Recombinant hydrogenophilus bacteria producing lactic acid
By introducing lactate dehydrogenase and malate/lactate dehydrogenase genes into hydrogenophilic bacteria, destroying the lactate utilization enzyme gene and introducing lactate permease, the problem of low efficiency of lactic acid production using carbon dioxide as a carbon source was solved, efficient lactic acid production and carbon dioxide fixation were achieved, and the industrial production of polylactic acid was promoted.
Patent Information
- Application Number
- CN201980098975.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2019-08-09
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2039-08-09
AI Technical Summary
Existing technologies make it difficult to efficiently produce lactic acid using carbon dioxide as the sole carbon source, and existing recombinant microbial methods have problems such as insufficient enzyme activity or slow growth rate.
Lactate dehydrogenase and/or malate/lactate dehydrogenase genes are introduced into hydrogenophilic bacteria, and three lactate utilization enzyme genes on the genome are destroyed. Lactate permease genes are further introduced to increase lactate secretion.
It has achieved efficient utilization of carbon dioxide to produce lactic acid, significantly increased the output of lactic acid, solved the problem of lactic acid production on an industrial scale, provided raw materials for polylactic acid, and reduced greenhouse gas emissions.
Smart Images

Figure GDA0003787515850000451 
Figure GDA0003787515850000461 
Figure GDA0003787515850000471
Abstract
Description
Technical Field
[0001] The present invention relates to a recombinant Hydrogenophilus bacterium capable of producing lactic acid and a method for producing lactic acid using the bacterium. Background Art
[0002] The 2015 Paris Agreement, which mandated a rapid reduction in global greenhouse gas emissions, has set a target of reducing its emissions of greenhouse gases such as carbon dioxide and methane by 26% by 2030 compared to 2013 levels.
[0003] Globally, the production of a large portion of chemicals relies on petroleum resources, exacerbating the problem of increasing greenhouse gas emissions. Therefore, moving away from oil dependence is a desirable strategy for chemical production, and countries are actively pursuing research and development in biorefining to produce green chemicals from biomass. However, saccharification of biomass, the raw material for microbial fermentation, is both costly and requires complex processes.
[0004] As part of efforts to transition away from oil dependence, gases such as carbon dioxide, methane, and carbon monoxide are attracting attention as more sustainable carbon sources. Technologies that utilize these gases to produce valuable chemicals and biofuels using microorganisms are also a subject of intense interest. In particular, carbon sequestration and efficient utilization of carbon dioxide, a significant contributor to global warming, are highly anticipated.
[0005] In view of the problems such as the pollution of the ocean by plastic waste, biodegradable plastics that are eventually decomposed into water and carbon dioxide by microorganisms in nature have attracted attention. Biodegradable plastics are divided into bacterial product series, natural product series and chemical synthesis series according to the manufacturing method. Polylactic acid (lactic acid resin), which has the fastest research and actual implementation progress among all biodegradable plastics, is considered to be a biodegradable plastic intermediate between the bacterial product series and the chemical synthesis series, because its raw material is lactic acid, which is a product of the metabolic pathway in the living body such as the glycolysis system. In other words, polylactic acid is produced by purifying lactic acid produced by microbial fermentation and performing chemical polycondensation. Current polylactic acid production uses biomass as raw material. As mentioned above, converting biomass into sugar requires complicated steps, so the current polylactic acid production has the problem of high cost.
[0006] Therefore, there is a need for a practical method for producing lactic acid in simpler steps, particularly a practical method for producing lactic acid through carbon dioxide fixation.
[0007] Lactic acid is produced from pyruvic acid, which is an important metabolite in vivo. That is, lactic acid is produced from pyruvic acid by the catalytic activity of lactate dehydrogenase.
[0008] As a technique for producing lactic acid using a recombinant microorganism, Patent Literature 1 describes a method for producing lactic acid using a transformant obtained by introducing a lactate dehydrogenase gene (ldh gene) of Lactobacillus helveticus or Bacillus megaterium into a yeast strain.
[0009] Patent Literature 2 describes a method for producing lactic acid using a transformant obtained by introducing a Lactobacillus pentosus LDH gene as a lactate dehydrogenase gene into Schizosaccharomyces pombe.
[0010] Patent Literature 3 describes a method for producing lactic acid using a transformant obtained by introducing a Thermoanaerobacter pseudethanolicus ldh gene as a lactate dehydrogenase gene into Moorella thermoacetica.
[0011] Patent Literature 4 describes a method for producing lactic acid using a transformant obtained by introducing a Lactobacillus delbrueckii hdhD gene or ldhA gene as a lactate dehydrogenase gene into Geobacillus thermoglucosidans.
[0012] Non-Patent Literature 1 describes a method for producing lactic acid using a transformant obtained by introducing a lactate dehydrogenase gene of Lactobacillus casei into Escherichia coli.
[0013] However, all of these methods are methods for producing lactic acid using sugar as a carbon source, and are not methods for producing lactic acid using carbon dioxide as a carbon source.
[0014] Non-Patent Literature 2 describes a method for producing lactic acid using a transformant obtained by introducing a lactate dehydrogenase gene of Bacillus subtilis into Synechocystis sp. strain PCC6803. This method uses a photosynthetic bacterium, cyanobacterium, as a host and produces lactic acid using sodium bicarbonate as a carbon source.
[0015] Cyanobacteria have a higher carbon dioxide fixation capacity than plants. However, a method using cyanobacteria as a host has not been put into practical use as an industrialized method for producing lactic acid because of insufficient carbon dioxide fixation capacity of cyanobacteria.
[0016] Patent Literature 5 describes a method for producing lactic acid using a transformant obtained by introducing a Thermus thermophilus ldh gene as a lactic acid dehydrogenase gene into Hydrogenobacter thermophilus.
[0017] Hydrogenobacter thermophilus is a hydrogen-oxidizing bacterium that grows twice in 1.5 hours. However, it is necessary to apply a current in order to produce a sufficient amount of lactic acid, and therefore a method using Hydrogenobacter thermophilus as a host has not been put into practical use as an industrialized method for producing lactic acid.
[0018] Bibliographic List
[0019] Patent Literature
[0020] [Patent Literature 1] JP 2005-528106 A
[0021] [Patent Literature 2] JP 2014 / 030655 Al
[0022] [Patent Literature 3] JP 2015-023854 A
[0023] [Patent Literature 4] JP 2017-523778 A
[0024] [Patent Literature 5] JP 2017-093465 A
[0025] Non-Patent Literature
[0026] [Non-Patent Literature 1] Homofermentative production of D-or L-lactate in metabolically engineered Escherichia coli RRI, Chang DE, Jung HC, Rhee JS, Pan JG. Appl. Environ. Microbiol. (1999) 65: 1384-1389
[0027] [Non-patent document 2] Engineering acyanobacterial cell factory for production of lactic acid, Angermayr SA, Paszota M, Hellingwerf KJ. Appl. Environ. Microbiol. (2012) 78: 7098-7106 Summary of the Invention
[0028] Technical issues
[0029] The object of the present invention is to provide a recombinant hydrogenophilic bacterium capable of efficiently producing lactic acid using carbon dioxide as the sole carbon source, and a method for efficiently producing lactic acid using the recombinant.
[0030] Technical Solutions
[0031] Hydrogenophiles are hydrogen-oxidizing bacteria that grow by using hydrogen energy to produce organic matter from carbon dioxide. Hydrogen-oxidizing bacteria typically grow very slowly, but hydrogenophiles have a rapid growth rate and their carbon dioxide fixation capacity is significantly higher than that of plants and photosynthetic bacteria.
[0032] However, hydrogenophilus bacteria do not have the ability to produce lactic acid on an industrial scale. Hydrogenophilus bacteria do not have the known lactate dehydrogenase gene and malate / lactate dehydrogenase gene encoding enzymes that catalyze the reaction of producing lactic acid from pyruvate. In order to provide these bacteria with the ability to produce lactic acid on an industrial scale, it is necessary to introduce genes for enzymes that catalyze the reaction of producing lactic acid.
[0033] However, studies by the present inventors have shown that when heterologous genes are introduced into hydrogenophilus bacteria using vectors functional in hydrogenophilus bacteria, functional proteins are often not produced or are not produced in sufficient amounts. Genes that are active in bacteria other than hydrogenophilus often do not or do not produce sufficient amounts of activity in hydrogenophilus bacteria.
[0034] Faced with this situation, the inventors of the present invention found that when a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene is introduced into a bacterium belonging to the genus Hydrogenophilus, the genes function in the bacterium belonging to the genus Hydrogenophilus and induce high activity.
[0035] In addition, the inventors of the present invention found that the ldh gene of Parageobacillus thermoglucosidasius, Geobacillus kaustophilus or Thermus thermophilus, which is a lactate dehydrogenase gene, and the mldh gene of Thermus thermophilus and the mldh-1 and mldh-2 genes of Meiothermus ruber, which are malate / lactate dehydrogenase genes, resulted in higher enzyme activity expression, particularly in bacteria of the genus Hydrogenophilus.
[0036] Hydrogenophilus bacteria are known to utilize lactic acid (Agric. Biol. Chem. (1978) 42(7): 1305-1308; Orlygsson J., Kristjansson JK (2014) The Family Hydrogenophilaceae, Rosenberg E., DeLong EF, Lory S., Stackebrandt E., Thompson F. eds., The Prokaryotes, Springer, Berlin, Heidelberg).
[0037] The inventors of the present invention presume that the HPTL_1694, HPTL_1695, and HPTL_1696 genes appearing side by side on the genome of Hydrogenophilus thermoluteolus function as lactate utilization enzyme genes.
[0038] It is conceivable that when the lactate utilizing enzyme gene functions, lactic acid produced in the cells of the bacteria of the genus Hydrogenophilus is utilized, and thus the amount of lactic acid secreted into the culture supernatant decreases.
[0039] The present inventors have observed that in Hydrogenophilus thermoluteolus transformants into which lactate dehydrogenase genes and / or malate / lactate dehydrogenase genes have been introduced, the amount of lactic acid secreted into the culture medium significantly increases when one or more of the genes HPTL_1694, HPTL_1695, and HPTL_1696 on the genome are disrupted. Based on this, the present inventors have concluded that the HPTL_1694, HPTL_1695, and HPTL_1696 genes are lactate utilization enzyme genes.
[0040] Disruption of any one or more of the HPTL_1694, HPTL_1695, and HPTL_1696 genes enhances the lactate production capacity of the resulting cells. Therefore, it is assumed that these three genes form an operon, and the three proteins encoded by these genes form a complex to exhibit the function of utilizing lactate.
[0041] The inventors of the present invention also observed that the above-mentioned lactate utilization enzyme gene-disrupted strain produces lactic acid extremely efficiently by using carbon dioxide as the sole carbon source.
[0042] The inventors of the present invention also observed that when a gene encoding a lactate permease that promotes the secretion of lactate to the outside of the cell is introduced into a strain of hydrogenophilic bacteria in which the lactate utilization enzyme gene is disrupted and into which the lactate dehydrogenase gene and / or malate / lactate dehydrogenase gene has been introduced, the amount of lactic acid secreted into the culture medium is further increased.
[0043] The present invention has been accomplished based on the above observations and provides the following items [1] to [8].
[0044] [1] A recombinant hydrogenophilus bacterium having a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene introduced therein, and wherein one or more of three lactate utilization enzyme genes on the genome are disrupted.
[0045] [2] The recombinant hydrogenophilus bacterium according to item [1], wherein the three lactate utilization enzyme genes are respectively formed by the DNA of any one of the following (a1) to (a6), the DNA of any one of the following (b1) to (b6), and the DNA of any one of the following (c1) to (c6):
[0046] (a1) DNA consisting of the base sequence set forth in SEQ ID NO: 1;
[0047] (a2) a DNA consisting of a base sequence having 90% or higher identity with the base sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having lactate utilization enzyme activity;
[0048] (a3) a DNA that hybridizes under stringent conditions with a DNA having a complementary base sequence to SEQ ID NO: 1 and encodes a polypeptide having lactate utilization enzyme activity;
[0049] (a4) a DNA encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2;
[0050] (a5) a DNA encoding a polypeptide formed of an amino acid sequence having 90% or greater identity with SEQ ID NO: 2 and having lactate utilization enzyme activity; and
[0051] (a6) a DNA encoding a polypeptide consisting of an amino acid sequence having one or more amino acids deleted, substituted or added in the amino acid sequence set forth in SEQ ID NO: 2 and having lactate utilization enzyme activity;
[0052] (b1) a DNA consisting of the base sequence set forth in SEQ ID NO: 3;
[0053] (b2) a DNA consisting of a base sequence having 90% or higher identity with the base sequence set forth in SEQ ID NO: 3 and encoding a polypeptide having lactate utilization enzyme activity;
[0054] (b3) a DNA that hybridizes under stringent conditions with a DNA having a complementary base sequence to SEQ ID NO: 3 and encodes a polypeptide having lactate utilization enzyme activity;
[0055] (b4) a DNA encoding a polypeptide formed by the amino acid sequence set forth in SEQ ID NO: 4;
[0056] (b5) a DNA encoding a polypeptide formed of an amino acid sequence having 90% or greater identity with SEQ ID NO: 4 and having lactate utilization enzyme activity; and
[0057] (b6) a DNA encoding a polypeptide formed of an amino acid sequence having one or more amino acids deleted, substituted or added in the amino acid sequence set forth in SEQ ID NO: 4 and having lactate utilization enzyme activity; and
[0058] (c1) a DNA consisting of the base sequence set forth in SEQ ID NO: 5;
[0059] (c2) a DNA consisting of a base sequence having 90% or higher identity with the base sequence set forth in SEQ ID NO: 5 and encoding a polypeptide having lactate utilization enzyme activity;
[0060] (c3) a DNA that hybridizes under stringent conditions with a DNA having a complementary base sequence to SEQ ID NO: 5 and encodes a polypeptide having lactate utilization enzyme activity;
[0061] (c4) a DNA encoding a polypeptide formed by the amino acid sequence set forth in SEQ ID NO: 6;
[0062] (c5) a DNA encoding a polypeptide formed of an amino acid sequence having 90% or greater identity with SEQ ID NO: 6 and having lactate utilization enzyme activity; and
[0063] (c6) DNA encoding a polypeptide formed from an amino acid sequence having one or more amino acid deletions, substitutions or additions in the amino acid sequence set forth in SEQ ID NO: 6, and having lactic acid utilizing enzyme activity.
[0064] [3] The recombinant Hydrogenophilus bacterium according to item [1] or [2], wherein one or more of the three lactic acid utilizing enzyme genes is disrupted by introducing one or more nucleotide deletions, additions, substitutions or a combination thereof in one or more of the three lactic acid utilizing enzyme genes.
[0065] [4] The recombinant Hydrogenophilus bacterium according to any one of items [1] to [3], wherein the lactic acid dehydrogenase gene is formed from DNA of any one of the following (d1) to (d6):
[0066] (d1) DNA formed from the base sequence set forth in SEQ ID NO: 9, 10 or 11;
[0067] (d2) DNA formed from a base sequence having 90% or higher identity to the base sequence formed from the base sequence set forth in SEQ ID NO: 9, 10 or 11, and encoding a polypeptide having lactic acid dehydrogenase activity;
[0068] (d3) DNA that hybridizes under stringent conditions to DNA formed from the complementary base sequence of SEQ ID NO: 9, 10 or 11, and encoding a polypeptide having lactic acid dehydrogenase activity;
[0069] (d4) DNA encoding a polypeptide formed from the amino acid sequence set forth in SEQ ID NO: 12, 13 or 14;
[0070] (d5) DNA encoding a polypeptide formed from an amino acid sequence having 90% or higher identity to SEQ ID NO: 12, 13 or 14, and having lactic acid dehydrogenase activity; and
[0071] (d6) DNA encoding a polypeptide formed from an amino acid sequence having one or more amino acid deletions, substitutions or additions in the amino acid sequence set forth in SEQ ID NO: 12, 13 or 14, and having lactic acid dehydrogenase activity.
[0072] [5] The recombinant Hydrogenophilus bacterium according to any one of items [1] to [4], wherein the malate / lactate dehydrogenase gene is formed from DNA of any one of the following (e1) to (e6):
[0073] (e1) DNA formed from the base sequence set forth in SEQ ID NO: 15, 16 or 17;
[0074] (e2) a base sequence formed with a base sequence having 90% or higher identity to the base sequence set forth in any one of SEQ ID NOs: 15, 16, or 17, and encoding a DNA of a polypeptide having lactate dehydrogenase activity;
[0075] (e3) a DNA that hybridizes under stringent conditions to a DNA formed from the complementary base sequence of any one of SEQ ID NOs: 15, 16, or 17, and encoding a polypeptide having lactate dehydrogenase activity;
[0076] (e4) a DNA encoding a polypeptide formed from the amino acid sequence set forth in any one of SEQ ID NOs: 18, 19, or 20;
[0077] (e5) a DNA encoding a polypeptide formed from an amino acid sequence having 90% or higher identity to any one of SEQ ID NOs: 18, 19, or 20, and having lactate dehydrogenase activity; and
[0078] (e6) a DNA encoding a polypeptide formed from an amino acid sequence having one or more amino acid deletions, substitutions, or additions in the amino acid sequence set forth in any one of SEQ ID NOs: 18, 19, or 20, and having lactate dehydrogenase activity.
[0079] [6] The recombinant Hydrogenophilus bacterium according to any one of items [1] to [5], wherein the recombinant Hydrogenophilus bacterium further has a lactate permease gene introduced therein.
[0080] [7] The recombinant Hydrogenophilus bacterium according to item [6], wherein the lactate permease gene is formed from a DNA of any one of the following (f1) to (f6):
[0081] (f1) a DNA formed from the base sequence set forth in SEQ ID NO: 21;
[0082] (f2) a base sequence formed with a base sequence having 90% or higher identity to the base sequence set forth in SEQ ID NO: 21, and encoding a polypeptide having lactate permease activity;
[0083] (f3) a DNA that hybridizes under stringent conditions to a DNA formed from the complementary base sequence of SEQ ID NO: 21, and encoding a polypeptide having lactate permease activity;
[0084] (f4) a DNA encoding a polypeptide formed from the amino acid sequence set forth in SEQ ID NO: 22;
[0085] (f5) a DNA encoding a polypeptide formed from an amino acid sequence having 90% or higher identity to SEQ ID NO: 22, and having lactate permease activity; and
[0086] (f6) DNA encoding a polypeptide formed from an amino acid sequence having one or more amino acid deletions, substitutions or additions in the amino acid sequence set forth in SEQ ID NO: 22 and having lactate permease activity.
[0087] [8] A method for producing lactic acid, the method comprising the step of culturing the recombinant Hydrogenophilus bacterium of any one of items [1] to [7] using carbon dioxide as the substantially sole carbon source.
[0088] Advantageous effects
[0089] Measures to cope with the increase in carbon dioxide in the atmosphere require reduction of carbon dioxide emissions and fixation of emitted carbon dioxide. In order to reduce carbon dioxide emissions, solar energy, wind energy, geothermal energy and the like are used instead of fossil energy. However, the extent of use of such energy is not yet sufficient to suppress the accumulation of carbon dioxide in the atmosphere. Therefore, it is necessary to enhance atmospheric carbon fixation or recycling of emitted carbon dioxide.
[0090] Carbon fixation of carbon dioxide can be performed by physical or chemical means, but fixation using living cells produces organic substances, and thus can be used as food, feed and fuel. In this way, carbon dioxide itself becomes a resource that can be directly converted into valuable chemical products. Therefore, the dual problems of global warming caused by the increase in carbon dioxide in the atmosphere and shortage of food, feed and fuel can be solved. Furthermore, while suppressing global warming due to the increase in carbon dioxide emissions, it is possible to produce very much needed chemical products.
