Antibodies targeting ror1 and uses thereof

Abstract

The present invention provides antibodies targeting ROR1, as well as multispecific antibodies, chimeric antigen receptors, antibody conjugates, pharmaceutical compositions and kits comprising the same, and their use in the diagnosis / treatment / prevention of diseases associated with ROR1 expression.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of immunotherapy. More particularly, the present application relates to antibodies targeting ROR1 and their use in the prevention and / or treatment and / or diagnosis of diseases. BACKGROUND

[0002] Receptor tyrosine kinase-like orphan receptor 1 (ROR1) is a member of the receptor tyrosine kinase (RTK) family, which is generally highly expressed during embryogenesis and fetal development, but not on normal adult cells. However, expression of ROR1 has been detected in many hematological and solid malignancies, such as Chronic Lymphocytic Leukaemia (CLL), Acute Lymphoblastic Leukaemia (ALL), mantle cell leukaemia, hairy cell leukaemia, pancreatic cancer, prostate cancer, colon cancer, bladder cancer, ovarian cancer, testicular cancer, uterine cancer, adrenal cancer, breast cancer, lung cancer, melanoma, neuroblastoma, sarcoma, kidney cancer, etc. Due to this tumor-embryonic expression pattern of ROR1, it has become a target for the treatment of specific cancers and tumors.

[0003] Therefore, it is of great value and significance to develop drugs and antibodies targeting ROR1. The present application aims to provide an antibody targeting ROR1 and its use in the prevention and / or treatment and / or diagnosis of diseases. SUMMARY

[0004] In a first aspect, the present application provides an antibody or antigen-binding fragment thereof targeting ROR1, comprising:

[0005] (1) CDR-L1 as shown in SEQ ID NO: 1, CDR-L2 as shown in SEQ ID NO: 2, CDR-L3 as shown in SEQ ID NO: 3, CDR-H1 as shown in SEQ ID NO: 4, CDR-H2 as shown in SEQ ID NO: 5, and CDR-H3 as shown in SEQ ID NO: 6;

[0006] (2) CDR-L1 as shown in SEQ ID NO: 1, CDR-L2 as shown in SEQ ID NO: 2, CDR-L3 as shown in SEQ ID NO: 7, CDR-H1 as shown in SEQ ID NO: 4, CDR-H2 as shown in SEQ ID NO: 8, and CDR-H3 as shown in SEQ ID NO: 9;

[0007] (3) CDR-L1 as depicted in SEQ ID NO: 10, CDR-L2 as depicted in SEQ ID NO: 11, CDR-L3 as depicted in SEQ ID NO: 12, CDR-H1 as depicted in SEQ ID NO: 13, CDR-H2 as depicted in SEQ ID NO: 14, and CDR-H3 as depicted in SEQ ID NO: 15;

[0008] (4) CDR-L1 as depicted in SEQ ID NO: 16, CDR-L2 as depicted in SEQ ID NO: 17, CDR-L3 as depicted in SEQ ID NO: 18, CDR-H1 as depicted in SEQ ID NO: 19, CDR-H2 as depicted in SEQ ID NO: 20, and CDR-H3 as depicted in SEQ ID NO: 21; or

[0009] (5) CDR-L1 as depicted in SEQ ID NO: 1, CDR-L2 as depicted in SEQ ID NO: 22, CDR-L3 as depicted in SEQ ID NO: 7, CDR-H1 as depicted in SEQ ID NO: 4, CDR-H2 as depicted in SEQ ID NO: 5, and CDR-H3 as depicted in SEQ ID NO: 23.

[0010] In one embodiment, the antibody or antigen-binding fragment thereof of the application comprises a heavy chain variable region having at least 90% identity to, or one or few modifications (e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) from, an amino acid sequence selected from the group consisting of SEQ ID NO: 25, 28, 31, 34, 37, 69, 73, 77, 81, 85, 89, and 93; and a light chain variable region having at least 90% identity to, or one or few modifications (e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) from, an amino acid sequence selected from the group consisting of SEQ ID NO: 24, 27, 30, 33, 36, 68, 72, 76, 80, 84, 88, and 92. Preferably, the modifications are conservative modifications, e.g. conservative substitutions, additions and deletions of amino acids. In a preferred embodiment, the antibody or antigen-binding fragment thereof of the application comprises a heavy chain variable region selected from the group consisting of SEQ ID NO: 25, 28, 31, 34, 37, 69, 73, 77, 81, 85, 89, and 93; and a light chain variable region selected from the group consisting of SEQ ID NO: 24, 27, 30, 33, 36, 68, 72, 76, 80, 84, 88, and 92.

