’ end of the sense strand of the HSD17B13 RNAi agent. The non-nucleotide groups can be linked to the RNAi agents directly or indirectly via a linker / linking group. In some embodiments, the non-nucleotide groups are linked to the RNAi agents via a labile, cleavable, or reversible bond or linker.
[0279] In some embodiments, the non-nucleotide groups enhance the pharmacokinetic or biodistribution properties of the RNAi agents or conjugates to which they are attached to improve the cell- or tissue-specific distribution and cell-specific uptake of the RNAi agents or conjugates. In some embodiments, the non-nucleotide groups enhance the endocytosis of the RNAi agents.
[0280] The targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi agents to which they are attached to improve the cell-specific (in some cases, including organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi agents. The targeting groups can be monovalent, divalent, trivalent, tetravalent, or of higher valency for the target to which it is directed. Representative targeting groups include but are not limited to compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics (with affinity for cell surface molecules).
[0281] In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker, or one, two, or three abasic and / or ribosaccharide (abasic ribose) residues, which in some cases can act as linkers. In some embodiments, the targeting ligand comprises a cluster of galactose derivatives.
[0282] The HSD17B13 RNAi agents described herein can be synthesized with a reactive group, such as an amino group (also referred to herein as an amine), at the 5' terminus and / or the 3' terminus. The reactive group can then be used for attachment of a targeting moiety using methods generally known in the art.
[0283] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand that contains a compound that has affinity for an asialoglycoprotein receptor. As noted herein, asialoglycoprotein receptors are highly expressed on hepatocytes. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose that have an affinity for an asialoglycoprotein receptor that is equal to or greater than the affinity of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formyl galactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine, and N-isobutyryl-galactosamine (see, e.g., S.T. Iobst and K. Drickamer, J.B.C., 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives that can be used to target oligonucleotides and other molecules to the liver in vivo are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).
[0284] Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to asialoglycoprotein receptors expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to asialoglycoprotein receptors facilitates cell-specific targeting of hepatocytes and endocytosis of the molecule into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative, also referred to as monovalent or monodentate), or multimeric (e.g., having multiple galactose derivatives). Galactose derivatives or clusters of galactose derivatives can be attached to the 3’ or 5’ end of the sense or antisense strand of an RNAi agent using methods known in the art. Preparation of targeting ligands, such as clusters of galactose derivatives, is described, for example, in International Patent Application Publication No. WO 2018 / 044350 to Arrowhead Pharmaceuticals, Inc., and International Patent Application Publication No. WO 2017 / 156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated herein by reference in their entirety.
[0285] As used herein, a cluster of galactose derivatives comprises a molecule having two to four terminal galactose derivatives. The terminal galactose derivatives are attached to the molecule through their C-1 carbon. In some embodiments, the cluster of galactose derivatives is a galactose derivative trimer (also referred to as a triantennary galactose derivative or a trivalent galactose derivative). In some embodiments, the cluster of galactose derivatives comprises N-acetyl-galactosamine. In some embodiments, the cluster of galactose derivatives comprises three N-acetyl-galactosamines. In some embodiments, the cluster of galactose derivatives is a galactose derivative tetramer (also referred to as a tetraantennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the cluster of galactose derivatives comprises four N-acetyl-galactosamines.
[0286] As used herein, a galactose derivative trimer contains three galactose derivatives each attached to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives each attached to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are connected to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, e.g., U.S. Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995, Vol. 39, pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of three galactose derivatives, and further allows for the attachment of the branch point to the RNAi agent. An example of a branch point group is a di-lysine or di-glutamic acid salt. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as but not limited to a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster consists of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.
[0287] Embodiments of the present disclosure include pharmaceutical compositions for delivering a HSD17B13 RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, for example, a HSD17B13 RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster consists of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.
[0288] A targeting ligand or targeting group can be attached to the 3’ end or 5’ end of the sense strand or antisense strand of the HSD17B13 RNAi agents disclosed herein.
[0289] Targeting ligands include, but are not limited to, (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s, which are defined in Table 6. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.
[0290] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, a delivery polymer, or a delivery vehicle. The linking group can be attached to the 3’ end and / or 5’ end of the sense strand or the antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5’ end or 3’ end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5’ end of the sense strand of the RNAi agent. Examples of linking groups can include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.
[0291] In some embodiments, the targeting group is attached internally to a nucleotide on the sense strand and / or the antisense strand of the RNAi agent. In some embodiments, the targeting group is attached to the RNAi agent via a linker.
[0292] A linker or linking group is a connection between two atoms that connects one chemical group (e.g., an RNAi agent) or segment of interest to another chemical group (e.g., a targeting group or a delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. The linkage can optionally include a spacer that increases the distance between the two connected atoms. The spacer can further increase the flexibility and / or length of the linkage. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the previous list is not meant to limit the scope of the present specification.
[0293] In some embodiments, when two or more RNAi reagents are included in a single composition, each RNAi reagent may be linked to the same target group or two different target groups (i.e., target groups with different chemical structures). In some embodiments, the target group is linked to the HSD17B13 RNAi reagent disclosed herein without the use of an additional adapter. In some embodiments, the target group itself is designed to have adapters or other sites to facilitate readily available conjugation. In some embodiments, when two or more RNAi reagents are included in a single composition, each RNAi reagent may utilize the same adapter or different adapters (i.e., adapters with different chemical structures).
[0294] Any HSD17B13 RNAi reagent nucleotide sequence listed in Tables 2, 3, or 4, whether modified or unmodified, may contain a 3' and / or 5' targeting group or linker group. Any HSD17B13 RNAi reagent sequence containing a 3' or 5' targeting group or linker group, listed in Tables 3 or 4, or described elsewhere herein, may alternatively omit a 3' or 5' targeting group or linker group, or may contain different 3' or 5' targeting groups or linker groups, including but not limited to those depicted in Table 6. Any HSD17B13 RNAi reagent duplex listed in Table 5, whether modified or unmodified, may further contain a targeting group or linker group, including but not limited to those described in Table 6, and the targeting group or linker group may be attached to the 3' or 5' end of the sense or antisense strand of the HSD17B13 RNAi reagent duplex.
[0295] Table 6 provides examples of targeting groups and linking groups (which, when combined, can form targeting ligands). Table 4 provides several embodiments of the sense strand of the HSD17B13 RNAi reagent, the sense strand having a targeting group or linking group attached to the 5' or 3' end.
[0296] Table 6. Structures representing various modified nucleotides, targeting ligands or targeting groups, capped residues, and linker groups.
[0297]
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
[0307]
[0308]
[0309]
[0310]
[0311]
[0312] In each of the above structures in Table 6, NAG comprises N-acetyl-galactosamine or another galactose derivative, as understood by one of ordinary skill in the art in view of the above structures and the description provided herein to be attached. For example, in some embodiments, the NAG in the provided structures is N-acetyl-galactosamine.
[0313] Each (NAGx) can be attached to the HSD17B13 RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group (as in (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group.
[0314]
[0315] Other linking groups known in the art can be used.