[0091] Biodegradable plastics among chemical products are attracting attention due to their environmental benefits. Biodegradable plastics produced by carbon dioxide fixation are decomposed by microorganisms in the environment into water and carbon dioxide. That is, biodegradable plastics are carbon neutral, and are able to solve the problems of global warming caused by the increase in carbon dioxide emissions, difficulty in obtaining plastic products necessary for life and environmental problems such as ocean pollution at the same time.
[0092] Hydrogen oxidizing bacteria can grow by utilizing the chemical energy generated by the reaction of hydrogen with oxygen and using carbon dioxide as the sole carbon source. Since hydrogen oxidizing bacteria can produce chemical products from a mixture of oxygen, hydrogen, and carbon dioxide as raw materials, the cells can efficiently assimilate carbon from carbon dioxide and be cultured in simple culture media. Typical hydrogen oxidizing bacteria generally grow slowly, but hydrogenophilic bacteria have an exceptionally high production rate. The Journal of Mitsubishi Research Institute, Issue 34, 1999, describes hydrogenophilic bacteria as follows: "Their proliferation capacity is so high that their carbon fixation capacity for carbon dioxide cannot be compared with that of plants, which truly illustrates the high carbon dioxide fixation capacity of microorganisms."
[0093] When heterologous genes are introduced into hydrogenophilic bacteria using vectors that function in hydrogenophilic bacteria, functional proteins are generally not produced. In this case, by introducing a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene into hydrogenophilic bacteria, the genes become functional in hydrogenophilic bacteria and can efficiently produce lactic acid.
[0094] When one or more of the three lactic acid utilization enzyme genes on the genome of the transformant of the genus Hydrogenophilus are disrupted, the amount of lactic acid produced in the culture medium can be significantly increased.
[0095] When a lactate permease gene is further introduced into the strain in which the lactate utilization enzyme gene of the hydrogenophilus bacterium, into which the lactate dehydrogenase gene and / or malate / lactate dehydrogenase gene has been introduced, is disrupted, the lactate permease gene functions in the recombinant strain, increasing the amount of lactic acid secreted into the culture medium. By disrupting the lactate utilization enzyme gene of the hydrogenophilus bacterium serving as the host, the effect of increasing lactic acid secretion by introducing the lactate permease gene is significantly enhanced.
[0096] As mentioned above, among microorganisms capable of fixing carbon dioxide, hydrogenophilus bacteria have particularly outstanding carbon dioxide fixation capabilities. Therefore, the recombinant of the present invention enables industrial production of lactic acid by fixing carbon dioxide. Lactic acid serves as a raw material for producing polylactic acid, a typical biodegradable plastic. Therefore, the present invention paves the way for the efficient industrial production of polylactic acid using carbon dioxide. BRIEF DESCRIPTION OF THE DRAWINGS
[0097] Figure 1 is a schematic diagram illustrating an example of a method for producing a strain in which the lactate utilization enzyme gene is disrupted. DETAILED DESCRIPTION
[0098] The present invention is described in detail below.
[0099] The recombinant Hydrogenophilus bacterium of the present application is a recombinant Hydrogenophilus bacterium in which a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene is introduced, and in which one or more of the three lactate-utilizing enzyme genes on the genome is disrupted.
[0100] (1) Hydrogenophilus bacteria
[0101] Examples of Hydrogenophilus bacteria include Hydrogenophilus thermoluteolus, Hydrogenophilus halorhabdus, Hydrogenophilus denitrificans, Hydrogenophilus hirschii, Hydrogenophilus islandicus, Hydrogenophilus sp. Mar3, and Hydrogenophilus sp. Z1038. In particular, Hydrogenophilus thermoluteolus is preferred because of its superior growth rate, which places its ability to fix carbon from carbon dioxide at a top level among microorganisms that fix carbon dioxide.
[0102] Hydrogenophilus bacteria have been easily isolated from a wide variety of regions throughout the earth. A preferred Hydrogenophilus thermoluteolus strain is strain TH-1 (NBRC 14978). Hydrogenophilus thermoluteolus strain TH-1 (NBRC 14978) exhibits a top level of growth rate among microorganisms that fix carbon dioxide (Agricultural and Biological Chemistry, 41, 685-690 (1977)). Hydrogenophilus thermoluteolus strain NBRC 14978 is internationally deposited in accordance with the Budapest Treaty, and is therefore available to the public.
[0103] (2) Lactate utilization enzyme gene
[0104] (2-1) Wild-type lactate utilization enzyme gene
[0105] Wild-type Hydrogenophilus bacteria have three lactate-utilizing enzyme genes on the genome, and polypeptides encoded by these genes form a lactate-utilizing enzyme complex (which is considered to be a lactate oxidase complex). Wild-type Hydrogenophilus bacteria produce a lactate-utilizing enzyme complex that is active, and thus have a lactate-utilizing ability.
[0106] The three wild-type lactic acid utilizing enzyme genes are each formed from DNA of any one of the following (al) to (a6), DNA of any one of the following (bl) to (b6), and DNA of any one of the following (cl) to (c6):
[0107] (al) DNA formed from the base sequence set forth in SEQ ID NO: 1;
[0108] (a2) DNA formed from a base sequence having 90% or higher identity with the base sequence set forth in SEQ ID NO: 1, and encoding a polypeptide having lactic acid utilizing enzyme activity;
[0109] (a3) DNA that hybridizes under stringent conditions to DNA formed from the complementary base sequence of SEQ ID NO: 1, and encoding a polypeptide having lactic acid utilizing enzyme activity;
[0110] (a4) DNA encoding a polypeptide formed from the amino acid sequence set forth in SEQ ID NO: 2;
[0111] (a5) DNA encoding a polypeptide formed from an amino acid sequence having 90% or higher identity with SEQ ID NO: 2, and having lactic acid utilizing enzyme activity; and
[0112] (a6) DNA encoding a polypeptide formed from an amino acid sequence having one or more amino acid deletions, substitutions, or additions in the amino acid sequence set forth in SEQ ID NO: 2, and having lactic acid utilizing enzyme activity.
[0113] SEQ ID NO: 1 sets forth the base sequence of the HPTL_1694 gene of Hydrogenophilus thermoluteolus wild-type strain, and SEQ ID NO: 2 sets forth the amino acid sequence of a polypeptide encoded by the HPTL_1694 gene of Hydrogenophilus thermoluteolus wild-type strain.
[0114] (bl) DNA formed from the base sequence set forth in SEQ ID NO: 3;
[0115] (b2) DNA formed from a base sequence having 90% or higher identity with the base sequence set forth in SEQ ID NO: 3, and encoding a polypeptide having lactic acid utilizing enzyme activity;
[0116] (b3) DNA that hybridizes under stringent conditions to DNA formed from the complementary base sequence of SEQ ID NO: 3, and encoding a polypeptide having lactic acid utilizing enzyme activity;
[0117] (b4) a DNA encoding a polypeptide formed by the amino acid sequence set forth in SEQ ID NO: 4;
[0118] (b5) a DNA encoding a polypeptide formed of an amino acid sequence having 90% or greater identity with SEQ ID NO: 4 and having lactate utilization enzyme activity; and
[0119] (b6) A DNA encoding a polypeptide formed of an amino acid sequence having one or more amino acids deleted, substituted or added in the amino acid sequence set forth in SEQ ID NO: 4 and having lactate utilization enzyme activity.
[0120] SEQ ID NO: 3 sets forth the base sequence of the HPTL_1695 gene of the Hydrogenophilus thermoluteolus wild-type strain, and SEQ ID NO: 4 sets forth the amino acid sequence of the polypeptide encoded by the HPTL_1695 gene of the Hydrogenophilus thermoluteolus wild-type strain.
[0121] (c1) a DNA consisting of the base sequence set forth in SEQ ID NO: 5;
[0122] (c2) a DNA consisting of a base sequence having 90% or higher identity with the base sequence set forth in SEQ ID NO: 5 and encoding a polypeptide having lactate utilization enzyme activity;
[0123] (c3) a DNA that hybridizes under stringent conditions with a DNA having a complementary base sequence to SEQ ID NO: 5 and encodes a polypeptide having lactate utilization enzyme activity;
[0124] (c4) a DNA encoding a polypeptide formed by the amino acid sequence set forth in SEQ ID NO: 6;
[0125] (c5) a DNA encoding a polypeptide formed of an amino acid sequence having 90% or greater identity with SEQ ID NO: 6 and having lactate utilization enzyme activity; and
[0126] (c6) A DNA encoding a polypeptide formed of an amino acid sequence having one or more amino acids deleted, substituted or added in the amino acid sequence set forth in SEQ ID NO: 6 and having lactate utilization enzyme activity.
[0127] SEQ ID NO: 5 sets forth the base sequence of the HPTL_1696 gene of the Hydrogenophilus thermoluteolus wild-type strain, and SEQ ID NO: 6 sets forth the amino acid sequence of the polypeptide encoded by the HPTL_1696 gene of the Hydrogenophilus thermoluteolus wild-type strain.
[0128] In the present invention, the identity of each base sequence and amino acid sequence is a value calculated using GENETYX version 17 (manufactured by Genetyx Corporation).
[0129] In the present invention, the term "stringent conditions" refers to conditions in which hybridization is performed in a hybridization solution having a salt concentration of 6×SSC at a temperature of 50° C. to 60° C. for 16 hours, followed by washing in a solution having a salt concentration of 0.1×SSC.
[0130] The DNA of (a2), (b2) or (c2) is preferably formed of a base sequence having 95% or higher, particularly 98% or higher, especially 99% or higher identity with the base sequence set forth in SEQ ID NO: 1, 3 or 5, respectively.
[0131] The DNA of (a5), (b5) or (c5) preferably encodes a polypeptide formed by an amino acid sequence having 95% or higher, particularly 98% or higher, especially 99% or higher identity with the amino acid sequence set forth in SEQ ID NO: 2, 4 or 6, respectively.
[0132] In the present invention, the number "one or more amino acids" is, for example, 1 to 5, particularly 1 to 3, particularly 1 or 2, especially 1. The plurality includes several.
[0133] The fact that the polypeptide to be tested has lactate utilization enzyme activity is verified by reacting the polypeptide to be tested and two other wild-type lactate utilization enzymes with 5 mM lactate in the presence of 120 μg / mL phenazine methosulfate (PMS) and 60 μg / mL 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT), and detecting an increase in absorbance at 570 nm. In conjunction with the lactate oxidase reaction in which lactate is oxidized to pyruvate, MTT is reduced to formazan in the presence of PMS, resulting in an increase in absorbance at 570 nm. When the polypeptide to be tested shows even a slight increase in absorbance at 570 nm, the formed lactate utilization enzyme complex is judged to exhibit lactate oxidase activity, and therefore, the polypeptide to be tested is judged to have lactate utilization enzyme activity.
[0134] For example, when the polypeptide to be tested is a polypeptide encoded by a base sequence similar to SEQ ID NO: 1, the polypeptide to be tested, a polypeptide encoded by SEQ ID NO: 2, and a polypeptide encoded by SEQ ID NO: 3 are reacted with lactic acid in the presence of PMS and MTT.
[0135] (2-2) Disruption of lactate utilization enzyme gene
[0136] In the recombinant hydrogenophilus bacteria of the present invention, one or more of the three lactate utilization enzyme genes on the genome are disrupted. As a result, an active lactate utilization enzyme complex is not formed, or its activity is lower than that of the wild-type lactate utilization enzyme complex.
[0137] In the present invention, the fact that the recombinant hydrogenophilus bacterium does not form an active lactate utilization enzyme complex or forms a lactate utilization enzyme complex with lower activity than the wild-type lactate utilization enzyme complex can be verified by the fact that the recombinant hydrogenophilus bacterium cannot grow in a culture medium containing lactate as the sole carbon source or has a lower growth rate than that of the wild-type strain.
[0138] In order to destroy the lactate utilization enzyme gene, it is generally suitable to delete all or part of the lactate utilization enzyme gene. The lactate utilization enzyme gene can be destroyed by inserting some nucleotides, oligonucleotides or polynucleotides in the gene. When gene disruption is carried out by the homologous recombination described later, it is suitable to insert a positive selection marker gene into the lactate utilization enzyme gene. The lactate utilization enzyme gene can be replaced with all or part of other nucleotides, oligonucleotides or polynucleotides.
[0139] As described above, it is suitable to disrupt the lactate utilization enzyme gene by deletion, addition (including insertion), replacement or a combination thereof (hereinafter sometimes referred to as "mutation") of one or more nucleotides. When the deletion, addition (including insertion) or replacement of multiple nucleotides are introduced, the mutation can be introduced into one site in the gene or can be introduced into multiple sites therein in a dispersed manner.
[0140] Preferably, the number of nucleotides to be deleted, added (including insertion) or replaced is 3 or more, particularly 5 or more, particularly 10 or more, particularly 20 or more, particularly 50 or more. Preferably, the number of nucleotides to be deleted, added (including insertion) or replaced corresponds to 1% or more, particularly 5% or more, particularly 10% or more, particularly 50% or more of the full length of the gene. This ensures the destruction of the lactate utilization enzyme gene. The full length of the lactate utilization enzyme gene (i.e. 100% of the number of constituent nucleotides of the lactate utilization enzyme gene) can be deleted or replaced. In the case of adding (including insertion), up to 100,000 nucleotides can be added. Up to 1,000 or up to 100 nucleotides can be added.
[0141] In addition to the case where the entire lactate utilization enzyme gene is deleted, the above mutation is ideally introduced into a site outside the region near the C-terminus encoding the lactate utilization enzyme. This contributes to the loss or reduction of the function of the lactate utilization enzyme gene. For example, ideally, the above mutation is introduced into a region encoding 95% or less, particularly 90% or less, and particularly 80% or less of the full length from the N-terminus of the lactate utilization enzyme. When the region near the N-terminus encoding the lactate utilization enzyme is mutated, in many cases the polypeptide is not expressed or the polypeptide does not have a normal higher-order structure, so the above mutation can be introduced into the region near the N-terminus encoding the lactate utilization enzyme.
[0142] For example, by producing a disrupted lactate utilization enzyme gene through PCR, etc., and introducing the disrupted gene into the mother strain to cause homologous recombination between the disrupted gene and the gene on the genome, the lactate utilization enzyme gene on the chromosome can be replaced with the disrupted gene.
[0143] Gene disruption methods based on homologous recombination are well known, but using homologous recombination to modify genes on the genome in hydrogenophiles is unprecedented. The inventors of the present invention have identified a hygromycin resistance gene that works in hydrogenophiles and can be used as a positive selection marker, and a streptomycin sensitivity gene that works in hydrogenophiles (particularly in streptomycin-resistant strains) and can be used as a counter-selection marker. Therefore, by using these genes, the lactate utilization enzyme gene of hydrogenophiles can be destroyed by homologous recombination.
[0144] In this method, for example, a streptomycin-sensitive gene formed by the base sequence set forth in SEQ ID NO: 7 can be used as a counter-selective marker. In this method, for example, a hygromycin-resistant gene formed by the base sequence set forth in SEQ ID NO: 8 can be used as a positive selection marker gene that functions in hydrogenophilus bacteria.
[0145] The following describes a method for disrupting the lactate utilization enzyme gene, taking a method involving deleting a portion of the region within the lactate utilization enzyme gene as an example. Figure 1 is a graphic illustration of this approach.
[0146] In appropriate cases, using genomic DNA from a hydrogenophilus bacterium as a template, PCR is performed to amplify the 5' upstream DNA region of the region to be deleted and the 3' downstream DNA region of the same region to be deleted, respectively, of a DNA fragment formed from the lactate utilization enzyme gene of the hydrogenophilus bacterium. The DNA obtained by ligating the 5' upstream region and the 3' downstream region to each other is ligated into a vector that can be used in a host such as Escherichia coli. The DNA obtained by ligating the 5' upstream region and the 3' downstream region of the region to be deleted is DNA in which the interior of the lactate utilization enzyme gene has been deleted.
[0147] To improve the efficiency of homologous recombination, the 5' upstream DNA region and the 3' downstream DNA region preferably consist of 10 or more nucleotides, preferably 50 or more nucleotides, and more preferably 100 or more nucleotides. Alternatively, the DNAs to be connected to each other do not necessarily have to be composed of base sequences that are completely identical to the 5' upstream region and the 3' downstream region of the region to be deleted, respectively. As the length of the region for homologous recombination increases, homologous recombination can be induced by using a lower identity with the 5' upstream region or the 3' downstream region of the region to be deleted.
[0148] Then, a marker cassette is generated to be inserted between the 5' upstream region and the 3' downstream region of the region to be deleted, which are connected to each other on the vector. Here, the marker cassette allows the streptomycin-sensitive gene that functions in hydrogenophilus bacteria and the hygromycin-resistant gene that functions in hydrogenophilus bacteria to be adjacent to each other, or a DNA of about 10,000 base pairs or less to be inserted therebetween.
[0149] Then, if appropriate, the marker cassette is inserted between the 5' upstream region and the 3' downstream region of the region to be deleted on the vector, into which the DNA fragment containing the internal portion of the lactate utilization enzyme gene has been inserted. Furthermore, if appropriate, the resulting vector is used to transform a host according to conventional methods, and the vector is extracted from the transformant.
[0150] Then, where appropriate, the vector is linearized by cutting a portion of the vector or the boundary between the vector and the 5' upstream region or the 3' downstream region with a restriction enzyme, thereby providing a marker DNA fragment. The cutting is performed so that the marker cassette is inserted between the 5' upstream region and the 3' downstream region of the region to be deleted. Thus, a marker DNA fragment is obtained in which the marker cassette is inserted, wherein the DNA fragment containing the streptomycin sensitivity gene and the DNA fragment containing the hygromycin resistance gene are connected to each other.
[0151] Where appropriate, an operation is performed in which the marker DNA fragment is introduced into a streptomycin-resistant strain of a hydrogenophilic bacterium, and each transformant in which the lactate utilization enzyme gene of the streptomycin-resistant strain has been replaced by the marker DNA fragment is selected by using the presence of hygromycin resistance as an indicator.
[0152] Introduction of DNA into bacterial cells of the genus Hydrogenophilus can be performed by a known method, such as the calcium chloride method, the calcium phosphate method, the DEAE-dextran-mediated transfection method, or the electric pulse method.
[0153] Then, in order to eliminate the marker cassette inserted into the lactate utilization enzyme gene in which the internal segment has been deleted, homologous recombination is performed using the previously generated DNA fragment in which the segment within the lactate utilization enzyme gene has been deleted.
[0154] By cutting in a manner that does not separate the deleted lactate utilization enzyme gene, the vector in which the internal segment of the lactate utilization enzyme gene is inserted is linearized. Where applicable, the linear DNA fragment is introduced into a streptomycin-sensitive strain (each recombinant in which the lactate utilization enzyme gene has been replaced by the marker DNA fragment), and a strain that has become streptomycin-resistant is selected. It is also preferred to select a strain that has streptomycin resistance and has lost hygromycin resistance. Thus, a recombinant in which the marker cassette inserted into the lactate utilization enzyme gene has been eliminated is obtained, that is, a recombinant with a deletion in the lactate utilization enzyme gene.
[0155] Where appropriate, the base sequence of the lactate utilization enzyme gene of the obtained recombinant is determined to verify the deletion within the gene.
[0156] Due to the deletion of the segment within the lactate utilization enzyme gene, the recombinant has a reduced growth rate compared to the parent strain of the hydrogenophilus bacterium, or does not grow in a medium using lactate as the sole carbon source.