[0011] In one embodiment, the antibody or antigen-binding fragment thereof of the application comprises a heavy chain variable region and a light chain variable region selected from the group consisting of:

[0012] (a) a heavy chain variable region as depicted in SEQ ID NO: 25 and a light chain variable region as depicted in SEQ ID NO: 24;

[0013] (b) a heavy chain variable region as depicted in SEQ ID NO: 28 and a light chain variable region as depicted in SEQ ID NO: 27;

[0014] (c) a heavy chain variable region as depicted in SEQ ID NO: 31 and a light chain variable region as depicted in SEQ ID NO: 30;

[0015] (d) a heavy chain variable region as depicted in SEQ ID NO: 34 and a light chain variable region as depicted in SEQ ID NO: 33; and

[0016] (e) a heavy chain variable region as depicted in SEQ ID NO: 37 and a light chain variable region as depicted in SEQ ID NO: 36;

[0017] (f) a heavy chain variable region as depicted in SEQ ID NO: 69 and a light chain variable region as depicted in SEQ ID NO: 68;

[0018] (g) a heavy chain variable region as depicted in SEQ ID NO: 73 and a light chain variable region as depicted in SEQ ID NO: 72;

[0019] (h) a heavy chain variable region as depicted in SEQ ID NO: 77 and a light chain variable region as depicted in SEQ ID NO: 76;

[0020] (i) a heavy chain variable region as depicted in SEQ ID NO: 81 and a light chain variable region as depicted in SEQ ID NO: 80;

[0021] (j) a heavy chain variable region as depicted in SEQ ID NO: 85 and a light chain variable region as depicted in SEQ ID NO: 84;

[0022] (k) a heavy chain variable region as depicted in SEQ ID NO: 89 and a light chain variable region as depicted in SEQ ID NO: 88;

[0023] (l) a heavy chain variable region as depicted in SEQ ID NO: 93 and a light chain variable region as depicted in SEQ ID NO: 92.

[0024] Optionally, the heavy chain variable region and light chain variable region have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identity to the heavy chain variable region and light chain variable region of any one of (a)-(l);

[0025] Optionally, the heavy chain variable region and light chain variable region have one or several modifications of amino acids compared to the heavy chain variable region and light chain variable region of any one of (a)-(l), for example up to 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 modifications of amino acids; preferably, the modifications are conservative modifications, for example conservative substitutions, additions and deletions of amino acids.

[0026] In one embodiment, the antibody or antigen-binding fragment thereof of the application has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 29, 32, 35, 38, 70, 74, 78, 82, 86, 90, and 94, or has one or several modifications, e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, compared to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26, 29, 32, 35, 38, 70, 74, 78, 82, 86, 90, and 94. Preferably, the modifications are conservative modifications, e.g. conservative substitutions, additions, and deletions of amino acids. Preferably, the amino acid sequence of the antibody or antigen-binding fragment thereof of the application is selected from the group consisting of SEQ ID NOs: 26, 29, 32, 35, 38, 70, 74, 78, 82, 86, 90, and 94.

[0027] In one embodiment, the antibody or antigen-binding fragment thereof of the application is a murine, chimeric, humanized, or human antibody, preferably a humanized antibody.

[0028] The present application also provides nucleic acid molecules encoding the above-mentioned antibodies or antigen-binding fragments thereof. Thus, in one embodiment, the nucleic acid molecule encoding the antibody or antigen-binding fragment thereof has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 39-43, 71, 75, 78, 83, 87, 91, and 95, and the antibody or antigen-binding fragment thereof encoded thereby is capable of specifically binding to the ROR1 antigen. Preferably, the nucleic acid molecule encoding the antibody or antigen-binding fragment thereof is selected from the group consisting of SEQ ID NOs: 39-43, 71, 75, 78, 83, 87, 91, and 95.

