A vsv vector-based htnev vaccine and its preparation method and application

By optimizing the codons of the HTNV M gene on the VSV vector, a recombinant plasmid rVSVΔG-HTNV M(I532K/S1094L/ΔC6)-GFP was constructed, which solved the problem of weak neutralizing antibody ability of existing HFRS inactivated vaccines and realized a new type of vaccine that can achieve protective effect with a single dose.

CN113842454BActive Publication Date: 2026-01-30FOURTH MILITARY MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202111161972.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-30
Publication Date
2026-01-30
Estimated Expiration
2041-09-30

AI Technical Summary

Technical Problem

Existing HFRS inactivated vaccines have weak ability to induce neutralizing antibodies and low ability to activate cellular immunity, requiring three doses in the entire course of vaccination. In particular, vaccination compliance is low in rural areas where HFRS is prevalent.

Method used

Using the VSV vector, codons were optimized at positions 532 and 1094 of the HTNV M gene, and a recombinant plasmid rVSVΔG-HTNV M(I532K/S1094L/ΔC6)-GFP was constructed, which can induce a protective immune response with a single inoculation.

Benefits of technology

The HTNV vaccine, which provides sufficient protection with a single dose, improves immunization efficiency and is suitable for widespread use in areas with high incidence of HFRS.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113842454B_ABST
    Figure CN113842454B_ABST
Patent Text Reader

Abstract

This invention relates to the field of vaccine preparation technology, specifically disclosing a VSV-based HTNV vaccine, its preparation method, and its application. The method involves constructing a recombinant plasmid by inserting the nucleotide sequence of the HTNV envelope glycoprotein into the recombinant VSV vector plasmid, followed by packaging and processing to obtain an immunogenic HTNV recombinant VSV vaccine. The HTNV vaccine prepared by this invention provides a novel candidate vaccine for the prevention and treatment of hemorrhagic fever with renal syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of vaccine preparation technology, specifically relating to an HTNV vaccine based on a VSV vector, its preparation method, and its application. Background Technology

[0002] Hantaan virus (HTNV) is an enveloped, negative-sense RNA virus belonging to the family Hantaviridae in the order Bunyavirales. Its genome is divided into three segments: S, M, and L, encoding the nucleocapsid protein NP, the envelope glycoprotein GPC (which cleaves into Gn and Gc after intracellular translation), and the RNA-dependent RNA polymerase RdRp, respectively. HTNV infection causes hemorrhagic fever with renal syndrome (HFRS), clinically manifested as fever, hemorrhage, and acute renal impairment. Approximately 90% of HFRS cases occur in Eurasia, with China being the most severely affected country. The disease is widespread, has a high mortality rate, and poses a significant threat in my country.

[0003] Currently, bivalent inactivated vaccines for hemorrhagic fever with renal syndrome (HFRS) (Vero cells) have been developed both domestically and internationally. Their widespread use has played a positive role in controlling the occurrence and spread of HFRS. However, these vaccines still have some shortcomings, primarily weak ability to induce neutralizing antibodies, low ability to activate cellular immunity, and the requirement for three doses over a year. Vaccination adherence is particularly low in rural areas where HFRS is prevalent. Therefore, there is an urgent need to develop novel, highly effective HFRS vaccines that provide sufficient protection with a single dose. Summary of the Invention

[0004] The purpose of this invention is to provide an HTNV vaccine based on vesicular stomatitis virus (VSV) vector, its preparation method and application. The prepared HTNV vaccine provides a novel candidate vaccine for the prevention and treatment of hemorrhagic fever with renal syndrome, and a single dose can provide sufficient protection.

[0005] This invention provides a method for preparing an HTNV vaccine based on a VSV vector, specifically including the following steps:

[0006] Construction of S1, pCAGGS-HTNV M(I532K) plasmid:

[0007] Using plasmid pUC-opti GPC as a template, mutant primers opti GPC-F-infu, GPC-R-infu, opti GPC-I532K seg1-R, and opti GPC-I532K seg2-F were designed to mutate isoleucine (I) at position 532 to lysine (K), obtaining the pCAGGS-HTNV M(I532K) plasmid. I532K seg1 and I532K seg2 were amplified by PCR using primers opti GPC-F-infu, opti GPC-I532K seg1-R, opti GPC-I532K seg2-F, and opti GPC-R-infu, respectively. These amplified plasmids were then ligated into the pCAGGS-X-myc vector, which had been double-digested with EcoRI and KpnI, to construct the single mutant plasmid pCAGGS-HTNV. M(I532K); The nucleotide sequence of opti GPC in the plasmid pUC-opti GPC is shown in SEQ ID NO.1;

[0008] Construction of S2, pCAGGS-HTNV M(I532K / S1094L) plasmid:

[0009] Using the pCAGGS-HTNV M(I532K) plasmid as a template, mutant primers opti GPC-S1094Lseg1-R and opti GPC-S1094L seg2-F were designed to mutate serine (S) at position 1094 to leucine (L), obtaining the pCAGGS-HTNVM(I532K / S1094L) plasmid. I532K / S1094L seg1 and I532K / S1094L seg2 were amplified by PCR using primers opti GPC-F-infu, opti GPC-S1094L seg1-R, opti GPC-S1094L seg2-F, and opti GPC-R-infu, respectively. These were then ligated into the pCAGGS-X-myc vector, which had been double-digested with EcoRI and KpnI, to construct the double mutant plasmid pCAGGS-HTNV. M(I532K / S1094L);

[0010] Construction of S3, recombinant plasmid rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP:

[0011] Using pCAGGS-HTNV M(I532K / S1094L) plasmid as a template, primers rVSV-Sph IMF and SphI-GPC-C6-R were designed to amplify the target fragment HTNV M(I532K / S1094L / ΔC6). Then, it was ligated with the plasmid pVSVΔG-GFP, which had been digested with Sph I. The ligation product was transformed into Stbl 3 competent cells and plated on ampicillin-resistant LB solid culture plates. Single colonies were picked and inoculated into 5 ml of ampicillin-resistant 2×YT culture medium. The cells were incubated overnight at 30°C in a shaker. The bacterial culture was then extracted to obtain the recombinant plasmid rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP.