[0316] In some embodiments, a delivery vehicle can be used to deliver the RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves the delivery of the RNAi agent to a cell or tissue. The delivery vehicle can include or consist of, but is not limited to, a polymer, such as an amphiphilic polymer, a membrane active polymer, a peptide, a melittin, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine. In some embodiments, the RNAi agent can be combined with a lipid, a nanoparticle, a polymer, a liposome, a micelle, a DPC, or other delivery system available in the art. The RNAi agent can also be chemically conjugated to a targeting group, a lipid (including but not limited to cholesterol and cholesterol-based derivatives), a nanoparticle, a polymer, a liposome, a micelle, a DPC (see, e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), a hydrogel, a cyclodextrin, a biodegradable nanocapsule, and a bioadhesive microsphere, a protein carrier, or other delivery system suitable for nucleic acid or oligonucleotide delivery as known and available in the art.
[0317] Pharmaceutical compositions and formulations
[0318] The HSD17B13 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, the pharmaceutical compositions include at least one HSD17B13 RNAi agent. These pharmaceutical compositions can be particularly useful for inhibiting target mRNA expression in a target cell, cell population, tissue, or organism.
[0319] The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from a reduction in target HSD17B13 mRNA levels or inhibition of target gene expression. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease, disorder, or condition that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method includes administering an HSD17B13 RNAi agent linked to a targeting ligand as described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition including the HSD17B13 RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.
[0320] The pharmaceutical compositions and methods disclosed herein comprising HSD17B13 RNAi agents reduce target mRNA levels in a cell, population of cells, cell population, tissue, organ, or subject, comprising inhibiting HSD17B13 mRNA expression in a subject by administering to the subject a therapeutically effective amount of a HSD17B13 RNAi agent described herein. In some embodiments, the subject has been previously identified or diagnosed as having pathogenic upregulation of a target gene in a target cell or tissue. In some embodiments, the subject has been previously identified or diagnosed as having NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease such as cirrhosis. In some embodiments, the subject has symptoms associated with NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease such as cirrhosis.
[0321] In some embodiments, the pharmaceutical compositions comprising HSD17B13 RNAi agents are used to treat or manage a clinical manifestation in a subject associated with NAFLD, NASH, liver fibrosis, alcoholic or non-alcoholic liver disease including cirrhosis, and / or overexpression of HSD17B13. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed HSD17B13 RNAi agents can be used to reduce the number, severity, and / or frequency of symptoms of a disease in a subject.
[0322] The pharmaceutical compositions comprising HSD17B13 RNAi agents can be used to treat at least one symptom in a subject having a disease or condition that would benefit from a reduction or inhibition of HSD17B13 mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising HSD17B13 RNAi agents is administered to a subject, thereby treating the symptom. In other embodiments, a prophylactically effective amount of one or more HSD17B13 RNAi agents is administered to a subject, thereby preventing or inhibiting at least one symptom.
[0323] The route of administration is the path by which the HSD17B13 RNAi agent comes into contact with the body. Generally, methods of administering drugs, as well as oligonucleotides and nucleic acids, for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The HSD17B13 RNAi agents disclosed herein can be administered via any suitable route in a formulation that is appropriately tailored to the particular route. Thus, the pharmaceutical compositions described herein can be administered by, for example, intravenous, intramuscular, intradermal, subcutaneous, intraarticular, or intraperitoneal injection. In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.
[0324] The pharmaceutical compositions comprising the HSD17B13 RNAi agents described herein can be delivered to a cell, cell population, tissue, or subject using oligonucleotide delivery techniques known in the art. Generally, any suitable method for delivering nucleic acid molecules (in vitro or in vivo) that is recognized in the art as appropriate can be adapted for use with the compositions described herein. For example, delivery can be by topical administration (e.g., direct injection, implantation, or topical application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or local (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.
[0325] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0326] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one therapeutic compound described and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient is a substance other than an active pharmaceutical ingredient (API, therapeutic product, e.g., HSD17B13 RNAi agent) that is intentionally included in a drug delivery system. An excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. Excipients can act to: a) aid in the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptance of the API, c) aid in product identification, and / or d) enhance the overall safety, effectiveness of any other attribute of API delivery during storage or use. A pharmaceutically acceptable excipient can or can not be an inert substance.
[0327] Excipients include, but are not limited to, absorption enhancers, anti-adherents, antifoaming agents, antioxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorants, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water repellents, and wetting agents.
[0328] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). The suitable carrier should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by the inclusion of agents which delay absorption, for example, aluminum monostearate and gelatin.
[0329] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0330] In some embodiments, pharmaceutical formulations suitable for subcutaneous administration can be prepared in a sodium phosphate aqueous buffer, including HSD17B13 RNAi agents disclosed herein (e.g., HSD17B13 RNAi agents formulated in a 0.5 mM sodium monobasic phosphate, 0.5 mM sodium dihydrogen phosphate aqueous solution).
[0331] Formulations suitable for intra-articular administration can be in the form of sterile aqueous preparations of the drug, which can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for intra-articular and intraocular administration.
[0332] Formulations suitable for oral administration of the HSD17B13 RNAi agents disclosed herein can also be prepared. In some embodiments, the HSD17B13 RNAi agents disclosed herein are administered orally. In some embodiments, the HSD17B13 RNAi agents disclosed herein are formulated in a capsule for oral administration.
[0333] The active compounds can be prepared with carriers that protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for
[0334] The HSD17B13 RNAi agents can be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such active compound for the treatment of individuals.
[0335] The pharmaceutical compositions can contain other additional components conventionally found in pharmaceutical compositions. Such additional components include, but are not limited to: antipruritics, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also contemplated that a cell, tissue, or isolated organ expressing or comprising an RNAi agent as defined herein can be used as a “pharmaceutical composition.” As used herein, a “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to the amount of an RNAi agent that produces a pharmacological, therapeutic, or prophylactic result.
[0336] In some embodiments, in addition to administering an RNAi agent disclosed herein, the methods disclosed herein further comprise the step of administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another HSD17B13 RNAi agent (e.g., an HSD17B13 RNAi agent that targets a different sequence within the HSD17B13 target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, or an aptamer.
[0337] In some embodiments, the HSD17B13 RNAi agent is optionally combined with one or more additional therapeutic agents. The HSD17B13 RNAi agent and additional therapeutic agent(s) can be administered in a single composition, or they can be administered separately. In some embodiments, the one or more additional therapeutic agents are administered separately in a separate dosage form from the RNAi agent (e.g., the HSD17B13 RNAi agent is administered by subcutaneous injection, while the additional therapeutic agent involved in the method of therapeutic dosing regimen is administered orally). In some embodiments, the HSD17B13 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and one or more optional additional therapeutic agents are administered orally, which together provide a therapeutic regimen for diseases and conditions associated with NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease including cirrhosis. In some embodiments, the HSD17B13 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and one or more optional additional therapeutic agents are administered via separate subcutaneous injections. In some embodiments, the HSD17B13 RNAi agent and one or more additional therapeutic agents are combined into a single dosage form (e.g., formulated as a “cocktail” for subcutaneous injection in a single composition). The HSD17B13 RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.
