Composition for treating insulin deficiency

Abstract

The present disclosure provides compositions and methods for treating an insulin deficiency (ID) disorder or related symptoms in a subject in need thereof, the compositions comprising S100 calcium binding protein A9 (S100A9), variants or fragments of S100 calcium binding protein A9, and insulin, variants or fragments of insulin.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority from European patent application serial number 19183317.7, filed on June 28, 2019, the content of which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] The sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification. The name of the text file containing the sequence listing is PAT7278PC00_ST25.txt. Technical Field

[0005] The present disclosure provides compositions and methods for treating an insulin deficiency (ID) disorder or related symptoms in a subject in need thereof, the compositions comprising S100 calcium binding protein A9 (S100A9), variants or fragments of S100 calcium binding protein A9, and insulin, variants or fragments of insulin. Background Art

[0006] Tens of millions of people suffer from type 1 diabetes (T1D), a condition caused by an autoimmune-mediated attack on pancreatic beta cells, resulting in total (or nearly total) beta cell loss and insulin deficiency.1 If untreated, T1D is a fatal catabolic disease characterized by hyperglycemia. Consequently, T1D research and drug development have focused primarily on improving strategies to reduce hyperglycemia without causing life-threatening hypoglycemia. 2,3 However, in addition to elevated circulating glucose levels, beta-cell loss can lead to several other defects, some of which (such as severe hyperketonemia and ketoacidosis) can be life-threatening. 4-7 Therefore, it is important to develop strategies that can not only improve hyperglycemia but also rescue the “other defects” caused by insulin deficiency (such as increased ketogenesis). For example, the results shown below emphasize the importance of improving both hyperglycemia and “other defects”. In fact, our data show that, despite a modest improvement in hyperglycemia, normalization of hyperketonemia and hypertriglyceridemia is associated with a significant extension of lifespan in mice with β-cell loss and insulin deficiency.

[0007] Untreated T1D can rapidly lead to death 4 However, since the discovery of insulin in the early 1920s 8,9Since the advent of insulin therapy, T1D has been treated; a way to transform this deadly disease into a tolerable one for humans. The remarkable success of insulin (representing one of the most important discoveries in medicine) has led to the conclusion that life without insulin is impossible, although the scientific community has had to admit that insulin therapy is unsatisfactory. 4 In fact, subjects with T1D are at increased risk of kidney failure, blindness, nerve damage, heart attack, stroke, and hypoglycemia. 4 Some of these defects may arise from insulin therapy itself. For example, insulin stimulates the synthesis of lipids and cholesterol; thus, it may be that due to its established lipogenic effects 10 Chronic insulin therapy promotes lipid deposition outside adipose tissue. This effect may contribute to the extremely high incidence of coronary artery disease observed in diabetic subjects. 5,6 Furthermore, the lipogenic effects of insulin promote lipid-induced insulin resistance and may therefore be responsible, at least in part, for the increased insulin requirements seen in long-term T1D care. 11 Insulin is also a potent blood sugar lowering hormone. Because of this effect, intensive insulin therapy can lead to hypoglycemia, which can cause disability and sometimes even death. 12-14 Because insulin therapy cannot eradicate the disabling side effects of T1D (e.g., heart attack, stroke, blindness, kidney failure, neuropathy, etc.), the cost of T1D care is substantial, and the quality of life of T1D patients is reduced compared to that of normal subjects. 15 Given the shortcomings of current treatments, research aimed at improving T1D treatment is urgently needed.

[0008] The primary approach is to gradually reduce the insulin dose, thereby reducing the risks associated with insulin therapy, such as life-threatening hypoglycemia. However, almost all intended adjunctive therapies to insulin focus on improving hyperglycemia. For example, synthetic analogs of amylin (pramlintide), incretin mimetics (such as glucagon-like peptide-1 receptor agonists and dipeptidyl-peptidase-4 inhibitors), and sodium-glucose transporter-1 and sodium-glucose transporter-2 (SGLT1 and SGLT2) inhibitors are all intended to reduce hyperglycemia and are associated with an increased risk of hypoglycemia. 2,3 Some of these treatments are also associated with an increased risk of ketoacidosis. 2,3 .

[0009] Therefore, there remains a need for improved therapeutic approaches for treating insulin deficiency (ID) disorders or related symptoms in subjects in need thereof that reduce the risk of hypoglycemia and ketoacidosis. Summary of the Invention

[0010] The present invention provides a composition for use in treating an insulin deficiency (ID) disorder or related symptoms in a subject in need thereof, the composition comprising:

[0011] i) S100 calcium binding protein A9 (S100A9), variants or fragments of S100 calcium binding protein A9 and

[0012] ii) Insulin, variants or fragments of insulin.

[0013] Another aspect of the present invention relates to a method for treating an insulin deficiency (ID) disorder or related symptoms in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of

[0014] i) S100 calcium binding protein A9 (S100A9), variants or fragments of S100 calcium binding protein A9 and

[0015] ii) insulin, variants or fragments of insulin.

[0016] Another aspect of the present invention relates to a plasmid or vector comprising one or more nucleic acids encoding the S100 calcium binding protein A9 (S100A9), variants or fragments of S100 calcium binding protein A9, and insulin, variants or fragments of insulin, and / or affinity tags of the present invention.

[0017] Another aspect of the present invention relates to a nucleic acid encoding: S100 calcium binding protein A9 (S100A9), S100 calcium binding protein A9 variant or fragment of the present invention, and insulin, insulin variant or fragment and / or affinity tag.

[0018] Another aspect of the invention relates to a host cell comprising the plasmid or vector or nucleic acid of the invention.

[0019] Another aspect of the present invention relates to a pharmaceutical composition comprising a therapeutically effective amount of i) to iii): i) a composition of the present invention, or ii) a plasmid or vector of the present invention, or iii) a host cell of the present invention; and at least one pharmaceutically acceptable excipient, diluent, carrier, salt and / or additive.

[0020] Another aspect of the present invention relates to a method for treating an insulin deficiency (ID) disorder or related symptoms in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of

[0021] i) S100 calcium binding protein A9 (S100A9), variants or fragments of S100 calcium binding protein A9 and

[0022] ii) insulin, variants or fragments of insulin.

[0023] Another aspect of the present invention relates to the use of a composition or pharmaceutical composition of the present invention in the preparation of a medicament for treating an insulin deficiency (ID) disorder or related symptoms.

[0024] Other aspects of the invention relate to a delivery device comprising a pharmaceutical composition of the invention and a kit comprising i) one or more reservoirs comprising a pharmaceutical composition or a delivery device of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1. Murine S100A9 ameliorates metabolic imbalances in diabetic (DT)-induced ID mice. (a) Proinsulin mRNA levels in DT-treated RIP-DTR mice (sacrificed 10 days after hydrodynamic tail vein injection (HTVI)) and their age-matched nondiabetic healthy controls. (b) Plasma insulin levels in DT-pLIVE and DT-pLIVE-S100A9 mice (10 days after HTVI) and age-matched healthy controls. (c) Plasma S100A9 levels and circulating (d) glucose, (e) glucagon and β-hydroxybutyrate, and (f) triglycerides. Error bars represent mean ± SEM. Statistical analysis was performed using one-way analysis of variance (Tukey's post-hoc test). Healthy (n = 3-6), DT-pLIVE (n = 7-12), and DT-pLIVE-S100A9 (n = 7-12). *P<0.05; **P<0.01; ***P<0.001, ****P<0.0001.

[0026] Figure 2 Enhanced murine S100A9 improves the effectiveness of insulin in reducing hyperglycemia in ID mice. An insulin dose of 1.5 U / mouse had no effect on hyperglycemia in DT-pLIVE mice (day 14 after hydrodynamic tail vein injection (HTVI)), but it did result in a rapid reduction in hyperglycemia in DT-pLIVE-S100A9 mice (day 14 after HTVI). Blood glucose was measured 3 hours after insulin injection.

[0027] Figure 3The presence of a C-terminal FLAG sequence does not affect the ability of murine S100A9 to ameliorate ID symptoms in mice. (a) Plasma insulin levels in DT-pLIVE mice, DT-pLIVE-n-S100A9 mice, and DT-pLIVE-S100A9-FLAG mice (day 7 after HTVI) and age-matched healthy controls (healthy) (ND = not detected). (b) Blood glucose. (c) Plasma β-hydroxybutyrate levels. For each group, n = 4-9. Error bars represent SEM. Statistical analysis was performed using one-way analysis of variance (Tukey's post-hoc test). Statistical results presented in each case are relative to the DT-pLIVE group. *P < 0.05; **P < 0.01; ***P < 0.001.

[0028] Figure 4 Recombinant murine S100A9 combined with suboptimal insulin therapy improves metabolic imbalance in ID mice. (A) Experimental treatment and grouping. (B) Plasma insulin levels and (C) blood glucose in mice (and healthy controls) on day 13 after the first STZ injection. (D) Plasma bovine insulin (released from Linbit particles) and (E) blood glucose in mice (and healthy controls) on day 17 (day 3 after particle implantation). (F) Blood glucose levels in mice (and healthy controls) after intraperitoneal injection of rS100A9 or saline. rS100A9 or saline injections were performed under a time factor (Zeitgeber, ZT) of 2. (G) Body weight. (H) The left graph shows daily or average daily food intake; the right graph shows food intake within 3 hours after saline or rS100A9 injection. Plasma and blood glucose values ​​at the indicated experimental times were obtained from mice with free access to food ("fed") or after 3 hours of food removal ("3-hour fasting"). N = 8 or 9 per group. In the insulin-treated group, all mice that showed plasma bovine insulin levels below 25 pg / mL were excluded from the study. In C and E, fed and fasted values ​​were obtained from plasma collected at ZT 2 and ZT 5, respectively. Error bars represent SEM. Statistical analysis was performed using one-way analysis of variance (Tukey's post-hoc test). The statistical results presented in each case are relative to the STZ-sham-saline group. *P<0.05; **P<0.01, ***P<0.001, ****P<0.0001. DETAILED DESCRIPTION

[0029] Although methods and materials similar or equivalent to those described herein can be used in the practice of the present invention or in testing, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned in this article are all incorporated herein by reference. The publications and applications discussed herein are only for the purposes disclosed before the date of filing this application. Anything herein should not be construed as admitting that the present invention has no right to be announced earlier than this type of publication due to prior invention. In addition, the materials, methods and embodiments are only illustrative and not restrictive.

[0030] In the event of a conflict, the present specification (including definitions) will control. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter herein belongs. As used herein, the following definitions are provided to facilitate understanding of the present invention.