[0012] Preparation of S4,rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine:

[0013] When BHK-21 cells were cultured to approximately 90% confluence, VV-T7 cells were infected with BHK-21 at MOI=5 for 2 hours, and then transfected with the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid and helper plasmids pBS-N, pBS-P, pBS-G, and pBS-L to prepare the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine.

[0014] Furthermore, in S1, the primer opti GPC-F-infu gene sequence is shown in SEQ ID NO.2;

[0015] The GPC-R-infu gene sequence of the primer is shown in SEQ ID NO.3;

[0016] The gene sequence of the primer opti GPC-I532K seg1-R is shown in SEQ ID NO.4;

[0017] The gene sequence of the primer opti GPC-I532K seg2-F is shown in SEQ ID NO.5.

[0018] Further, in S1, the point mutation process is as follows: first, amplified I532K seg1 and I532K seg2 are obtained, and then ligated with the double-digested pCASSG vector to construct the HTNV GPC single mutant pCAGGS-HTNV M(I532K). Then, the ligation product is transformed into DH5α competent bacteria, and the plasmid is extracted from the bacterial culture and verified by double enzyme digestion to obtain the pCAGGS-HTNV M(I532K) plasmid.

[0019] Furthermore, in S1, the connection system of I532K seg1 and I532K seg2 with the pCASSG vector is as follows: 50 ng of pCAGGS vector, 36 ng of I532K seg1, 32 ng of I532K seg2, 0.8 μL of 5×In-Fusion Enzyme Premix, and the balance ddH2O to make the total volume 30 μL.

[0020] Further, in S2, the gene sequence of the opti GPC-S1094L seg1-R primer is shown in SEQ ID NO.6, and the gene sequence of the opti GPC-S1094L seg2-F primer is shown in SEQ ID NO.7.

[0021] Further, in S3, the gene sequence of the rVSV-Sph IMF primer is shown in SEQ ID NO.8, and the gene sequence of the Sph I-GPC-C6-R primer is shown in SEQ ID NO.9.

[0022] Furthermore, in S4, the ratio of the amount of the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid and the VSV helper plasmids pBS-N, pBS-P, pBS-G, and pBS-L is 5:3:5:8:1.

[0023] The present invention also provides an HTNV vaccine prepared by the above preparation method.

[0024] The present invention also provides a vaccine injectable comprising the above-described HTNV vaccine.

[0025] The present invention also provides the application of the above-mentioned HTNV vaccine or vaccine injection in the preparation of drugs for the prevention of hemorrhagic fever with renal syndrome.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] 1. The VSV virus used as a vaccine vector in this invention has the following advantages:

[0028] (1) VSV is an animal virus with low infectivity to humans and good safety.

[0029] (2) There are no pre-existing antibodies in the population, so the efficacy of the vaccine will not be reduced due to immunization against the vector;

[0030] (3) The genome is small, only 11knt in length, making reverse genetics operations easy;

[0031] (4) It can accommodate nearly 6kb of foreign genes and can express one or more foreign genes at the same time, with strong universality;

[0032] (5) The VSV vaccine can induce effective protection with only a single dose.

[0033] 2. Regarding the modification of HTNV M sequences in this invention:

[0034] (1) Codon optimization of cell membrane glycoprotein (GPC) to obtain an M gene sequence that expresses GPC at a high level in eukaryotic cells;

[0035] (2) HTNV's Gn and Gc mature in the Golgi apparatus. Mutations at positions 532 and 1094 on the HTNV GPC and the truncation of the last six amino acids of Gc help it exit the cell membrane, which in turn facilitates its encapsulation into the VSV virus, improves the packaging efficiency of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP virus, and increases the viral titer.

[0036] 3. The HTNV vaccine prepared by this invention can achieve sufficient protection with a single dose, and is a novel and highly effective candidate vaccine for HFRS, laying the foundation and providing a new approach for the prevention of hemorrhagic fever with renal syndrome. Attached Figure Description

[0037] Figure 1 The PCR results for I532K seg1 and I532K seg2 in this invention are shown.

[0038] Where M represents Marker: DL 2000; 1 and 2 represent I532K seg1; 3 and 4 represent I532K seg2;

[0039] Figure 2 The results of enzyme digestion identification of the pCAGGS-M(I532K) plasmid in this invention;

[0040] Where M represents Marker: DL 5000; 1 represents pCAGGS-M(I532K) plasmid;

[0041] Figure 3 The results of PCR amplification of I532K / S1094L seg1 in this invention;

[0042] Where M represents Marker: DL 5000; 1 represents I532K / S1094L seg1;

[0043] Figure 4 The results of PCR amplification of I532K / S1094L seg2 in this invention;

[0044] Where M represents Marker: DL 2000; 1 represents I532K / S1094L seg2;

[0045] Figure 5 The results of double enzyme digestion identification of pCAGGS-M(I532K / S1094L) in this invention;

[0046] Where M represents Marker: DL 10000; 1 represents pCAGGS-M (I532K / S1094L);

[0047] Figure 6 The PCR identification results of the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid in this invention;

[0048] Where M represents Marker: DL 10000; 1 and 2 represent rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP;

[0049] Figure 7 The results of Western blot analysis of VSV-GFP and rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP in this invention are shown.