[0338] Generally, an effective amount of a HSD17B13 RNAi agent is in the range of about 0.1 to about 100 mg / kg body weight / dose, e.g., about 1.0 to about 50 mg / kg body weight / dose. In some embodiments, an effective amount of the active compound is in the range of about 0.25 to about 5 mg / kg body weight / dose. In some embodiments, an effective amount of the active ingredient is in the range of about 0.5 to about 4 mg / kg body weight / dose. The dosage can be given once a week, once every two weeks, once a month or at any other interval, depending on the dosage of the HSD17B13 RNAi agent administered, the level of activity of the particular HSD17B13 RNAi agent, and the level of inhibition desired for the particular subject. The examples herein show appropriate levels of inhibition in certain animal species. The amount administered will depend on such variables as the overall health of the patient, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. In addition, it is understood that the initial dose administered can be increased beyond the upper levels noted above to rapidly reach the desired blood or tissue levels, or the initial dose can be less than the optimal dose.
[0339] For the treatment of a disease or for the formation of a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein, including HSD17B13 RNAi agents, can be combined with an excipient or a second therapeutic agent or therapy, including but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.
[0340] When incorporated into pharmaceutically acceptable excipients or adjuvants, the HSD17B13 RNAi agents described can be packaged into kits, containers, packages, or dispensers. The pharmaceutical compositions described herein can be packaged into pre-filled syringes or vials.
[0341] Methods of treatment and inhibition of expression
[0342] The HSD17B13 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or condition that would benefit from the administration of an RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from the reduction and / or inhibition of expression of HSD17B13 mRNA and / or HSD17B13 (alternatively referred to herein as 17p-HSD13) protein levels, for example, a subject that has been diagnosed with or is suffering from a symptom associated with NAFLD, NASH, liver fibrosis, or alcoholic or non-alcoholic liver disease, including cirrhosis.
[0343] In some embodiments, a therapeutically effective amount of any one or more HSD17B13 RNAi agents is administered to a subject. Treatment of a subject can include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more HSD17B13 RNAi agents described herein is administered to a subject. The subject can be a human, patient, or human patient. The subject can be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein can be to a human or animal.
[0344] The HSD17B13 RNAi agents described herein can be used to treat at least one symptom in a subject having a disease or disorder associated with HSD17B13, or having a disease or disorder mediated at least in part by HSD17B13 gene expression. In some embodiments, the HSD17B13 RNAi agents are used to treat or manage the clinical manifestations of a subject having a disease or disorder that would benefit from a reduction in HSD17B13 mRNA, or is mediated at least in part thereby. A therapeutically effective amount of one or more HSD17B13 RNAi agents described herein, or a composition containing a HSD17B13 RNAi agent, is administered to a subject. In some embodiments, the methods disclosed herein include administering to a subject to be treated a composition comprising a HSD17B13 RNAi agent described herein. In some embodiments, a prophylactically effective amount of any one or more of the HSD17B13 RNAi agents described is administered to a subject, thereby treating the subject by preventing or inhibiting at least one symptom.
[0345] In certain embodiments, the disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by HSD17B13 gene expression in a patient in need thereof, wherein the method comprises administering to the patient any HSD17B13 RNAi agent described herein.
[0346] In some embodiments, the level of gene expression and / or mRNA level of HSD17B13 gene is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% in a subject to which a HSD17B13 RNAi agent is administered relative to the subject prior to administration of the HSD17B13 RNAi agent, or a subject that has not received a HSD17B13 RNAi agent. The level of gene expression and / or mRNA level in a subject can be reduced in a cell, cell population, and / or tissue of the subject.
[0347] In some embodiments, the level of HSD17B13 protein is reduced in a subject to which a HSD17B13 RNAi agent has been administered by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to administration of the HSD17B13 RNAi agent, or a subject that has not received the HSD17B13 RNAi agent. The level of protein in the subject can be reduced in the subject’s cells, cell population, tissue, blood, and / or other fluids.
[0348] Reduction in the level of HSD17B13 mRNA and HSD17B13 protein can be assessed by any method known in the art. As used herein, a reduction or decrease in the level of HSD17B13 mRNA and / or protein is referred to herein collectively as a reduction or decrease in HSD17B13 or inhibition or reduction of expression of HSD17B13. The examples set forth herein illustrate known methods for assessing inhibition of HSD17B13 gene expression. Those of ordinary skill in the art will further know suitable methods for assessing inhibition of HSD17B13 gene expression in vivo and / or in vitro.
[0349] In some embodiments, disclosed herein are methods of treatment (including prophylactic or preventative treatment) of a disease, disorder, or symptom caused by NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease including cirrhosis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a HSD17B13 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a HSD17B13 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods of treatment (including prophylactic or preventative treatment) of a disease or symptom caused by NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease including cirrhosis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a HSD17B13 RNAi agent comprising an antisense strand comprising a sequence of any sequence in Table 2 or 3, and a sense strand comprising any sequence in Table 2 or 4 that is at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods of treatment (including prophylactic or preventative treatment) of a disease or symptom caused by NAFLD, NASH, liver fibrosis, and / or alcoholic or non-alcoholic liver disease including cirrhosis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a HSD17B13 RNAi agent comprising a sense strand comprising any sequence in Table 2 or 4, and an antisense strand comprising a sequence of any sequence in Table 2 or 3 that is at least partially complementary to the sense strand.
[0350] In some embodiments, disclosed herein are methods for inhibiting expression of a HSD17B13 gene in a cell, wherein the method comprises administering to the cell a HSD17B13 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a HSD17B13 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods of inhibiting expression of a HSD17B13 gene in a cell, wherein the method comprises administering to the cell a HSD17B13 RNAi agent comprising an antisense strand comprising a sequence of any sequence in Table 2 or 3, and a sense strand comprising any sequence in Table 2 or 4 that is at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods of inhibiting expression of a HSD17B13 gene in a cell, wherein the method comprises administering a HSD17B13 RNAi agent comprising a sense strand comprising any sequence in Table 2 or 4, and an antisense strand comprising a sequence of any sequence in Table 2 or 3 that is at least partially complementary to the sense strand.
[0351] The use of HSD17B13 RNAi agents provides methods for the therapeutic (including prophylactic) treatment of diseases / conditions associated with NAFLD, NASH, liver fibrosis, alcoholic liver disease, or non-alcoholic liver disease including cirrhosis, and / or to enhance or elevate HSD17B13 expression. The HSD17B13 RNAi agents described mediate RNA interference to inhibit the expression of one or more genes necessary for the production of HSD17B13 protein. The HSD17B13 RNAi agents can also be used to treat or prevent various diseases, conditions, or states, including NAFLD, NASH, liver fibrosis, and / or alcoholic liver disease or non-alcoholic liver disease including cirrhosis. In addition, compositions for delivering HSD17B13 RNAi agents to liver cells in vivo are described.
[0352] Cells, tissues, organs, and non-human organisms
[0353] Cells, tissues, organs, and non-human organisms comprising at least one HSD17B13 RNAi agent described herein are contemplated. The cells, tissues, organs, or non-human organisms are prepared by delivering the RNAi agent to the cells, tissues, organs, or non-human organisms.
[0354] The embodiments and items provided above are now illustrated by the following non-limiting examples. Examples
[0355] Example 1. Synthesis of HSD17B13 RNAi reagents.
[0356] The HSD17B13 RNAi agent duplexes shown in Table 5 above were synthesized according to the following general procedure:
[0357] A. Synthesis.