[0031] The terms "comprise" or "comprising" are generally used to mean include / including, that is, to allow the presence of one or more features or components. The terms "comprise" and "comprising" also encompass the more restricted terms "consist" and "consisting", respectively.

[0032] As used in the specification and claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0033] As used herein, "at least one" means "one or more," "two or more," "three or more," etc. For example, at least one affinity tag includes one, two or more, three or more, etc. affinity tags.

[0034] As used herein, the terms "subject," "subject in need thereof," or "patient," "patient in need thereof" are well known in the art and are used interchangeably herein to refer to mammals, including dogs, cats, rats, mice, monkeys, cows, horses, goats, sheep, pigs, camels, and most preferably humans. In some cases, the subject is a subject in need of treatment or a subject suffering from a disease or condition. However, in other aspects, the subject can be a healthy subject. The term does not denote a specific age or sex. Thus, adult and neonatal subjects, whether male or female, are encompassed. Preferably, the subject is a human, and most preferably, the subject is a human suffering from an insulin deficiency (ID) condition or associated symptoms.

[0035] As used herein, the terms "treating," "treated," or "treatment" include preventative (eg, prophylactic), palliative, and therapeutic uses or outcomes.

[0036] As used herein, the term "insulin deficiency" refers to a partial or complete loss of insulin-producing pancreatic beta cells. The term also includes a reduction in their ability to secrete insulin, resulting in reduced circulating insulin levels.

[0037] As used herein, the term "insulin deficiency-related symptoms" refers to adverse effects caused by low levels or lack of insulin.

[0038] Symptoms associated with insulin deficiency generally refer to and are selected from the group consisting of hyperglycemia, hyperketonemia, ketoacidosis, hypertriglyceridemia, hyperglucoseemia, hypercalprotectinemia, increased or high circulating non-esterified fatty acids (NEFA) levels, severe hypoleptinemia, decreased or low body fat mass, increased appetite, polydipsia, and any combination thereof.

[0039] Insulin deficiency (ID) disorders generally refer to type 1 diabetes or type 2 diabetes, as well as subtypes of type 2 diabetes.

[0040] The terms "nucleic acid," "polynucleotide," and "oligonucleotide" are used interchangeably to refer to any type of deoxyribonucleotide (e.g., DNA, cDNA...) or ribonucleotide (e.g., RNA, mPvNA...) polymer, or a combination of deoxyribonucleotide and ribonucleotide (e.g., DNA / RNA) polymers, in a linear or cyclic conformation, and in a single-stranded or double-stranded form. These terms should not be construed as limiting the length of the polymer and may include known analogs of natural nucleotides, as well as nucleotides modified at the base, sugar, and / or phosphate moieties (e.g., phosphorothioate backbone). Typically, analogs of a particular nucleotide have the same base pairing specificity; i.e., an analog of A will base pair with T.

[0041] As used herein, the term "vector" refers to a viral vector or a nucleic acid (DNA or RNA) molecule, such as a plasmid or other vehicle, comprising one or more heterologous nucleic acid sequences (e.g., nucleic acid sequences encoding one or more nucleic acids encoding peptides (e.g., S100A9, insulin, and / or affinity tags of the present invention, variants or fragments thereof). The terms "expression vector," "gene delivery vector," and "gene therapy vector" refer to any vector that can effectively incorporate one or more nucleic acids into a cell and express the one or more nucleic acids in the cell, preferably under the control of a promoter (e.g., as described in Kallunki T, Barisic M, et al.). M, Liu B. How to Choose the Right Inducible Gene Expression System for Mammalian Studies? Cells. 2019; 8(8): 796). The cloning vector or expression vector may include additional elements, for example, regulatory elements and / or post-transcriptional regulatory elements other than the promoter.

[0042] The term "about" when referring specifically to a given number is intended to include a deviation of plus or minus ten (10) percent (e.g., ±10%). For example, about 20 consecutive amino acids also includes 18 to 22 consecutive amino acids, about 30 consecutive amino acids also includes 27 to 33 consecutive amino acids, etc.

[0043] As used herein, a "fragment" of a protein, peptide, or polypeptide of the present invention refers to a sequence that contains fewer amino acids than the protein, peptide, or polypeptide of the present invention. As long as the sequence exhibits the same properties as the native sequence from which it is derived, i.e., has biological activity, the sequence may be used.

[0044] The term "variant" refers to a protein, peptide or polypeptide having an amino acid sequence that differs to some extent from a native sequence peptide, i.e., an amino acid sequence that differs from the native sequence by amino acid substitutions, wherein one or more amino acids are substituted with another amino acid having the same characteristics and conformational effects. Amino acid sequence variants have substitutions, deletions and / or insertions at certain positions within the amino acid sequence of the native amino acid sequence. Substitutions can also be conservative, in which case the conservative amino acid substitutions are defined herein as exchanges within one of the following five groups:

[0045] I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, Gly

[0046] II. Polar, positively charged residues: His, Arg, Lys

[0047] III. Polar, negatively charged residues: and their amides: Asp, Asn, Glu, Gin

[0048] IV. Large, aromatic residues: Phe, Tyr, Tip

[0049] V. Large, aliphatic, nonpolar residues: Met, Leu, Ile, Val, Cys.

[0050] The present invention is based, in part, on the surprising discovery that administration of S100 calcium binding protein A9 (S100A9) along with otherwise suboptimal insulin doses greatly improves metabolism in insulin-deficient mice without causing hypoglycemia.

[0051] S100A9 belongs to the EF-hand superfamily of Ca2+-binding proteins and is highly expressed in monocytes and neutrophils and secreted in conditions of increased inflammation, such as rheumatoid arthritis or sepsis. 16,17 S100A9 forms a heterocomplex with its partner S100A8 (S100A9 / S100A8; also known as calprotectin), which is also secreted in inflammatory states. 18 Calprotectin is an endogenous activator of Toll-like receptor 4 (TLR4) 17 and the receptor for advanced glycation end products (RAGE) 19. Calprotectin has been shown to have multiple deleterious effects, including potential sepsis-induced lethality. 16,17,19-21 . However, others have shown that calprotectin can also exist in monomers to exert anti-inflammatory effects. 20 Notably, S100A9 homodimers have been reported to directly influence TLR4 signaling. 22 Collectively, these data suggest that calprotectin (S100A9 / S100A8 heterodimers) and S100A9 (S100A9 / S100A9 homodimers) regulate inflammatory pathways. Although calprotectin is thought to exert deleterious effects, there is murine and human evidence that S100A9 is beneficial. For example, enhanced S100A9 conferred significant beneficial metabolic effects in T1D mice (Figure 1).

[0052] One aspect of the present invention relates to a composition comprising i) S100 calcium binding protein A9 (S100A9), a variant or fragment of S100 calcium binding protein A9 and ii) insulin, a variant or fragment of insulin. Preferably, the composition is a composition for use in treating insulin deficiency (ID) or related symptoms in a subject in need thereof, comprising i) S100 calcium binding protein A9 (S100A9), a variant or fragment of S100 calcium binding protein A9 and ii) insulin, a variant or fragment of insulin.

[0053] The treatment includes reducing hyperglycemia, reducing and / or reducing the risk of hypoglycemia, reducing the increase in blood glycosylated hemoglobin levels, reducing hyperglucose levels, reducing and / or reducing the risk of hyperketonemia and ketoacidosis, reducing hypertriglyceridemia, reducing increased liver fatty acid oxidation (FAO), increasing liver native or modified S100A9 mRNA levels, increasing liver native or modified S100A9 protein levels, increasing plasma native or modified S100A9 protein levels, increasing liver ATP levels, extending lifespan, reducing circulating non-esterified fatty acids (NEFA) levels, reducing liver mitochondrial DNA levels, reducing circulating calprotectin levels, reducing lipase activity, or any combination thereof.

[0054] In certain aspects, the treatment comprises reducing the dose of insulin or the dose of a variant or fragment of insulin by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or more compared to administering insulin in the absence of S100A9 protein, variant or fragment of S100A9 protein.

[0055] Preferably, the S100A9 protein is a natural protein or a recombinant protein, or a variant or fragment of the natural protein or the recombinant protein having the amino acid sequence shown in SEQ ID NO: 1.

[0056] The S100A9 protein fragment is preferably an active fragment, which comprises at least about 25 consecutive amino acids, at least about 30 consecutive amino acids, at least about 35 consecutive amino acids, at least about 40 consecutive amino acids, at least about 45 consecutive amino acids, at least about 50 consecutive amino acids, at least about 55 consecutive amino acids, at least about 60 consecutive amino acids, at least about 65 consecutive amino acids, at least about 70 consecutive amino acids, at least about 75 consecutive amino acids, at least about 80 consecutive amino acids, at least about 85 consecutive amino acids, at least about 90 consecutive amino acids, at least about 95 consecutive amino acids, or at least about 100 consecutive amino acids, at least about 105 consecutive amino acids, or at least about 110 consecutive amino acids of the amino acid sequence as shown in SEQ ID NO: 1.

[0057] Non-limiting examples of S100A9 fragments include S100A9 N91 (SEQ ID NO: 2), S100A9 C91 (SEQ ID NO: 3), S100A9 N76 (SEQ ID NO: 4), and S100A9C76 (SEQ ID NO: 5), and combinations of one or more thereof.

[0058] The amino acid sequence of a variant of the S100A9 protein differs from the amino acid sequence of SEQ ID NO: 1 or an active fragment thereof in 1 to about 60 amino acids, preferably 1 to about 40 amino acids, more preferably 1 to about 20 amino acids, and even more preferably 1 to about 10 amino acids. Preferably, the amino acid sequence variant is a linear or cyclic peptide having substitutions, deletions, and / or insertions at certain positions within the native amino acid sequence or the amino acid sequence of SEQ ID NO: 1 as described above, at the N-terminus and / or C-terminus, and within one or more internal domains.

[0059] Typically, the sequence of such variants is functional, i.e., a biologically active variant, and has a high degree of sequence homology to the reference amino acid sequence, e.g., when the two sequences are aligned, the sequence homology exceeds 50%, typically exceeds 60%, even more specifically 80% or more, e.g., at least 90% or 95% or more. Such alignments and percentage homology or sequence identity can be determined using software programs known in the art, such as those described in Ausubel et al. eds. (2007) Current Protocols in Molecular Biology. Preferably, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, the programs are BLASTN and BLASTP using the following default parameters: genetic code = standard; filter = none; strand = both; break = 60; expectation = 10; matrix = BLOSUM62; description = 50 sequences; sort by = high score; database = non-replicates, GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + SwissProtein + SPupdate + PIR. Biologically equivalent polynucleotides are those having the above specified percentage homologies and encoding polypeptides having the same or similar biological activity.