[0050] Where M represents Marker: 245kD; 1 represents VSV-GFP; 2 represents rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP;

[0051] Figure 8 TCID in this invention 50 The titers of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP and VSV-GFP were detected;

[0052] Figure 9 This is a graph showing the results of FFA detection of neutralizing antibodies in this invention. Detailed Implementation

[0053] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. However, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Test methods in the following embodiments that do not specify specific conditions are generally operated under conventional conditions. Since they do not involve the inventive point, their steps are not described in detail.

[0054] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0055] The present invention employs the following technical solution: The optimized HTNV M gene sequence is 3408 bp in length, and the plasmid is pUC-opti GPC. Using this plasmid as a template, point mutations are performed at amino acid sites 532 and 1094 to construct the mutant plasmid pCAGGS-HTNV M(I532K / S1094L). Based on this, the HTNV M(I532K / S1094L) fragment is cloned into the pVSVΔG-GFP vector, and the M gene is truncated to construct rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP. This plasmid, along with VSV helper plasmids pBS-N, pBS-P, pBS-G, and pBS-L, is co-transfected into BHK-21 cells transiently expressing T7 polymerase to package a recombinant VSV virus expressing HTNV GPC. This recombinant virus is used in vaccines, and the titer of neutralizing antibodies induced in mice after immunization with Balb / C is tested.

[0056] The products used in this invention are sourced from the following sources:

[0057] Escherichia coli DH5α competent cells and Stbl 3 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.; pUC-optiGPC plasmid was synthesized by Nanjing GenScript Biotech Co., Ltd.; pCAGGS-X-myc was kindly provided by the Chinese Academy of Agricultural Sciences; pVSVΔG-GFP was synthesized by Nanjing GenScript Biotech Co., Ltd.; pBS-N, pBS-P, pBS-G, pBS-L, and pCAGGS-VSV G plasmids were all kindly provided by the Wuhan Institute of Virology; BHK-21 cells and Vero E6 cells were purchased from the American Type Culture Collection.

[0058] HTNV strain 76-118 was preserved in our laboratory; the poxvirus VV-T7 expressing T7 polymerase was kindly provided by the Wuhan Institute of Virology; and the VSV-GFP virus was prepared and preserved in our laboratory.

[0059] Antibodies G2-8, 3G1, and 1A8 were prepared and preserved in our laboratory; antibody VSV G was purchased from Abcam, UK; antibody IRDye 680RD Goat anti-Mouse was purchased from LI-COR; antibody HRP-Goat Anti-mouse IgG was purchased from Sangon Biotech (Shanghai) Co., Ltd.; restriction endonucleases used in this invention were purchased from TAKARA Biotechnology Co., Ltd.; Q5 high-fidelity DNA polymerase was purchased from NEB; 5×In-Fusion Enzyme Premix was purchased from TAKARA Biotechnology Co., Ltd.; gel extraction kit was purchased from Sangon Biotech (Shanghai) Co., Ltd.; plasmid mini-preparation kit was purchased from ASICS Biotechnology (Hangzhou) Co., Ltd.; plasmid large-preparation kit was purchased from OMEGA; DNA marker, 4S RedNucleic Acid Stain, ampicillin, 50×TAE, 20×TBS, and Tween-20 were all purchased from Sangon Biotech (Shanghai) Co., Ltd.; Lipofectamine TM 2000 was purchased from Thermo; protein marker was purchased from Yeasen; 4× sampling buffer was provided by GenScript; 10× loading buffer was purchased from Sangon Biotech (Shanghai) Co., Ltd.; BSA was purchased from Yeasen; methanol was purchased from Tianjin Fuyu Fine Chemical Co., Ltd.; and precipitated TMB membrane substrate solution was purchased from Baizhi Biotechnology.

[0060] DMEM and Opti-MEM media were purchased from Gibco; FBS was purchased from Yeasen; DPBS was purchased from Corning; and penicillin-streptomycin-gentamicin mixture and trypsin-EDTA digestion solution were purchased from Solarbio.

[0061] Example 1

[0062] A method for preparing an HTNV vaccine based on a VSV vector, the specific process of which is as follows:

[0063] 1. Construction of the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid (Δ indicates the deletion of this part of the gene):

[0064] (1) Construction of pCAGGS-HTNV M(I532K) vector

[0065] The HTNV M used in this experiment was synthesized by Nanjing Genscript Biotech after codon optimization of the HTNV 76-118 standard strain viral gene sequence, resulting in plasmid pUC-opti GPC. The nucleotide sequence of opti GPC in plasmid pUC-opti GPC is shown in SEQ ID NO.1.

[0066] Then, using the pUC-opti GPC plasmid as a template, point mutations were performed at amino acid sites 532 and 1094. Corresponding mutation primers were designed, including the following primers:

[0067] The upstream primer is opti GPC-F-infu (gene sequence shown in SEQ ID NO.2), the downstream primer is GPC-R-infu (gene sequence shown in SEQ ID NO.3), the downstream primer is opti GPC-I532K seg1-R (gene sequence shown in SEQ ID NO.4), and the upstream primer is opti GPC-I532K seg2-F (gene sequence shown in SEQ ID NO.5).