[0358] The sense and antisense strands of the RNAi agents were synthesized according to the phosphoramidite technique on solid phase used in oligonucleotide synthesis. Such standard synthesis is generally known in the art. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) were used. The synthesis was performed on solid supports made of controlled pore glass (CPG, 500 Å or 600 Å, from Prime Synthesis, Aston, PA, USA). Monomers placed at the 3’-end of the respective strand were attached to the solid support as a starting point for the synthesis. All RNA and 2’-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). 2’-O-methyl phosphoramidites included the following: (5’-O-dimethoxytrityl-N 6 -(benzoyl)-2’-O-methyl-adenosine-3’-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5’-O-dimethoxy-trityl-N 4 -(acetyl)-2’-O-methyl-cytidine-3’-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5’-O-dimethoxytrityl-N 2-(isobutyryl)-2'-O-methylguanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) amidite, and 5'-O-dimethoxytrityl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N- diisopropylamino) amidite. The 2'-deoxy-2'-fluoro amidite carries the same protecting groups as the 2'-O-methyl amidite. 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'- benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-amidite are also available from Thermo Fisher Scientific or Hongene Biotech. 5'-dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2- cyanoethyl-N,N-diisopropylamino) amidite is available from Glen Research (Virginia) or Hongene Biotech. The inverted deoxy base (3'-O-dimethoxytrityl-2'-deoxyribo-5'-O-(2- cyanoethyl-N,N-diisopropylamino) amidite is available from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5'-O-dimethoxytrityl-N 2 6 -(phenoxyacetate)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N- diisopropylamino) amidite is available from ChemGenes or Hongene Biotech.
[0359] Phosphoramidites containing targeting ligands were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and molecular sieves (3 Å) were added. 5-Benzylthio-lH-tetrazole (BTT, 250 mM solution in acetonitrile) or 5-ethylthio-lH-tetrazole (ETT, 250 mM solution in acetonitrile) were used as activator solutions. Coupling times were 12 minutes (RNA), 15 minutes (targeting ligand), 90 seconds (2'OMe), and 60 seconds (2'F). For the introduction of phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Unless specifically identified as "naked" RNAi agents in the absence of targeting ligands, each HSD17B13 RNAi agent duplex synthesized and tested in the examples below utilized N-acetyl-galactosamine as "NAG" in the chemical structure of the targeting ligand represented in Table 6. The chemical structures of certain duplexes used in the examples reported herein can be found in Table 6. Figures 1A to 10D
[0360] B. Cleavage and deprotection of support-bound oligomers.
[0361] After completion of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of a 40 wt% aqueous methylamine solution and a 28% ammonium hydroxide solution (Aldrich) at 30 °C for 1.5 hours. The solution was evaporated and the solid residue was reconstituted in water (see below).
[0362] C. Purification.
[0363] Crude oligos were purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 pm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, with 20% acetonitrile, and buffer B was identical to buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were pooled and then run on size exclusion HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G25 fine powder, with a running buffer of DI water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile, with filtration.
[0364] D. Annealing.
[0365] Complementary strands were mixed to form the RNAi agent by combining equimolar solutions of RNA (sense and antisense) in lx Phosphate Buffered Saline (Corning, Cellgro). Some of the RNAi agents were lyophilized and stored at -15 to -25 °C. Duplex concentration was determined by measuring the absorbance of the solution at 260 nm on a UV-Vis spectrometer in lx Phosphate Buffered Saline. The solution absorbance at 260 nm was then multiplied by a conversion factor and a dilution factor to determine the duplex concentration. The conversion factor used was 0.050 mg / (mL-cm) or calculated from the extinction coefficient determined experimentally.
[0366] Example 2. In vivo testing of HSD17B13 RNAi reagents in rats.
[0367] To evaluate the in vivo activity of HSD17B13 RNAi agents designed to target different positions on the HSD17B13 gene, Sprague Dawley rats were used. On Day 1, each rat was administered a single subcutaneous injection of 500 μΐ / 200 g animal weight containing 3.0 mg / kg (mpk) of the HSD17B13 RNAi agent, or vehicle control (saline buffer without RNAi agent), in a pharmaceutically acceptable saline buffer, according to the dosing groups described in Table 7.
[0368] Table 7. Dosing groups for Example 2
[0369] Group RNAi reagent and dose Dosing regimen 1 Saline (no RNAi reagent) Single injection at day 1 2 3.0 mg / kg AD06079 Single injection at day 1 3 3.0 mg / kg AD06080 Single injection at day 1 4 3.0 mg / kg AD06081 Single injection at day 1 5 3.0 mg / kg AD06082 Single injection at day 1 6 3.0 mg / kg AD06083 Single injection at day 1 7 3.0 mg / kg AD06084 Single injection at day 1 8 3.0 mg / kg AD06085 Single injection at day 1
[0370] Each RNAi agent included a modified sequence, as well as a tridentate N- acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand. (See Tables 3-6 for modified sequence and targeting ligand structures.) HSD17B13 RNAi agents AD06079, AD06080, and AD06081 (Groups 2, 3, and 4) each included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 488 of the gene; HSD17B13 RNAi agents AD06082 and AD06083 (Groups 5 and 6) each included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 492 of the gene; and HSD17B13 RNAi agents AD06084 and AD06085 (Groups 7 and 8) each included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 499 of the gene. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene.)
[0371] Injections (i.e., subcutaneous injections) were performed in the loose skin between the skin and muscle on the neck and shoulder area. Three (3) rats in each group were tested (n=3). All rats were sacrificed on Day 15. The liver was harvested and approximately 100 mg of liver sample was collected and snap-frozen in liquid nitrogen for RNA isolation. The relative expression of HSD17B13 mRNA for each animal from each respective treatment group was determined by qRT-PCR by normalizing the expression levels to the animals in Group 1 (vehicle control, no RNAi reagent) (ΔΔCt). The results are set forth in Table 8 below: T Analysis), the relative expression of each HSD17B13 RNAi reagent was determined by qRT-PCR, the results of which are set forth in Table 8 below:
[0372] Table 8. Relative HSD17B13 mRNA levels at Day 15 from Example 2, normalized to control
[0373]
[0374] As shown in Table 8 above, each RNAi reagent in Groups 2 through 8 showed a reduction in HSD17B13 mRNA levels at Day 15 compared to the vehicle control. For example, a single subcutaneous administration of HSD17B13 RNAi reagent AD06085 at 3.0 mg / kg showed an approximately 87% (0.131) reduction in HSD17B13 mRNA at Day 15.
[0375] Example 3. In vivo testing of HSD17B13 RNAi reagents in rats.
[0376] To evaluate the in vivo activity of additional HSD17B13 RNAi reagents, Sprague Dawley rats were used. On Day 1, each rat was administered a single subcutaneous injection of 500 μl / 200 g animal weight containing 3.0 mg / kg (mpk) of a HSD17B13 RNAi reagent, or vehicle control (saline buffer without RNAi reagent), in a pharmaceutically acceptable saline buffer, according to the dosing groups described in Table 9.
[0377] Table 9. Dosing groups for Example 3
[0378] Group RNAi reagent and dose Dosing regimen 1 Saline (no RNAi reagent) Single injection at day 1 2 3.0 mg / kg AD06081 Single injection at day 1 3 3.0 mg / kg AD06079 Single injection at day 1 4 3.0 mg / kg AD06177 Single injection at day 1 5 3.0 mg / kg AD06178 Single injection at day 1 6 3.0 mg / kg AD06179 Single injection at day 1 7 3.0 mg / kg AD06180 Single injection at day 1 8 3.0 mg / kg AD06181 Single injection at day 1 9 3.0 mg / kg AD06182 Single injection at day 1 10 3.0 mg / kg AD06183 Single injection at day 1
[0379] Each RNAi agent includes a modified sequence, as well as a trisaccharide N- acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand. (See Tables 3-6 for modified sequence and targeting ligand structures). All of the HSD17B13 RNAi agents tested (Groups 2-10) include a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 488 of the gene. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).