[0157] (3) Transformants of strains with disrupted lactic acid utilization enzyme genes
[0158] (3-1) Lactate dehydrogenase gene · malate / lactate dehydrogenase gene
[0159] The recombinant of the present application is a recombinant in which a lactate-utilizing enzyme gene of the above-mentioned Hydrogenophilus bacteria is disrupted and a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene is introduced therein. In other words, such a recombinant has a lactate-utilizing enzyme gene disrupted on the genome, and has an exogenous lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene. The malate / lactate dehydrogenase is an enzyme having lactate dehydrogenase activity. Two or more lactate dehydrogenase genes can be introduced, and two or more malate / lactate dehydrogenase genes can be introduced.
[0160] The lactate-utilizing enzyme gene on the genome of the wild-type Hydrogenophilus bacteria can be disrupted before the lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene is introduced, or the lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene can be introduced into the wild-type Hydrogenophilus bacteria before the lactate-utilizing enzyme gene on the genome is disrupted.
[0161] From the viewpoint of good lactate production efficiency, the lactate dehydrogenase gene is preferably (d1) the ldh gene of Geobacillus thermoglucosidasius, the ldh gene of Geobacillus thermodenitrificans, or the ldh gene of Thermus thermophilus.
[0162] The base sequence of the ldh gene of Geobacillus thermoglucosidasius is set forth in SEQ ID NO: 9, the base sequence of the ldh gene of Geobacillus thermodenitrificans is set forth in SEQ ID NO: 10, and the base sequence of the ldh gene of Thermus thermophilus is set forth in SEQ ID NO: 11.
[0163] It is also preferable to use (d2) a DNA having a base sequence that is 90% or higher, particularly 95% or higher, particularly 98% or higher, particularly 99% or higher identical to the base sequence set forth in SEQ ID NO: 9, 10, or 11, and that encodes a polypeptide having lactate dehydrogenase activity.
[0164] It is also preferable to use (d3) a DNA that hybridizes under stringent conditions to a DNA formed of the complementary base sequence of SEQ ID NO: 9, 10, or 11, and that encodes a polypeptide having lactate dehydrogenase activity.
[0165] It is also possible to preferably use (d4) DNA encoding a polypeptide formed of an amino acid sequence set forth in SEQ ID NO: 12, 13, or 14. SEQ ID NO: 12 sets forth the amino acid sequence of lactate dehydrogenase of Geobacillus thermoglucosidasius, SEQ ID NO: 13 sets forth the amino acid sequence of lactate dehydrogenase of Geobacillus thermodenitrificans, and SEQ ID NO: 14 sets forth the amino acid sequence of lactate dehydrogenase of Thermus thermophilus.
[0166] It is also possible to preferably use (d5) DNA encoding a polypeptide formed of an amino acid sequence having 90% or higher, particularly 95% or higher, particularly 98% or higher, particularly 99% or higher identity to the amino acid sequence of SEQ ID NO: 12, 13, or 14 and having lactate dehydrogenase activity.
[0167] It is also possible to preferably use (d6) DNA encoding a polypeptide formed of an amino acid sequence having one or a plurality of amino acid deletions, substitutions, or additions in the amino acid sequence set forth in SEQ ID NO: 12, 13, or 14 and having lactate dehydrogenase activity.
[0168] From the viewpoint of good lactic acid production efficiency, the malate / lactate dehydrogenase gene is preferably (el) any one of the mldh gene of Thermus thermophilus and the mldh-1 and mldh-2 genes of Subterraneus ruber.
[0169] The base sequence of the mldh gene of Thermus thermophilus is set forth in SEQ ID NO: 15, the base sequence of the mldh-1 gene of Subterraneus ruber is set forth in SEQ ID NO: 16, and the base sequence of the mldh-2 gene of Subterraneus ruber is set forth in SEQ ID NO: 17.
[0170] It is also possible to preferably use (e2) DNA formed of a base sequence having 90% or higher, particularly 95% or higher, particularly 98% or higher, particularly 99% or higher identity to the base sequence set forth in SEQ ID NO: 15, 16, or 17 and encoding a polypeptide having lactate dehydrogenase activity; or (e3) DNA hybridizing under stringent conditions to DNA formed of the complementary base sequence of SEQ ID NO: 15, 16, or 17 and encoding a polypeptide having lactate dehydrogenase activity.
[0171] The malate / lactate dehydrogenase has both malate dehydrogenase activity and lactate dehydrogenase activity, but in the present application, the malate / lactate dehydrogenase is identified by the presence of lactate dehydrogenase activity.
[0172] (e4) A DNA encoding a polypeptide formed by the amino acid sequence set forth in SEQ ID NO: 18, 19, or 20 can also be preferably used. SEQ ID NO: 18 sets forth the amino acid sequence encoded by the malate / lactate dehydrogenase (Mldh) gene of Thermus thermophilus, SEQ ID NO: 19 sets forth the amino acid sequence encoded by the malate / lactate dehydrogenase (Mldh-1) gene of Thermus rubrum, and SEQ ID NO: 20 sets forth the amino acid sequence encoded by the malate / lactate dehydrogenase (Mldh-2) gene of Thermus rubrum.
[0173] Preferably, (e5) a DNA encoding a polypeptide formed from an amino acid sequence having 90% or higher, particularly 95% or higher, particularly 98% or higher, and particularly 99% or higher identity with SEQ ID NO: 18, 19 or 20 and having lactate dehydrogenase activity; or (e6) a DNA encoding a polypeptide formed from an amino acid sequence having one or more amino acid deletions, substitutions or additions in the amino acid sequence set forth in SEQ ID NO: 18, 19 or 20 and having lactate dehydrogenase activity can also be used.
[0174] In the present invention, the fact that a polypeptide has lactate dehydrogenase activity is verified by reacting the test polypeptide with pyruvate in the presence of NADH and detecting a decrease in absorbance at 340 nm. Lactate dehydrogenase produces lactate from pyruvate. Lactate dehydrogenase consumes NADH during the production of lactate from pyruvate, so a decrease in absorbance at 340 nm is used as an indicator to detect a decrease in NADH. Specifically, the method described in the "Examples" section is performed. If the test polypeptide even slightly reduces absorbance at 340 nm, the polypeptide is judged to have lactate dehydrogenase activity.
[0175] (3-2) Lactate permease gene
[0176] The present invention encompasses recombinants containing the aforementioned hydrogenophilic bacteria strains in which the lactate utilization enzyme gene has been disrupted, and into which a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene and a lactate permease gene have been introduced. In other words, the recombinants have a disrupted lactate utilization enzyme gene in their genome, along with exogenous or non-native lactate dehydrogenase and / or malate / lactate dehydrogenase genes and an exogenous or non-native lactate permease gene.
[0177] One or two or more of each of the lactate dehydrogenase gene, malate / lactate dehydrogenase gene, and lactate permease gene may be introduced.
[0178] The lactate utilization enzyme gene on the genome of the wild-type hydrogenophilus bacterium can be destroyed before the introduction of the lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene and the lactate permease gene, or the lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene and the lactate permease gene can be introduced into the wild-type hydrogenophilus bacterium before the lactate utilization enzyme gene on the genome is destroyed. The lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene can be introduced into the wild-type hydrogenophilus bacterium before the lactate utilization enzyme gene on the genome is destroyed, and then the lactate permease gene is introduced, or the lactate permease gene can be introduced into the wild-type hydrogenophilus bacterium before the lactate utilization enzyme gene on the genome is destroyed, and then the lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene is introduced.
[0179] From the viewpoint of good lactic acid secretion efficiency of a strain in which the lactic acid utilization enzyme gene of a hydrogenophilus bacterium is disrupted, the lactate permease gene is preferably the lutP gene of (f1) Geobacillus thermophilus.
[0180] The base sequence of the lutP gene of Geobacillus thermophilus is set forth in SEQ ID NO:21.
[0181] (f2) A DNA composed of a base sequence having 90% or higher, particularly 95% or higher, particularly 98% or higher, and particularly 99% or higher identity with the DNA composed of the base sequence set forth in SEQ ID NO: 21 and encoding a polypeptide having lactate permease activity can also be preferably used.
[0182] A DNA (f3) which hybridizes under stringent conditions with a DNA having a complementary base sequence to SEQ ID NO: 21 and encodes a polypeptide having lactate permease activity can also be preferably used.
[0183] (f4) A DNA encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 22 can also be preferably used. SEQ ID NO: 22 sets forth the amino acid sequence of lactate permease (LutP) of Geobacillus thermophilus.
[0184] (f5) A DNA encoding a polypeptide formed of an amino acid sequence having 90% or higher, particularly 95% or higher, particularly 98% or higher, particularly 99% or higher identity with SEQ ID NO: 22 and having lactate permease activity can also be preferably used.
[0185] A DNA encoding a polypeptide formed of an amino acid sequence having one or more amino acid deletions, substitutions or additions in the amino acid sequence set forth in SEQ ID NO: 22 and having lactate permease activity (f6) can also be preferably used.
[0186] In the present invention, the fact that the polypeptide to be tested has lactate permease activity is verified by the fact that when DNA encoding the polypeptide to be tested is introduced into Escherichia coli and then cultured, the amount of lactic acid produced in the culture supernatant is increased compared to the host before introduction. Escherichia coli is used as a host because Escherichia coli has a lactate dehydrogenase gene and produces lactic acid.
[0187] (3-3) Method for Producing Transformants
[0188] A method for obtaining a transformant is described, which comprises introducing a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene and a lactate permease gene into a wild-type strain or a lactate utilization enzyme gene-disrupted strain of a hydrogenophilus bacterium serving as a host.
[0189] The plasmid vector used to introduce the above-mentioned DNA into the host should contain DNA that controls the autonomous replication function in hydrogenophilic bacteria. Examples include the broad-host range vector pRK415 (GenBank: EF437940.1), pBHR1 (GenBank: Y14439.1), pMMB67EH (ATCC 37622), pCAR1 (NCBI Reference Sequence: NC_004444.1), pC194 (NCBI Reference Sequence: NC_002013.1), pK18mobsacB (GenBank: FJ437239.1), pUB110 (NCBI Reference Sequence: NC_001384.1), etc.
[0190] Examples of preferred promoters include tac promoter, lac promoter, trc promoter, or each of promoters OXB1 and OXB11 to OXB20 from Oxford Genetics Ltd. Examples of preferred terminators include the T1T2 terminator of the rRNA operon rrnB of Escherichia coli, the t0 transcription terminator of lambda phage, the T7 terminator, and the like.
[0191] Transformation can be performed by known methods such as the calcium chloride method, the calcium phosphate method, the DEAE-dextran transfection method, and the electric pulse method.
[0192] Hydrogenophilus bacteria grow under autotrophic conditions. However, since they can also grow under heterotrophic conditions, the culture medium for cultivating the disrupted bacterial strain or hydrogenophilus bacteria transformant of the lactic acid utilization enzyme gene of hydrogenophilus bacteria, hydrogenophilus bacteria can be an inorganic culture medium or an organic culture medium. The organic culture medium comprising sugar, organic acid, amino acid, etc. can be used. However, the disrupted bacterial strain of the lactic acid utilization enzyme gene does not have the lactic acid utilization ability or has the lactic acid utilization ability of reduction, so ideally, the culture medium containing lactic acid as the sole carbon source is not used to cultivate the bacterial strain. The pH of the culture medium can be adjusted to approximately 6.2 to 8.
[0193] In any case, cultivation can be carried out in the supply of a gas mixture containing hydrogen, oxygen and carbon dioxide, preferably a gas mixture consisting of hydrogen, oxygen and carbon dioxide. When using an organic culture medium, a gas mixture such as air containing hydrogen, oxygen and carbon dioxide can be used for ventilation. When not supplying carbon dioxide, the culture medium containing carbonate as a carbon source can be used. Mixed gases can be captured in an airtight culture vessel or continuously supplied to the airtight culture vessel, and shaking can be utilized to cultivate and be dissolved in the culture medium. Alternatively, the culture vessel can be airtight or open, and mixed gases can be dissolved in the culture medium by bubbling.
[0194] The volume ratio of hydrogen, oxygen, and carbon dioxide in the supply gas (hydrogen:oxygen:carbon dioxide) is preferably 1.75 to 7.5:1:0.25 to 3, more preferably 5 to 7.5:1:1 to 2, and even more preferably 6.25 to 7.5:1:1.5. Hydrogenophilus bacteria are thermophilic bacteria, so the culture temperature is preferably 35 to 55°C, more preferably 37 to 52°C, and even more preferably 50 to 52°C.
[0195] When both the lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene and the lactate permease gene are introduced into the strain in which the lactate utilization enzyme gene is disrupted, the lactate permease gene can be introduced by cloning the lactate dehydrogenase gene and / or the malate / lactate dehydrogenase gene and the lactate permease gene into the same plasmid vector, or can be introduced by cloning into different plasmid vectors.
[0196] The lactate dehydrogenase gene, malate / lactate dehydrogenase gene, and lactate permease gene can each be incorporated into the genome of the hydrogenophilus bacterium strain in which the lactate utilization enzyme gene is disrupted by homologous recombination or the like.
[0197] (4) Method for producing lactic acid
[0198] When lactic acid is produced using the transformant of the above-mentioned hydrogenophilus bacterium, the transformant can be cultured using an inorganic or organic medium while supplying a gas mixture containing hydrogen, oxygen and carbon dioxide.
[0199] The supplied gas is preferably a gas mixture consisting of hydrogen, oxygen and carbon dioxide. However, different types of gases may be mixed therein as long as lactic acid can be efficiently produced.
[0200] Hydrogenophilus bacterium can use hydrogen as the energy and use carbon dioxide to grow as sole carbon source, therefore, by basically only using carbon dioxide (particularly by only using carbon dioxide) to produce above-mentioned compound as carbon source, carbon dioxide can be fixed efficiently especially.Therefore, use the inorganic culture medium that does not contain the carbon source such as organic matter and carbonate, promptly basically only using carbon dioxide (particularly only using carbon dioxide) to cultivate as carbon source is preferred.The situation of other carbon sources of wherein being mixed with inevitable amount is contained in " basically only using carbon dioxide as carbon source ".In addition, also can use the culture medium that contains organic matter for example sugar, organic acid and amino acid and carbonate, and do not supply carbon dioxide.
[0201] The pH of the culture medium is preferably 6.2 to 8, more preferably 6.4 to 7.4, and further preferably 6.6 to 7. When the pH is within this range, bacteria grow well and mixed gases dissolve well in the culture medium, and lactic acid can be efficiently produced.
[0202] When batch culture is used, the mixed gas can be captured in an airtight culture container and can be subjected to static culture or shaking culture. When continuous culture is used, the mixed gas can be continuously supplied to an airtight culture container and can be subjected to shaking culture, or an airtight culture container can be used to culture the recombinant while the mixed gas is introduced into the culture medium by bubbling. Shaking culture is preferred because it can achieve better dissolution of the mixed gas in the culture medium.
[0203] The volume ratio of hydrogen, oxygen, and carbon dioxide in the supply gas mixture (hydrogen:oxygen:carbon dioxide) is preferably 1.75 to 7.5:1:0.25 to 3, more preferably 5 to 7.5:1:1 to 2, and even more preferably 6.25 to 7.5:1:1.5. When the volume ratio is within this range, bacteria grow well and can efficiently produce the target compound.
[0204] The supply rate of the mixed gas or raw gas can be 10.5 to 60 L / hour, particularly 10.5 to 40 L / hour, and particularly 10.5 to 21 L / hour per 1 L of the culture medium. When the supply rate is within this range, the transformant grows well, the target compound can be efficiently produced, and the amount of waste mixed gas can be reduced.
[0205] The culture temperature is preferably 35 to 55° C., more preferably 37 to 52° C., and even more preferably 50 to 52° C. When the temperature is within this range, the transformant grows well and can efficiently produce lactic acid.
[0206] By culturing in this manner, the target compound, lactic acid, is produced in the reaction solution. The lactic acid can be recovered by collecting the reaction solution. However, the lactic acid can also be further isolated from the reaction solution by following known methods. Such known methods include precipitation, fractionation, and electrodialysis.
[0207] Example
[0208] Next, the present invention will be described in further detail with reference to Examples, but the present invention is not limited to these Examples.
[0209] ( 1) Acquisition of streptomycin-resistant strains
[0210] Hydrogenophilus thermoluteolus TH-1 strain (NBRC 14978) (hereinafter sometimes referred to as “TH-1 strain”) was inoculated using a platinum loop into a medium containing 5 mL of A liquid medium [3.0 g of (NH4)2SO4, 1.0 g of KH2PO4, 2.0 g of K2HPO4, 0.25 g of NaCl, 0.014 g of FeSO4.7H2O, 0.5 g of MgSO4.7H2O, 0.03 g of CaCl2, 4.0 mg of MoO3, 28 mg of ZnSO4.7H2O, 2.0 mg of CuSO4.5H2O, 4.0 mg of H3BO3, 4.0 mg of MnSO4.5H2O, and 4.0 mg of CoCl2.6H2O dissolved in 1 L of distilled water (pH 7.0). 7.0)], the test tube was filled with a mixed gas of H2:O2:CO2=7.5:1:1.5 and cultured with shaking at 50°C. After 24 hours, the culture solution was applied to solid medium A [3.0 g (NH4)2SO4, 1.0 g KH2PO4, 2.0 g K2HPO4, 0.25 g NaCl, 0.014 g FeSO4·7H2O, 0.5 g MgSO4·7H2O, 0.03 g CaCl2, 4.0 mg MoO3, 28 mg ZnSO4·7H2O, 2.0 mg CuSO4·5H2O, 4.0 mg H3BO3, 4.0 mg MnSO4·5H2O, 4.0 mg CoCl2·6H2O and 15 g agar (pH 7.0) dissolved in 1 L of distilled water] containing 500 μg / mL streptomycin and cultured at 50°C in an incubator filled with a mixed gas of H2:O2:CO2 = 7.5:1:1.5 for 60 hours.
[0211] As a result, the formation of three colonies was recognized on the solid medium A containing 500 μg / mL streptomycin. These grown strains were streptomycin-resistant strains of the TH-1 strain, and one of the strains was designated as the NOC269 strain.
[0212] (2) Construction of marker cassette
[0213] (2-1) Preparation of counter-selection markers
[0214] Genomic DNA was extracted from a wild-type strain of the TH-1 strain (a streptomycin-sensitive strain) using conventional methods. Using the extracted genomic DNA as a template, a DNA fragment containing the rpsL gene, which encodes the streptomycin-sensitive gene for ribosomal protein S12, was amplified by PCR. The following primers were used for the PCR. PCR was performed using a DNA Thermal Cycler manufactured by Life Technologies Corporation and a KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent using conventional methods.
[0215] Primers used to amplify the wild-type rpsL gene of the TH-1 strain:
[0216] (a-1)5'-AT ACGCGT CCTCCGATGCGTCGTAAGGGAAACGTC-3' (SEQ ID NO: 23)
[0217] (b-1)5'-ATA GTCGAC TTATTTCTTGCCCGCAGGCGGCGCCCG-3' (SEQ ID NO: 24)
[0218] Primer (a-1) has an MluI restriction enzyme site added thereto, and primer (b-1) has a SalI restriction enzyme site added thereto.
[0219] (2-2) Preparation of positive selection markers
[0220] Using DNA from plasmid pJR225 (GenBank: K01193) [Gene, 25, 179-188 (1983)] containing the hygromycin resistance gene (hereinafter sometimes referred to as "hph") sequence as a template, a DNA fragment containing the hph gene was amplified by PCR. The following primers were used for the PCR. PCR was performed by conventional methods using a "DNA Thermal Cycler" manufactured by Life Technologies Corporation and KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent.