[0068] SEQ ID NO.2:

[0069] CATTTTGGCAAAGAATTCGCCACCATGGGCATCTGGAAGTGGCTGGTGATGG;

[0070] SEQ ID NO.3:

[0071] GAGCCTCCACCCCCGGTACCAGACTTCTTGTGCTTCCTCACAGG;

[0072] SEQ ID NO.4: CTTCTTCCCTCAGCACACACTTCAGGCGGTT;

[0073] SEQ ID NO.5:

[0074] CTGTGCTGAGGAAGAAGAAGGAGGGAGTTCGAGAAGACCAAGGG;

[0075] I532K seg1 and I532K seg2 were amplified by PCR using Q5 DNA polymerase. The PCR reaction system was as follows: template (pUC-opti GPC) 1 μL, upstream primer opti GPC-F-infu 0.5 μL, downstream primer opti GPC-I532K seg1-R 0.5 μL, Q5 enzyme 0.25 μL, dNTP 0.5 μL, 5× buffer 5 μL, ddH2O 17.75 μL. This reaction system was used to amplify I532K seg1. I532K seg2 was amplified using the same template, upstream primer opti GPC-I532K seg2-F, and downstream primer GPC-R-infu. The amplification methods for I532K / S1094L seg1 and I532K / S1094L seg2 were similar.

[0076] The reaction conditions were: 98℃ for 30s, (98℃ for 15s, 55℃ for 10s, 72℃ for 90s) for 30 cycles, 72℃ for 5min, and 10℃ forever.

[0077] The PCR products were verified by 1% agarose gel electrophoresis (TAE electrophoresis buffer), such as... Figure 1 The PCR results for I532Kseg 1 and I532Kseg 2 are shown in the figure. Bands of the expected size can be observed in the figure. The gel was cut and the target band was recovered using a gel recovery kit.

[0078] Plasmid pCAGGS-X-myc was double-digested with EcoRI and KpnI. The double-digestion system is as follows:

[0079] pCAGGS-X-myc 1μg, EcoRI 1μL, KpnI 1μL, 10×Buffer 3μL, add the balance ddH2O to make the total volume 30μL;

[0080] The enzyme was digested in a water bath at 37°C for 2 hours. After the enzyme digestion product was verified to be correct by 1% agarose gel electrophoresis, the gel was cut and the target band was recovered using a gel recovery kit.

[0081] The PCR product obtained from the above amplification was ligated with the double-digested pCASSG vector to construct the HTNV GPC single mutant pCAGGS-HTNV M(I532K). The ligation reaction system was as follows:

[0082] 50 ng pCAGGS carrier, 36 ng I532K seg1, 32 ng I532K seg2, 0.8 μL 5×In-Fusion Enzyme Premix, and the balance ddH2O to make the total volume 30 μL; the ligation conditions were 50℃ water bath for 40 min.

[0083] Add 5 μL of the ligation product to DH5α competent bacteria, mix gently, incubate on ice for 30 min, heat shock at 42℃ for 90 s, incubate on ice for 90 s, add 1 mL of antibiotic-free LB medium, mix gently, and incubate at 37℃ with shaking for 1 h. Centrifuge at 5000g for 3 min, resuspend the bacterial pellet in 200 μL of the supernatant, and spread evenly on ampicillin-resistant LB agar plates. Incubate the plates inverted at 37℃ overnight. Pick single colonies from the plates and inoculate them into 5 mL of ampicillin-resistant 2×YT medium. Incubate overnight at 37℃ with shaking. Perform double enzyme digestion verification on the bacterial culture.

[0084] 1 ng of recombinant plasmid pCAGGS-HTNV M(I532K), 1 μL of EcoRI, 1 μL of KpnI, 3 μL of 10×Buffer, and the remaining ddH2O were added to make the total volume 30 μL; the double digestion conditions were 37℃ water bath for 3 h.

[0085] The double enzyme digestion products were verified by 1% agarose gel electrophoresis, such as... Figure 2 The image shows the results of double enzyme digestion identification of the pCAGGS-HTNV M(I532K) plasmid. A band matching the expected size can be observed. The corresponding recombinant plasmid was sent to Sangon Biotech for sequencing verification, and the pCAGGS-HTNV M(I532K) plasmid was obtained.

[0086] (2) Construction of the double mutant pCAGGS-HTNV M(I532K / S1094L) vector

[0087] Using the successfully constructed pCAGGS-HTNV M(I532K) plasmid as a template, relevant upstream and downstream primers were designed, including the opti GPC-S1094L seg1-R primer with gene sequence as shown in SEQ ID NO.6 and the opti GPC-S1094L seg2-F primer with gene sequence as shown in SEQ ID NO.7. Then, I532K / S1094L seg1 and I532K / S1094L seg2 were amplified by PCR using opti GPC-F-infu, opti GPC-S1094L seg1-R, opti GPC-S1094L seg2-F, and opti GPC-R-infu as primers, respectively. The specific PCR reaction system and reaction conditions are as described above.

[0088] PCR products were verified by 1% agarose gel electrophoresis (e.g.) Figure 3 , Figure 4(As shown), the gel was excised and the target bands I532K / S1094L seg1 and I532K / S1094L seg2 were recovered. The recovered target bands were ligated into the pCAGGS-X-myc vector, which had been double-digested with EcoRI and KpnI, to construct the double mutant pCAGGS-HTNV M(I532K / S1094L). The ligation reaction and subsequent transformation experiments have been described previously. The double-enzyme digestion identification results of the pCAGGS-HTNV M(I532K / S1094L) plasmid are shown below. Figure 5 As shown, bands of the expected size can be observed, indicating that the plasmid was successfully constructed. Sequencing at Sangon Biotech Co., Ltd. further confirmed the successful construction of the plasmid, which is now stored for future use.

[0089] SEQ ID NO.6: GAGCTTCACGAACCAGCACTTGATACCGCACTG;

[0090] SEQ ID NO.7:

[0091] GCTGGTTCGTGAAGCTCGGCGAGTGGATCTCCGGTATCTTCTCT.