[0380] Injections (i.e., subcutaneous injections) were performed in the loose skin on the neck and shoulder area between the skin and muscle. Four (4) rats in each group were tested (n=4). All rats were sacrificed on Day 15. Livers were harvested, and approximately 100 mg of liver sample was collected and snap-frozen in liquid nitrogen for RNA isolation. The relative expression of HSD17B13 mRNA for each animal from each respective treatment group was determined by qRT-PCR by normalizing (ΔΔC T Analysis), the results of which are set forth in Table 10 below:
[0381] Table 10. Relative HSD17B13 mRNA levels at Day 15 from Example 3, normalized to control
[0382]
[0383] As shown in Table 10 above, each of the RNAi agents in Groups 2-10 showed a reduction in HSD17B13 mRNA levels at Day 15 compared to the vehicle control. Group 9 (AD06182) showed only about a 20% (0.800) reduction in HSD17B13 mRNA at Day 15. However, the remaining HSD17B13 RNAi agents tested (i.e., Groups 2-8 and 10) each showed about a 65% (Group 10, 0.348) to about 81% (Group 3, 0.196) reduction in HSD17B13 mRNA at Day 15 following a single subcutaneous administration.
[0384] Example 4. In vivo testing of HSD17B13 RNAi agents in rats.
[0385] To evaluate the in vivo activity of certain additional HSD17B13 RNAi agents, Sprague Dawley rats were used. On Day 1, each rat was administered a single subcutaneous injection of 500 μl / 200 g animal weight containing 3.0 mg / kg (mpk) of the HSD17B13 RNAi agent, or vehicle control (saline buffer without RNAi agent), in a pharmaceutically acceptable saline buffer, according to the dosing groups described in Table 11.
[0386] Table 11. Dosing groups for Example 4
[0387] Group RNAi agent and dose Dosing regimen 1 Saline (no RNAi agent) Single injection at day 1 2 3.0 mg / kg AD06085 Single injection at day 1 3 3.0 mg / kg AD06184 Single injection at day 1 4 3.0 mg / kg AD06185 Single injection at day 1 5 3.0 mg / kg AD06186 Single injection at day 1 6 3.0 mg / kg AD06187 Single injection at day 1 7 3.0 mg / kg AD06188 Single injection at day 1 8 3.0 mg / kg AD06189 Single injection at day 1 9 3.0 mg / kg AD06190 Single injection at day 1 10 3.0 mg / kg AD06082 Single injection at day 1 11 3.0 mg / kg AD06191 Single injection at day 1
[0388] Each RNAi agent included a modified sequence, as well as a tridentate N- acetyl-galactosamine-containing targeting ligand conjugated to the 5' end of the sense strand. (See Tables 3-6 for modified sequence and targeting ligand structures.) HSD17B13 RNAi agents AD06085, AD06184, AD06185, AD06186, AD06187, AD06188, AD06189, and AD06190 (Groups 2-9) each included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 499 of the gene; and HSD17B13 RNAi agents AD06082 and AD06191 included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 492 of the gene. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene.)
[0389] Injections (i.e., subcutaneous injections) were performed in the loose skin on the neck and shoulder area between the skin and muscle. Four (4) rats in each group were tested (n=4). All rats were sacrificed on Day 15. Livers were harvested, and approximately 100 mg of liver sample was collected and snap-frozen in liquid nitrogen for RNA isolation. Relative expression of each HSD17B13 RNAi agent was determined by qRT-PCR by normalizing the HSD17B13 mRNA expression levels from animals in each respective treatment group to the animals in Group 1 (vehicle control, no RNAi agent) (ΔΔCT analysis), the results of which are set forth in Table 12 below:
[0390] Table 12. Relative HSD17B13 mRNA levels at Day 15, normalized to control, from Example 4
[0391]
[0392] As shown in Table 12 above, each of the RNAi agents in Groups 2-11 showed a reduction in HSD17B13 mRNA levels compared to control at Day 15. More specifically, HSD17B13 RNAi agent AD06187 showed about a 90% (0.099) reduction in HSD17B13 mRNA and HSD17B13 RNAi agent AD06085 showed about a 79% (0.211) reduction in HSD17B13 mRNA at Day 15 after a single subcutaneous administration.
[0393] Example 5. In vivo testing of HSD17B13 RNAi agents in cynomolgus monkeys.
[0394] HSD17B13 RNAi agent AD06078 was evaluated in cynomolgus macaques. Two cynomolgus macaques (Macaca fascicularis) primates (also referred to herein as "cynos") were administered a 0.4 mL / kg (approximately 3 mL volume, depending on animal mass) subcutaneous injection containing 4.0 mg / kg of HSD17B13 RNAi agent AD06078 formulated in saline on Days 1 and 22. HSD17B13 RNAi agent AD06078 included modified nucleotides, as well as a tridentate N-acetyl-galactosamine-containing targeting ligand ((NAG37)s) conjugated to the 5' end of the sense strand, as shown in Tables 3-6. HSD17B13 RNAi agent AD06078 included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 1501 of the gene. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).
[0395] Liver biopsies were taken on Days -8 (pre-dose), 15, 29, and 43. On the day of each biopsy collection, the cynomolgus monkeys were anesthetized and ultrasound-guided liver biopsies were performed to extract two or three liver tissue samples approximately 1 mm x 2 mm in size. The biopsy samples were then homogenized and HSD17B13 mRNA levels in the cynomolgus monkey livers were measured by RT-qPCR. The resulting values were then normalized to the pre-dose (in this case, Day -8) HSD17B13 mRNA measurement. The resulting mRNA data is reflected in Tables 13 and 14 below:
[0396] Table 13. Pre-dose normalized HSD17B13 mRNA levels from Example 5 for cynomolgus monkey #1 (cy0595)
[0397]
[0398] The day 29 biopsy sample from cynomolgus monkey #1 was smaller than normal and based on the overly pale appearance, it was suspected to be adipose tissue rather than liver tissue. The analysis at day 29 was therefore discarded.
[0399] Table 14. Normalized HSD17B13 mRNA levels from Example 5, pre-dose for cynomolgus monkey #2 (cy0471)
[0400]
[0401] Both cynomolgus monkeys dosed with AD06078 showed a reduction in liver-specific HSD17B13 mRNA up to day 43 compared to pre-treatment measurements. For example, the second monkey had approximately 67% (0.335) reduction in HSD17B13 mRNA at day 43 compared to pre-dose levels.
[0402] Example 6. HSD17B13-SEAP mouse model.