[0060] Non-limiting examples of S100A9 protein variants are selected from the group consisting of SEQ ID No. 49, SEQ ID No. 50, SEQ ID No. 51, SEQ ID No. 52, and SEQ ID No. 53, and combinations of one or more thereof. These sequences correspond to S100A9 proteins found in other animal species, such as mammals, as shown in Table 1 below:

[0061] Table 1

[0062] Amino acid alignment shows homology of S100A9 between humans and other mammalian species

[0063]

[0064] Variants and fragments of the S100A9 protein may comprise synthetic, non-standard, and / or naturally occurring amino acid sequences (including D-isomers and / or retro-inverso isomers) derived from the naturally occurring amino acid sequence of the S100A9 protein. For example, the replacement amino acid may be a basic non-standard amino acid (e.g., L-ornithine, L-2-amino-3-guanidinopropionic acid, or D-isomers of lysine, arginine, and ornithine). Methods for introducing non-standard amino acids into proteins are known in the art and include recombinant protein synthesis using an E. coli auxotrophic expression host.

[0065] Non-naturally occurring amino acids include, but are not limited to, trans-3-methylproline, 2,4-methane-proline, cis-4-hydroxyproline, trans-4-hydroxy-proline, N-methylglycine, allo-threonine, methyl-threonine, hydroxyethylcysteine, hydroxyethylhomo-cysteine, nitroglutamine, homoglutamine, hexahydropicolinic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, and 4-fluorophenylalanine. Several methods for incorporating non-naturally occurring amino acid residues into proteins are known in the art.

[0066] Another example of an S100A9 variant includes an S100A9N69A-E78A variant having an amino acid sequence as shown in SEQ ID NO:6.

[0067] The S100A9 protein, its variants, or fragments can also be coupled to chemical or enzymatic moieties. These moieties are typically used to increase solubility, prolong stability, reduce immunogenicity, and / or enable fusion to immunoglobulins or specific regions of immunoglobulins. Non-limiting examples of these moieties include PEG, maleimide-PEG(n)-succinimide ester, and biotin.

[0068] Alternatively, the present invention further comprises i) a protein or polypeptide, said protein or polypeptide comprising, in one or more instances, an S100A9 protein, a variant or fragment of an S100A9 protein having an amino acid sequence as shown in SEQ ID NO: 1, or ii) said i) S100A9 protein, a variant or fragment of an S100A9 protein, insulin, a variant or fragment of insulin, and, when present, iii) at least one affinity tag, on the same peptide in any order.

[0069] Insulin is selected from natural insulin, recombinant insulin, proinsulin, basal insulin, insulin analogs or bolus insulin. Insulin is a protein comprising an A chain and / or a B chain having an amino acid sequence as shown in SEQ ID NO: 7 and / or SEQ ID NO: 8, or a variant or fragment of the A chain and / or B chain.

[0070] Insulin protein fragments refer to fragments of the A chain and / or B chain of insulin. The A chain insulin fragment has an A chain length of at least about 15 consecutive amino acids, at least about 16 consecutive amino acids, at least about 17 consecutive amino acids, at least about 18 consecutive amino acids, at least about 19 consecutive amino acids, at least about 20 consecutive amino acids, at least about 21 consecutive amino acids, at least about 22 consecutive amino acids, at least about 23 consecutive amino acids, at least about 24 consecutive amino acids, at least about 25 consecutive amino acids, at least about 26 consecutive amino acids, at least about 27 consecutive amino acids, at least about 28 consecutive amino acids, at least about 29 consecutive amino acids, at least about 30 consecutive amino acids, at least about 35 consecutive amino acids, or more consecutive amino acids of the native A chain amino acid sequence. The insulin fragment of the B chain has a B chain length of at least about 25 consecutive amino acids, at least about 26 consecutive amino acids, at least about 27 consecutive amino acids, at least about 28 consecutive amino acids, at least about 29 consecutive amino acids, at least about 29 consecutive amino acids, at least about 30 consecutive amino acids, at least about 31 consecutive amino acids, at least about 32 consecutive amino acids, at least about 33 consecutive amino acids, at least about 34 consecutive amino acids, at least about 35 consecutive amino acids, at least about 36 consecutive amino acids, at least about 37 consecutive amino acids, at least about 38 consecutive amino acids, at least about 39 consecutive amino acids, at least about 40 consecutive amino acids, at least about 41 consecutive amino acids, at least about 42 consecutive amino acids, at least about 42 consecutive amino acids, at least about 43 consecutive amino acids, at least about 44 consecutive amino acids, at least about 45 consecutive amino acids, at least about 50 consecutive amino acids, or more of the native amino acid B chain sequence.

[0071] Variants of insulin proteins are linear or cyclic peptides that differ from the amino acid sequences shown in SEQ ID NO: 7 and / or SEQ ID NO: 8 or active fragments thereof in 1 to about 60 amino acids, preferably 1 to about 40 amino acids, more preferably 1 to about 20 amino acids, and even more preferably 1 to about 10 amino acids. Preferably, the amino acid sequence variants have substitutions, deletions, and / or insertions at certain positions at the N-terminus and / or C-terminus of at least one of the two chains and within one or more internal domains of the amino acid sequence as described above. Typically, the sequences of such variants are functional, i.e., biologically active variants, and have a high degree of sequence homology to the reference amino acid sequence, for example, when the two sequences are aligned, the sequence homology is greater than 50%, typically greater than 60%, even more particularly 80% or more, for example at least 90% or 95% or more.

[0072] Non-limiting examples of insulin variants are selected from the group comprising insulin lispro (SEQ ID No. 9 and / or SEQ ID No. 10), insulin glulisine (SEQ ID No. 11 and / or SEQ ID No. 12), insulin aspart (SEQ ID No. 13 and / or SEQ ID No. 14), insulin glargine (SEQ ID No. 15 and / or SEQ ID No. 16), insulin detemir (SEQ ID No. 17 and / or SEQ ID No. 18) and insulin degludec (SEQ ID No. 19 and / or SEQ ID No. 20), and combinations of one or more thereof.

[0073] Variants and fragments of insulin proteins may comprise synthetic and / or naturally occurring amino acid sequences (including D-isomers and / or retro-inverso isomers) derived from the naturally occurring amino acid sequences of insulin proteins as described above.

[0074] Insulin protein, its variant or fragment can also be coupled with chemical moiety or enzyme moiety. These moieties are generally used to increase solubility, prolong stability, reduce immunogenicity and / or can be fused with immunoglobulin or specific region of immunoglobulin. Non-limiting examples of these moieties include PEG and biotin. Examples can be found in, for example, US 2010 / 0216690 and WO2007 / 104738 (which are incorporated herein in their entirety).

[0075] Many insulin analogs are known in the art. For example, insulin analogs include those described in, for example, US Publication No. 5597796, EP1193272, US 20090069216, and WO2007 / 096332 (incorporated herein in their entireties).

[0076] Proinsulin and proinsulin derivatives are also known in the art and can be selected, for example, from those described in US20190263881.

[0077] In one aspect of the present invention, the S100A9 protein, variant or fragment thereof further comprises at least one affinity tag, wherein the at least one affinity tag is attached to the C' terminus and / or N' terminus of the S100A9 protein, variant or fragment thereof.

[0078] Affinity tags are typically fused to the C' or N' terminus, or both, of recombinant proteins to facilitate affinity purification and detection. This approach enables highly selective capture and avoids the multi-step purification process that limits yield during R&D.

[0079] The affinity tag of the present invention can be any molecule, peptide or non-peptide that can be used for research and treatment, and any molecule, peptide or non-peptide that can be added to S100A9 protein, variants or fragments of S100A9 protein (Kimple et al., in Curr Protoc Protein Sci.; 73: Unit–9.9., 2013) and / or insulin, variants or fragments of insulin.

[0080] Preferably, the affinity tag is selected from the group consisting of: FLAG tag (SEQ ID NO: 21), chitin binding protein (CBP) tag (SEQ ID NO: 24), maltose binding protein (MBP) tag (SEQ ID NO: 25), streptomycin tag II (SEQ ID NO: 31), glutathione-S-transferase (GST) tag (SEQ ID NO: 32), poly (His) tag (SEQ ID NO: 33), C-myc (SEQ ID NO: 26), SBP (SEQ ID NO: 27), S (SEQ ID NO: 28), HAT (SEQ ID NO: 29), and a combination of one or more thereof.

[0081] More preferably, the affinity tag is a FLAG tag, which consists of or includes the amino acid sequence shown in SEQ ID NO: 21, or one or more combinations thereof. Examples of combinations or tandems of FLAG tags include 2x FLAG (SEQ ID NO: 22), 3x FLAG (SEQ ID NO: 23), etc.

[0082] Alternatively, the last tag of the 3x FLAG combination can encode an enterokinase cleavage site as shown in SEQ ID NO: 23 (DYKDHD-G-DYKDHD-I-DYKDDDDK).

[0083] Non-limiting examples of S100A9 proteins, variants or fragments of S100A9 proteins comprising one or more FLAG tags are selected from those listed in Table 2.

[0084] In certain aspects of the present invention, i) S100A9 protein, a variant or fragment of S100A9 protein, ii) insulin, a variant or fragment of insulin, and, when present, iii) at least one affinity tag are on the same peptide. Any combination is contemplated, for example (from N-terminus to C-terminus): S100A9-affinity tag-insulin, or S100A9-insulin, or insulin-S100A9, or insulin-affinity tag-S100A9, or affinity tag-insulin-S100A9, or insulin-S100A9-affinity tag, or affinity tag-S100A9-insulin, on the same peptide, separated or not separated by a peptidyl linker or a non-peptidyl linker. An example of a peptidyl linker (SEQ ID No. 47) is given in Table 2.

[0085] The compositions of the present invention may also include sodium-glucose co-transporter 1 (SGLT1) inhibitors and / or sodium-glucose co-transporter 2 (SGLT2) inhibitors, amylin analogs, biguanides (e.g., metformin), incretin mimetics (e.g., glucagon-like peptide receptor agonists, dipeptidyl-peptidase-4 inhibitors).

[0086] The i) S100A9 protein, variant or fragment thereof and / or ii) insulin, variant or fragment thereof, optionally coupled to an affinity tag, can be prepared by various methods and techniques known in the art, such as chemical synthesis or recombinant techniques as described in Maniatis et al. 1982, Molecular Cloning, A laboratory Manual, Cold Spring Harbor Laboratory.