[0092] (3) Construction of recombinant plasmid rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP

[0093] Using the double mutant plasmid pCAGGS-HTNV M(I532K / S1094L) successfully constructed above as a template, primers rVSV-Sph IMF with gene sequences as shown in SEQ ID NO.8 and primers SphI-GPC-C6-R with gene sequences as shown in SEQ ID NO.9 were designed.

[0094] SEQ ID NO.8: CTTAGCCTTTTATGCATGCATGGGCATCTGGAAGTGGC;

[0095] SEQ ID NO.9:

[0096] CTATGTCGTACCGCATGCTTACACAGGGCACAGGATGGAC;

[0097] The target fragment HTNV M (I532K / S1094L / ΔC6) was amplified and recovered. The plasmid pVSVΔG-GFP (synthesized by Nanjing Genscript Biotech) was digested with Sph I. The digestion system was: 1 ng pVSVΔG-GFP, 1 μL Sph I, 3 μL 10× Buffer, and the remaining ddH2O was added to a total volume of 30 μL. The digestion conditions were 37℃ water bath for 3 h. The digestion products were verified by 0.6% agarose gel electrophoresis and the vector was recovered.

[0098] The recovered target fragment HTNV M(I532K / S1094L / ΔC6) was ligated with the vector pVSVΔG-GFP. The ligation reaction system was as follows: 50 ng of pVSVΔG-GFP vector, 36 ng of HTNV M(I532K / S1094L / ΔC6), 0.8 μL of 5×In-FusionEnzyme Premix, and the balance ddH2O was added to make the total volume 30 μL. The ligation conditions were 50℃ water bath for 40 min. The ligation product was transformed into Stbl 3 competent cells and plated on ampicillin-resistant LB solid culture plates. The plates were placed at room temperature for long single colonies. Single colonies were picked from a plate and inoculated into 5 ml of ampicillin-resistant 2×YT medium. The culture was incubated overnight at 30°C in a shaker. The bacterial culture was then extracted to obtain the recombinant plasmid rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP, which was identified by PCR and confirmed by 0.6% agarose gel electrophoresis. Figure 6 The image shown is a PCR identification diagram of the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid, indicating that the plasmid was successfully constructed. The plasmid was further sent to Sangon Biotech for sequencing analysis. The plasmid was correctly preserved and will be directly used in the preparation of the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine described below.

[0099] 2. Preparation of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine:

[0100] BHK-21 cells were seeded in six-well plates and cultured overnight until the cells reached approximately 90% confluence. BHK-21 cells were then infected with VV-T7 (a poxvirus stably expressing T7 polymerase) at MOI=5 for 2 hours. The cells were then transfected with the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid and helper plasmids pBS-N, pBS-P, pBS-G, and pBS-L in a ratio of 5:3:5:8:1, at doses of 1.25 μg, 0.75 μg, 1.25 μg, 2 μg, and 0.25 μg, respectively. All of these were added to an EP tube containing 500 μL of opti-MEM medium, designated tube A. 11 μL of the transfection reagent Lipofectamine 2000 was added to another EP tube containing 500 μL of opti-MEM medium, designated tube B. Incubate at room temperature for 5 min, then transfer the liquid from tube B to tube A, mix well, and incubate at room temperature for 20 min to obtain the plasmid-transfection reagent mixture. Discard VV-T7 cells in a six-well plate, add the plasmid-transfection reagent mixture, and change the medium to 10% FBS DMEM after 6 h. Observe GFP expression after 24 h; after 48 h, cells show obvious cytopathic effects. Harvest the supernatant, centrifuge at 5000×g for 4 min to remove cell debris, filter through a 0.1 μm filter to remove poxvirus, and store at -80℃ for later use. BHK-21 cells were seeded again in six-well plates and grown overnight. After growth, the cells were transfected with plasmid pCAGGS-VSV G 2 μg / well. After 6 hours, the medium was changed to DMEM with 10% FBS. After 24 hours, the filtrate stored at -80℃ was directly used to infect BHK-21 cells transfected with pCAGGS-VSV G. The medium was changed after 2 hours, and GFP expression was continuously observed. If GFP expression was observed, it would preliminarily prove that the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine was successfully prepared. The harvested supernatant was stored at -80℃ for later use.

[0101] 3. Identification of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine:

[0102] (1) Western Blot detection of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP and VSV-GFP virus (VSV virus expressing green fluorescent protein GFP, prepared and preserved by our laboratory, used as a control in the vaccine identification process and as a vector control in the later immunization)

[0103] After large-scale amplification of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP and VSV-GFP viruses in Vero E6 cells, viral particles were harvested from the cell supernatant. 15 μL of each virus was added to 5 μL of 4× sampling buffer, and the mixture was boiled in water for 10 min to denature the viral proteins. The target bands were separated by 10% SDS-PAGE at 120 V for 2 h. Transfer was then performed at 0.25 A for 90 min. The transferred PVDF membranes were blocked with 3% BSA at room temperature for 30 min, followed by slow blocking on a horizontal shaker. The blocked membrane was incubated overnight at 4°C with primary antibody G2-8 (targeting HTNV Gc protein in rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP) or VSV G (targeting VSV G protein in VSV-GFP). The Western blotting membrane was washed three times with TBST for 10 min each time using a horizontal shaker. The washed membrane was then incubated with secondary antibody IRDye 680RD Goat anti-Mouse at room temperature for 1 h. The Western blotting membrane was washed three times with TBST for 10 min each time using a horizontal shaker. The membrane was scanned using an Odyssey scanner.

[0104] The control group was set as VSV-GFP virus, and the results were as follows: Figure 7 As shown, the Gc protein in rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP can be detected by monoclonal antibodies against glycoproteins HTNV Gc and VSV G, while the VSV G protein in VSV-GFP virus can be detected by monoclonal antibody against VSV G.