[0403] To assess certain additional HSD17B13 RNAi agents, the HSD17B13-SEAP mouse model was used. Six to eight week old female C57BL / 6 albino mice were transiently transfected in vivo with a plasmid administered via hydrodynamic tail vein injection at least 29 days prior to administration of the HSD17B13 RNAi agent or control. The plasmid contains a HSD17B13 cDNA sequence (GenBank NM_178135.4 (SEQ ID NO: 1)) inserted within the 3' UTR of a SEAP (secreted human placental alkaline phosphatase) reporter gene. A total volume of 10% of the animal's body weight, containing 50 pg of plasmid with the HSD17B13 cDNA sequence in Lactated Ringer's solution was injected into the mice via tail vein to generate HSD17B13-SEAP model mice. The solution was injected through a 27 gauge needle over 5-7 seconds as previously described (Zhang G et al., "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA." Human Gene Therapy 1999, vol. 10, pp. p1735-1737.). Inhibition of HSD17B13 expression by the HSD17B13 RNAi agent resulted in a concomitant inhibition of measured SEAP expression. Prior to administration of the treatment (between day -7 and day 1 prior to dosing), SEAP expression levels in serum were measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) and mice were grouped according to average SEAP levels.
[0404] Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular region into serum separator tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to clot at ambient temperature for 20 minutes. Tubes were centrifuged at 8,000 x g for 3 minutes to separate serum and stored at 4°C. Serum was collected and measured by Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. Serum SEAP levels for each animal can be normalized to a control group of mice injected with vehicle control in order to account for treatment-independent decreases in HSD17B13 expression using this model. To accomplish this, first, the SEAP level for each animal at a certain time point is divided by the pre-treatment expression level for that animal (day -1) in order to determine an "normalized to pre-treatment" expression ratio. Expression at a particular time point is then normalized to the control group by dividing the "normalized to pre-treatment" ratio for the individual animal by the average "normalized to pre-treatment" ratio for all mice in the normal vehicle control group. Alternatively, serum SEAP levels for each animal are evaluated by normalization to pre-treatment levels only.
[0405] Example 7. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice.
[0406] The HSD17B13-SEAP mouse model described in Example 6 above was used. On day 1, each mouse was given a single subcutaneous administration of 200 μl / 20 g animal weight containing 3.0 mg / kg (mpk) of HSD17B13 RNAi reagent formulated in a pharmaceutically acceptable saline buffer, or vehicle control (saline buffer without RNAi reagent), according to the following Table 15:
[0407] Table 15. Dosing Groups for Example 7
[0408] Group RNAi agent and dose Dosing regimen 1 Saline (no RNAi agent) Single injection at day 1 2 3.0 mg / kg AD06078 Single injection at day 1 3 3.0 mg / kg AD06081 Single injection at day 1 4 3.0 mg / kg AD06084 Single injection at day 1 5 3.0 mg / kg AD06085 Single injection at day 1
[0409] Each HSD17B13 RNAi agent includes modified nucleotides conjugated at the 5' end of the sense strand to a targeting ligand including three N-acetyl-galactosamine groups (tridentate ligand), with modified sequences as shown in duplex structures herein. (See Tables 3-6 for specific modification and structure information related to the HSD17B13 RNAi agents). HSD17B13 RNAi agent AD06078 (Group 2) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 1501 of the gene; HSD17B13 RNAi agent AD06081 (Group 3) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 488 of the gene; and HSD17B13 RNAi agents AD06084 and AD06085 include nucleotide sequences designed to inhibit HSD17B13 gene expression at position 499 of the gene. (See SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).
[0410] Injections (i.e., subcutaneous injections) were performed in the loose skin on the neck and shoulder area between the skin and the muscle. Four (4) mice in each group were tested (n=4). Serum was collected on Day -2 (prior to treatment), Day 8, Day 15, Day 22, and Day 29, and SEAP expression levels were determined according to the procedures described above in Example 6. Data from the experiment are shown in Tables 16 and 17 below:
[0411] Table 16. Mean SEAP in HSD17B13-SEAP mice from Example 7, normalized to pre-treatment (Day -2)
[0412]
[0413] * The gradual decrease in SEAP over time in the vehicle control group (Group 1), as noted above in Example 6, is due to loss of the SEAP reporter gene in the mouse cells due to natural cell replication in the animals, and is not a result of any inhibitory compound.
[0414] Table 17. Mean SEAP in HSD17B13-SEAP mice from Example 7, normalized to pre-treatment (Day -2) and vehicle control
[0415]
[0416] At days 8 and 15, each HSD17B13 RNAi agent in each dosing group (i.e., Groups 2-5) showed reduction of SEAP compared to the vehicle control (Group 1). Further, both HSD17B13 RNAi agents AD06084 and AD06085, which include nucleotide sequences designed to inhibit expression at position 499 of the HSD17B13 gene, showed particularly high levels of knockdown measured up to day 22. (Compare Groups 4 and 5 to Group 1).
[0417] Example 8. In vivo testing of HSD17B13 RNAi agents in cynomolgus monkeys.
[0418] HSD17B13 RNAi agents AD06078, AD06187, AD06278, and AD06280 were evaluated in cynomolgus monkeys. On days 1 and 30, three monkeys (n=3) in each group were administered a 0.3 mL / kg (approximately 3 mL volume, depending on animal mass) subcutaneous injection containing 3.0 mg / kg of the respective HSD17B13 RNAi agent formulated in saline. The HSD17B13 RNAi agents included modified nucleotides, as well as a tridentate N-acetyl-galactosamine-containing targeting ligand ((NAG37)s) conjugated to the 5' end of the sense strand, as shown in Tables 3-6. HSD17B13 RNAi agent AD06078 (Group 1) included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 1501 of the gene; HSD17B13 RNAi agent AD06187 (Group 2) included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 499 of the gene; HSD17B13 RNAi agent AD06278 (Group 3) included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 513 of the gene; and HSD17B13 RNAi agent AD06280 (Group 4) included a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 791 of the gene. (For the referenced HSD17B13 gene, see, e.g., SEQ ID NO: 1 and Table 2)
[0419] Liver biopsies were taken on days -7 (pre-dose), 15, 29, and 43. On the day of each biopsy collection, the monkeys were anesthetized and laparoscopic surgery was used to extract two liver tissue samples of approximately 80 mg to 120 mg each. The biopsy samples were then homogenized and HSD17B13 mRNA levels in the monkey livers were measured by RT-qPCR. The resulting values were then normalized to the pre-dose (in this case, on day -7) HSD17B13 mRNA measurement. The resulting mRNA data is reflected in Table 18 below:
[0420] Table 18. HSD17B13 mRNA levels normalized to pre-dose (Day -7) for each group (n=3) from Example 8
[0421]
[0422] Example 9. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice.
[0423] The HSD17B13-SEAP mouse model described in Example 6 above was used. On Day 1, each mouse was given a single subcutaneous administration of 200 μl / 20 g animal weight containing 3.0 mg / kg (mpk) of HSD17B13 RNAi reagent in a pharmaceutically acceptable saline buffer, or vehicle control (saline buffer without RNAi reagent) according to the following Table 19:
[0424] Table 19. Dosing groups for Example 9
[0425] Group RNAi agent and dose Dosing regimen 1 Saline (no RNAi agent) Single injection at day 1 2 3.0 mg / kg AD06210 Single injection at day 1 3 3.0 mg / kg AD06211 Single injection at day 1 4 3.0 mg / kg AD06212 Single injection at day 1 5 3.0 mg / kg AD06213 Single injection at day 1 6 3.0 mg / kg AD06214 Single injection at day 1 7 3.0 mg / kg AD06217 Single injection at day 1 8 3.0 mg / kg AD06218 Single injection at day 1
[0426] Each HSD17B13 RNAi agent includes modified nucleotides that are conjugated at the 5' end of the sense strand to a targeting ligand that includes three N-acetyl-galactosamine groups (tridentate ligand), with modified sequences as shown in duplex structures herein. (See Tables 3-6 for specific modification and structure information related to the HSD17B13 RNAi agents). HSD17B13 RNAi agent AD06210 (Group 2) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 513 of the gene; HSD17B13 RNAi agent AD06211 (Group 3) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 645 of the gene; HSD17B13 RNAi agent AD06212 (Group 4) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 649 of the gene; HSD17B13 RNAi agent AD06213 (Group 5) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 759 of the gene; HSD17B13 RNAi agent AD06214 (Group 6) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 791 of the gene; HSD17B13 RNAi agent AD06217 (Group 7) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 1505 of the gene; and HSD17B13 RNAi agent AD06218 (Group 8) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 2185 of the gene. (See SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).