[0029] In another aspect, the present application also provides a multispecific antibody, preferably a bispecific antibody or a trispecific antibody, comprising an anti-ROR1 antibody or antigen-binding fragment thereof as described above, and one or more second antibodies or antigen-binding portions thereof that specifically bind to other antigens.

[0030] In one embodiment, the second antibody or antigen-binding portion thereof can be in any antibody or antibody fragment format, e.g. a full-length antibody, a Fab, a Fab', a (Fab')2, a Fv, a scFv, a scFv-scFv, a minibody, a diabody, or a sdAb.

[0031] The present application also provides a vector comprising a nucleic acid molecule encoding the anti-ROR1 antibody or antigen-binding fragment thereof or multispecific antibody as defined above, and a host cell expressing the anti-ROR1 antibody or antigen-binding fragment thereof or multispecific antibody.

[0032] In another aspect, the present application also provides a chimeric antigen receptor comprising the anti-ROR1 antibody or antigen-binding fragment thereof as defined in the present application, a transmembrane domain and an intracellular signaling domain. Preferably, the chimeric antigen receptor further comprises one or more costimulatory domains.

[0033] The present application also provides a nucleic acid molecule encoding a chimeric antigen receptor targeting ROR1 as defined above, and a vector comprising said nucleic acid molecule.

[0034] The present application also provides a cell, preferably an immune cell, such as a T cell, a NK cell, a NKT cell, a macrophage, a dendritic cell, comprising a chimeric antigen receptor targeting ROR1 as defined above. In a preferred embodiment, the engineered immune cell further comprises a second chimeric antigen receptor targeting a further tumor antigen.

[0035] In another aspect, the present application also provides an antibody conjugate comprising the anti-ROR1 antibody or antigen-binding fragment thereof as defined in the present application and a second functional moiety, wherein the second functional moiety is selected from the group consisting of an Fc, a radioisotope, a half-life extending moiety, a detectable label and a drug.

[0036] In one embodiment, the half-life extending moiety is selected from the group consisting of a binding moiety for albumin, a binding moiety for transferrin, a polyethylene glycol molecule, a recombinant polyethylene glycol molecule, human serum albumin, a fragment of human serum albumin and a white polypeptide (including an antibody) that binds human serum albumin. In one embodiment, the detectable label is selected from the group consisting of a fluorophore, a chemiluminescent compound, a bioluminescent compound, an enzyme, an antibiotic resistance gene and a contrast agent. In one embodiment, the drug is selected from the group consisting of a cytotoxin and an immunomodulator.

[0037] In another aspect, the present application also provides a detection kit comprising the anti-ROR1 antibody or antigen-binding fragment thereof, the multispecific antibody, the antibody conjugate, the chimeric antigen receptor or the engineered immune cell as defined in the present application.

[0038] In another aspect, the present application also provides a pharmaceutical composition comprising the anti-ROR1 antibody or antigen-binding fragment thereof, the chimeric antigen receptor, the multispecific antibody, the engineered immune cell or the antibody conjugate as defined in the present application, and one or more pharmaceutically acceptable excipients.

[0039] In another aspect, the present application also provides a method of treating and / or preventing and / or diagnosing a disease associated with ROR1 expression, comprising administering to a subject an anti-ROR1 antibody or antigen-binding fragment thereof, chimeric antigen receptor, multispecific antibody, antibody conjugate, engineered immune cell, or pharmaceutical composition as described above. DETAILED DESCRIPTION

[0041] Unless otherwise indicated, all technical terms and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the application pertains.

[0042] Anti-ROR1 antibody or antigen-binding fragment thereof

[0043] As used herein, the term "antibody" has the broadest meaning understood by those skilled in the art and includes monoclonal antibodies (including intact antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments or synthetic polypeptides carrying one or more CDR sequences that are capable of exhibiting the desired biological activity. The antibodies of the present application can be of any class (e.g., IgG, IgE, IgM, IgD, IgA, etc.) or subclass (e.g., IgGl, IgG2, IgG2a, IgG3, IgG4, IgAl, IgA2, etc.).