[0105] (2)TCID 50 Detection of the titers of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP and VSV-GFP

[0106] Both VSV-GFP and rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP viruses were used to infect Vero E6 cells with an MOI of 0.0001. Cell supernatants were harvested at 0h, 3h, 6h, 12h, 24h, and 48h, and stored at -80℃. Vero E6 cells were seeded in 96-well plates and cultured overnight. When cell confluence exceeded 90%, the harvested cell supernatant was serially diluted 10-fold and used to infect Vero E6 cells, with four replicates per dilution. The plates were incubated at 37°C for 2 hours, with the plates gently agitated every 15 minutes to ensure adequate viral infection. After 2 hours, the viral load was aspirated, and methylcellulose covering medium was added. The plates were cultured for one week. The covering medium was washed off with PBS, and crystal violet staining was added. The plates were stained at room temperature for 30 minutes, the crystal violet was washed off, and the plates were air-dried. The number of spots in the 96-well plates was observed and recorded. The TCID values ​​of VSV-GFP and rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP were calculated using the Reed-Munch method. 50 value.

[0107] The results are as follows Figure 8 As shown, the control group was set as VSV-GFP virus. The results showed that, compared with VSV, the titer of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP virus was significantly reduced after inserting the envelope glycoprotein with the HTNV codon.

[0108] 4. Immunization with rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP can induce a strong specific neutralization response.

[0109] To evaluate the immunogenicity of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP in Balb / C mice, a single dose of the experimental group rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP or the vector control group VSV-GFP and HFRS inactivated vaccine were administered intraperitoneally. Thirty-five days after immunization, the neutralizing antibodies were quantified by spot-forming assays (FFA) of the post-immunization serum of the mice. The specific experimental doses are shown in Table 1.

[0110] Table 1 Immunogenic inoculation doses in mice

[0111]

[0112] FFA detection of neutralizing antibodies against rVSV-HTNV M(I532K / S1094L / ΔC6)-GFP immunized Balb / C mice:

[0113] Vero E6 cells were seeded in 96-well plates and allowed to grow overnight. Once the cell confluence was greater than 90%, mouse immunization serum was diluted to 200 μL at dilutions of 1:10, 1:20, 1:40, 1:80, and 1:160. Each diluted solution was then mixed with an equal volume of 100 FFU of HTNV. The mixture was incubated at 37°C for 1 hour, with the mixture being stirred again every 15 minutes to ensure adequate contact between the virus and serum. The culture medium was discarded from the 96-well plates, and the virus-serum mixture was added to each well at a rate of 100 μL / well, with four replicates for each dilution. A positive control was also included, infecting cells with a mixture of antibody 3G1 and HTNV at the same dilution. Additionally, HTNV infection wells were included. Infect cells with the virus-serum mixture for 2 hours, gently shaking the plate every 15 minutes to ensure full virus infection. After 2 hours, discard the liquid and add 100 μL of covering medium to each well of a 96-well plate. Incubate the cell culture plate at 37°C with 5% CO2 for 5 days. Wash away the covering solution with DPBS, fix cells with 4% paraformaldehyde, and incubate at room temperature for 30 min. Discard the fixative, add 0.5% Triton X-100, and rupture the membrane at room temperature for 15 min. Dilute 1A8 antibody with 3% FBS in DPBS and add it to a 96-well plate. Incubate overnight at 4°C. Discard 1A8 antibody and wash cells twice with DPBS. Dilute secondary antibody HRP-Goat Anti-mouse IgG with 3% FBS in DPBS and add it to a 96-well plate. Incubate at room temperature for 1 h. Discard the secondary antibody and wash cells twice with DPBS. Add 100 μL of precipitant TMB membrane substrate solution (Baizhi Biotechnology) to each well and develop color at room temperature in the dark for 15-30 min. Add 100 μL of DPBS to each well to stop the color development. Dark spots will be visible on the bottom of the plate. Observe the spots and count them. Calculate the neutralizing titer of the serum using the spot reduction method.

[0114] FFA test results for neutralizing antibody titers are as follows: Figure 9 As shown, compared with the vector control group VSV-GFP, the rVSVΔG-HTNVM(I532K / S1094L / ΔC6)-GFP vaccine induced Balb / C mice to produce higher neutralizing antibody titers; at the same time, the neutralizing antibody titers induced by the rVSVΔG-HTNVM(I532K / S1094L / ΔC6)-GFP vaccine were higher than those induced by the HFRS inactivated vaccine.