[0221] Primers used to amplify the hph gene:
[0222] (a-2)5'-ATA CTCGAG GAGATGACGTTGGAGGGGCAAGGTCG-3' (SEQ ID NO: 25)
[0223] (b-2)5'-AT ACGCGT CTATTCCTTTGCCCTCGGACGAGTGCT-3' (SEQ ID NO: 26)
[0224] Primer (a-2) has an XhoI restriction enzyme site added, and primer (b-2) has an MluI restriction enzyme site added.
[0225] The reaction solution generated by each of the above PCR reactions was subjected to electrophoresis using a 1% agarose gel. As a result, when genomic DNA of the TH-1 strain was used as a template, an approximately 0.5-kbp DNA fragment corresponding to the rpsL gene was detected, whereas when pJR225 plasmid DNA was used as a template, an approximately 1.0-kbp DNA fragment corresponding to the hph gene was detected.
[0226] The DNA fragment containing the rpsL gene and the DNA fragment containing the hph gene thus prepared were cleaved with restriction enzyme SalI and restriction enzyme XhoI, respectively, and mixed with Escherichia coli plasmid vector pUC19 (GenBank: M77789.2) which had been cleaved with restriction enzyme SmaI, and then ligated to each other using T4 DNA ligase (manufactured by Takara Bio Inc.).
[0227] The resulting ligation solution was used to transform Escherichia coli JM109 by the calcium chloride method, and the transformant was applied to LB agar medium containing 50 μg / mL ampicillin and 50 μg / mL hygromycin. The strain grown on the medium was subjected to liquid culture by conventional methods, plasmid DNA was extracted from the culture fluid, and the plasmid was cut with the restriction enzyme MluI. The inserted fragment was thus identified. As a result, in addition to the approximately 2.7 kbp DNA fragment of the pUC19 vector, an approximately 1.5 kbp DNA fragment corresponding to the sequences of the linked rpsL gene and hph gene was also found.
[0228] The constructed plasmid containing the marker cassette in which the rpsL gene and the hph gene were linked to each other was named pUC-Sm s ·Hm r .
[0229] (3) Disruption of the host's lactate utilization enzyme gene
[0230] (3-1) Construction of DNA for disrupting the HPTL_1695 gene
[0231] Using genomic DNA from a wild-type TH-1 strain as a template, DNA fragments corresponding to the 5'-upstream and 3'-downstream regions of the HPTL_1695 gene to be deleted were amplified by PCR. The following primers were used for the PCR. PCR was performed using a DNA Thermal Cycler manufactured by Life Technologies Corporation and a KOD FX Neo (manufactured by Toyobo Co., Ltd.) as reagents, using conventional methods.
[0232] Primers for amplifying the 5'-upstream region of the region to be deleted in the HPTL_1695 gene
[0233] (a-3)5'-CGC GAATTC ATGGCTACCCAACCCCGCGTCGGTCT-3' (SEQ ID NO: 27)
[0234] (b-3)5'-CGC ACGCGT TGGAGTGCGGCTGGTCATCGGGTGAC-3' (SEQ ID NO: 28)
[0235] Primer (a-3) has an EcoRI restriction enzyme site added thereto, and primer (b-3) has an MluI restriction enzyme site added thereto.
[0236] Primers for amplifying the 3'-downstream region of the region to be deleted in the HPTL_1695 gene
[0237] (a-4)5'-GC ACGCGT CTGCAGAACGGAGGCGAGCGATGAACG-3' (SEQ ID NO: 29)
[0238] (b-4)5'-CGC GCATGC TCAGGGGATCAAGAAGACGTGCACCC-3' (SEQ ID NO: 30)
[0239] Primer (a-4) has an MluI restriction enzyme site added thereto, and primer (b-4) has an SphI restriction enzyme site added thereto.
[0240] Each of the PCR reaction mixtures was subjected to electrophoresis using 1% agarose gel. As a result, approximately 0.8-kbp DNA fragments corresponding to the upstream region and the downstream region of the HPTL_1695 gene were detected.
[0241] The DNA fragment of the upstream region of the HPTL_1695 gene thus prepared was cleaved with restriction enzymes EcoRI and MluI, and the DNA fragment of the downstream region of the HPTL_1695 gene thus prepared was cleaved with restriction enzymes MluI and SphI. The cleavage products were mixed with the pUC19 vector cleaved with restriction enzymes EcoRI and SphI, and then ligated to each other using T4 DNA ligase (manufactured by Takara Bio Inc.).
[0242] The ligation solution obtained by the calcium chloride method was used to transform Escherichia coli JM109, and the transformant was applied to the LB agar medium containing 50 μg / mL ampicillin. The bacterial strain grown on the substratum was liquid cultured by an ordinary method, and plasmid DNA was extracted from the culture fluid, and the plasmid was cut with restriction enzymes EcoRI and SphI. The upstream and downstream regions were then determined to be successfully cloned. As a result, the 2.7-kbp and 1.6-kbp DNA fragments of expection were identified under the situation of successful cloning.
[0243] In this plasmid, the 5'-upstream region and 3'-downstream region of the HPTL_1695 gene were linked together, and a DNA fragment in which a region within the HPTL_1695 gene had been deleted was cloned. The constructed plasmid containing the DNA fragment in which the HPTL_1695 gene had been deleted was named pΔHPTL_1695.
[0244] (3-2) Construction of DNA for labeling HPTL_1695 gene
[0245] The pUC-Sm prepared in (2) above was s ·Hm r The fragment was cut with the restriction enzyme MluI and electrophoresed using a 1% agarose gel. An approximately 1.5 kbp DNA fragment containing the marker cassette, in which the rpsL gene and the hph gene are linked to each other, was then excised from the gel, and the gel was frozen and thawed. DNA was then recovered from the gel.
[0246] The recovered DNA fragment of the marker cassette was mixed with pΔHPTL_1695 produced in (3-1) which had been cleaved with the restriction enzyme MluI, and then ligated to each other using T4 DNA ligase (manufactured by Takara Bio Inc.).
[0247] The resulting ligation solution was used to transform Escherichia coli JM109 using the calcium chloride method, and the transformants were transferred to LB agar medium containing 50 μg / mL ampicillin and 50 μg / mL hygromycin. The strain grown on this medium was liquid cultured using conventional methods, plasmid DNA was extracted from the culture broth, and the plasmid was cut with the restriction enzyme MluI. The inserted fragment was thus identified. In addition to the approximately 4.3 kbp DNA fragment of the pΔHPTL_1695 plasmid, an approximately 1.5 kbp DNA fragment corresponding to the sequence of the marker cassette was also identified.
[0248] The constructed plasmid for labeling HPTL_1695 gene was named ΔHPTL_1695-Sm s ·Hm r .
[0249] (3-3) Marking of the HPTL_1695 gene in streptomycin-resistant strains (positive selection)
[0250] The circular plasmid pΔHPTL_1695-Sm prepared in (3-2) was cleaved with restriction enzymes EcoRI and SphI. s ·Hm r Linearization. The linearized pΔHPTL_1695-Sm s ·Hm r The NOC269 strain, a streptomycin-resistant TH-1 strain, was transformed by electric pulse electroporation. The transformants were transferred to solid medium A containing 100 μg / mL hygromycin and cultured at 50°C for 60 hours in an incubator filled with a mixed gas atmosphere of H₂:O₂:CO₂ = 7.5:1:1.5.
[0251] Each strain grown on the A solid medium was restreaked on A solid medium containing 100 μg / mL hygromycin or 500 μg / mL streptomycin, and cultured at 50° C. for 60 hours in an incubator filled with a mixed gas of H 2 :O 2 :CO 2 = 7.5:1:1.5.
[0252] The hygromycin-resistant and streptomycin-sensitive strains obtained as a result of the above steps were used as templates to amplify the DNA region containing the HPTL_1695 gene by colony PCR. The following primers were used for the PCR. The combination of primers (a-5) and (b-5) was the combination of primers (a-3) and (b-4) used in (3-1), and the genomic DNA of the wild-type TH-1 bacterial strain was used as a template to amplify the approximately 2.9-kbp DNA region containing the HPTL_1695 gene by PCR. PCR was performed using a "DNA Thermal Cycler" manufactured by Life Technologies Corporation and TaKaRa Ex Taq (manufactured by Takara BioInc.) as a reaction reagent, using a conventional method.
[0253] Primers used to amplify the region containing the HPTL_1695 gene
[0254] (a-5)5'-CGC GAATTC ATGGCTACCCAACCCCGCGTCGGTCT-3' (SEQ ID NO: 31)
[0255] (b-5)5'-CGC GCATGC TCAGGGGATCAAGAAGACGTGCACCC-3' (SEQ ID NO: 32)
[0256] The resulting reaction mixture was subjected to electrophoresis using a 1% agarose gel. A roughly 3.1 kbp DNA fragment corresponding to the sequence containing the marker cassette inserted into the HPTL_1695 gene was detected. In this strain, the marker cassette was inserted into the HPTL_1695 gene. In other words, a strain in which the HPTL_1695 gene was labeled with a marker was obtained.
[0257] (3-4) Disruption of the HPTL_1695 gene (counter-selection)
[0258] The circular plasmid pΔHPTL_1695 prepared in (3-1) was linearized by cutting with the restriction enzymes EcoRI and SphI. The resulting linearized pΔHPTL_1695 was transformed into the HPTL_1695 gene-tagged strain obtained in (3-3) by electric pulse method (electroporation). The transformant was transferred to solid medium A containing 500 μg / mL streptomycin and cultured at 50°C for 60 hours in an incubator filled with a mixed gas atmosphere of H2:O2:CO2 = 7.5:1:1.5.
[0259] Each strain grown on the A solid medium was restreaked on A solid medium containing 100 μg / mL hygromycin or 500 μg / mL streptomycin, and cultured at 50° C. for 60 hours in an incubator filled with a mixed gas of H 2 :O 2 :CO 2 = 7.5:1:1.5.
[0260] Using the hygromycin-sensitive and streptomycin-resistant strains obtained as a result of the above steps as templates, the DNA region containing the HPTL_1695 gene was amplified by the colony PCR method. The colony PCR was performed by the same method as in (3-3).
[0261] The resulting reaction mixture was subjected to electrophoresis using a 1% agarose gel. The results revealed a DNA fragment of approximately 1.6 kbp that would be amplified if the HPTL_1695 gene was replaced by the DNA fragment (3-1) in which the HPTL_1695 gene segment was deleted. In other words, the HPTL_1695 gene segment had been deleted, resulting in a disruption of the HPTL_1695 gene. The strain with the HPTL_1695 gene disruption was designated as strain NOC373.
[0262] In the NOC373 strain, the base sequence of the HPTL_1695 gene of the TH-1 strain (SEQ ID NO: 3) is replaced by ACGCGTCTGCAG (SEQ ID NO: 33). This corresponds to the amino acid sequence of the polypeptide encoded by the HPTL_1695 gene of the TH-1 strain (SEQ ID NO: 4) being replaced by TRLQ (SEQ ID NO: 34) from amino acids 7 to 470.
[0263] (3-5) Determination of lactic acid utilization performance of NOC373 strain
[0264] In the NOC373 strain, the HPTL_1695 gene is disrupted. Whether the NOC373 strain in which the HPTL_1695 gene is disrupted has lost the ability to utilize lactic acid is determined as follows.
[0265] Strain NOC373 and strain NOC269, the parent strain of NOC373, were each streaked onto solid medium A containing 30 mM sodium lactate as the sole carbon source and cultured at 50°C for 60 hours. The results showed that the parent strain NOC269 grew on solid medium A containing 30 mM sodium lactate, but the NOC373 strain with the HPTL_1695 gene disrupted did not grow at all. This indicates that disruption of the HPTL_1695 gene caused the NOC373 strain to lose its original lactate utilization ability. This confirms that the HPTL_1695 gene is indeed a lactate utilization enzyme gene.
[0266] (4) Lactate dehydrogenase gene · Introduction of malate / lactate dehydrogenase genes
[0267] (4-1) Construction of plasmid vector
[0268] The following describes a method for constructing a plasmid vector commonly used for introducing a gene that provides lactic acid-producing ability.
[0269] First, PCR was performed using the broad host range vector pRK415 (GenBank: EF437940.1) (Gene, 70, 191-197 (1998)) as a template. To amplify a DNA fragment of a plasmid region excluding the tetracycline gene region, the following primer pair was synthesized and used. PCR was performed using a "DNA Thermal Cycler" manufactured by Life Technologies Corporation and KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent by conventional methods.
[0270] Primers used to amplify pRK415 plasmid sequences
[0271] (a-6)5'-CGT GGCC AACTA GGCC CAGCCAGATACTCCCGATC-3' (SEQ ID NO: 35)
[0272] (b-6)5'-TGA GGCC TCATT GGCC GGAGCGCAACCCACTCACT-3' (SEQ ID NO: 36)
[0273] An SfiI restriction site has been added to primers (a-6) and (b-6).
[0274] PCR was performed using the plasmid pK18mobsacB (GenBank: FJ437239.1) (Gene, 145, 69-73 (1994)) containing the neomycin / kanamycin resistance gene (hereinafter referred to as "nptII") as a template and according to conventional methods. The following primer pair was synthesized and used in the PCR to amplify a DNA fragment containing the nptII gene sequence. PCR was performed according to conventional methods using a "DNA Thermal Cycler" manufactured by Life Technologies Corporation and a KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent.
[0275] Primers used to amplify nptII gene sequences
[0276] (a-7)5'-ctg GGCC TAGTT GGCC acgtagaaagccagtccgc-3' (SEQ ID NO: 37)
[0277] (b-7)5'-tcc GGCC AATGA GGCC tcagaagaactcgtcaaga-3' (SEQ ID NO: 38)
[0278] An SfiI restriction site has been added to primers (a-7) and (b-7).
[0279] The reaction solution generated by each of the above PCRs was subjected to electrophoresis using 1% agarose gel, and as a result, an approximately 8.7-kb DNA fragment was detected when the pRK415 plasmid was used as a template, and an approximately 1.1-kb DNA fragment was detected when the nptII gene was used as a template.
[0280] Each of the thus prepared DNA fragments was cut with the restriction enzyme Sfil, and reacted with T4 DNA ligase (manufactured by Takara Bio Inc.) to obtain a ligation solution. Escherichia coli JM109 was transformed with the obtained ligation solution by the calcium chloride method (Journal of Molecular Biology, 53, 159-162 (1970)), and the transformants were applied to an LB agar medium containing 50 μg / mL of kanamycin. Strains that can survive on the medium were cultured in a liquid medium by a conventional method, and plasmid DNA was extracted from the obtained culture solution. The plasmid DNA was cut with the restriction enzyme Sfil, and the inserted fragments were confirmed. As a result, in addition to DNA fragments of about 2.0-kb, 3.0-kb, and 3.7-kb derived from the pRK415 plasmid, a DNA fragment of about 1.1-kb of the nptll gene sequence was also observed.
[0281] The constructed plasmid was named pCYK01.
[0282] (4-2) Construction of cloning vector for gene expression
[0283] (4-2-1) Preparation of DNA fragment containing the λt0 terminator sequence
[0284] The following primer pair was synthesized and used in PCR in order to prepare DNA having a λt0 terminator sequence. PCR was performed using a "DNA thermal cycler" manufactured by Life Technologies Corporation and using KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent. No template DNA was included because the extension was performed using each primer as a template for the other primer.
[0285] Primer for preparing λt0 terminator sequence
[0286] (a-8) 5'-GC ATTAAT ccttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccg-3' (SEQ ID NO: 39)
[0287] (b-8) 5'-caccgtgcagtcgatgGATctggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggag-3' (SEQ ID NO: 40)
[0288] The base sequences of the 3' ends of the primers (a-8) and (b-8) are complementary to each other.
[0289] The resulting reaction solution was subjected to electrophoresis using 1% agarose gel, and as a result, an approximately 0.13-kb DNA fragment corresponding to the λt0 terminator sequence was detected.
[0290] (4-2-2) Preparation of DNA fragments containing the tac promoter sequence
[0291] PCR was performed using a plasmid pMAL-c5X (manufactured by New England Biolabs Inc.) containing the tac promoter as a template. In the PCR, the following primer pairs were synthesized and used to amplify the tac promoter sequence. PCR was performed using a DNA thermal cycler manufactured by Life Technologies Corporation and a KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent, according to conventional methods.
[0292] Primers used to amplify tac promoter sequences
[0293] (a-9)5'-TTATTGGTGAGAATCCAGATCCATCGACTGCACGGTGCACCAATGCTTCT-3' (SEQ IDNO: 41)
[0294] (b-9)5'-gc aagctt ggagtgatcatcgtATGCATATGCGTTTCTCCTCCAGATCCctgtttcctgtgtgaaattgt-3' (SEQ ID NO: 42)
[0295] The resulting reaction solution was subjected to electrophoresis using 1% agarose gel, and as a result, an approximately 0.3-kb DNA fragment corresponding to the tac promoter sequence was detected.
[0296] (4-2-3) Introduction of λt0 terminator and tac promoter sequences
[0297] The DNA fragments prepared in (4-2-1) and (4-2-2) above were cut out from the agarose gel, and the DNA was recovered from the gel by freezing and thawing the gel. The recovered DNA fragments corresponding to the λt0 terminator sequence and the tac promoter sequence were mixed and used as templates to perform overlap extension PCR. A combination of the above primers (a-8) and (b-9) was used in the overlap extension PCR to prepare a DNA in which the tac promoter was connected to the downstream of the λt0 terminator. The base sequences at the 5' ends of the primers (b-8) and (a-9) used to amplify the template DNA fragments were complementary to each other. PshBI and HindIII restriction sites have been added to primers (a-8) and (b-9), respectively.
[0298] The resulting reaction solution was subjected to electrophoresis using 1% agarose gel, and as a result, an approximately 0.4-kb DNA fragment corresponding to the DNA in which the tac promoter was ligated downstream of the λt0 terminator was detected.
[0299] The approximately 0.4-kb DNA fragment in which the tac promoter was linked to the downstream of the λt0 terminator and the approximately 9.8-kb DNA fragment of the above-mentioned cloning vector pCYK01 amplified by PCR were cleaved with restriction enzymes PshBI and HindIII. The cleaved DNA fragments were ligated to each other using T4 DNA ligase (manufactured by Takara Bio Inc.).
[0300] The resulting ligation solution was used to transform Escherichia coli JM109 using the calcium chloride method, and the transformants were plated on LB agar medium containing 50 μg / mL kanamycin. Strains that survived the culture medium were cultured in a liquid medium using conventional methods, and plasmid DNA was extracted from the resulting culture medium. This plasmid DNA was cleaved with the restriction enzymes PshBI and HindIII, and the inserted fragment was confirmed. In addition to the approximately 9.6 kb DNA fragment derived from plasmid pCYK01, an approximately 0.4 kb DNA fragment was observed in which the tac promoter was ligated downstream of the λt0 terminator.
[0301] (4-2-4) Introduction of the rrnB T1T2 bidirectional terminator (hereinafter referred to as the "rrnB terminator")
[0302] PCR was performed using a plasmid pMAL-c5X (manufactured by New England Biolabs Inc.) containing the rrnB terminator sequence as a template. In the PCR, the following primer pairs were synthesized and used to amplify the rrnB terminator sequence. PCR was performed using a DNA thermal cycler manufactured by Life Technologies Corporation and a KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent, according to a conventional method.
[0303] Primers used to amplify the rrnB terminator sequence
[0304] (a-10)5'-ctc gaattc actggccgtcgttttacaacgtcgtg-3' (SEQ ID NO: 43)
[0305] (b-10)5'-CG CAATTG AGTTTGTAGAAACGCAAAAAGGCCATC-3' (SEQ ID NO: 44)
[0306] EcoRI and MunI restriction sites have been added to primers (a-10) and (b-10), respectively.
[0307] The resulting reaction solution was subjected to electrophoresis using 1% agarose gel, and as a result, an approximately 0.6-kb DNA fragment corresponding to the rrnB terminator sequence was detected.