[0087] As described herein, i) the S100A9 protein of the present invention, variants or fragments thereof, and / or ii) insulin, variants or fragments thereof, optionally coupled to an affinity tag, are preferably recombinantly produced in a cell expression system. A variety of unicellular host cells can be used to express nucleic acid sequences encoding the peptides of the present invention (e.g., S100A9, insulin, and / or affinity tags), variants or fragments thereof. These hosts can include well-known eukaryotic and prokaryotic hosts, such as Escherichia coli strains (E. coli), Pseudomonas strains (Pseudomonas), Bacillus strains (Bacillus), Streptomyces strains (Streptomyces), fungal strains such as yeast, and tissue cultured animal cells such as CHO, YB / 20, NSO, SP2 / 0, R1.1, BW, and LM cells, African green monkey kidney cells (e.g., COS 1, COS 7, BSCl, BSC40, and BMT10), insect cells (e.g., Sf9), as well as human cells and plant cells.

[0088] The present invention also encompasses one or more nucleic acids encoding a peptide of the present invention (eg, S100A9, insulin, and / or affinity tag), a variant, or a fragment thereof.

[0089] The present invention also encompasses gene delivery vehicles, preferably in the form of plasmids or vectors, comprising one or more nucleic acids encoding a peptide of the present invention (eg, S100A9, insulin and / or affinity tag), variants or fragments thereof.

[0090] As used herein, a "vector" is capable of transferring a nucleic acid sequence to a target cell (eg, viral vectors, non-viral vectors, microparticle carriers, and liposomes).

[0091] Suitable vectors include derivatives of SV40 and known bacterial plasmids, for example, E. coli plasmids col E1, pCR1, pBR322, pLive, pMB9 and their derivatives, plasmids such as RP4; phage DNA, for example, numerous derivatives of phage X (e.g., NM989) and other phage DNA (e.g., M1 3 and filamentous single-stranded phage DNA); yeast plasmids, such as 2μ plasmids or their derivatives; vectors for eukaryotic cells, for example, vectors for insect cells or mammalian cells; vectors derived from a combination of plasmids and phage DNA, for example, plasmids modified to use phage DNA or other expression control sequences; and the like. Various viral vectors are used to deliver nucleic acids to cells in vitro or in vivo. Non-limiting examples are vectors based on herpes viruses, pox viruses, adeno-associated viruses, lentiviruses, and the like. In principle, they are all suitable for delivering expression cassettes comprising expressible nucleic acid molecules encoding one or more nucleic acids encoding the peptides of the present invention (e.g., S100A9, insulin, and / or affinity tags), variants, or fragments thereof.

[0092] In one aspect, the viral vector is a vector suitable for ex vivo and in vivo gene delivery. More preferably, the viral vector is selected from the group consisting of adeno-associated virus (AAV) and lentivirus, such as first-generation, second-generation, and third-generation lentiviruses, but does not exclude other viral vectors, such as adenoviral vectors, herpes virus vectors, etc. Other delivery methods or vehicles (such as yeast systems, microvesicles, microemulsions, gene guns / attaching vectors to gold nanoparticles) are known and can be provided. In certain aspects, one or more viral or plasmid vectors can be delivered via liposomes, microparticles or nanoparticles, exosomes, microvesicles, or gene guns.

[0093] In other aspects of the invention, the pharmaceutical composition of the invention is a sustained-release formulation, or a formulation administered using a sustained-release device. Such devices are well known in the art and include, for example, transdermal patches and micro-implantable pumps that can provide drug delivery in a continuous, steady-state manner over time at varying doses to achieve the sustained-release effect of a non-sustainable-release pharmaceutical composition.

[0094] The present invention also encompasses host cells comprising a gene delivery vector of the present invention, or one or more nucleic acids encoding a peptide of the present invention (e.g., S100A9, insulin, and / or affinity tag), variants, or fragments thereof, preferably in the form of a plasmid or vector. The host cell can be any prokaryotic or eukaryotic cell, preferably a eukaryotic cell, and most preferably a mammalian cell. Even more preferably, the host cell is selected from the group consisting of pancreatic cells (e.g., β cells), islet cells, and pancreatic precursor cells. Preferably, the host cell is a human β cell.

[0095] The present invention also encompasses methods for enhancing secretion of the peptides of the present invention (e.g., S100A9, insulin and / or affinity tags), variants or fragments thereof, variants or fragments thereof, by implanting i) wild-type and / or genetically engineered pancreatic β cells, ii) drug-induced engineered pancreatic β cells or other types of cells, ii) light-induced engineered pancreatic β cells or other types of cells, iii) electromagnetically-induced engineered pancreatic β cells or other types of cells, and iv) electrically-induced engineered cells.

[0096] The present invention also encompasses methods for increasing the levels of insulin and / or S100A9, variants or fragments thereof by implanting a reservoir material, such as a solid pellet and / or a hydrogel implanted subcutaneously.

[0097] The present invention also encompasses methods for increasing the levels of insulin and / or S100A9, variants or fragments thereof by a combination of the above methods.

[0098] The present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of a composition comprising i) S100 calcium binding protein A9 (S100A9), a variant or fragment of S100 calcium binding protein A9 and insulin, a variant or fragment of insulin, or ii) a plasmid or vector of the present invention, or iii) a host cell of the present invention, and at least one pharmaceutically acceptable excipient, diluent, carrier, salt and / or additive.

[0099] Typically, the pharmaceutical compositions of the present invention are used for treating insulin deficiency (ID) disorders or related symptoms in a subject in need thereof.

[0100] As used herein, the term "therapeutically effective amount" refers to an amount of a composition or peptide of the present invention that is, within the scope of sound medical judgment, high enough to significantly positively improve the symptoms and / or condition to be treated, but low enough to avoid serious side effects (at a reasonable risk / benefit ratio).

[0101] The therapeutically effective amount of the composition or peptide of the present invention is selected based on a variety of factors, including the type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; and the patient's liver and kidney function. A physician of ordinary skill in the art can readily determine and prescribe the effective amount of the drug required to prevent, counteract or arrest the progression of insulin deficiency (ID) conditions or related symptoms.

[0102] Although the therapeutically effective amount will vary from patient to patient, a suitable daily intake per patient is in the range of about 0.1 mg to about 5000 mg (e.g., 0.1 mg, 0.5 mg, 1 mg, 2 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 75 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, The dosage of the peptide of the present invention is preferably about 1 mg to about 2000 mg per day (or, if used, a corresponding amount of its pharmaceutically acceptable salt or prodrug). In a specific aspect, the peptide of the present invention is administered to a subject in a daily dose ranging from about 1 mg to about 2000 mg.

[0103] A practicing physician or other technician will be able to routinely determine the most appropriate therapeutically effective amount for an individual patient. The above dosages are examples of general situations; of course, in individual cases, higher or lower dosage ranges are necessary, which are also within the scope of the present invention.

[0104] In some aspects, the pharmaceutical composition is administered as a depot formulation for injection. In other aspects, the pharmaceutical composition is administered as a large dose infusion or intravenous push.

[0105] A "pharmaceutically acceptable carrier or diluent" refers to a carrier or diluent that can be used to prepare a generally safe, non-toxic and desirable pharmaceutical composition, and includes carriers or diluents that are acceptable for human pharmaceutical use.

[0106] Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions.

[0107] Pharmaceutically acceptable excipients include starch, glucose, lactose, sucrose, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene glycol, water, ethanol, phenol, protamine sulfate, zinc oxide, etc.

[0108] The pharmaceutical composition may also include one or more pharmaceutically acceptable salts, such as inorganic acid salts, such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and organic acid salts, such as acetates, propionates, malonates, benzoates, and the like. In addition, adjuvants, such as wetting agents or emulsifiers, pH buffering substances, gels or gelling materials, flavorings, colorants, microspheres, polymers, suspending agents, and the like may also be present herein. In addition, one or more other conventional pharmaceutical ingredients, such as preservatives, wetting agents, suspending agents, surfactants, antioxidants, anticaking agents, fillers, chelating agents, coating agents, chemical stabilizers, and the like may also be present, particularly if the dosage form is a reconstituted form. Suitable exemplary ingredients include microcrystalline cellulose, sodium carboxymethylcellulose, polysorbate 80, phenylethyl alcohol, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, parachlorophenol, gelatin, albumin, and combinations thereof. Pharmaceutically acceptable excipients are discussed extensively in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., NJ 1991), which is incorporated herein by reference.

[0109] The pharmaceutical composition of the present invention can be applied to the experimenter by different approaches, including oral, parenteral, sublingual, transdermal, rectal, through mucosal, local, through inhalation, through buccal administration, intrapleural, intravenous, intraarterial, abdominal cavity, subcutaneous, intramuscular, intranasal intrathecal and intraarticular or their combination.For human use, the composition can be used as suitable acceptable preparation according to normal human practice. The technical staff will easily determine the dosage regimen and the route of administration that are most suitable for specific patients. The composition of the present invention can be applied to the experimenter by traditional syringe, pump, injection pen, microneedle patch, indwelling catheter, needle-free injection device, " micro-bullet bombardment gun " or other physical methods such as electroporation (" EP "), " hydrodynamic method ", or ultrasonic wave.

[0110] The pharmaceutical compositions of the present invention can also be delivered to patients by several techniques, including DNA injection with or without in vivo electroporation of nucleic acids encoding the peptides of the present invention (e.g., S100A9, insulin, and / or affinity tags), liposome-mediated, nanoparticle-facilitated recombinant vectors, such as the recombinant lentiviruses, recombinant adenoviruses, and recombinant adeno-associated viruses described herein.

[0111] The present invention also provides several technologies for enhancing the secretion of the peptides of the present invention (e.g., S100A9, insulin and / or affinity tags), which are achieved by implanting i) wild-type and / or genetically engineered host cells, ii) drug-induced engineered host cells, ii) light-induced engineered host cells, iii) electromagnetically induced engineered host cells, and iv) electrically induced engineered host cells (see, for example, Krawczyk K, Xue S, Buchmann P, et al. Electrogenetic cellular insulin release for real-time glycemic control intype 1 diabetic mice. Science. 2020; 368(6494): 993-1001, incorporated herein by reference).

[0112] Several techniques are also contemplated that aim to increase the levels of the peptides of the invention (eg S100A9, insulin and / or affinity tags) by implanting depot materials (eg solid pellets and / or hydrogels implanted subcutaneously).