[0115] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0116] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations. sequence list <110> Air Force Medical University of the Chinese People's Liberation Army <120> A VSV-based HTNV vaccine, its preparation method and application <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 3408 <212> DNA <213> Artificial synthesis <400> 1 atgggcatct ggaagtggct ggtgatggct tccctggtgt ggcctgtgct gaccctgaga 60 aacgtgtacg acatgaagat cgaatgccca cacaccgtga gcttcggcga aaactccgtg 120 atcggatacg tggagctgcc acctgtgccc ctggctgaca ccgctcagat ggtgcctgag 180 agctcctgca acatggacaa ccaccagagc ctgaacacca tcaccaagta cacccaggtg 240 tcttggcgtg gaaaggccga ccagagccag tctagccaga actctttcga gaccgtgagc 300 accgaagtgg acctgaaggg cacctgcgtg ctgaagcaca agatggtgga ggaaagctac 360 cgctccagga agtctgtgac ctgctacgac ctgagctgca actccaccta ctgcaagcca 420 accctgtaca tgatcgtgcc catccacgct tgcaacatga tgaagtcctg cctgatcgcc 480 ctgggccctt acagagtgca ggtggtgtac gaacgttctt actgcatgac cggagtgctg 540 atcgagggaa agtgcttcgt gccagaccag tctgtcgtga gcatcatcaa gcacggtatc 600 ttcgacatcg cttccgtgca catcgtgtgc ttcttcgtgg ccgtgaaggg caacacctac 660 aagatcttcg agcaggtgaa gaagtccttc gaatctacct gcaacgacac cgagaacaag 720 gtgcagggat actacatctg catcgtgggc ggaaacagcg ctcccatcta cgtgcctacc 780 ctggacgact tccgcagcat ggaagccttc accggcatct tcaggtcccc acacggagag 840 gaccacgacc tggctggaga ggaaatcgcc agctactcca tcgtgggccc tgctaacgcc 900 aaggtgccac acagcgcttc ctctgacacc ctgtccctga tcgcctacag cggaatccct 960 tcctacagct ccctgtccat cctgacctct agcaccgaag ctaagcacgt gttctctcca 1020 ggcctgttcc ccaagctgaa ccacaccaac tgcgacaagt ccgctatccc actgatctgg 1080 accggtatga tcgacctgcc tggctactac gaggccgtgc acccatgcac cgtgttctgc 1140 gtgctgtccg gccccggagc ttcttgcgag gccttcagcg aaggtggcat cttcaacatc 1200 acctctccta tgtgcctcgt gagcaagcag aacagattcc gtctgaccga gcagcaggtg 1260 aacttcgtgt gccagcgcgt ggacatggac atcgtggtgt actgcaacgg ccagaggaag 1320 gtgatcctga ccaagaccct ggtgatcgga cagtgcatct acaccatcac cagcctgttc 1380 tccctgctgc caggagtggc tcactccatc gctgtggagc tgtgcgtgcc cggattccac 1440 ggttgggcta ccgctgctct gctggtgacc ttctgcttcg gttgggtgct gatccctgct 1500 atcaccttca tcatcctgac cgtgctgaag ttcatcgcca acatcttcca cacctccaac 1560 caggaaaacc gcctgaagtc tgtgctgagg aagatcaagg aggagttcga gaagaccaag 1620 ggaagcatgg tgtgcgacgt gtgcaagtac gagtgcgaaa cctacaagga gctgaaggct 1680 cacggtgtgt cttgccccca gagccagtgc ccttactgct tcacccactg cgagccaacc 1740 gaagccgctt tccaggccca ctacaaggtg tgccaggtga cccaccgctt cagggacgac 1800 ctgaagaaga ccgtgacccc acagaacttc acccccggct gctacagaac cctgaacctg 1860 ttcagataca agtctcgttg ctacatcttc accatgtgga tcttcctgct ggtgctggaa 1920 agcatcctgt gggccgcttc tgctagcgag accccactga cccccgtgtg gaacgacaac 1980 gctcacggtg tgggcagcgt gccaatgcac accgacctgg aactggactt ctccctgacc 2040 tcctctagca agtacaccta ccgcaggaag ctgaccaacc ccctggagga agctcagtct 2100 atcgacctgc acatcgagat cgaggaacag accatcggag tggacgtgca cgctctgggt 2160 cactggttcg acggacgcct gaacctgaag accagcttcc actgctacgg tgcttgcacc 2220 aagtacgagt acccctggca caccgccaag tgccactacg agagggacta ccagtacgaa 2280 acctcctggg gctgcaaccc ttctgactgc ccaggagtgg gcaccggttg caccgcttgc 2340 ggactgtacc tggaccagct gaagcctgtg ggttctgcct acaagatcat caccatcaga 2400 tacagcagac gtgtgtgcgt gcagttcggc gaggaaaacc tgtgcaagat catcgacatg 2460 aacgactgct tcgtgtcccg tcacgtgaag gtgtgcatca tcggaaccgt gtctaagttc 2520 agccagggcg acaccctgct gttcttcgga ccactggagg gaggtggcct gatcttcaag 2580 cactggtgca cctctacctg ccagttcggc gaccccggag acatcatgag ccctagagac 2640 aagggcttcc tgtgccctga gttccccggc agcttccgta agaagtgcaa cttcgctacc 2700 acccccatct gcgagtacga cggtaacatg gtcagcggct acaagaaggt gatggccacc 2760 atcgactcct tccagtcttt caacacctcc accatgcact tcaccgacga gagatcgaa 2820 tggaaggacc ccgacggcat gctgcgtgac cacatcaaca tcctggtgac caaggacatc 2880 gacttgca acctgggtga aaacccttgc aagatcggcc tgcagacctc ctctatcgag 2940 ggagcttggg gcagcggtgt gggcttcacc ctgacctgcc tggtgtccct gaccgaatgc 3000 cccaccttcc tgaccttat caaggcttgc gacaaggcca tctgctacgg tgctgagagc 3060 gtgaccctga cccgcggcca gaacaccgtg aaggtgtccg gaaaggggagg tcactccggt 3120 tctaccttca ggtgctgcca cggagaagac tgcagccaga tcggtctgca cgctgctgct 3180 ccacacctgg acaaggtgaa cggtatctcc gagatcgaaa actctaaggt gtacgacgac 3240 ggagcccccc agtgcggtat caagtgctgg ttcgtgaagt ccggcgagtg gatctccggt 3300 atcttctctg gcaactggat cgtgctgatc gtgctgtgcg tgttcctgct gttcagcctg 3360 gtgctgctgt ccatcctgtg ccctgtgagg aagcacaaga agtcttaa 3408 <210> 2 <211> 52 <212> DNA <213> Synthetic <400> 2 cattttggca aagaattcgc caccatgggc atctggaagt ggctggtgat gg 52 <210> 3 <211> 44 <212> DNA <213> Synthetic <400> 3 gagcctccac ccccggtacc agacttcttg tgcttcctca cagg 44 <210> 4 <211> 30 <212> DNA <213> Synthetic <400> 4 cttcttcctc agcacacact tcaggcggtt 30 <210> 5 <211> 43 <212> DNA <213> Synthetic <400> 5 ctgtgctgag gaagaagaag gaggagttcg agaagaccaa ggg 43 <210> 6 <211> 33 <212> DNA <213> Synthetic <400> 6 gagcttcacg aaccagcact tgataccgca ctg 33 <210> 7 <211> 44 <212> DNA <213> Synthetic <400> 7 gctggttcgt gaagctcggc gagtggatct ccggtatctt ctct 44 <210> 8 <211> 39 <212> DNA <213> Synthetic <400> 8 cttagccttt ttatgcatgc atgggcatct ggaagtggc 39 <210> 9 <211> 40 <212> DNA <213> Synthetic <400> 9 ctatgtcgta ccgcatgctt acacagggca caggatggac 40