[0308] The approximately 0.6-kb DNA fragment containing the rrnB terminator sequence amplified by the above PCR was cut with restriction enzymes EcoRI and MunI, and the approximately 10.0-kb DNA fragment of the plasmid constructed in the above (4-2-3) was cut with restriction enzyme EcoRI. The cut DNA fragments were ligated to each other using T4 DNA ligase (manufactured by Takara Bio Inc.).
[0309] The connection solution that obtains is transformed into Escherichia coli JM109 by the calcium chloride method, and the transformant that obtains is applied on the LB agar medium that contains 50 μ g / mL kanamycin.The bacterial strain that survives on described substratum is cultivated in liquid nutrient medium by ordinary method, and from the nutrient solution that obtains, extracts plasmid DNA.This plasmid is cut with Restriction Enzymes EcoRI and MunI, and confirms the fragment that inserts.As a result, except the dna fragmentation of about 10.0-kb of the plasmid that comes from above-mentioned (4-2-3), also observe the dna fragmentation of about 0.6-kb corresponding to the rrnB terminator sequence.
[0310] The constructed cloning vector for gene expression was named pCYK21.
[0311] (4-3) Introduction of lactate dehydrogenase gene and malate / lactate dehydrogenase gene
[0312] (4-3-1) Cloning of lactate dehydrogenase gene
[0313] Genomic DNA was extracted from Geobacillus parathermoglucosidase NBRC 107763, Geobacillus thermophilus NBRC 102445, and Thermus rubrum NBRC 106122 according to conventional methods. Genomic DNA of Thermus thermophilus HB8 strain (ATCC 27634) was purchased from Takara Bio Inc.
[0314] The four genomic DNAs were each used as templates to amplify DNA fragments containing the lactate dehydrogenase ldh gene from each of Geobacillus parathermoglucosidase, Geobacillus thermophilus, and Thermus thermophilus, and DNA fragments containing the malate / lactate dehydrogenase mldh gene from each of Thermus thermophilus and Thermus rubrum, respectively, by the PCR method. The following primers were used for PCR. PCR was performed using a "DNA Thermal Cycler" manufactured by Life Technologies Corporation and a KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent, according to conventional methods.
[0315] Primers for amplifying the thermoglucosidase-encoding ldh gene of Geobacillus paragea
[0316] (a-11)5'-TTA CATATG AAACAACAAGGCATGAATCGAGTAGC-3' (SEQ ID NO: 45)
[0317] (b-11)5'-TTA GAATTC TTATTTTACATCATCAAAATAACGGG-3' (SEQ ID NO: 46)
[0318] An NdeI restriction site has been added to primer (a-11), and an EcoRI restriction site has been added to primer (b-11).
[0319] Primers for amplifying the ldh gene of Geobacillus thermophilus
[0320] (a-12)5'-TTA CATATG AAAAACGGGAGAGGAAATCGGGTAGC-3' (SEQ ID NO: 47)
[0321] (b-12)5'-TTA GAATTC TTACTGAGCAAAATAGCGCGCCAATA-3' (SEQ ID NO: 48)
[0322] An NdeI restriction site has been added to primer (a-12) and an EcoRI restriction site has been added to primer (b-12).
[0323] Primers for amplifying the ldh gene of Thermus thermophilus
[0324] (a-13)5'-TTA CATATG AAGGTCGGCATCGTGGGAAGCGGCAT-3' (SEQ ID NO: 49)
[0325] (b-13)5'-TTA GAATTC CTAAAACCCCAGGGCGAAGGCCGCCT-3' (SEQ ID NO: 50)
[0326] An NdeI restriction site has been added to primer (a-13) and an EcoRI restriction site has been added to primer (b-13).
[0327] Primers for amplifying the mldh gene of Thermus thermophilus
[0328] (a-14)5'-TTA CATATG AGGTGGCGGGCGGACTTCCTCTCGGC-3' (SEQ ID NO: 51)
[0329] (b-14)5'-TTA GAATTC TCAAGCATCGTCCCTCCAAGGCACGC-3' (SEQ ID NO: 52)
[0330] An NdeI restriction site has been added to primer (a-14) and an EcoRI restriction site has been added to primer (b-14).
[0331] Primers used to amplify the mldh-1 gene of Thermus rubrum
[0332] (a-15)5'-TTA CATATG CAAGGCATCCTGTGCAACAACTGCG-3' (SEQ ID NO: 53)
[0333] (b-15)5'-TTA GAATTC TTAAAGGCCCACCGCTTTAGCGGCCT-3' (SEQ ID NO: 54)
[0334] An NdeI restriction site has been added to primer (a-15) and an EcoRI restriction site has been added to primer (b-15).
[0335] Primers used to amplify the mldh-2 gene of Thermus rubrum
[0336] (a-18)5'-TTA CATATG AGGGTTCCTTATCCCGTACTCAAGCA-3' (SEQ ID NO: 55)
[0337] (b-18)5'-TTT GAATTC TCATCTTGTCCCTCCTCCTTGTAGAT-3' (SEQ ID NO: 56)
[0338] An NdeI restriction site has been added to primer (a-18) and an EcoRI restriction site has been added to primer (b-18).
[0339] The resulting reaction solution was subjected to electrophoresis using 1% agarose gel, and an approximately 1.0-kb DNA fragment was detected for each of the Geobacillus parathermoglucosidase ldh gene, the Geobacillus thermophilus ldh gene, the Thermus thermophilus ldh gene, the Thermus thermophilus mldh gene, and the Thermus rubrum mldh-1 gene and mldh-2 gene.
[0340] The approximately 1.0-kb DNA fragment containing each of the thermoglucosidase parageobacillus ldh gene, the thermophilic Geobacillus ldh gene, the Thermus thermophilus ldh gene, the Thermus thermophilus mldh gene, and the Thermus rubrum mldh-1 gene and mldh-2 gene amplified by the above PCR was cut with the restriction enzymes NdeI and EcoRI. The approximately 10.6-kb DNA fragment of the above cloning vector pCYK21 was also cut with the restriction enzymes NdeI and EcoRI. Each of the cut 1.0-kb DNA fragments and the 10.6-kb DNA fragment were ligated to each other using T4 DNA ligase (manufactured by Takara Bio Inc.).
[0341] The obtained ligation solution was used to transform the Hydrogenophilus thermoluteolus strain TH-1 (NBRC 14978) by the electric pulse method, and the obtained transformant was applied to A solid medium containing 50 μg / ml kanamycin and cultured at 50° C. in an incubator filled with a mixed gas of H 2 : O 2 : CO 2 = 7.5:1:1.5 for 60 hours.
[0342] Each strain surviving on the A solid medium was inoculated into a test tube containing 5 ml of A liquid medium containing 50 μg / ml kanamycin using a platinum loop. The test tube was filled with a mixture of H2:O2:CO2 = 7.5:1:1.5, cultured with shaking at 50°C, and plasmid DNA was extracted from the culture medium. Plasmids containing the thermoglucosidase parageobacillus ldh gene, the thermophilic Geobacillus ldh gene, the thermophilic Thermus ldh gene, the thermophilic Thermus mldh gene, and the rubrum Thermus mldh-1 and mldh-2 genes, respectively, were cut with the restriction enzymes NdeI and EcoRI, and the inserted fragments were confirmed. As a result, in addition to the approximately 10.6-kb DNA fragment of plasmid pCYK21, fragments with a length of approximately 1.0-kb were observed, each of which was an insert fragment of the Geobacillus parathermoglucosidase ldh gene, the Geobacillus thermophilus ldh gene, the Thermus thermophilus ldh gene, the Thermus thermophilus mldh gene, and the Thermus rubrum mldh-1 gene and mldh-2 gene.
[0343] The plasmid containing the thermoglucosidase ldh gene of Geobacillus parabacterium was named pC-Pth-ldh, the plasmid containing the thermoglucosidase ldh gene of Geobacillus thermophilus was named pC-Gka-ldh, the plasmid containing the thermophilus ldh gene was named pC-Tth-ldh, the plasmid containing the thermophilus mldh gene was named pC-Tth-mldh, the plasmid containing the Thermus thermophilus mldh-1 gene was named pC-Mru-mldh-1, and the plasmid containing the Thermus thermophilus mldh-2 gene was named pC-Mru-mldh-2.
[0344] (4-3-2) Lactate dehydrogenase gene and lactate / malate dehydrogenase gene in Hydrogenophilus Confirmation of expression in thermoluteolus strains
[0345] Each of the strains introduced with the lactate dehydrogenase gene or malate / lactate dehydrogenase gene obtained as described above was inoculated into a test tube containing 5 ml of liquid medium A containing 50 μg / ml kanamycin using a platinum loop. The test tube was filled with a mixed gas of H2:O2:CO2 = 7.5:1:1.5 and cultured with shaking at 50°C for 20 hours.
[0346] The bacterial cells thus cultivated and propagated were collected by centrifugation (4 ° C, 15,000 rpm, 1 minute). The bacterial cells were destroyed by ultrasonic treatment and subsequently centrifuged (4 ° C, 15,000 rpm, 5 minutes) to obtain cell destruction supernatant. The cell destruction supernatant was used as a crude enzyme solution to measure lactate dehydrogenase activity by the following method. Crude enzyme solution, 50mM sodium acetate (pH 5.0), 0.5mM NADH, 0.2mM fructose 1,6-diphosphate and 5mM sodium pyruvate were mixed, reacted at 50 ° C, followed the reduction of the absorbance at 340nm from NADH, and analyzed the initial reaction rate. Specific activity was calculated from the initial reaction rate and protein concentration. The enzyme level that produces 1 μmol of lactic acid per minute is defined as 1U (unit).
[0347] As a result, lactate dehydrogenase activity was detected in each of the strain LDH03 into which the thermoglucosidase ldh gene of Geobacillus parabacterium was introduced, the strain LDH04 into which the ldh gene of Geobacillus thermophilus was introduced, the strain LDH05 into which the ldh gene of Thermus thermophilus was introduced, the strain MLDH01 into which the mldh gene of Thermus thermophilus was introduced, the strain MLDH02 into which the mldh-1 gene of Thermus rubrum was introduced, and the strain MLDH03 into which the mldh-2 gene of Thermus rubrum was introduced.
[0348] [Table 1]
[0349] Lactate dehydrogenase activity of Hydrogenophilus thermoluteolus strains obtained by introducing ldh or mldh genes
[0350]
[0351] The host of the transformants in Table 1 was not a strain with a disrupted lactate utilization enzyme gene, but the wild-type strain Hydrogenophilus thermoluteolus TH-1. However, it was revealed that each of the ldh and mldh genes functioned in Hydrogenophilus thermoluteolus and could express enzyme activity.
[0352] (4-3-3) Lactic Acid Utilization by Lactate Dehydrogenase Genes and Malate / Lactate Dehydrogenase Genes in Hydrogenophilic Bacteria Introduction of enzyme genes into disrupted strains
[0353] The corresponding plasmids were extracted from Hydrogenophilus thermoluteolus LDH05 (with wild type HPTL_1695) having a pC-Tth-ldh plasmid containing the lactate dehydrogenase gene (ldh) of Thermus thermophilus and Hydrogenophilus thermoluteolus MLDH02 (with wild type HPTL_1695) having a pC-Mru-mldh1 plasmid containing the malate / lactate dehydrogenase gene (mldh-1) of Thermus rubrum by a conventional method, and the NOC373 strain (the HPTL_1695 gene-disrupted strain) was transformed with each plasmid by an electric pulse method (electroporation). The transformant was transferred to a solid medium containing 50 μg / mL kanamycin and cultivated at 50°C for 60 hours in an incubator filled with a mixed gas of H2:O2:CO2=7.5:1:1.5.
[0354] Each strain grown on the A solid medium was inoculated using a platinum loop into a test tube containing 5 mL of A liquid medium containing 50 μg / mL kanamycin. The test tube was filled with a gas mixture of H2:O2:CO2 = 7.5:1:1.5 and shaken at 50°C. Plasmid DNA was then extracted from the culture medium. Each plasmid containing the ldh gene of Thermus thermophilus and the mldh-1 gene of Thermus rubrum, respectively, was cut with the restriction enzymes NdeI and EcoRI. The inserted fragments were thus identified. As a result, in addition to the approximately 10.6-kb DNA fragment of plasmid pCYK21, an approximately 1.0-kb insert was identified, corresponding to each of the ldh gene of Thermus thermophilus and the mldh-1 gene of Thermus rubrum. The resulting strains were named as shown in Table 2.
[0355] Table 2
[0356]
[0357] (4-3-4) Lactic acid production
[0358] Each bacterial strain in Table 2 was inoculated into liquid medium A containing 50 μg / ml kanamycin using a platinum loop and cultured with shaking at 50° C. for 24 hours, while supplying a mixed gas of H 2 : O 2 : CO 2 = 7.5:1:1.5.
[0359] After the culture, lactic acid in the culture supernatant obtained by centrifugation (4°C, 15,000 rpm, 5 minutes) was quantified using F-Kit L-Lactic Acid (Roche).
[0360] As shown in Table 3, each of the LAC01 strain and LAC02 strain in which the HPTL_1695 gene was disrupted showed a significant increase in the amount of lactic acid in the culture supernatant compared with the corresponding LDH05 strain and MLDH02 strain, respectively.
[0361] Table 3
[0362]
[0363] The host of strains LDH05 and MLDH02 is Hydrogenophilus thermoluteolus TH-1, while the host of strains LAC01 and LAC02 is strain NOC373, which was obtained by disrupting the HPTL_1695 gene in the streptomycin-resistant strain NOC269 of Hydrogenophilus thermoluteolus TH-1.
[0364] The amount of lactic acid in the culture supernatant of one transformant, produced by introducing the ldh gene from Thermus thermophilus into the NOC269 strain (a streptomycin-resistant strain), the parent strain of the NOC373 host strain, was almost identical to that of the LDH05 strain. The amount of lactic acid in the culture supernatant of one transformant, produced by introducing the mldh-1 gene from Thermus rubrum into the NOC269 strain (a streptomycin-resistant strain), the parent strain of the NOC373 host strain, was almost identical to that of the MLDH02 strain. Streptomycin resistance has been shown to not affect lactic acid production.
[0365] (5) Introduction of lactate permease gene
[0366] In order to further promote the secretion of lactic acid produced in the cells into the culture supernatant, a lactate permease gene was co-expressed.
[0367] (5-1) Cloning of the lactate permease gene
[0368] The genomic DNA of Geobacillus thermophilus was used as a template to amplify the lactate permease gene of Geobacillus thermophilus by PCR. The following primers were used for the PCR. PCR was performed using a DNA thermal cycler manufactured by Life Technologies Corporation and a KOD FX Neo (manufactured by Toyobo Co., Ltd.) as a reaction reagent and by conventional methods.
[0369] Primers for amplifying the lactate permease gene (lutP) of Geobacillus thermophilus
[0370] (a-19)5'-CGG CAATTG CGGGCACAAAGGGGAGGAGAAAACC G-3' (SEQ ID NO: 57)
[0371] (b-19)5'-CGG CAATTG TTATGGAATCATCCACGACAATACCG-3' (SEQ ID NO: 58)
[0372] Primers (a-19) and (b-19) each have a MunI restriction enzyme site added thereto.
[0373] The reaction mixture obtained from the PCR was subjected to electrophoresis using 1% agarose gel. As a result, an approximately 1.7-kbp DNA fragment of the lactate permease gene was detected.
[0374] An approximately 1.7-kb DNA fragment containing the lactate permease gene of Geobacillus thermophilus amplified by PCR was cut with the restriction enzyme MunI and then with the restriction enzyme EcoRI. T4 DNA ligase (manufactured by Takara Bio Inc.) was used to ligate the DNA fragment to each of the plasmid DNAs described in (4-3-1), i.e., pC-Tth-ldh (containing the lactate dehydrogenase gene (ldh gene) of Thermus thermophilus) and pC-Mru-mldh1 (containing the malate / lactate dehydrogenase gene (mldh gene) of Thermus rubrum.
[0375] Each of the resulting ligation products was used to transform the NOC269 and NOC373 strains by an electric pulse method (electroporation). The transformants were applied to A solid medium containing 50 μg / mL kanamycin and cultured at 50° C. in an incubator filled with a mixed gas of H 2 : O 2 : CO 2 = 7.5:1:1.5 for 60 hours.
[0376] From the bacterial strain grown on the solid medium, the bacterial strain in which the lactate permease gene is cloned into the downstream of the ldh gene or mldh gene contained in the plasmid in the same direction as the ldh gene or mldh gene is selected by colony PCR. When the colony PCR is carried out using a combination of a primer corresponding to the upstream sequence of the ldh gene or mldh gene and the above-mentioned primer (b-19), the bacterial strain in which the lactate permease gene is cloned in the same direction as the ldh gene or mldh gene can be identified on the basis of whether DNA fragmentation can be amplified. The PCR is carried out by a conventional method using a " DNA thermal cycler " manufactured by Life Technologies Corporation and TaKaRa Ex Taq (manufactured by Takara Bio Inc.) as a reaction reagent.
[0377] Primers for colony PCR
[0378] Lactate permease gene lutP from Geobacillus thermophilus
[0379] (a-20)5'-GGCTCGTATAATGTGTGGAATTGTGAGCGGATAAC-3' (SEQ ID NO: 59)
[0380] (b-20)5'-CGG CAATTG TTATGGAATCATCCACGACAATACCG-3' (SEQ ID NO: 60)
[0381] As a result, in each transformation, an approximately 2.7-kb DNA fragment was detected that would be amplified in the case where the lactate permease gene was cloned in the same direction as the ldh gene or mldh gene. The resulting plasmids and bacterial strains were named as shown in Table 4.
[0382] Table 4
[0383]
[0384] (5-2) Lactic acid production
[0385] Each strain in Table 4 into which the lactate permease gene was introduced was inoculated into liquid medium A containing 50 μg / ml kanamycin using a platinum loop, and cultured with shaking at 50° C. for 24 hours, with a mixed gas of H 2 : O 2 : CO 2 = 7.5:1:1.5 supplied during the culture.
[0386] After cultivation, the lactic acid in the culture supernatant obtained by centrifugation (4°C, 15,000rpm, 5 minutes) was quantified using F-kit L-lactic acid (Roche). The results determined that, as shown in Table 5, the LAC06 and LAC12 strains obtained by introducing the lactate permease gene lutP of thermophilic Geobacillus into the NOC373 strain as a strain in which the HPTL_1695 gene was destroyed, respectively showed an increase in the amount of lactic acid in the culture supernatant compared to the LAC01 and LAC02 strains, each of which was a strain in which no lactate permease gene was introduced. When the NOC269 strain in which the lactate utilization enzyme gene was not destroyed was the host, the effect of introducing the lactate permease gene was not significant. In contrast, when the lactate utilization enzyme gene was destroyed, the enhancement of the lactic acid production capacity caused by the introduction of the lactate permease gene became significant. That is, the destruction of the lactate utilization enzyme gene and the introduction of the lactate permease gene synergistically acted to enhance lactic acid production capacity.
[0387] Table 5
[0388]
[0389] (7) Preserved strains
[0390] The Hydrogenophilus thermoluteolus LAC06 strain and the Hydrogenophilus thermoluteolus LAC12 strain were deposited at the NITE Patent Microorganisms Depositary, National Institute of Technology and Evaluation (2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan (zip code 292-0818)).
[0391] For the Hydrogenophilus thermoluteolus LAC06 strain, the accession number is BP-03007 and the acceptance date is July 30, 2019. For the Hydrogenophilus thermoluteolus LAC12 strain, the accession number is BP-03008 and the acceptance date is July 30, 2019.