[0113] Any combination of the delivery methods and techniques disclosed herein is contemplated.

[0114] The present invention also provides use of the composition and pharmaceutical composition of the present invention in the preparation of a medicament for treating insulin deficiency (ID) disorders or related symptoms.

[0115] The compositions or pharmaceutical compositions of the present invention are administered simultaneously, separately or staggered.

[0116] Combined or simultaneous administration can include co-administration in a single pharmaceutical formulation or using separate formulations, or sequential administration in any order but generally over a period of time so that all active agents can simultaneously exert their biological activities. The preparation and dosing regimen of such agents can be used according to the manufacturer's instructions or determined empirically by a skilled artisan.

[0117] The present invention also provides a method for treating an insulin deficiency (ID) disorder or related symptoms in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of

[0118] i) S100 calcium binding protein A9 (S100A9), variants or fragments of S100 calcium binding protein A9 and

[0119] ii) Insulin, variants or fragments of insulin.

[0120] In certain aspects, the treatment comprises increasing modified S100A9 mRNA levels in the liver, increasing modified S100A9 protein levels in the liver, increasing modified S100A9 protein levels in plasma, reducing glucagonemia, reducing ketonemia, reducing triglyceridemia, reducing circulating non-esterified fatty acids (NEFA) levels, reducing hyperketonemia, reducing hepatic fatty acid oxidation (FAO), increasing hepatic ATP levels, reducing hepatic mitochondrial DNA levels, extending lifespan, reducing calprotectin levels, reducing hyperglycemia, reducing hypertriglyceridemia, reducing hyperglucagonemia, reducing hypercalprotectinemia, reducing hypoleptinemia, reducing body fat mass, reducing hyperphagia, reducing polydipsia, or any combination thereof.

[0121] In certain aspects, the treatment comprises reducing the insulin dose by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or more compared to administering insulin in the absence of S100A9 protein, variant or fragment of S100A9 protein.

[0122] The combination of the aforementioned reduced insulin dose and S100A9 protein, variant or fragment thereof can achieve similar or better metabolic control compared to 100% insulin dose in the absence of S100A9 protein, variant or fragment thereof.

[0123] Table 2

[0124]

[0125]

[0126]

[0127] The present invention also encompasses a delivery device comprising the composition, composition for use or pharmaceutical composition of the present invention. Preferably, the delivery device is selected from the group consisting of a syringe, pump, pen, microneedle patch, needle-free injection device or indwelling catheter comprising the composition, composition for use or pharmaceutical composition of the present invention.

[0128] The present invention also encompasses a kit comprising:

[0129] i) a first reservoir comprising a composition of the invention and ii) a second reservoir comprising pharmaceutically acceptable excipients, diluents, carriers, salts and / or additives,

[0130] or

[0131] iii) one or more reservoirs comprising a pharmaceutical composition of the invention,

[0132] or

[0133] iv) a delivery device selected from the group of a syringe, a pump, a pen, a needle or an indwelling catheter comprising the composition or pharmaceutical composition of the present invention.

[0134] The test kit of the present invention may also include a label or package insert that is located on or associated with the reservoir or container. Suitable containers include, for example, bottles, vials, syringes, etc. The container may be formed from a variety of materials, such as glass or plastic. The container may contain a composition that can effectively treat the symptoms of the present invention and may have a sterile inlet. Alternatively or in addition, the test kit may also include a second (or third) container that includes a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline (PBS), Ringer's solution, and glucose solution. From a commercial and user perspective, the test kit may also include other required materials, including other buffers, diluents, filters, needles, and syringes.

[0135] The label or package insert may include instructions for use. The included instructions may be affixed to the packaging material or included as a package insert. While instructions are typically written or printed, they are not limited to such. This disclosure encompasses any medium capable of storing such instructions and communicating them to an end user.

[0136] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those skilled in the art. It is therefore intended that the appended claims encompass all such modifications and changes as fall within the true spirit of the invention.

[0137] References

[0138] 1.Wasserfall, C., et al.Persistence of Pancreatic Insulin mRNAExpression and Proinsulin Protein in Type 1 Diabetes Pancreata.Cellmetabolism26, 568-575 e563(2017).

[0139] 2. Harris, K., Boland, C., Meade, L. & Battise, D. Adjunctive therapy for glucose control in patients with type 1 diabetes. Diabetes MetabSyndr Obes 11, 159-173 (2018).

[0140] 3.Lyons,S.K.,et al.Use of Adjuvant Pharmacotherapy in Type 1Diabetes:Intemational Comparison of 49,996 Individuals in the ProspectiveDiabetes Follow-up and T1D Exchange Registries.Diabetes Care 40,e139-e140(2017).

[0141] 4.Coppari,R.&Bjorbaek,C.Leptin revisited:its mechanism of action andpotential for treating diabetes.Nature reviews.Drug discovery 11,692-708(2012).

[0142] 5.Larsen,J,et al.Silent coronary atheromatosis in type l diabeticpatients and its relation to long-term glycemic control.Diabetes 51,2637-2641(2002).

[0143] 6.Orchard,T.J,et al.Insulin resistance-related factors,but notglycemia,predict coronary artery disease in type 1 diabetes:10-year follow-updata from the Pittsburgh Epidemiology of Diabetes ComplicationsStudy.Diabetes care 26,1374-1379(2003).

[0144] 7.Umpierrez,G.&Korytkowski,M.Diabetic emergencies-ketoacidosis,hyperglycaemic hyperosmolar state and hypoglycaemia.Naturereviews.Endocrinology 12,222-232(2016).

[0145] 8.Banting,F.G.,Best,C.H.,Collip,J.B.,Campbell,W.R&Fletcher,A.A.Pancreatic Extracts in the Treatment of Diabetes Mellitus.Candian MedicalAssociation journal 12.141-146 (1922).

[0147] 9.Banting,F.G.,Campbell,W.R.&Fletcher,A.A.Further Clinical Experiencewith Insulin (Pancreatic Extracts)in the Treatment of DiabetesMellitus.British medical journal1,8-12(1923).

[0148] 10.Horton,J.D.,Goldstein,J.L.&Brown,M.S.SREBPs:activators of thecomplete program of cholesterol and fatty acid synthesis in theliver.TheJoural of clinical investigation 109,1125-1131(2002).

[0149] 11.Shulman,G.I.Cellular mechanisms of insulin resistance.The Journalof clinicalinvestigation 106,171-176(2000)

[0150] 12Bulsara,M.K.,Holman,C.D.,Davis,E.A.&Jones,T.W.The impact of adecade of changing treatment on rates of severe hypoglycemia in a population-based cohort of children with type 1 diabetes.Diabetes Care 27,2293-2298(2004).

[0151] 13.Cryer,P.E.Hypoglycemia-associated autonomic failure indiabetesAmerican journal of physiology.Endocrinology and metabolism 281,E1115-1121(2001).

[0152] 14Cryer.P.E.Mechanisms of hypoglycemia-associated autonomic failuteand its component syndromes in diabetes.Diabetes 54,3592-3601(2005).

[0153] 15.Chiang,J.L.,Kirkman,M.S.,Laffel,L.M.,Peters,A.L.&Type 1DiabetesSourcebook,A.Type l diabetes through the life span:a position statement ofthe American Diabetes Association.Diabetes Care 37,2034-2054(2014).

[0154] 16.Averill,M.M.,Kerkhoff,C.&Bornfeldt,K.E.S100A8 and S100A9 incardiovascular biology and disease.Arteriosclerosis,thrombosis,and vascularbiology 32,223-229(2012).

[0155] 17.Loser,K.,et al.The Toll-like receptor 4ligands Mrp8 and Mrp14 areerucial in the development of autoreactive CD8+T cells.Nature mediclne 16,713-717(2010).

[0156] 18.Leanderson,T.,Liberg,D.&Ivars,F.S100A9 as a Pharmacological TargetMolecule in Inflammation and CancerEndocrine,metabolic&immune disorders drugtargets 15,97-104(2015).

[0157] 19.Eggers,K.,et al.RAGE-dependent regulation of calcium-bindingproteins S100A8 and S100A9 in human THP-1.Experimental andclinicalendocrinology&diabetes:official journal,German Society ofEndocrinology[and]German Diabetes Association 119,353-357(2011).

[0158] 20.Geczy,C.L.,Chung,Y.M.&Hiroshima,Y.Calgranulins may contributevascular protection in atherogenesis.Circulation journal:official journal ofthe Japanese Circulation Socity 78,271-280(2014).

[0159] 21.Vogl,T.,et al.Mrp8 and Mrp14 are endogenous activators of Toll-like receptor 4,promoting lethal,endotoxin-induced shock.Nature medicie 13,1042-1049(2007).

[0160] 22.Vogl,T.,et al.Autoinhibitory regulation of S100A8 / S100A9 alarminactivity locally restricts sterile inflammation.,J Clin Invest 128,1852-1866(2018).

[0161] 23.Blanco-Rojo,R.,et al.Interaction of an S100A9 gene aiant withsaturated fat and carbohydrates to modulate insulin resistance in 3populations of different ancestries.The mmerican journal of clinical mutritio104,508-517(216).

[0162] 24Ortega,F.J.,et al.Targeting the association of calgranulin B(S100A9)with insulin resistance and tyte 2 diabetes.J MolMed(Berl)91,523-534(2013).

[0163] 25.Nyalwidhe,J.O.,et al.Comparative quantitative proteomic analysisof disease stratified laser captured microdissected human islets identifiesprotens and pathways potentially related to type l diabetes.PloS one 12,e0183908(2017).

[0164] 26.Zhi,W.,et al.Discovery and validation of serun protein changes intype l diabetes patients using high throughput two dimensional liquidchromatography-mass spectrometry and immunoassays.Molecular&cellularproteomics:MCP 10,M111012203(2011).

[0165] 27Fujikawa,T.,et al.Leptin engages a hypothalamic neurocircuitry topermit survival in the absence of insulin.Cell metabolism 18,431-444(2013).

[0166] 28Ramadori,G.et al.S100A9 extends lifespan in insulin deficiency.NatCommun 10,3545,doi:10.1038 / s41467-019-11498-x(2019).

[0167] 29 Fujikawa, T., Chuang, J. C., Sakata, I., Ramadori, G. & Coppari, R. Leptintherapy improves insulin-deficient type 1 iiabetes by CNS-dependent mechanisms in mice. Proo Natl Acad SciUSA 107, 17391-17396, doi:10.1073 / pnas.1008025107(2010).