Claims

1. A method of preparing a VSV vector-based HTNV vaccine, characterized by, It comprises the following steps: S1, construction of pCAGGS-HTNV M(I532K) plasmid: With plasmid pUC-opti GPC as template, design mutation primers opti GPC-F-infu, GPC-R-infu, opti GPC-I532K seg1-R and opti GPC-I532K seg2-F, obtain pCAGGS-HTNV M(I532K) plasmid by mutating isoleucine at 532 site to lysine; respectively take opti GPC-F-infu, opti GPC-I532K seg1-R; opti GPC-I532K seg2-F, opti GPC-R-infu as primers, PCR amplification I532K seg1 and I532K seg2, then with pCAGGS-X-myc vector after double enzyme digestion, connection, obtain single mutation plasmid pCAGGS-HTNV M(I532K). EcoR I and Kpn I double enzyme digestion, connection, obtain single mutation plasmid pCAGGS-HTNV M(I532K). The nucleotide sequence of opti GPC in the plasmid pUC-opti GPC is shown in SEQ ID NO. 1; The sequence of the primer opti GPC-F-infu gene is shown in SEQ ID NO. 2; The sequence of the primer GPC-R-infu gene is shown in SEQ ID NO. 3; The sequence of the primer opti GPC-I532K seg1-R gene is shown in SEQ ID NO. 4; The sequence of the primer opti GPC-I532K seg2-F gene is shown in SEQ ID NO. 5; The point mutation process is as follows: first, I532K seg1 and I532K seg2 are amplified, then connected with the double enzyme-digested pCASSG vector, to construct the HTNV GPC single mutant pCAGGS-HTNV M(I532K), then the ligation product is transformed into DH5α competent bacteria, and double enzyme digestion is verified to obtain the pCAGGS-HTNV M(I532K) plasmid; The I532K seg1 and I532K seg2 and pCASSG vector connection system is as follows: pCAGGS vector 50 ng, I532K seg1 36 ng, I532K seg2 32 ng, 5×In-Fusion Enzyme Premix 0.8 µL, and the rest is ddH2O to make the total volume 30 µL; S2, construction of pCAGGS-HTNV M(I532K / S1094L) plasmid: With pCAGGS-HTNV M(I532K) plasmid as a template, opti GPC-S1094L seg1-R primer and opti GPC-S1094L seg2-F primer are designed, and 1094 site serine is mutated to leucine to obtain pCAGGS-HTNV M(I532K / S1094L) plasmid; I532K / S1094L seg1 and I532K / S1094L seg2 are amplified by PCR with opti GPC-F-infu, opti GPC-S1094L seg1-R; opti GPC-S1094L seg2-F, opti GPC-R-infu as primers, and then connected with pCAGGS-X-myc vector digested by I and I double enzymes to obtain double mutant plasmid pCAGGS-HTNV M(I532K / S1094L). EcoR Iand Kpn Idouble enzymes to obtain double mutant plasmid pCAGGS-HTNV M(I532K / S1094L). The sequence of the primer opti GPC-S1094L seg1-R is shown in SEQ ID NO. 6, and the sequence of the primer opti GPC-S1094L seg2-F is shown in SEQ ID NO. 7; S3, construction of recombinant plasmid rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP: Using pCAGGS-HTNV M (I532K / S1094L) plasmid as a template, primers rVSV- were designed. Sph IMF and Sph I-GPC-C6-R primers were used to amplify the target fragment HTNV M (I532K / S1094L / ΔC6), and then... Sph The plasmid pVSVΔG-GFP, after being digested with a single enzyme, was ligated. The ligation product was transformed into Stbl 3 competent cells, and the plasmid was extracted to obtain the recombinant plasmid rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP. The rVSV- Sph The gene sequence of the I-M-F primer is shown as SEQ ID NO.

8. Sph The gene sequence of the I-GPC-C6-R primer is shown as SEQ ID NO.

9. S4, preparation of rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine: When BHK-21 cells are cultured to about 90% confluence, VV-T7 is used to infect BHK-21 at MOI=5 for 2h, the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid and the auxiliary plasmids pBS-N, pBS-P, pBS-G and pBS-L are transfected, and the rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP vaccine is prepared; The rVSVΔG-HTNV M(I532K / S1094L / ΔC6)-GFP plasmid and VSV helper plasmids pBS-N, pBS-P, pBS-G, pBS-L are used in a ratio of 5:3:5:8:

1.

2. The method of preparing a VSV vector-based HTNV vaccine according to claim 1, wherein, In S1, the I532K seg1 and I532K seg2 are connected with the pCASSG vector system: pCAGGS vector 50 ng, I532K seg1 36 ng, I532K seg2 32 ng, 5×In-Fusion Enzyme Premix 0.8 µL, and the rest is ddH2O to make the total volume 30 µL.