[0392] In addition, the Hydrogenophilus thermoluteolus LDH05 strain and the Hydrogenophilus thermoluteolus MLDH02 strain have also been deposited at the NITE Patent Microorganisms Depositary, National Institute of Technology and Evaluation (2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan (zip code 292-0818)).
[0393] For the Hydrogenophilus thermoluteolus LDH05 strain, the accession number is BP-02822 and the acceptance date is November 14, 2018. For the Hydrogenophilus thermoluteolus MLDH02 strain, the accession number is BP-02828 and the acceptance date is November 21, 2018.
[0394] Therefore, these strains are available to the public.
[0395] In addition, all strains described in this specification (including ATCC strains and NBRC strains) are internationally deposited under the Budapest Treaty, or are owned by organizations that provide the strains without any terms or conditions, or are sold on the market, and therefore, these strains are available to the public.
[0396] Industrial Applicability
[0397] The recombinant of the present invention effectively produces lactic acid using carbon dioxide as the sole carbon source, and therefore, it can efficiently produce raw materials for biodegradable plastics while solving global warming caused by increased carbon dioxide emissions. Sequence Listing <110> CO2 Resource Utilization Research Institute Co., Ltd. <120> Transgenic hydrogenophilic bacteria producing lactic acid <130> FPR0019WO <160> 60 <170> PatentIn version 3.5 <210> 1 <211> 759 <212> DNA <213> Hydrogenophilus thermoluteolus <400> 1 atggctaccc aaccccgcgt cggtctcttt gtcacctgcc tggtcaatac catccgtccc 60 aacatcgcga tggcgcttgc acaactcttg gaagccacgg ggcaccgcgt cgaagtcccg 120 ttcgcgcaaa cctgctgcgg gcaacccggc tacaacgcgg gggactggga tgccgcccgt 180 gcgcttgcga agcagaccat cgccgcgttc gaacccttcg attatctcat cgcgccgtcg 240 ggctcgtgcc ttgcgacgat tcgccacgac tatccggagc tgctcaaaga cgatcccgaa 300 tggcgggaac gcgcgcaacg gctcgcagcc aagtcgtggg aagcgctgag ctacttcgcc 360 caacaggttc cattggaaca actcccacgg gtccggttcc cctatcgcgt cacctaccac 420 gactcctgtt ccggcttgcg cagcctgggg atcaagggac aaccgcgcca gctccttgcc 480 cgtgtcgaag ggctgacgct cgtggagatg gcagaggccg aggtgtgttg cgggttcggt 540 ggcaccttct gcgtcaaata tcccgaactc tccgaggcga tggtcgaacg caaggtccaa 600 aacatcctga agagcggcgc gcaagtgctc ttaggcggcg acctgggttg tctgatgaac 660 attgccgggc ggcttgcgcg catccatgcc ccggtccggg tctatcatac cctcgaagtg 720 ctggcggggc tggcaaatgg cccggttg aatggctga 759 <210> 2 <211> 252 <212> PRT <213> Hydrogenophilus thermoluteolus <400> 2 Met Ala Thr Gln Pro Arg Val Gly Leu Phe Val Thr Cys Leu Val Asn 1 5 10 15 Thr Ile Arg Pro Asn Ile Ala Met Ala Leu Ala Gln Leu Leu Glu Ala 20 25 30 Thr Gly His Arg Val Glu Val Pro Phe Ala Gln Thr Cys Cys Gly Gln 35 40 45 Pro Gly Tyr Asn Ala Gly Asp Trp Asp Ala Ala Arg Ala Leu Ala Lys 50 55 60 Gln Thr Ile Ala Ala Phe Glu Pro Phe Asp Tyr Leu Ile Ala Pro Ser 65 70 75 80 Gly Ser Cys Leu Ala Thr Ile Arg His Asp Tyr Pro Glu Leu Leu Lys 85 90 95 Asp Asp Pro Glu Trp Arg Glu Arg Ala Gln Arg Leu Ala Ala Lys Ser 100 105 110 Trp Glu Ala Leu Ser Tyr Phe Ala Gln Gln Val Pro Leu Glu Gln Leu 115 120 125 Pro Arg Val Arg Phe Pro Tyr Arg Val Thr Tyr His Asp Ser Cys Ser 130 135 140 Gly Leu Arg Ser Leu Gly Ile Lys Gly Gln Pro Arg Gln Leu Leu Ala 145 150 155 160 Arg Val Glu Gly Leu Thr Leu Val Glu Met Ala Glu Ala Glu Val Cys 165 170 175 Cys Gly Phe Gly Gly Thr Phe Cys Val Lys Tyr Pro Glu Leu Ser Glu 180 185 190 Ala Met Val Glu Arg Lys Val Gln Asn Ile Leu Lys Ser Gly Ala Gln 195 200 205 Val Leu Leu Gly Gly Asp Leu Gly Cys Leu Met Asn Ile Ala Gly Arg 210 215 220 Leu Ala Arg Ile His Ala Pro Val Arg Val Tyr His Thr Leu Glu Val 225 230 235 240 Leu Ala Gly Leu Ala Asn Gly Pro Gly Leu Asn Gly 245 250 <210> 3 <211> 1428 <212> DNA <213> Hydrogenophilus thermoluteolus <400> 3 atgaccagcc gcactccacg ccgctttcgc gaacaagcgg tcttcgcgct gcacgagccc 60 aatctccagg cggcgctttc ccgtgccgcg gatggcttca tcggcaaacg cgcgaaagcg 120 gttgcgctcg tccccgaatt cgagcagttg cgcgaagcgg gcccccagcg caaagatgaa 180 atcctggcca acctcgacac ctacctcgcc gcgttcgaag cagaggtcac ccgccacggc 240 ggtgtcgtcc attgggcacc cgatgccgac gcggcgcgcc gcatcattct ggagatctgc 300 gccgcagcga atgcccgcgt gatcaccaag ggcaaatcga tggtctccga ggagatcggg 360 ctcaacgagg cgctggaggc agcggggtac gaaatcgtcg aaaccgacct aggggagtac 420 atcattcagc tggcgggaga agctccttca cacatcatcg cccccgcggt ccacaaaacc 480 aaagagcaga tctccgacct cttcgaagcc gcgcatggca cgccgcggca aacgaccgtc 540 gaagggctgg tcaccgaggc gcggttgcag ctgcgacaaa agtacttcca agcagacgtc 600 ggcatcaccg gcgcgaactt cctcgtagcc gagacgggac agaccctcat cgtcaccaac 660 gaagggaacg gtgacctcac gcagacgctc gcacgggtcc atatcgtcac cgccggaatc 720 gagcgggtgg tcggcaccct cgaggacgtt gcgctctttc tgcgtttgct cgcgcgttcc 780 gcaacggggc aagacagcga aacctacacc acctactccg tcggcccgca ccgcgcaggc 840 gaccaggacg gcccggaagc gtttcacgtc gtgctcgtcg acaacggacg cagccggatg 900 ctcgatggac cgttccgtcc aatgttgcgc tgcatccgct gcggcgcgtg catgaaccat 960 tgcccggtct atggcgcgat cggcgggcat gcgtacggtt gggtctaccc ggggccgatg 1020 ggatcggtct tgactccgct ctttaccgga ctcgacaacg cgctcgatct gcccaacgcc 1080 tgcacgctga acggtcgttg cggtgaagtg tgcccggtga aaatcccatt gccggacctg 1140 ctgcgccgtc ttcgccacga acagcacaaa gcgggccttc gtccggcgct ggaaggacgg 1200 gccctcaccc tctggcgctg gctcgcaacc cgccctgcgc tctaccatgc cgcggaacgg 1260 gtcaaagtca ggctgctcgc cgcgtgggcg cgcgggcgca agacgcttga ctggttccc 1320 ttcgcccgcg gctggtttgg ggttcgtgac ctgcccacgc ccccgggacg caccttctc 1380 gaactgtggc acgccaaacg cgaaaaccca aacggaggcg agcgatga 1428 <210> 4 <211> 475 <212> PRT <213> Hydrogenophilus thermoluteolus <400> 4 Met Thr Ser Arg Thr Pro Arg Arg Phe Arg Glu Gln Ala Val Phe Ala 1 5 10 15 Leu His Glu Pro Asn Leu Gln Ala Ala Leu Ser Arg Ala Ala Asp Gly 20 25 30 Phe Ile Gly Lys Arg Ala Lys Ala Val Ala Leu Val Pro Glu Phe Glu 35 40 45 Gln Leu Arg Glu Ala Gly Ala Gln Arg Lys Asp Glu Ile Leu Ala Asn 50 55 60 Leu Asp Thr Tyr Leu Ala Ala Phe Glu Ala Glu Val Thr Arg His Gly 65 70 75 80 Gly Val Val His Trp Ala Pro Asp Ala Asp Ala Ala Arg Arg Ile Ile 85 90 95 Leu Glu Ile Cys Ala Ala Ala Asn Ala Arg Val Ile Thr Lys Gly Lys 100 105 110 Ser Met Val Ser Glu Glu Ile Gly Leu Asn Glu Ala Leu Glu Ala Ala 115 120 125 Gly Tyr Glu Ile Val Glu Thr Asp Leu Gly Glu Tyr Ile Ile Gln Leu 130 135 140 Ala Gly Glu Ala Pro Ser His Ile Ile Ala Pro Ala Val His Lys Thr 145 150 155 160 Lys Glu Gln Ile Ser Asp Leu Phe Glu Ala Ala His Gly Thr Pro Arg 165 170 175 Gln Thr Thr Val Glu Gly Leu Val Thr Glu Ala Arg Leu Gln Leu Arg 180 185 190 Gln Lys Tyr Phe Gln Ala Asp Val Gly Ile Thr Gly Ala Asn Phe Leu 195 200 205 Val Ala Glu Thr Gly Gln Thr Leu Ile Val Thr Asn Glu Gly Asn Gly 210 215 220 Asp Leu Thr Gln Thr Leu Ala Arg Val His Ile Val Thr Ala Gly Ile 225 230 235 240 Glu Arg Val Val Gly Thr Leu Glu Asp Val Ala Leu Phe Leu Arg Leu 245 250 255 Leu Ala Arg Ser Ala Thr Gly Gln Asp Ser Glu Thr Tyr Thr Thr Tyr 260 265 270 Ser Val Gly Pro His Arg Ala Gly Asp Gln Asp Gly Pro Glu Ala Phe 275 280 285 His Val Val Leu Val Asp Asn Gly Arg Ser Arg Met Leu Asp Gly Pro 290 295 300 Phe Arg Pro Met Leu Arg Cys Ile Arg Cys Gly Ala Cys Met Asn His 305 310 315 320 Cys Pro Val Tyr Gly Ala Ile Gly Gly His Ala Tyr Gly Trp Val Tyr 325 330 335 Pro Gly Pro Met Gly Ser Val Leu Thr Pro Leu Phe Thr Gly Leu Asp 340 345 350 Asn Ala Leu Asp Leu Pro Asn Ala Cys Thr Leu Asn Gly Arg Cys Gly 355 360 365 Glu Val Cys Pro Val Lys Ile Pro Leu Pro Asp Leu Leu Arg Arg Leu 370 375 380 Arg His Glu Gln His Lys Ala Gly Leu Arg Pro Ala Leu Glu Gly Arg 385 390 395 400 Ala Leu Thr Leu Trp Arg Trp Leu Ala Thr Arg Pro Ala Leu Tyr His 405 410 415 Ala Ala Glu Arg Val Lys Val Arg Leu Leu Ala Ala Trp Ala Arg Gly 420 425 430 Arg Lys Thr Leu Asp Trp Phe Pro Phe Ala Arg Gly Trp Phe Gly Val 435 440 445 Arg Asp Leu Pro Thr Pro Pro Gly Arg Thr Phe Leu Glu Leu Trp His 450 455 460 Ala Lys Arg Glu Asn Pro Asn Gly Gly Glu Arg 465 470 475 <210> 5 <211> 756 <212> DNA <213> Hydrogenophilus thermoluteolus <400> 5 atgaacgcaa ccgcaggctt tcccacgtcg caacgacccg aacggctgga ctccgcttcg 60 acaaacgaca gcaccgccac ccggcacgcc gacggtcgtg aacgggtgct cgctgcgatc 120 cgcgctgcgc tgggcaaaaa tggcgcagtt gagcctgccg atcccgctgc gcgtgccgct 180 gcgatcaccc cgcgcgcacc ccacccccgg ctggcgttct ctgaaccagt cgcggcacga 240 tggcaacgac tttggaccgc acgtgccgga acggtgcacg aactcccttc ccgcgacgcc 300 cttcccgaag cggtcgcggc gtggtgtgcc gaagtgggtg ccacaccgcc cacacacgcg 360 agcggcaccc tcctcgacct cccctggcct gctgcgtggc aactgcgctg cgaaccggca 420 accgtcacca cggaaaccgc ggtgagcgaa gcgtacgctg gcatcgccga agtgggaagt 480 cttgtcttcc tctccgcccc cgtgcatccc accacccacc ggttcgtgcc agacaaccac 540 ctcgtgctgc tatcgcagtc ccgcatcgtt tcccatttcg aggagttctg ggcgctgctg 600 cgccgcgaac tgggtgacga cacaaccgat tggcgcgaac atctgccgcg caccatcaac 660 ttcgtcgctg gcccctcacg caccggagac gtcgagcaga cgatccagtt gggcgcccat 720 gggccgcggc gggtgcacgt cttcttgatc ccctga 756 <210> 6 <211> 251 <212> PRT <213> Hydrogenophilus thermoluteolus <400> 6 Met Asn Ala Thr Ala Gly Phe Pro Thr Ser Gln Arg Pro Glu Arg Leu 1 5 10 15 Asp Ser Ala Ser Thr Asn Asp Ser Thr Ala Thr Arg His Ala Asp Gly 20 25 30 Arg Glu Arg Val Leu Ala Ala Ile Arg Ala Ala Leu Gly Lys Asn Gly 35 40 45 Ala Val Glu Pro Ala Asp Pro Ala Ala Arg Ala Ala Ala Ile Thr Pro 50 55 60 Arg Ala Pro His Pro Arg Leu Ala Phe Ser Glu Pro Val Ala Ala Arg 65 70 75 80 Trp Gln Arg Leu Trp Thr Ala Arg Ala Gly Thr Val His Glu Leu Pro 85 90 95 Ser Arg Asp Ala Leu Pro Glu Ala Val Ala Ala Trp Cys Ala Glu Val 100 105 110 Gly Ala Thr Pro Pro Thr His Ala Ser Gly Thr Leu Leu Asp Leu Pro 115 120 125 Trp Pro Ala Ala Trp Gln Leu Arg Cys Glu Pro Ala Thr Val Thr Thr 130 135 140 Glu Thr Ala Val Ser Glu Ala Tyr Ala Gly Ile Ala Glu Val Gly Ser 145 150 155 160 Leu Val Phe Leu Ser Ala Pro Val His Pro Thr Thr His Arg Phe Val 165 170 175 Pro Asp Asn His Leu Val Leu Leu Ser Gln Ser Arg Ile Val Ser His 180 185 190 Phe Glu Glu Phe Trp Ala Leu Leu Arg Arg Glu Leu Gly Asp Asp Thr 195 200 205 Thr Asp Trp Arg Glu His Leu Pro Arg Thr Ile Asn Phe Val Ala Gly 210 215 220 Pro Ser Arg Thr Gly Asp Val Glu Gln Thr Ile Gln Leu Gly Ala His 225 230 235 240 Gly Pro Arg Arg Val His Val Phe Leu Ile Pro 245 250 <210> 7 <211> 396 <212> DNA <213> Hydrogenophilus thermoluteolus <400> 7 atgccaacca tcaaccagtt ggtgcgtcgt ccgcggaaaa cggcgccga aaagagcaaaa 60 gtgccggcgt tgcagggatg tccgcaaaaa cgaggcgtgt gtacgcgcgt ctataccacg 120 acgccgaaaa agccgaactc ggcccttcgt aaggtcgcga aagtgcgttt gaccaacggt 180 tacgaggtga tttcgtacat cggcggcgaa gggcacaatc tgcaagaaca ctcggtggtg 240 ctgattcgtg gcggccgggt gaaagacctg ccgggtgtgc gttaccacat cgtgcgcggt 300 tcgctcgact tgcaaggggt caaggaccgt aagcaagggc gttccaagta cggggcgaag 360 cgtccgaagc cgggcgccgc tgcgggcaag aaataa 396 <210> 8 <211> 1026 <212> DNA <213> Escherichia coli <400> 8 atgaaaaagc ctgaactcac cgcgacatct gtcgagaagt ttctgatcga aaagttcgac 60 agcgtctccg acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120 gtaggagggc gtggatatgt cctgcgggta atagctgcg ccgatggttt ctacaaagat 180 cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 240 ggggaattca gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 300 caagacctgc ctgaaaccga actgcccgct gttctgcagc cggtcgcgga ggccatggat 360 gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 420 atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480 cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 540 ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 600 tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 660 atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc gtggttggct 720 tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780 cggctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840 ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga 900 gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc 960 tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc gagggcaaag 1020 gaatag 1026 <210> 9 <211> 960 <212> DNA <213> 热葡萄糖苷酶副地芽孢杆菌(Parageobacillus thermoglucosidasius) <400> 9 atgaaacaac aaggcatgaa tcgagtagca cttataggaa cggggttcgt tggggccagc 60 tatgcatttg cccttatgaa ccaaggaata gcagatgagt tagtattgat tgatgtaaat 120 aagaataagg cagagggcga tgtgatggat ttaaatcacg gaaaagtatt cgcgccgaag 180 ccgatgaata tttggtttgg agattatcaa gattgccaag acgccgattt ggtggtgatt 240 tgtgcagggg ctaaccaaaa gccgggagaa acaagactgg atcttgttga caaaaatatt 300 aatatcttca aaacgattgt cgattctgtg atgaaatccg gatttgatgg cgtttttctt 360 gtggcaacga acccagtgga tattttaacg tatgctactt ggaaatttag cgggttaccg 420 aaagagcggg taatcggctc aggaacgatt cttgatacag caagattccg cttcttgcta 480 agtgaatatt ttcaagtggc tccgaccaat gtacatgcgt atattattgg cgagcatggg 540 gatacagagc tgcctgtttg gagccatgcg gaaattggaa gcattccagt tgagcaaata 600 ttgatgcaaa acgataacta tagaaaagag gatttagaca atatctttgt taatgttcgt 660 gatgcggcat atcaaatcat tgagaaaaaa ggggcaacgt attacggcat tgcaatggga 720 ttagtccgta tcactcgtgc tattttgcac aatgaaaatg ccatcttaac cgtttctgct 780 catttggacg gccaatatgg cgaacgaaat gtttatattg gcgtgcctgc cattatcaac 840 cgaaacggta ttcgtgaagt gatggaattg acgctaaatg aaacagaaca acaacaattc 900 catcatagtg taactgtatt aaaagacatt ctttcccgtt attttgatga tgtaaaataa 960 <210> 10 <211> 954 <212> DNA <213> 嗜热地芽孢杆菌(Geobacillus kaustophilus) <400> 10 atgaaaaacg ggagaggaaa tcgggtagcg gtcgtcggca ccgggtttgt cggcgccagt 60 tatgcgtttg ccttaatgaa tcaagggatt gccgatgaga tcgtgctcat cgatgcaaat 120 gaaaacaagg ctgagggcga tgcgatggac ttcaaccatg ggaaagtatt tgcgccgaag 180 ccggctgaca tttggcacgg cgattacgat gattgccgcg atgccgattt ggttgtcatt 240 tgcgccggcg ccaaccaaaa accgggcgag acgcggcttg atcttgtgga caaaaacatt 300 gccattttcc