[0168] Example

[0169] Materials and methods

[0170] Animals and Induction of Insulin Deficiency. All mice were housed in a light- and temperature-controlled environment with free access to standard chow and water. Adult male mice were used for all experiments described in this study. The insulin-deficient animal model was established as follows: Diphtheria toxin (DT, Sigma Aldrich) was dissolved in sterile 0.9% NaCl and administered intraperitoneally to RIP-DTR animals (0.5 μg / kg body weight on days 0, 1, and 4).

[0171] Evaluation of mRNA, protein, and substrate content. Mice were sacrificed, and their tissues were quickly removed and snap-frozen in liquid nitrogen, and the tissues were subsequently stored at -80°C. RNA was extracted using Trizol reagent (Invitrogen). Complementary DNA was generated by Superscript II (Invitrogen) and used for real-time quantitative PCR (q-RTPCR) analysis with SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA). mRNA content was normalized to 18s mRNA levels. All analyses were performed using Applied Biosystems 5 real-time PCR system. For each mRNA assessment, q-RTPCR analysis was repeated at least three times. Protein was extracted by homogenizing the samples in lysis buffer (Tris 20 mM, EDTA 5 mM, NP40 1% (v / v)), protease inhibitors (P2714-1BTL, from Sigma, St. Louis, MO, USA), followed by SDS-PAGE separation and final transfer of the proteins to a nitrocellulose membrane by electroblotting. The following antibody was used: Calgranulin B-S100A9 (Cat. No. PB9678, Boster).

[0172] Circulating substrate and hormone levels. Tail vein blood was collected between 2:00 PM and 4:00 PM from mice that were fed ad libitum. To avoid confounding effects from a randomized postprandial meal, food was removed 2 hours before blood collection. Serum or plasma samples were collected after centrifugation (3500 x g, 10 minutes) and stored at -80°C. Glucose, non-esterified fatty acids, triglycerides, ketone bodies, and glucagon levels were measured using commercially available kits.

[0173] Overexpression of S100A9. Hydrodynamic tail vein injection (HTVI) was performed. Overexpression of S100A9 was achieved by using the pLIVE vector (Myrus) that allows expression of a given gene under the control of the albumin promoter. The following sequence was cloned into pLIVE between the restriction sites BamH1 and Xho1:

[0174] GCTAGCGGATCCGCCGCCACCATGGCCAACAAAGCACCTTCTCAGATGGAGCGCAGCATAACCACCATCATCGACACCTTCCATCAATACTCTAGGAAGGAAGGACACCCTGACACCCTGAGCAAGAAGGAATTCAGACAAATGGTGGAAGCACAGTTGGCAACCTTTATGAAGAAAGAGAAGAGAAATGAAGCCCTC ATAAATGACATCATGGAGGACCTGGACACAAACCAGGACAATCAGCTGAGCTTTGAGGAGTGTATGATGCTGATGGCAAAGTTGATCTTTGCCTGTCATGAGAAGCTGCATGAGAACAACCCACGTGGGCATGGCCACAGTCATGGCAAAGGCTGTGGGAAGGACTACAAAGACGATGACGACAAGTGACTCGAG(SEQ ID No.45).

[0175] pLIVE-S100A9 plasmid DNA was sequenced to confirm the correct sequence and orientation. Each mouse received 50 μg of pLIVE-S100A9 or pLIVE; age-matched mice that did not undergo any manipulation were used as healthy controls. Figure 2 The data shown in Figure 3 were collected from mice injected intraperitoneally with 20 μg of recombinant S100A9.

[0176] Statistical Analysis Data sets were analyzed for statistical significance using PRISM (GraphPad, San Diego, CA) with two-sided unpaired Student's t-test when two groups were compared, or one-way or two-way ANOVA (Tukey's post hoc test) when more than two groups were compared.

[0177] Example 1

[0178] result

[0179] Beneficial metabolic effects of enhanced S100A9 in a T1D mouse model

[0180] The inventors overexpressed S100A9 in insulin-deficient mice. The inventors performed hydrodynamic tail vein injection studies in RIP-DTR mice, which carry the rat insulin promoter (RIP) upstream of the diphtheria toxin receptor (DTR) sequence cloned into the Hprt locus on the X chromosome. After three consecutive intraperitoneal DT administrations, RIP-DTR mice almost completely lost pancreatic β cells. 27 In fact, in RIP-DTR mice that underwent DT injection of either pLIVE (DT-pLIVE) or pLIVE-S100A9 (DT-pLIVE-S100A9) for HTVI, almost all pancreatic β cells were ablated (data not shown). Consistent with β cell loss, pancreatic proinsulin mRNA levels were barely measurable, and these defects resulted in almost undetectable circulating insulin in both DT-pLIVE and DT-pLIVE-S100A9 mice (Figures 1a and 1b). To test whether S100A9 is increased in DT-pLIVE-S100A9 mice, we assessed plasma S100A9 levels and found that plasma S100A9 levels were increased in DT-pLIVE-S100A9 mice compared to DT-pLIVE mice and healthy controls (Figure 1c). Overall, these data indicate that DT-pLIVE-S100A9 mice are insulin-deficient and overexpress S100A9. Due to their insulin resistance, DT-pLIVE mice developed hyperglycemia, hyperketonemia, hypertriglyceridemia, and hyperglucagonemia (Figures 1d-1f). Next, we assessed the effects of S100A9 overexpression on these deficiencies. Hyperglycemia was slightly improved in DT-pLIVE-S100A9 mice compared to DT-pLIVE mice (Figure 1c). Notably, circulating levels of glucagon, β-hydroxybutyrate, and triglycerides were similar between DT-pLIVE-S100A9 mice and healthy controls and significantly decreased between DT-pLIVE-S100A9 mice and DT-pLIVE controls, respectively (Fig. 1e to 1f).

[0181] The therapeutic value of S100A9 combined with insulin in T1D

[0182] Figure 2 The results presented demonstrate the metabolic and pro-survival effects of enhanced S100A9 in T1D mice. The inventors set out to test whether enhanced S100A9 could reduce the insulin dose used to treat T1D. Specifically, the inventors increased circulating S100A9 levels in combination with suboptimal insulin doses (an insulin regimen that fails to improve hyperglycemia and hyperketonemia caused by beta cell loss).

[0183] Figure 2 The results presented also demonstrate that while a suboptimal dose of insulin did not affect hyperglycemia in control mice, it significantly reduced hyperglycemia in mice overexpressing S100A9 without causing hypoglycemia.

[0184] Example 2

[0185] The presence of a C-terminal FLAG sequence did not interfere with the ability of S100A9 to ameliorate ID symptoms in mice.

[0186] To determine whether the addition of a FLAG tag sequence to S100A9 affects the ability of S100A9 to ameliorate ID symptoms in mice, we used HTVI to deliver plasmids overexpressing the full-length native S100a9 sequence (with or without a C-terminal FLAG tag) under the control of the albumin promoter (pLIVE-n-S100A9 or pLIVE-S100A9-FLAG) or a control empty vector (pLIVE) to DT-treated RIP-DTR mice that had undergone HTVI with pLIVE (DT-pLIVE) or pLIVE-n-S100A9 (DT-pLIVE-n-S100A9) or pLIVE-S100A9-FLAG (DT-pLIVE-S100A9-FLAG). 27 showed similar degrees of hypoinsulinemia ( Figure 3 a). Although DT-pLIVE mice exhibited hyperglycemia and hyperketonemia, DT-pLIVE-n-S100A9 mice and DT-pLIVE-S100A9-FLAG mice showed similar improvements in these parameters ( Figure 3 b to Figure 3 c) These data indicate that fusion of S100A9 to a FLAG tag sequence does not interfere with the beneficial effects of S100A9. Furthermore, these results suggest that, in addition to the FLAG sequence, other sequences of interest can be fused to S100A9 without interfering with the ability of S100A9 to improve ID symptoms.

[0187] Recombinant S100A9 combined with suboptimal insulin treatment improves metabolic imbalance in ID mice.

[0188] To directly test the therapeutic potential of S100A9, we evaluated the metabolic consequences of administering recombinant S100A9 (rS100A9) alone or in combination with suboptimal doses of insulin in streptozotocin (STZ)-treated mice. Figure 4 As shown in a, 8-week-old male FVB mice were intraperitoneally (ip) injected with STZ (150 mg / kg body weight) twice, one week apart (this treatment produces an established ID model). 27，28，29 Two weeks after the first STZ injection, mice were randomly divided into three groups: i) the “STZ-insulin-rS100A9” group was surgically implanted with subcutaneous insulin pellets (composed of half of Linbit pellets, Linshin-Canada, expected to continuously deliver bovine insulin at a dose with minimal effect on blood glucose) and three days after the surgery, these mice were intraperitoneally injected with rS100A9 (1 mg / kg body weight); ii) the “STZ-insulin-saline” group was surgically implanted with subcutaneous insulin pellets as described above and three days after the surgery, these mice were intraperitoneally injected with saline; iii) the “STZ-sham-saline” group was surgically treated as the previous group and three days after the surgery, these mice were intraperitoneally injected with saline. Age-matched untreated mice served as healthy controls ( Figure 4 a). As expected, STZ treatment resulted in severe insulinopenia and hyperglycemia ( Figure 4 b- Figure 4 c). Three days after surgery, STZ-insulin-rS100A9 mice and STZ-insulin-saline mice showed detectable plasma bovine insulin levels ( Figure 4 d), whereas bovine insulin was not expected to be measurable in STZ-sham-saline mice and healthy mice ( Figure 4 d). Consistent with suboptimal insulin dosing, STZ-insulin-rS100A9 mice and STZ-insulin-saline mice exhibited hyperglycemia three days after surgery, as they showed only a modest reduction in blood glucose 3 hours after food removal compared with the STZ-sham-saline group ( Figure 4 e) Next, we monitored the acute metabolic effects of ip injection of rS100A9.