[0427] Injections (i.e., subcutaneous injections) were performed in the loose skin between the skin and muscle on the neck and shoulder area. Four (4) mice in each group were tested (n=4). Serum was collected on Day -1 (prior to treatment), Day 8, Day 15, and Day 22, and SEAP expression levels were determined according to the procedures described above in Example 6. Data from the experiment is shown in Table 20 below:
[0428] Table 20. Mean SEAP expression in HSD17B13-SEAP mice from Example 9, normalized to pre-treatment (Day -1)
[0429]
[0430] * The gradual decrease in SEAP over time in the vehicle control group (Group 1) is due to loss of the SEAP reporter gene in the mouse cells due to natural cell replication in the animals, and is not a result of any inhibitory compound, as noted above in Example 6.
[0431] At days 15 and 22, each HSD17B13 RNAi agent in each dosing group (i.e., Groups 2-8) showed reduction of SEAP compared to the vehicle control (Group 1). Further, HSD17B13 RNAi agents AD06210 (Group 2), which includes a nucleotide sequence designed to inhibit expression at position 513 of the HSD17B13 gene, and AD06214 (Group 6), which includes a nucleotide sequence designed to inhibit expression at position 791 of the HSD17B13 gene, showed particularly high levels of knockdown relative to the other RNAi agents tested. For example, at day 15, AD06210 (Group 2) showed approximately 84% (0.157) reduction, while AD06214 (Group 6) showed approximately 85% (0.151) reduction. (For example, as compared to AD06218 (Group 8), which showed only slightly greater than the knockdown level of the control group (Group 1)). At day 22, HSD17B13 RNAi agent AD06214 (Group 6) also showed approximately 83% knockdown (0.171).
[0432] Example 10. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice.
[0433] The HSD17B13-SEAP mouse model described in Example 6 above was used. On day 1, each mouse was given a single subcutaneous administration of 200 μl / 20 g animal weight containing 3.0 mg / kg (mpk) of HSD17B13 RNAi agent, or vehicle control (saline buffer without RNAi agent), in a pharmaceutically acceptable saline buffer according to the following Table 21:
[0434] Table 21. Dosing Groups for Example 10
[0435] Group RNAi agent and dose Dosing regimen 1 Saline (no RNAi agent) Single injection at day 1 2 3.0 mg / kg AD06185 Single injection at day 1 3 3.0 mg / kg AD06187 Single injection at day 1 4 3.0 mg / kg AD06210 Single injection at day 1 5 3.0 mg / kg AD06213 Single injection at day 1 6 3.0 mg / kg AD06214 Single injection at day 1
[0436] Each HSD17B13 RNAi agent includes modified nucleotides conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) including three N-acetyl-galactosamine groups, with modified sequences as shown in duplex structures herein. (See Tables 3-6 for specific modification and structure information related to HSD17B13 RNAi agents). HSD17B13 RNAi agents AD06185 (Group 2) and AD06187 (Group 3) include nucleotide sequences designed to inhibit HSD17B13 gene expression at position 499 of the gene; HSD17B13 RNAi agent AD06210 (Group 4) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 513 of the gene; HSD17B13 RNAi agent AD06213 (Group 5) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 759 of the gene; and HSD17B13 RNAi agent AD06214 (Group 6) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 791 of the gene. (See SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).
[0437] Injections (i.e., subcutaneous injections) were performed in the loose skin on the neck and shoulder area between the skin and muscle. Four (4) mice in each group were tested (n=4). Serum was collected on Day -1 (prior to treatment), Day 8, Day 15, and Day 22, and SEAP expression levels were determined according to the procedures described above in Example 6. Data from the experiment is shown in Table 22 below:
[0438] Table 22. Mean SEAP expression in HSD17B13-SEAP mice from Example 10, normalized to pre-treatment (Day -1)
[0439]
[0440] * The gradual decrease in SEAP over time in the vehicle control group (Group 1) is due to loss of the SEAP reporter gene in the mouse cells due to natural cell replication in the animals, and is not a result of any inhibitory compound, as noted above in Example 6.
[0441] At all measured time points, each HSD17B13 RNAi agent in each dosing group (i.e., Groups 2-6) showed a decrease in SEAP compared to the vehicle control (Group 1).
[0442] Example 11. Single injection at day 1 .
[0443] The HSD17B13-SEAP mouse model described in Example 6 above was used. On Day 1, each mouse was given a single subcutaneous administration of 200 μl / 20 g animal weight containing a 3 mg / kg (mpk) dose of HSD17B13 RNAi agent, or vehicle control (saline buffer without RNAi agent), formulated in a pharmaceutically acceptable saline buffer, according to the following Table 25:
[0444] Table 25. Dosing groups for Example 12
[0445] In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice Group RNAi agent and dose 1 Dosing regimen Saline (no RNAi agent) 2 Single injection at day 1 0.625 mg / kg AD06280 3 Single injection at day 1 1.25 mg / kg AD06280 4 Single injection at day 1 2.5 mg / kg AD06280 5 Single injection at day 1 5.0 mg / kg AD06280 6 Single injection at day 1 0.625 mg / kg AD06187 7 Single injection at day 1 1.25 mg / kg AD06187 8 Single injection at day 1 2.5 mg / kg AD06187 9 Single injection at day 1 5.0 mg / kg AD06187
[0446] Both HSD17B13 RNAi agents included modified nucleotides conjugated at the 5' end of the sense strand to a targeting ligand including three N-acetyl-galactosamine groups (tridentate ligand), with modified sequences as shown in duplex structures herein. (See Tables 3-6 for specific modification and structure information related to the HSD17B13 RNAi agents.)
[0447] Injections (i.e., subcutaneous injections) were performed in the loose skin on the neck and shoulder area between the skin and muscle. Four (4) mice were tested in each group (n=4), except for the vehicle control group which only had two (2) mice. Serum was collected on Day -1 (pre-treatment), Day 8, Day 15, Day 22, and Day 29, and SEAP expression levels were determined according to the procedure described in Example 6 above. Data from the experiment is shown in Table 26 below:
[0448] Table 26. Mean SEAP in HSD17B13-SEAP mice from Example 12, normalized to pre-treatment (Day -1) and control
[0449]
[0450] Both HSD17B13 RNAi agents tested (i.e., AD06280 and AD06187) showed a reduction in SEAP compared to the vehicle control (Group 1).
[0451] Example 12. Single injection at day 1 .