gctcgatcgt tgagtcggtc atggcatccg gatttcaagg actgtttctc 360 gtcgccacca atccggtcga cattttaacg tacgcgacgt ggaaattcag cggcctgccg 420 caagagcgag taatcggatc gggcacgatt tggacacgg cgcggttccg cttcttgttg 480 ggcgactatt tcgccgtcgc cccgacgac gtgcacgcct atattatcgg cgaacatggc 540 gandactgaac tcccggtctg gagccaggct gatatcggcg gcgtgccgat ccgcaagctg 600 gtcgagtcta aagggaag agcgcaaaa gagctcgagc gcattttgt caatgtgcgc 660 gatgccgcct accaaattat tgagaaaaaa ggagcgacgt actacgggat tgctatgggg 720 cttgcccgcg tgacgcgcgc cattttgcat catgaaaatg ccatttgac cgtttccgct 780 tacttggacg gcccatacgg cgaacgcgat gtctacatcg gtgtgcctgc tgtgatcac 840 cgaaatggca tccggaagt gattgaatt gaacttgacg agggagaa aaatggttc 900 caccgtagtg ctgcgacgtt aaaagtgta ttggcgcgct atttgctca gtaa 954 <210> 11 <211> 933 <212> DNA <213> Thermus thermophilus <400> 11 atgaaggtcg gcatcgtggg aagcggcatg gtggggagcg ccaccgccta cgccctggcc 60 ctcctcggcg tggcgcggga ggtggtcctc gtggacctgg accggaagct ggcccaggcc 120 cacgccgagg acatcctcca cgccacgccc ttcgcccacc cggtctgggt gcgggcgggg 180 tcgtacgggg acctcgaggg ggcccgggcg gtggtgctcg ccgccggggt ggcccagcgc 240 cccggggaga cccgcctgca gcttctggac cgcaacgccc aggtcttcgc ccaggtggtg 300 ccccgggttt tagaggcggc cccggaggcg gtgctcctcg tggccacgaa cccggtggac 360 gtgatgaccc aggtggccta ccgcctctcc ggcctgcccc cggggcgggt ggtgggctcg 420 gggacgatcc tggacacggc ccgcttccgg gcccttctgg cggagtacct ccgggtggcc 480 ccccagtcgg tccacgccta cgtgctgggg gagcacgggg actcggaggt gctggtctgg 540 tccagcgccc aggtgggcgg ggtgcccctc ctggagttcg ccgaggcccg ggggcgggcc 600 ctttccccgg aggaccgggc ccgcattgac gaaggggtcc gccgggccgc ctaccggatc 660 attgagggga agggggccac ctactacggc atcggggcgg gcctcgcccg gcttgtgcgg 720 gccatcctca ccgacgaaaa gggggtgtac accgtgagcg ccttcacccc cgaggtggag 780 ggggtcttgg aggtgagcct ctccctgccc cgcatcctgg gcgcgggggg cgtggagggg 840 accgtctacc cgagcctgag cccggaggag cgggaggcct tgcggcggag cgccgagatc 900 ctcaaggagg cggccttcgc cctggggttt tag 933 <210> 12 <211> 319 <212> PRT <213> 热葡萄糖苷酶副地芽孢杆菌(Parageobacillus thermoglucosidasius) <400> 12 Met Lys Gln Gln Gly Met Asn Arg Val Ala Leu Ile Gly Thr Gly Phe 1 5 10 15 Val Gly Ala Ser Tyr Ala Phe Ala Leu Met Asn Gln Gly Ile Ala Asp 20 25 30 Glu Leu Val Leu Ile Asp Val Asn Lys Asn Lys Ala Glu Gly Asp Val 35 40 45 Met Asp Leu Asn His Gly Lys Val Phe Ala Pro Lys Pro Met Asn Ile 50 55 60 Trp Phe Gly Asp Tyr Gln Asp Cys Gln Asp Ala Asp Leu Val Val Ile 65 70 75 80 Cys Ala Gly Ala Asn Gln Lys Pro Gly Glu Thr Arg Leu Asp Leu Val 85 90 95 Asp Lys Asn Ile Asn Ile Phe Lys Thr Ile Val Asp Ser Val Met Lys 100 105 110 Ser Gly Phe Asp Gly Val Phe Leu Val Ala Thr Asn Pro Val Asp Ile 115 120 125 Leu Thr Tyr Ala Thr Trp Lys Phe Ser Gly Leu Pro Lys Glu Arg Val 130 135 140 Ile Gly Ser Gly Thr Ile Leu Asp Thr Ala Arg Phe Arg Phe Leu Leu 145 150 155 160 Ser Glu Tyr Phe Gln Val Ala Pro Thr Asn Val His Ala Tyr Ile Ile 165 170 175 Gly Glu His Gly Asp Thr Glu Leu Pro Val Trp Ser His Ala Glu Ile 180 185 190 Gly Ser Ile Pro Val Glu Gln Ile Leu Met Gln Asn Asp Asn Tyr Arg 195 200 205 Lys Glu Asp Leu Asp Asn Ile Phe Val Asn Val Arg Asp Ala Ala Tyr 210 215 220 Gln Ile Ile Glu Lys Lys Gly Ala Thr Tyr Tyr Gly Ile Ala Met Gly 225 230 235 240 Leu Val Arg Ile Thr Arg Ala Ile Leu His Asn Glu Asn Ala Ile Leu 245 250 255 Thr Val Ser Ala His Leu Asp Gly Gln Tyr Gly Glu Arg Asn Val Tyr 260 265 270 Ile Gly Val Pro Ala Ile Ile Asn Arg Asn Gly Ile Arg Glu Val Met 275 280 285 Glu Leu Thr Leu Asn Glu Thr Glu Gln Gln Gln Phe His His Ser Val 290 295 300 Thr Val Leu Lys Asp Ile Leu Ser Arg Tyr Phe Asp Asp Val Lys 305 310 315 <210> 13 <211> 317 <212> PRT <213> 嗜热地芽孢杆菌(Geobacillus kaustophilus) <400> 13 Met Lys Asn Gly Arg Gly Asn Arg Val Ala Val Val Gly Thr Gly Phe 1 5 10 15 Val Gly Ala Ser Tyr Ala Phe Ala Leu Met Asn Gln Gly Ile Ala Asp 20 25 30 Glu Ile Val Leu Ile Asp Ala Asn Glu Asn Lys Ala Glu Gly Asp Ala 35 40 45 Met Asp Phe Asn His Gly Lys Val Phe Ala Pro Lys Pro Ala Asp Ile 50 55 60 Trp His Gly Asp Tyr Asp Asp Cys Arg Asp Ala Asp Leu Val Val Ile 65 70 75 80 Cys Ala Gly Ala Asn Gln Lys Pro Gly Glu Thr Arg Leu Asp Leu Val 85 90 95 Asp Lys Asn Ile Ala Ile Phe Arg Ser Ile Val Glu Ser Val Met Ala 100 105 110 Ser Gly Phe Gln Gly Leu Phe Leu Val Ala Thr Asn Pro Val Asp Ile 115 120 125 Leu Thr Tyr Ala Thr Trp Lys Phe Ser Gly Leu Pro Gln Glu Arg Val 130 135 140 Ile Gly Ser Gly Thr Ile Leu Asp Thr Ala Arg Phe Arg Phe Leu Leu 145 150 155 160 Gly Asp Tyr Phe Ala Val Ala Pro Thr Asn Val His Ala Tyr Ile Ile 165 170 175 Gly Glu His Gly Asp Thr Glu Leu Pro Val Trp Ser Gln Ala Asp Ile 180 185 190 Gly Gly Val Pro Ile Arg Lys Leu Val Glu Ser Lys Gly Glu Glu Ala 195 200 205 Gln Lys Glu Leu Glu Arg Ile Phe Val Asn Val Arg Asp Ala Ala Tyr 210 215 220 Gln Ile Ile Glu Lys Lys Gly Ala Thr Tyr Tyr Gly Ile Ala Met Gly 225 230 235 240 Leu Path Arg Val Thr Arg Path To Leu His His Glu Asn Path To Leu 245 250 255 Thr Val Ser Ala Tyr Leu Asp Gly Pro Tyr Gly Glu Arg Asp Val Tyr 260 265 270 Ile Gly Val Pro Ala Val Ile Asn Arg Asn Gly Ile Arg Glu Val Ile 275 280 285 Glu Ile Glu Leu Asp Glu Glu Glu Lys Lys Trp Phe His Arg Ser Ala 290 295 300 Path Thr Leu Lys Gly Val Leu Path Arg Tyr Phe Path Gln 305 310 315 <210> 14 <211> 310 <212> PRT <213> Thermus thermophilus <400> 14 Met Lys Val Gly Ile Val Gly Ser Gly Met Val Gly Ser Ala Thr Ala 1 5 10 15 Tyr Path Leu Path Leu Leu Gly Val Path Arg Glu Val Val Leu Val Asp 20 25 30 Leu Asp Arg Lys Leu Ala Gln Ala His Ala Glu Asp Ile Leu His Ala 35 40 45 Thr Pro Phe Ala His Pro Val Trp Val Arg Ala Gly Ser Tyr Gly Asp 50 55 60 Leu Glu Gly Ala Arg Ala Val Val Leu Ala Ala Gly Val Ala Gln Arg 65 70 75 80 Pro Gly Glu Thr Arg Leu Gln Leu Leu Asp Arg Asn Ala Gln Val Phe 85 90 95 Ala Gln Val Val Pro Arg Val Leu Glu Ala Ala Pro Glu Ala Val Leu 100 105 110 Leu Val Ala Thr Asn Pro Val Asp Val Met Thr Gln Val Ala Tyr Arg 115 120 125 Leu Ser Gly Leu Pro Pro Gly Arg Val Val Gly Ser Gly Thr Ile Leu 130 135 140 Asp Thr Ala Arg Phe Arg Ala Leu Leu Ala Glu Tyr Leu Arg Val Ala 145 150 155 160 Pro Gln Ser Val His Ala Tyr Val Leu Gly Glu His Gly Asp Ser Glu 165 170 175 Val Leu Val Trp Ser Ser Ala Gln Val Gly Gly Val Pro Leu Leu Glu 180 185 190 Phe Ala Glu Ala Arg Gly Arg Ala Leu Ser Pro Glu Asp Arg Ala Arg 195 200 205 Ile Asp Glu Gly Val Arg Arg Ala Ala Tyr Arg Ile Ile Glu Gly Lys 210 215 220 Gly Ala Thr Tyr Tyr Gly Ile Gly Ala Gly Leu Ala Arg Leu Val Arg 225 230 235 240 Ala Ile Leu Thr Asp Glu Lys Gly Val Tyr Thr Val Ser Ala Phe Thr 245 250 255 Pro Glu Val Glu Gly Val Leu Glu Val Ser Leu Ser Leu Pro Arg Ile 260 265 270 Leu Gly Ala Gly Gly Val Glu Gly Thr Val Tyr Pro Ser Leu Ser Pro 275 280 285 Glu Glu Arg Glu Ala Leu Arg Arg Ser Ala Glu Ile Leu Lys Glu Ala 290 295 300 Ala Phe Ala Leu Gly Phe 305 310 <210> 15 <211> 1035 <212> DNA <213> Thermus thermophilus <400> 15 atgaggtggc gggcggactt cctctcggcc tgggcggagg ccctcttgcg aaaggcggga 60 gcggacgaac cctccgccaa ggcggtggcc tgggccctgg tggaggcgga cctcaggggg 120 gtgggaagcc acgggctttt gcgccttccc gtttacgtgc gccgcctcga ggcgggcctg 180 gtgaacccca gccccaccct gcccctggag gaacggggcc ccgtggccct cctggacggg 240 gagcacggct tcggaccccg cgtggcccta aaggccgtgg aggcggccca aagcctcgca 300 aggaggcacg gcctcggggc cgtgggggtg cggcggagca cccacttcgg catggcgggc 360 ctctacgcgg agaagctcgc ccgggagggc ttcgtggcct gggtcaccac caacgccgag 420 cccgacgtgg tgcccttcgg ggggcgggag aaggccttgg gcaccaaccc tctggccttc 480 gccgccccgg cccctcaggg gatcctcgtg gccgacctgg ccacctcgga aagcgccatg 540 ggcaaggtct tcctagcccg ggagaagggg gagcggatcc ccccaagctg gggggtggac 600 cgggagggga gccccacgga cgacccccac cgggtctacg ccctgaggcc cctcgggggg 660 cccaaggggt acgccctggc ccttttggtg gaggtgctct cgggggtgct cacgggggcg 720 ggggtggccc acggcatcgg ccgcatgtac gacgagtggg accgccccca ggacgtgggc 780 cacttcctcc tggccctgga cccggggcgc ttcgtgggca aagaggcctt cctggagcgg 840 atgggggccc tttggcaagc cctaaaggcc actcccccgg cgccggggca cgaggaggtc 900 ttcctccccg gggagttgga ggccaggagg cgggagcggg ccctggcgga ggggatggcc 960 cttccggagc gggtggtggc ggagcttaag gccttggggg agcgctacgg cgtgccttgg 1020 agggacgatg cttga 1035 <210> 16 <211> 1011 <212> DNA <213> Meiothermus ruber <400> 16 atgcaaggca ttcctgtgca acaactgcgc gagcgggtgg agcagattct aataaaccgg 60 ggctttacgc tggagaatgc tctacccatc gcagaatccc tggtgctggc cgagatgcgg 120 ggggttgcct cgcacggcct gatccgactg cccatctacc tcgagcgcgc ccgactgggt 180 tcggtaaaac cccaggcccg gcccgtgctg ctggcggatt atccagccct ggccctgctg 240 gatgcccagg atggtcacgg catcccctcc ggcttgaaag cgatggagct ggccattgaa 300 aaagcccaga aggtgggcct ggccgctgtg ggggtgcggc gctcgagcca ctttggcctg 360 gcctggtact tcgtgcgcag cgcagtggaa aaggggctgg tcggcgtggc actctccaac 420 gccgatgcgc tggtggcccc ctggggcgcc cgcagccgct ttctgggcac caaccccctg 480 gctgtgggca tcccggccat ggaggaaccc cccatcgccc tggacatggc caccagcgag 540 gccgcccacg gcaaaatttt gctggccaag tccagcggga aaaccatccc cctcaactgg 600 gccctcgatg cggaggggcg gcccaccgac gaccccgacc gggccctggc cggcgccctg 660 ctgccttttg gggggcccaa gggatcggcc atcagcctgc tcattgatgt gctgtgcggc 720 ccactcgtgg gcgctctgat tggccccgag atcgccccgc tctacaccga gccgaacgg 780 ccccagggcc tgggccatttt ttttatggcc ctgaacccgg gtgtttttgg cgacgccgaa 840 cagtttagaa agcaggtcga cgcgtacatt cgcagggttc gcgcgctgcc tcccgccgaa 900 aacgtcgatc gggttctact gccaggcgaa cgcgagtggc gcctcgagca aaaagcgcta 960 caggaggggg tgtctctaag cccagaggcc gctaaagcgg tgggccttta a 1011 <210> 17 <211> 999 <212> DNA <213> Meiothermus ruber <400> 17 atgagggttc cttatccccgt actcaagcag gcggtctcga gccacttcca gggcctgggg 60 ctggccccgg atcatgccga ggccttcacc gaggtgatcc tcgaggccga gctcgagggc 120 aacctggggc acggcctgac ccggattgcc footcaccg cccagctaca ggccggtggg 180 ctcaaccccc ggccgcagat gcgtttggaa cgaaccaaac ccggggttgc agttctgcat 240 gccgacggcg cacccgggcc ggtggccggg ctttttgcag tgcaggcgct ggccccgatg 300 gccagggagc agggaagcg cgccctggcc gtgcgcggcg cggggcattc cggggtgctc 360 tcggcgtacg tgggccggct ggcccaagag ggcctggtag ccctggcctt tgccaacacc 420 cccccggcca tcgccccggg gccggtgctg ggcaccaacc ccatcgccct gggcgcgccg 480 gccgagcccc agccggtcat cattgatacc tccatctcgg tggtggcgcg cggcaagatc 540 atcgccgcgg ctaaaaaggg cgagcccatc ccgccgggct gggcgctcga caaggagggt 600 cgcccaacca ccgatgccaa ggctgcgctg gaaggctcac tgctgcccat tggcgagggc 660 aaggggtttg cgctggcagt gctgggtggaa attctggccg gggccctggc gggcgacgtg 720 ctctcgcccg agctgcccct gccctggatg cccccagcgc aggccgccaa gccggggctg 780 ctgctgctgg cctttgaccc cgccgccttt ggcccgggct acaggggccg ggtggcccag 840 ctcatcgagg ctcttaaagc ggccggaggc cggattcccg gtgcgcgccg ggccgcttta 900 cgagagaaag ccttggcgga aggtctggag gtcaaccaga cgcttcaggc cgaactcggt 960 acactaggcg tgcatctaca aggaggaggg acaagatga 999 <210> 18 <211> 344 <212> PRT <213>嗜热栖热菌(Thermus thermophilus) <400> 18 Met Arg Trp Arg Ala Asp Phe Leu Ser Ala Trp Ala Glu Ala Leu Leu 1 5 10 15 Arg Lys Ala Gly Ala Asp Glu Pro Ser Ala Lys Ala Val Ala Trp Ala 20 25 30 Leu Val Glu Ala Asp Leu Arg Gly Val Gly Ser His Gly Leu Leu Arg 35 40 45 Leu Pro Val Tyr Val Arg Arg Leu Glu Ala Gly Leu Val Asn Pro Ser 50 55 60 Pro Thr Leu Pro Leu Glu Glu Arg Gly Pro Val Ala Leu Leu Asp Gly 65 70 75 80 Glu His Gly Phe Gly Pro Arg Val Ala Leu Lys Ala Val Glu Ala Ala 85 90 95 Gln Ser Leu Ala Arg Arg His Gly Leu Gly Ala Val Gly Val Arg Arg 100 105 110 Ser Thr His Phe Gly Met Ala Gly Leu Tyr Ala Glu Lys Leu Ala Arg 115 120 125 Glu Gly Phe Val Ala Trp Val Thr Thr Asn Ala Glu Pro Asp Val Val 130 135 140 Pro Phe Gly Gly Arg Glu Lys Ala Leu Gly Thr Asn Pro Leu Ala Phe 145 150 155 160 Ala Ala Pro Ala Pro Gln Gly Ile Leu Val Ala Asp Leu Ala Thr Ser 165 170 175 Glu Ser Ala Met Gly Lys Val Phe Leu Ala Arg Glu Lys Gly Glu Arg 180 185 190 Ile Pro Pro Ser Trp Gly Val Asp Arg Glu Gly Ser Pro Thr Asp Asp 195 200 205 Pro His Arg Val Tyr Ala Leu Arg Pro Leu Gly Gly Pro Lys Gly Tyr 210 215 220 Ala Leu Ala Leu Leu Val Glu Val Leu Ser Gly Val Leu Thr Gly Ala 225 230 235 240 Gly Val Ala His Gly Ile Gly Arg Met Tyr Asp Glu Trp Asp Arg Pro 245 250 255 Gln Asp Val Gly His Phe Leu Leu Ala Leu Asp Pro Gly Arg Phe Val 260 265 270 Gly Lys Glu Ala Phe Leu Glu Arg Met Gly Ala Leu Trp Gln Ala Leu 275 280 285 Lys Ala Thr Pro Pro Ala Pro Gly His Glu Glu Val Phe Leu Pro Gly 290 295 300 Glu Leu Glu Ala Arg Arg Arg Glu Arg Ala Leu Ala Glu Gly Met Ala 305 310 315 320 Leu Pro Glu Arg Val Val Ala Glu Leu Lys Ala Leu Gly Glu Arg Tyr 325 330 335 Gly Val Pro Trp Arg Asp Asp Ala 340 <210> 19 <211> 336 <212> PRT <213> Meiothermus ruber <400> 19 Met Gln Gly Ile Pro Val Gln Gln Leu Arg Glu Arg Val Glu Gln Ile 1 5 10 15 Leu Ile Asn Arg Gly Phe Thr Leu Glu Asn Ala Leu Pro Ile Ala Glu 20 25 30 Ser Leu Val Leu Ala Glu Met Arg Gly Val Ala Ser His Gly Leu Ile 35 40 45 Arg Leu Pro Ile Tyr Leu Glu Arg Ala Arg Leu Gly Ser Val Lys Pro 50 55 60 Gln Ala Arg Pro Val Leu Leu Ala Asp Tyr Pro Ala Leu Ala Leu Leu 65 70 75 80 Asp Ala Gln Asp Gly His Gly Ile Pro Ser Gly Leu Lys Ala Met Glu 85 90 95 Leu Ala Ile Glu Lys Ala Gln Lys Val Gly Leu Ala Ala Val Gly Val 100 105 110 Arg Arg Ser Ser His Phe Gly Leu Ala Trp Tyr Phe Val Arg Ser Ala 115 120 125 Val Glu Lys Gly Leu Val Gly Val Ala Leu Ser Asn Ala Asp Ala Leu 130 135 140 Val Ala Pro Trp Gly Ala Arg Ser Arg Phe Leu Gly Thr Asn Pro Leu 145 150 155 160 Ala Val Gly Ile Pro Ala Met Glu Glu Pro Pro Ile Ala Leu Asp Met 165 170 175 Ala Thr Ser Glu Ala Ala His Gly Lys Ile Leu Leu Ala Lys Ser Ser 180 185 190 Gly Lys Thr Ile Pro Leu Asn Trp Ala Leu Asp Ala Glu Gly Arg Pro 195 200 205 Thr Asp Asp Pro Asp Arg Ala Leu Ala Gly Ala Leu Leu Pro Phe Gly 210 215 220 Gly Pro Lys Gly Ser Ala Ile Ser Leu Leu Ile Asp Val Leu Cys Gly 225 230 235 240 Pro Leu Val Gly Ala Leu Ile Gly Pro Glu Ile Ala Pro Leu Tyr Thr 245 250 255 Glu Pro Glu Arg Pro Gln