[0189] Our data showed that three hours after injection, hyperglycemia was similar between STZ-insulin-saline mice and STZ-sham-insulin mice ( Figure 4f). However, the combination of insulin and ip rS100A9 resulted in a small but significant decrease in blood glucose in the STZ-insulin-rS100A9 group compared to the STZ-sham-insulin group ( Figure 4 f). It is noteworthy that these data were obtained from ID mice of similar body weight. In fact, STZ treatment induced similar weight loss in all three groups, while neither insulin nor rS100A9 treatment nor the combination of both affected body weight ( Figure 4 g). In addition, all three ID groups showed hyperphagia, and there was a trend toward decreased food intake in mice treated with insulin (and no additional effect caused by rS100A9 injection) ( Figure 4 h). Overall, these data indicate that intraperitoneal injection of rS100A9 (1 mg / kg body weight) combined with suboptimal doses of insulin is sufficient to produce beneficial effects on blood glucose in ID mice. Sequence Listing <110> University of Geneva <120> Composition for treating insulin deficiency <130> PAT7278PC00 <150> EP19183317.7 <151> 2019-06-28 <160> 53 <170> PatentIn version 3.5 <210> 1 <211> 114 <212> PRT <213> Homo sapiens <400> 1 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met His Glu 85 90 95 Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Gly 100 105 110 Thr Pro <210> 2 <211> 91 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 2 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His 85 90 <210> 3 <211> 91 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 3 Met Lys Leu Gly His Pro Asp Thr Leu Asn Gln Gly Glu Phe Lys Glu 1 5 10 15 Leu Val Arg Lys Asp Leu Gln Asn Phe Leu Lys Lys Glu Asn Lys Asn 20 25 30 Glu Lys Val Ile Glu His Ile Met Glu Asp Leu Asp Thr Asn Ala Asp 35 40 45 Lys Gln Leu Ser Phe Glu Glu Phe Ile Met Leu Met Ala Arg Leu Thr 50 55 60 Trp Ala Ser His Glu Lys Met His Glu Gly Asp Glu Gly Pro Gly His 65 70 75 80 His His Lys Pro Gly Leu Gly Glu Gly Thr Pro 85 90<~ <210> 4 <211> 76 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 4 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30<F Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 ৪5 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe 65 70 75 <210> 5 <211> 76 <212> PRT <213> Unknown<০০০০৫১২>[[ID=3৫]]<220> <223> Artificial Sequence <4০০> 5 Met Leu Val Arg Lys Asp Leu Gln Asn Phe Leu Lys Lys Glu Asn Lys 1 5 10 15 Asn Glu Lys Val Ile Glu His Ile Met Glu Asp Leu Asp Thr Asn Ala 20 25 30 Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile Met Leu Met Ala Arg Leu It should be noted that there are some potential errors in the original text, such as the "৪5" in line 17 which may be a typo. Also, the "০০০০৫১২" in line 34 seems to be an incorrect encoding. The above translation tries to handle the text as accurately as possible based on the provided rules despite these issues. 35 40 45 Thr Trp Ala Ser His Glu Lys Met His Glu Gly Asp Glu Gly Pro Gly 50 55 60 His His His Lys Pro Gly Leu Gly Glu Gly Thr Pro 65 70 75 <210> 6 <211> 114 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 6 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe<00′00537>35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Ala Ala Asp Lys Gln Leu Ser Phe Glu Ala Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met His Glu 85 90 95 Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Gly 100 105 110 Thr Pro <210> 7 <211> 21 <212> PRT <213> Homo sapiens <400> 7 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn 20 <210> 8 <211> 30 <212> PRT <213> Homo sapiens <400> 8 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr 20 25 30 [[ID=四十二]]<210> 9[[ID=四十三]] [[ID=四十四]]<211> 21[[ID=四十五]] [[ID=四十六]]<212> PRT[[ID=四十七]] [[ID=四十八]]<213> Unknown[[ID=四十九]] [[ID=五十]]<220>[[ID=五十一]] [[ID=五十二]]<223> Artificial Sequence[[ID=五十三]] [[ID=五十四]]<400> 9[[ID=五十五]] [[ID=五十六]]Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu[[ID=五十七]] [[ID=五十八]]1 5 10 15[[ID=五十九]] [[ID=六十]]Glu Asn Tyr Cys Asn[[ID=六十一]] [[ID=六十二]]20 <210> 10 <211> 30 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 10 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Lys Pro Thr 20 25 30 <210> 11 <211> twenty one <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 11 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn 20 <210> 12 <211> 30 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 12 Phe Val Lys Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Glu Thr 20 25 30 <210> 13 <211> twenty one <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 13 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn 20 <210> 14 <211> 30 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 14 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Asp Lys Thr 20 25 30 <210> 15 <211> twenty one <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 15 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Gly 20 <210> 16 <211> 32 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 16 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg 20 25 30 <210> 17 <211> twenty one <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 17 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn 20 <210> 18 <211> 29 <212> PRT <213> Unknown <220> <223> Artificial Sequence <220> <221> MISC_FEATURE <222> (29)..(29) <223> Myristic acid is added to the epsilon-amino group of K in position 29 position 29) <400> 18 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys 20 25 <210> 19 <211> twenty one <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 19 Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn 20 <210> 20 <211> 29 <212> PRT <213> Unknown <220> <223> Artificial Sequence <220> <221> MISC_FEATURE <222> (29)..(29) <223> A 16-carbon fatty acid is added to the epsilon-amino group of K in position 29 of the B chain via a γ-glutamic acid linker. position 29 of chain B via a gamma-glutamic acid linker) <400> 20 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys 20 25 <210> twenty one <211> 8 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> twenty one Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 <210> twenty two <211> 13 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> twenty two Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp 1 5 10 <210> twenty three <211> twenty two <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 23 Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp Tyr 1 5 10 15 Lys Asp Asp Asp Asp Lys 20 <210> 24 <211> 51 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 24 Thr Asn Pro Gly Val Ser Ala Trp Gln Val Asn Thr Ala Tyr Thr Ala 1 5 10 15 Gly Gln Leu Val Thr Tyr Asn Gly Lys Thr Tyr Lys Cys Leu Gln Pro 20 25 30 His Thr Ser Leu Ala Gly Trp Glu Pro Ser Asn Val Pro Ala Leu Trp 35 40 45 Gln Leu Gln 50 <210> 25 <211> 387 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 25 Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn 355 360 365 Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile 370 375 380 Glu Gly Arg 385 <210> 26 <211> 10 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 26 Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10 <210> 27 <211> 38 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 27 Met Asp Glu Lys Thr Thr Gly Trp Arg Gly Gly His Val Val Glu Gly 1 5 10 15 Leu Ala Gly Glu Leu Glu Gln Leu Arg Ala Arg Leu Glu His His Pro 20 25 30 Gln Gly Gln Arg Glu Pro 35 <210> 28 <211> 15 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 28 Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp Ser 1 5 10 15 <210> 29 <211> 19 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 29 Lys Asp His Leu Ile His Asn Val His Lys Glu Phe His Ala His Ala 1 5 10 15 His Asn Lys <210> 30 <211> 26 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 30 Lys Arg Arg Trp Lys Lys Asn Phe Ile Ala Val Ser Ala Ala Asn Arg 1 5 10 15 Phe Lys Lys Ile Ser Ser Ser Gly Ala Leu 20 25 <210> 31 <211> 8 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 31 Trp Ser His Pro Gln Phe Glu Lys 1 5 <210> 32 <211> 232 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 32 Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys 50 55 60 Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu 85 90 95 Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 Gly Ser Pro Gly Ile His Arg Asp 225 230 <210> 33 <211> 6 <212> PRT <213> Unknown <220> It should be noted that there was an error in the original "Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr" translation where "21" and " " and "900>" and "901>" and "902>" and "903>" and "904>" and "905>" and "906>" and "907>" and "908>" and "909>" and "910>" and "911>" were incorrect formats. They have been corrected in the translation above. Also, "未知(Unknown)" was translated more accurately as "Unknown".<223> Artificial Sequence <400> 33 His His His His His His 1 5 <210> 34 <211> 122 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 34 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met His Glu 85 90 95 Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Gly 100 105 110 Thr Pro Asp Tyr Lys Asp Asp Asp Asp Lys 115 120 <210> 35 <211> 123 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 35 Met Asp Tyr Lys Asp Asp Asp Asp Lys Met Thr Cys Lys Met Ser Gln 1 5 10 15 Leu Glu Arg Asn Ile Glu Thr Ile Ile Asn Thr Phe His Gln Tyr Ser 20 25 30 Val Lys Leu Gly His Pro Asp Thr Leu Asn Gln Gly Glu Phe Lys Glu 35 40 45 Leu Val Arg Lys Asp Leu Gln Asn Phe Leu Lys Lys Glu Asn Lys Asn 50 55 60 Glu Lys Val Ile Glu His Ile Met Glu Asp Leu Asp Thr Asn Ala Asp 65 70 75 80 Lys Gln Leu Ser Phe Glu Glu Phe Ile Met Leu Met Ala Arg Leu Thr 85 90 95 Trp Ala Ser His Glu Lys Met His Glu Gly Asp Glu Gly Pro Gly His 100 105 110 His His Lys Pro Gly Leu Gly Glu Gly Thr Pro 115 120 <210> 36 <211> 99 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 36 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Asp Tyr Lys Asp Asp 8� 90 95 Asp Asp Lys <210> 37[[ID=**]] <211> 100 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 37 Met Asp Tyr Lys Asp Asp Asp Asp Lys Met Thr Cys Lys Met Ser Gln 1 5 10 15 Leu Glu Arg Asn Ile Glu Thr Ile Ile Asn Thr Phe His Gln Tyr Ser 20 25 30 Val Lys Leu Gly His Pro Asp Thr Leu Asn Gln Gly Glu Phe Lys Glu 35 40 45 Leu Val Arg Lys Asp Leu Gln Asn Phe Leu Lys Lys Glu Asn Lys Asn 50 55 60 Glu Lys Val Ile Glu His Ile Met Glu Asp Leu Asp Thr Asn Ala Asp 65 70 75 80 Lys Gln Leu Ser Phe Glu Glu Phe Ile Met Leu Met Ala Arg Leu Thr 85 90 95 Trp Ala Ser His 100 <210> 38 <211> 84 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 38 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu<{0001012}>20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Asp Tyr Lys Asp 65 70 75 80 Asp Asp Asp Lys <210> 39 <211> 85 <212> PRT <213> Unknown<0001​​​​​​​​​​​​​​​​​​​​​​​​​​Lys Gln Leu Ser Phe 85 <210> 40 <211> 100 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 40 Met Asp Tyr Lys Asp Asp Asp Asp Lys Met Lys Leu Gly His Pro Asp 1 5 10 15 Thr Leu Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln 20 25 30 Asn Phe Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile 35 40 45 Met Glu Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu 50 55 60 Phe Ile Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met 65 70 75 80 His Glu Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly 85 90 95 Glu Gly Thr Pro 100 <210> 41 [[ID=z48]]<211> 99 <212> PRT<a <213> Unknown <220> <223> Artificial Sequence It should be noted that in the original text, the 7 - digit tags and are likely to be specific identifiers in a patent - related context. In your translation request, you mentioned preserving them exactly as - is, so I have done so. However, it's possible that the "a" in front of in the original text might be a mistake. If it's not, please clarify its significance. <400> 41 Met Lys Leu Gly His Pro Asp Thr Leu Asn Gln Gly Glu Phe Lys Glu 1 5 10 15 Leu Val Arg Lys Asp Leu Gln Asn Phe Leu Lys Lys Glu Asn Lys Asn 20 25 30 Glu Lys Val Ile Glu His Ile Met Glu Asp Leu Asp Thr Asn Ala Asp 35 40 45 Lys Gln Leu Ser Phe Glu Glu Phe Ile Met Leu Met Ala Arg Leu Thr 50 55 60 Trp Ala Ser His Glu Lys Met His Glu Gly Asp Glu Gly Pro Gly His 65 70 75 80 His His Lys Pro Gly Leu Gly Glu Gly Thr Pro Asp Tyr Lys Asp Asp 85 90 95 Asp Asp Lys <210> 42 <211> 84 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 42 Met Leu Val Arg Lys Asp Leu Gln Asn Phe Leu Lys Lys Glu Asn Lys 1 5 10 15 Asn Glu Lys Val Ile Glu His Ile Met Glu Asp Leu Asp Thr Asn Ala 20 25 30 Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile Met Leu Met Ala Arg Leu 35 40 45 Thr Trp Ala Ser His Glu Lys Met His Glu Gly Asp Glu Gly Pro Gly 50 55 60 His His His Lys Pro Gly Leu Gly Glu Gly Thr Pro Asp Tyr Lys Asp 65 70 75 80 Asp Asp Asp Lys <210> 43 <211> 85 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 43 Met Asp Tyr Lys Asp Asp Asp Asp Lys Met Leu Val Arg Lys Asp Leu 1 5 10 15 Gln Asn Phe Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His 20 25 30 Ile Met Glu Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu 35 40 45 Glu Phe Ile Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys 50 55 60 Met His Glu Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu 65 70 75 80 Gly Glu Gly Thr Pro 85 <210> 44 <211> 122 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 44 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Ala Ala Asp Lys Gln Leu Ser Phe Glu Ala Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met His Glu 85 90 95 Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Gly 100 105 110 Thr Pro Asp Tyr Lys Asp Asp Asp Asp Lys 115 120 <210> 45 <211> 393 <212> DNA <213> Unknown <220> <223> Artificial Sequence <400> 45 gctagcggat ccgccgccac catggccaac aaagcacctt ctcagatgga gcgcagcata 60 accaccatca tcgacacctt ccatcaatac tctaggaagg aaggacaccc tgacaccctg 120 agcaagaagg aattcagaca aatggtggaa gcacagttgg caacctttat gaagaaagag 180 aagagaaatg aagccctcat aaatgacatc atggaggacc tggacacaaa ccaggacaat 240 cagctgagct ttgaggagtg tatgatgctg atggcaaagt tgatctttgc ctgtcatgag 300 aagctgcatg agaacaaccc acgtgggcat ggccacagtc atggcaaagg ctgtgggaag 360 gactacaaag acgatgacga caagtgactc gag 393 <210> 46 <211> 114 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 46 Met Thr Ser Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met His Glu 85 90 95 Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Gly 100 105 110 Thr Cys <210> 47 <211> 16 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 47 Gly Ser Ser Gly Ser Ser Gly Ser Ser Gly Ser Ser Gly Ser Ser Gly 1 5 10 15 <210> 48 <211> 15 <212> PRT <213> Unknown <220> <223> Artificial Sequence <400> 48 Gly Leu Asn Asp Ile Phe Glu Ala Gln Lys Ile Glu Trp His Glu 1 5 10 15 <210> 49 <211> 113 <212> PRT <213> Mus musculus <400> 49 Met Ala Asn Lys Ala Pro Ser Gln Met Glu Arg Ser Ile Thr Thr Ile 1 5 10 15 Ile Asp Thr Phe His Gln Tyr Ser Arg Lys Glu Gly His Pro Asp Thr 20 25 30 Leu Ser Lys Lys Glu Phe Arg Gln Met Val Glu Ala Gln Leu Ala Thr 35 40 45 Phe Met Lys Lys Glu Lys Arg Asn Glu Ala Leu Ile Asn Asp Ile Met 50 55 60 Glu Asp Leu Asp Thr Asn Gln Asp Asn Gln Leu Ser Phe Glu Glu Cys 65 70 75 80 Met Met Leu Met Ala Lys Leu Ile Phe Ala Cys His Glu Lys Leu His 85 90 95 Glu Asn Asn Pro Arg Gly His Gly His Ser His Gly Lys Gly Cys Gly 100 105 110 Lys <210> 50 <211> 113 <212> PRT <213> Rat (Rattus norvegicus) <400> 50 Met Ala Ala Lys Thr Gly Ser Gln Leu Glu Arg Ser Ile Ser Thr Ile 1 5 10 15 Ile Asn Val Phe His Gln Tyr Ser Arg Lys Tyr Gly His Pro Asp Thr 20 25 30 Leu Asn Lys Ala Glu Phe Lys Glu Met Val Asn Lys Asp Leu Pro Asn 35 40 45 Phe Leu Lys Arg Glu Lys Arg Asn Glu Asn Leu Leu Arg Asp Ile Met [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​ 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Arg Arg Glu Phe Lys Gln Leu Val Glu Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Lys Lys Asn Asp Lys Ile Ile Asp His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met His Glu 85 90 95 Asp Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Asp 100 105 110 Ala Arg <210> 52 <211> 114 <212> PRT <213> Chimpanzee (Pan troglodytes)[[ID=……]] <4 * 00> 52 Met Thr Cys Lys Met Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile 1 5 10 15 Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly His Pro Asp Thr Leu 20 25 30 Asn Gln Gly Glu Phe Lys Glu Leu Val Gln Lys Asp Leu Gln Asn Phe 35 40 45 Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His Ile Met Glu 50 55 60 Asp Leu Asp Thr Asn Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile 65 70 75 80 Met Leu Met Ala Arg Leu Thr Trp Ala Ser His Glu Lys Met His Glu 85 90 95 Gly Asp Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Gly 100 105 110 Thr Pro <210> 53 <211> 144 <212> PRT <213> Pig (Sus scrofa) <400> 53 Met Ala Asp Gln Met Ser Gln Met Glu Cys Ser Ile Glu Thr Ile Ile 1 5 10 15 Asn Ile Phe His Gln Tyr Ser Val Arg Leu Gly Asn Arg Asp Thr Leu 20 25 30 Asn Gln Lys Glu Phe Lys Gln Leu Val Lys Lys Glu Leu Pro Asn Phe 35 40 45 Leu Lys Lys Gln Lys Arg Asp Glu Lys Ala Ile Asn His Ile Leu Glu 50 55 60 Asp Leu Asp Thr Asn Val Asp Lys Gln Leu Ser Phe Glu Glu Phe Ser 65 70 75 80 Met Leu Val Ala Lys Leu Thr Val Ala Ser His Glu Glu Met His Lys 85 90 95 Thr Ala Pro Pro Gly Asp Gly His His His Gly Pro Gly Phe Gly Ser 100 105 110 Ser Ser Ser Gly Pro Cys Ala Gly Gln Glu Ser Gln Thr Pro Gly Gly 115 120 125 His Gly His Gly His Ser His Gly Gly His Gly His Gly His Ser His 130 135 140