[0452] The HSD17B13-SEAP mouse model described in Example 6 above was used. On Day 1, each mouse was given a single subcutaneous administration of 200 μl / 20 g animal weight containing a 3 mg / kg (mpk) dose of HSD17B13 RNAi agent, or vehicle control (saline buffer without RNAi agent), formulated in a pharmaceutically acceptable saline buffer, according to the following Table 25:
[0453] Table 25. Dosing Groups for Example 12
[0454] In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice Group RNAi agent and dose 1 Dosing regimen Saline (no RNAi agent) 2 Single injection at day 1 3 mg / kg AD06187 3 Single injection at day 1 3 mg / kg AD06208 4 Single injection at day 1 3 mg / kg AD06209 5 Single injection at day 1 3 mg / kg AD06215 6 Single injection at day 1 3 mg / kg AD06216 7 Single injection at day 1 3 mg / kg AD06219 Single injection at day 1
[0455] All HSD17B13 RNAi agents include modified nucleotides conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) including three N-acetyl-galactosamine groups, with modified sequences as shown in duplex structures herein. (See Tables 3-6 for specific modification and structure information related to HSD17B13 RNAi agents). HSD17B13 RNAi agent AD06187 (Group 2) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 499 of the gene; HSD17B13 RNAi agent AD06208 (Group 3) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 92 of the gene; HSD17B13 RNAi agent AD06209 (Group 4) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 417 of the gene; HSD17B13 RNAi agent AD06215 (Group 5) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 1418 of the gene; HSD17B13 RNAi agent AD06216 (Group 6) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 1502 of the gene; HSD17B13 RNAi agent AD06219 (Group 7) includes a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 2195 of the gene. (See SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).
[0456] Injections (i.e., subcutaneous injections) were performed in the loose skin between the skin and muscle on the neck and shoulder area. Four (4) mice in each group were tested (n=4). Serum was collected on Day -1 (prior to treatment), Day 8, Day 15, and Day 22, and SEAP expression levels were determined according to the procedures described above in Example 6. Data from the experiment is shown in Table 26 below:
[0457] Table 26. Mean SEAP in HSD17B13-SEAP mice from Example 12, normalized to pre-treatment (Day -1) and control
[0458]
[0459] Other Embodiments
[0460] It is to be understood that while the application has been described in conjunction with the specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the application. Other aspects, advantages and modifications are within the scope of the following claims.
Claims
1. An RNAi agent for inhibiting expression of a HSD17B13 gene, comprising: an antisense strand, wherein the nucleotide sequence of the antisense strand is one of the following nucleotide sequences (5' - 3'): usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2); or usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4); and a sense strand, wherein the nucleotide sequence (5' - 3') of the sense strand is CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8); wherein a, c, g, and u represent 2'-0-methyladenosine, 2'-0-methylcytidine, 2'-0-methylguanosine, and 2'-0-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; s represents a phosphorothioate linkage, wherein all of the nucleotides of the sense strand are 2'-0-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof, wherein the sense strand of the RNAi agent is linked to a targeting ligand, and wherein the targeting ligand is: or 。 2. The RNAi agent of claim 1, wherein the sense strand comprises modified internucleoside linkages.
3. The RNAi agent of claim 1, wherein the sense strand comprises one or two inverted abasic residues.
4. The RNAi agent of claim 1, wherein the sense strand consists of the nucleotide sequence (5' - 3') of cguaagaaGfUfCfugauagauga (SEQ ID NO: 9) or cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10); wherein a, c, g, and u represent 2'-0-methyladenosine, 2'-0-methylcytidine, 2'-0-methylguanosine, and 2'-0-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; s represents a phosphorothioate linkage.
5. The RNAi agent of claim 1, wherein the nucleotide sequence (5' - 3') of the antisense strand is: usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4), wherein the nucleotide sequence (5' - 3') of the sense strand is: cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10), and wherein a, c, g, and u represent 2'-0-methyladenosine, 2'-0-methylcytidine, 2'-0-methylguanosine, and 2'-0-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; s represents a phosphorothioate linkage.
6. The RNAi agent of claim 1, wherein the RNAi agent is in free acid form.
7. The RNAi agent of claim 1, wherein the RNAi agent is in the form of a sodium salt.
8. The RNAi agent of claim 1, wherein the targeting ligand is attached to the 5' end of the sense strand.
9. The RNAi agent of claim 1, wherein the RNAi agent has a duplex structure selected from the group consisting of AD06214 (SEQ ID NO: 2 and 14) and AD06280 (SEQ ID NO: 4 and 15).
10. The RNAi agent of claim 1, wherein the antisense strand consists of the structure of (5'→ 3') usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2) and the sense strand consists of the structure of (5'→ 3') (NAG37)s(invAb)scguaagaaGfUfCfugauagaugas(invAb) (SEQ ID NO: 14); wherein a, c, g, and u are 2'-0-methyladenosine, 2'-0-methylcytidine, 2'-0-methylguanosine, and 2'-0-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s is the following chemical structure:
11. The RNAi agent of claim 1, wherein the antisense strand consists of the structure of (5'→ 3') usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4) and wherein the sense strand consists of the structure of (5'→ 3') (NAG37)s(invAb)scguaagaaGfuCfuGfauagaugas(invAb) (SEQ ID NO: 15); wherein a, c, g, and u are 2'-0-methyladenosine, 2'-0-methylcytidine, 2'-0-methylguanosine, and 2'-0-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s is the following chemical structure: 。 12. The RNAi agent of claim 1, wherein the RNAi agent comprises the following chemical structure:
13. The RNAi agent of claim 1, wherein the RNAi agent comprises the following chemical structure: 。 14. A composition comprising the RNAi agent of any one of claims 1-13, wherein the composition further comprises a pharmaceutically acceptable excipient. 。 15. The composition of claim 14, further comprising a second RNAi agent for inhibiting expression of HSD17B13. 。 16. Use of the RNAi agent of any one of claims 1-13 or the composition of claim 14 or 15 for the manufacture of a pharmaceutical composition for the treatment of a disease mediated at least in part by expression of the HSD17B13 gene, wherein the disease is liver fibrosis.
17. Use of the RNAi agent of any one of claims 1-13 or the composition of claim 14 or 15 for the manufacture of a pharmaceutical composition for the treatment of a disease mediated at least in part by expression of the HSD17B13 gene, wherein the disease is alcoholic liver disease.
18. Use of the RNAi agent of any one of claims 1-13 or the composition of claim 14 or 15 for the manufacture of a pharmaceutical composition for the treatment of a disease mediated at least in part by expression of the HSD17B13 gene, wherein the disease is non-alcoholic liver disease.
19. The use of claim 18, wherein the disease is NAFLD.
20. The use of claim 18, wherein the disease is NASH.
21. Use of the RNAi agent of any one of claims 1-13 or the composition of claim 14 or 15 for the manufacture of a pharmaceutical composition for the treatment of a disease mediated at least in part by expression of the HSD17B13 gene, wherein the disease is cirrhosis.
Citation Information
Patent Citations
Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4522811A
Triantennary cluster glycosides, their preparation and use
US5885968A
Enzymatic nucleic acids containing 5'-and / or 3'-cap structures
US5998203A
Delivery of substances to cells
WO2000053722A2
Polyconjugates for in vivo delivery of polynucleotides
WO2008022309A2