Gly Leu Gly His Phe Phe Met Ala Leu Asn 260 265 270 Pro Gly Val Phe Gly Asp Ala Glu Gln Phe Arg Lys Gln Val Asp Ala 275 280 285 Tyr Ile Arg Arg Val Arg Ala Leu Pro Pro Ala Glu Asn Val Asp Arg 290 295 300 Val Leu Leu Pro Gly Glu Arg Glu Trp Arg Leu Glu Gln Lys Ala Leu 305 310 315 320 Gln Glu Gly Val Ser Leu Ser Pro Glu Ala Ala Lys Ala Val Gly Leu 325 330 335 <210> 20 <211> 332 <212> PRT <213> Meiothermus ruber <400> 20 Met Arg Val Pro Tyr Pro Val Leu Lys Gln Ala Val Ser Ser His Phe 1 5 10 15 Gln Gly Leu Gly Leu Ala Pro Asp His Ala Glu Ala Phe Thr Glu Val 20 25 30 Ile Leu Glu Ala Glu Leu Glu Gly Asn Leu Gly His Gly Leu Thr Arg 35 40 45 Ile Ala Gln Tyr Thr Ala Gln Leu Gln Ala Gly Gly Leu Asn Pro Arg 50 55 60 Pro Gln Met Arg Leu Glu Arg Thr Lys Pro Gly Val Ala Val Leu His 65 70 75 80 Ala Asp Gly Ala Pro Gly Pro Val Ala Gly Leu Phe Ala Val Gln Ala 85 90 95 Leu Ala Pro Met Ala Arg Glu Gln Gly Ser Ala Ala Leu Ala Val Arg 100 105 110 Gly Ala Gly His Ser Gly Val Leu Ser Ala Tyr Val Gly Arg Leu Ala 115 120 125 Gln Glu Gly Leu Val Ala Leu Ala Phe Ala Asn Thr Pro Pro Ala Ile 130 135 140 Ala Pro Gly Pro Val Leu Gly Thr Asn Pro Ile Ala Leu Gly Ala Pro 145 150 155 160 Ala Glu Pro Gln Pro Val Ile Ile Asp Thr Ser Ile Ser Val Val Ala 165 170 175 Arg Gly Lys Ile Ile Ala Ala Ala Lys Lys Gly Glu Pro Ile Pro Pro 180 185 190 Gly Trp Ala Leu Asp Lys Glu Gly Arg Pro Thr Thr Asp Ala Lys Ala 195 200 205 Ala Leu Glu Gly Ser Leu Leu Pro Ile Gly Glu Gly Lys Gly Phe Ala 210 215 220 Leu Ala Val Leu Val Glu Ile Leu Ala Gly Ala Leu Ala Gly Asp Val 225 230 235 240 Leu Ser Pro Glu Leu Pro Leu Pro Trp Met Pro Pro Ala Gln Ala Ala 245 250 255 Lys Pro Gly Leu Leu Leu Leu Ala Phe Asp Pro Ala Ala Phe Gly Pro 260 265 270 Gly Tyr Arg Gly Arg Val Ala Gln Leu Ile Glu Ala Leu Lys Ala Ala 275 280 285 Gly Gly Arg Ile Pro Gly Ala Arg Arg Ala Ala Leu Arg Glu Lys Ala 290 295 300 Leu Ala Glu Gly Leu Glu Val Asn Gln Thr Leu Gln Ala Glu Leu Gly 305 310 315 320 Thr Leu Gly Val His Leu Gln Gly Gly Gly Thr Arg 325 330 <210> 21 <211> 1674 <212> DNA <213> Geobacillus kaustophilus <400> 21 atgtggaagc aagattttac accaatcgcc gaccagcttt ggttatcggc gattgtcgca 60 ctcattccga ttttatattt cttttgggcg ttggccgtca agcggatgaa agggcatgtt 120 gcggggctga cgacgttgct gcttgctgtt gtgttggctg taatcgctta cagaatgccg 180 gctggaaaag cggttatgtc agtgacgcaa ggcgcggtgt acggattgtt gccgatcggc 240 tggatcatca tcacctctgt ctttttatac aagctgacgg tgaaaacagg ccactttgac 300 attatccgca attcggttgt ctcgctcacc gaagaccgcc ggctgcaagc gttgctgatt 360 gccttttcgt ttggcgcctt tttggaaggg gcagctgggt ttggcgcgcc agtggcgatt 420 tcagcggcgc ttcttgcggg gttggggttc aacccgctgt atgccgcggg catttgcttg 480 atcgccaaca cagcgccagt ggcattcggg gcggtcggga ttccaatcat ttcgatggaa 540 ggaccgactg gcgtgccggc gatggaaatc tcaaaaatgg ttgggcggca gttgccgttt 600 ttatcagtgt tcatcccgtt ctatctcgtg ctcattatgg ccgggtggaa aaagacgatg 660 gaagtgttgc cggccattat cgtttccggt gtttcgtttg cgctgacgca atatttcacc 720 tcgaactttt taggaccgga gctgccggac attttgtcct cgctcgtttc gatcgtcgcg 780 ttggctgtct ttttgaaata ttggaagccg aaaagcacat tccgctttgc aacggagtcg 840 gaagtggcgg ccgctgggca agttgctcgc gcgacgcaac gcggcgggga agtattccgc 900 gcttggtcgc cgtttctcgt gctgacggct ttgatctcgc tgtggggcat cccgcaagtg 960 aaggcggcgc tcaccggcca ttatgaaggg acaaacggct tgttgaagtt ggtcaacgct 1020 atcggcgtcc acttgacgtt tatgccgcct gtgccggggc tcaacaacca aattttgaac 1080 ccaagtggcc agccgatcgc tgcggtgtat aagcttgagc tgctcggcgc ggctgggacg 1140 gcgattttgc tggcggcggt cgtcacaaag ttcatcatcg gcatctcgtg gaaagagtgg 1200 gcgcgtacgt ttgtggaaac gcttaacgaa ttgaaattcc cgatcatcac gatcgcttcg 1260 gttgtcggct ttgcctatat cgccaactcg tcaggcatga gcacgacgct tggaatggcg 1320 ttggccaaaa caggcccgtt gttcccgttc ttctcgccga ttttaggatg gctcggcgtg 1380 tttatcaccg gttccgacac gtcgtcgaac ttgttgttcg gcaacctgca aaaagtgacg 1440 gcgacatcga ttggcatgga tccggtgctg gcgttggcgg ccaactcatc aggcggcgtc 1500 gtcgggaaaa tgatttcgcc gcaatcgatc gctgtcgcct gtgcggccgt cggtttgacc 1560 ggcaaagaat ccgacttgtt ccgcttcacg atcaaacata gcgtgttctt aatcatcttg 1620 attggcgttc tcgtttactt gcaatcgacg gtattgtcgt ggatgattcc ataa 1674 <210> 22 <211> 557 <212> PRT <213> 嗜热地芽孢杆菌(Geobacillus kaustophilus) <400> 22 Met Trp Lys Gln Asp Phe Thr Pro Ile Ala Asp Gln Leu Trp Leu Ser 1 5 10 15 Ala Ile Val Ala Leu Ile Pro Ile Leu Tyr Phe Phe Trp Ala Leu Ala 20 25 30 Val Lys Arg Met Lys Gly His Val Ala Gly Leu Thr Thr Leu Leu Leu 35 40 45 Ala Val Val Leu Ala Val Ile Ala Tyr Arg Met Pro Ala Gly Lys Ala 50 55 60 Val Met Ser Val Thr Gln Gly Ala Val Tyr Gly Leu Leu Pro Ile Gly 65 70 75 80 Trp Ile Ile Ile Thr Ser Val Phe Leu Tyr Lys Leu Thr Val Lys Thr 85 90 95 Gly His Phe Asp Ile Ile Arg Asn Ser Val Val Ser Leu Thr Glu Asp 100 105 110 Arg Arg Leu Gln Ala Leu Leu Ile Ala Phe Ser Phe Gly Ala Phe Leu 115 120 125 Glu Gly Ala Ala Gly Phe Gly Ala Pro Val Ala Ile Ser Ala Ala Leu 130 135 140 Leu Ala Gly Leu Gly Phe Asn Pro Leu Tyr Ala Ala Gly Ile Cys Leu 145 150 155 160 Ile Ala Asn Thr Ala Pro Val Ala Phe Gly Ala Val Gly Ile Pro Ile 165 170 175 Ile Ser Met Glu Gly Pro Thr Gly Val Pro Ala Met Glu Ile Ser Lys 180 185 190 Met Val Gly Arg Gln Leu Pro Phe Leu Ser Val Phe Ile Pro Phe Tyr 195 200 205 Leu Val Leu Ile Met Ala Gly Trp Lys Lys Thr Met Glu Val Leu Pro 210 215 220 Ala Ile Ile Val Ser Gly Val Ser Phe Ala Leu Thr Gln Tyr Phe Thr 225 230 235 240 Ser Asn Phe Leu Gly Pro Glu Leu Pro Asp Ile Leu Ser Ser Leu Val 245 250 255 Ser Ile Val Ala Leu Ala Val Phe Leu Lys Tyr Trp Lys Pro Lys Ser 260 265 270 Thr Phe Arg Phe Ala Thr Glu Ser Glu Val Ala Ala Ala Gly Gln Val 275 280 285 Ala Arg Ala Thr Gln Arg Gly Gly Glu Val Phe Arg Ala Trp Ser Pro 290 295 300 Phe Leu Val Leu Thr Ala Leu Ile Ser Leu Trp Gly Ile Pro Gln Val 305 310 315 320 Lys Ala Ala Leu Thr Gly His Tyr Glu Gly Thr Asn Gly Leu Leu Lys 325 330 335 Leu Val Asn Ala Ile Gly Val His Leu Thr Phe Met Pro Pro Val Pro 340 345 350 Gly Leu Asn Asn Gin lie Leu Asn Pro Ser Gly Gin Pro lie Ala Ala 355 360 365 Val Tyr Lys Leu Glu Leu Leu Gly Ala Ala Gly Thr Ala lie Leu Leu 370 375 380 Ala Ala Val Val Thr Lys Phe lie lie Gly lie Ser Trp Lys Glu Trp 385 390 395 400 Ala Arg Thr Phe Val Glu Thr Leu Asn Glu Leu Lys Phe Pro lie lie 405 410 415 Thr lie Ala Ser Val Val Gly Phe Ala Tyr lie Ala Asn Ser Ser Gly 420 425 430 Met Ser Thr Thr Leu Gly Met Ala Leu Ala Lys Thr Gly Pro Leu Phe 435 440 445 Pro Phe Phe Ser Pro lie Leu Gly Trp Leu Gly Val Phe lie Thr Gly 450 455 460 Ser Asp Thr Ser Ser Asn Leu Leu Phe Gly Asn Leu Gin Lys Val Thr 465 470 475 480 Ala Thr Ser lie Gly Met Asp Pro Val Leu Ala Leu Ala Ala Asn Ser 485 490 495 Ser Gly Gly Val Val Gly Lys Met lie Ser Pro Gin Ser lie Ala Val 500 505 510 Ala Cys Ala Ala Val Gly Leu Thr Gly Lys Glu Ser Asp Leu Phe Arg 515 520 525 Phe Thr Ile Lys His Ser Val Phe Leu Ile Ile Leu Ile Gly Val Leu 530 535 540 Val Tyr Leu Gln Ser Thr Val Leu Ser Trp Met Ile Pro 545 550 555 <210> twenty three <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> twenty three atacgcgtcc tccgatgcgt cgtaagggaa acgtc 35 <210> twenty four <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> twenty four atagtcgact tatttcttgc ccgcagcggc gcccg 35 <210> 25 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 25 atactcgagg agatgacgtt ggaggggcaa ggtcg 35 <210> 26 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 26 atacgcgtct attcctttgc cctcggacga gtgct 35 <210> 27 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 27 cgcgaattca tggctaccca accccgcgtc ggtct 35 <210> 28 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 28 cgcacgcgtt ggagtgcggc tggtcatcgg gtgac 35 <210> 29 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 29 gcacgcgtct gcagaacgga ggcgagcgat gaacg 35 <210> 30 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 30 cgcgcatgct caggggatca agaagacgtg caccc 35 <210> 31 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 31 cgcgaattca tggctaccca accccgcgtc ggtct 35 <210> 32 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 32 cgcgcatgct caggggatca agaagacgtg caccc 35 <210> 33 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Nucleotide sequence replacing the internal sequence of HPTL_1695 gene <400> 33 acgcgtctgc ag 12 <210> 34 <211> 4 <212> PRT <213> Artificial sequence <220> <223> The amino acid sequence that replaces the internal sequence of the polypeptide encoded by the HPTL_1695 gene <400> 34 Thr Arg Leu Gln 1 <210> 35 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 35 cgtggccaac taggcccagc cagatactcc cgatc 35 <210> 36 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 36 tgaggcctca ttggccggag cgcaacccac tcact 35 <210> 37 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 37 ctgggcctag ttggccacgt agaaagccag tccgc 35 <210> 38 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 38 tccggccaat gaggcctcag aagaactcgt caaga 35 <210> 39 <211> 83 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 39 gcattaatcc ttggactcct gttgatagat ccagtaatga cctcagaact ccatctggat 60 ttgttcagaa cgctcggttg ccg 83 <210> 40 <211> 83 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 40 caccgtgcag tcgatggatc tggattctca ccaataaaaa acgcccggcg gcaaccgagc 60 gttctgaaca aatccagatg gag 83 <210> 41 <211> 50 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 41 ttattggtga gaatccagat ccatcgactg cacggtgcac caatgcttct 50 <210> 42 <211> 70 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 42 gcaagcttgg agtgatcatc gtatgcatat gcgtttctcc tccagatccc tgtttcctgt 60 gtgaaattgt 70 <210> 43 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 43 ctcgaattca ctggccgtcg ttttacaacg tcgtg 35 <210> 44 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 44 cgcaattgag tttgtagaaa cgcaaaaagg ccatc 35 <210> 45 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 45 ttacatatga aacaacaagg catgaatcga gtagc 35 <210> 46 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 46 ttagaattct tattttacat catcaaaata acggg 35 <210> 47 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 47 ttacatatga aaaacggggag aggaaatcgg gtagc 35 <210> 48 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 48 ttagaattct tactgagcaa aatagcgcgc caata 35 <210> 49 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 49 ttacatatga aggtcggcat cgtgggaagc ggcat 35 <210> 50 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 50 ttagaattcc taaaacccca gggcgaaggc cgcct 35 <210> 51 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 51 ttacatatga ggtggcgggc ggacttcctc tcggc 35 <210> 52 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 52 ttagaattct caagcatcgt ccctccaagg cacgc 35 <210> 53 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 53 ttacatatgc aaggcattcc tgtgcaacaa ctgcg 35 <210> 54 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 54 ttacatatga gggttcctta tcccgtactc aagca 35 <210> 55 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 55 ttacatatga gggttcctta tcccgtactc aagca 35 <210> 56 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 56 tttgaattct catcttgtcc ctcctccttg tagat 35 <210> 57 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 57 cggcaattgc gggcacaaag gggaggagaa aaccg 35 <210> 58 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 58 cggcaattgt tatggaatca tccacgacaa taccg 35 <210> 59 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PCR primers <400> 59 ggctcgtata atgtgtggaa ttgtgagcgg ataac 35 <210> 60 <211> 35 <212> DNA <213> Artificial sequence <220> <223> PCR primers <400> 60 cggcaattgt tatggaatca tccacgacaa taccg 35
Claims
1. A recombinant Hydrogenophilus thermoluteolus having a lactate dehydrogenase gene and / or a malate / lactate dehydrogenase gene introduced therein, and wherein the lactate utilization enzyme gene of the following (b1) or (b4) is disrupted on the genome, (b1) a DNA consisting of the base sequence set forth in SEQ ID NO: 3; (b4) a DNA encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, wherein the lactate dehydrogenase gene is composed of (d1) or (d4): (d1) a DNA consisting of the base sequence set forth in SEQ ID NO: 11, or (d4) a DNA encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 14, The malate / lactate dehydrogenase gene is composed of (e1) or (e4): (e1) a DNA composed of the base sequence set forth in SEQ ID NO: 16, or (e4) a DNA encoding a polypeptide composed of the amino acid sequence set forth in SEQ ID NO:
19. 2 . The recombinant Hydrogenophilus thermoluteolus according to claim 1 , wherein the lactate utilization enzyme gene is disrupted by introducing deletion, addition, substitution or a combination thereof of one or more nucleotides into the lactate utilization enzyme gene. 3 . The recombinant Hydrogenophilus thermoluteolus according to claim 1 , wherein the recombinant Hydrogenophilus thermoluteolus further has a lactate permease gene introduced therein.
4. The recombinant Hydrogenophilus thermoluteolus according to claim 3, wherein the lactate permease gene consists of (f1) or (f4): (f1) a DNA consisting of the base sequence set forth in SEQ ID NO: 21; or (f4) A DNA encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:
22.
5. A method for producing lactic acid, comprising the step of culturing the recombinant Hydrogenophilus thermoluteolus according to any one of claims 1 to 4 using carbon dioxide as the sole carbon source.
Citation Information
Patent Citations
Genetically modified (r)-lactic acid-producing thermophilic bacteria
JP2017523778A
Method for controlling metabolism of hydrogen bacterium
JP2014183743A
Genetically modified bacterium for producing lactate from co 2
WO2019106134A1