Claims

1. Use of a composition for the preparation of a medicament for treating type 1 diabetes or hyperglycemia in a subject in need thereof, the composition comprising: i) S100 calcium binding protein A9 (S100A9), wherein the amino acid sequence of the S100A9 protein comprises the sequence shown in SEQ ID NO: 1, and ii) insulin, wherein the amino acid sequence of the insulin protein is as shown in SEQ ID NO: 7 and / or SEQ ID NO: 8; or an insulin variant selected from the group consisting of insulin lispro as shown in SEQ ID No. 9 and / or SEQ ID No. 10, insulin glulisine as shown in SEQ ID No. 11 and / or SEQ ID No. 12, insulin aspart as shown in SEQ ID No. 13 and / or SEQ ID No. 14, insulin glargine as shown in SEQ ID No. 15 and / or SEQ ID No. 16, insulin detemir as shown in SEQ ID No. 17 and / or SEQ ID No. 18, and insulin degludec as shown in SEQ ID No. 19 and / or SEQ ID No.

20.

2. The method of claim 1, wherein the insulin is natural insulin, proinsulin, basal insulin or fast-acting insulin.

3. The use according to claim 1 or 2, wherein i) the S100A9 protein and ii) the insulin or insulin variant are administered simultaneously, separately or staggered, and the insulin variant is selected from the group consisting of insulin lispro shown in SEQ ID No. 9 and / or SEQ ID No. 10, insulin glulisine shown in SEQ ID No. 11 and / or SEQ ID No. 12, insulin aspart shown in SEQ ID No. 13 and / or SEQ ID No. 14, insulin glargine shown in SEQ ID No. 15 and / or SEQ ID No. 16, insulin detemir shown in SEQ ID No. 17 and / or SEQ ID No. 18, and insulin degludec shown in SEQ ID No. 19 and / or SEQ ID No.

20.

4. The use according to claim 1 or 2, wherein the treatment comprises reducing the insulin dose by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or more compared to administration of insulin or an insulin variant selected from the group consisting of insulin lispro set forth in SEQ ID No. 9 and / or SEQ ID No. 10, insulin glulisine set forth in SEQ ID No. 11 and / or SEQ ID No. 12, insulin aspart set forth in SEQ ID No. 13 and / or SEQ ID No. 14, insulin glargine set forth in SEQ ID No. 15 and / or SEQ ID No. 16, insulin detemir set forth in SEQ ID No. 17 and / or SEQ ID No. 18, and insulin degludec set forth in SEQ ID No. 19 and / or SEQ ID No.

20.

5. The use according to claim 1 or 2, wherein the composition comprises a therapeutically effective amount of S100 calcium binding protein A9 (S100A9) and insulin or an insulin variant, wherein the insulin variant is selected from the group consisting of insulin lispro shown in SEQ ID No. 9 and / or SEQ ID No. 10, insulin glulisine shown in SEQ ID No. 11 and / or SEQ ID No. 12, insulin aspart shown in SEQ ID No. 13 and / or SEQ ID No. 14, insulin glargine shown in SEQ ID No. 15 and / or SEQ ID No. 16, insulin detemir shown in SEQ ID No. 17 and / or SEQ ID No. 18, and insulin degludec shown in SEQ ID No. 19 and / or SEQ ID No. 20.

Images