[0044] As used herein, the term "antigen-binding fragment" or "antibody fragment" refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antibody fragments in the present application include, but are not limited to, Fab, Fab', F(ab')2, Fd fragments, Fd', Fv fragments, single-chain antibodies (scFv), disulfide bond-linked Fv (sdFv), a heavy chain variable region (VH) or a light chain variable region (VL) of an antibody, linear antibodies, "diabodies" with two antigen binding sites, single domain antibodies, nanobodies, a natural ligand of the antigen or a functional fragment thereof, etc. Thus, unless the context clearly indicates otherwise, "antibody" of the present application encompasses an antibody fragment or antigen-binding fragment as defined above. Thus, in a preferred embodiment, the antibody of the present application is selected from the group consisting of IgG, Fab, Fab', F(ab')2, Fd, Fd', Fv, scFv, sdFv, linear antibodies, and diabodies.

[0045] Generally, a whole antibody comprises two heavy chains and two light chains connected together by disulfide bonds, each light chain being connected to a respective heavy chain by disulfide bonds, in a "Y" shape structure. Each heavy chain comprises a heavy chain variable region (VH) comprising three complementarity determining regions (CDRs): CDR-H1, CDR-H2 and CDR-H3, and a heavy chain constant region comprising three constant domains: CH1, CH2 and CH3. Each light chain comprises a light chain variable region (VL) comprising three CDRs: CDR-L1, CDR-L2 and CDR-L3, and a light chain constant region comprising one constant domain CL. Within the heavy / light chain variable regions, the CDRs are separated by more conserved framework regions (FRs). The variable regions of the heavy / light chains are responsible for recognition and binding to the antigen, while the constant regions can mediate the binding of the antibody to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system.

[0046] The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using many numbering schemes well-known in the art, including: Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th edition, Public Health Service, National Institutes of Health, Bethesda, Maryland (“Kabat” numbering scheme); Al-Lazikani et al. (1997) JMB 273, 927-948 (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262: 732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding sitetopography,” J. Mol. Biol. 262, 732-745 (“Contact” numbering scheme); Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp. Immunol, January 2003; 27(1):55-77 (“IMGT” numbering scheme); Honegger A and Plückthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” JMol Biol, June 8, 2001; 309(3):657-70 (“Aho” numbering scheme); and Martin et al., “Modeling antibody hypervariable loops: a combined algorithm,” PNAS, 1989, 86(23):9268-9272 (“AbM” numbering scheme).

[0047] The boundaries of a given CDR or FR can differ depending on the scheme used to define them. For example, the Kabat scheme is based on structural alignment, while the Chothia scheme is based on structural information. The numbering of both the Kabat and Chothia schemes is based on the most common antibody region sequence lengths, with insertions provided by the insertion letter (e.g., “30a”) and deletions occurring in some antibodies. Both schemes place certain insertions and deletions (indels) at different positions, resulting in different numbering. The Contact scheme is based on analysis of complex crystal structures, and is similar to the Chothia numbering scheme in many respects. The AbM scheme is a compromise between the Kabat and Chothia definitions, based on the scheme used by Oxford Molecular’s AbM antibody modeling software.

[0048] Thus, unless otherwise specified, it should be understood that a“CDR” of a given antibody or region thereof (such as a variable region thereof) encompasses a CDR as defined by any of the above schemes or other known schemes. For example, where a particular CDR (e.g., CDR3) is specified to contain a given amino acid sequence, it is understood that such CDR can also have the sequence of the corresponding CDR (e.g., CDR3) as defined by any of the above schemes or other known schemes. Likewise, unless otherwise specified, it should be understood that a FR of a given antibody or region thereof (such as a variable region thereof) encompasses a FR as defined by any of the above schemes or other known schemes. Unless specifically indicated otherwise, the numbering scheme used to define the boundaries of CDRs and FRs herein employs the Chothia scheme.

[0049] “Single-chain antibody” and “scFv” are used interchangeably herein to refer to an antibody formed by the joining of an antibody heavy chain variable region (VH) and a light chain variable region (VL) by a linker. The optimal length and / or amino acid composition of the linker can be selected. The length of the linker can significantly affect the variable region folding and interaction of the scFv. In fact, if a short linker is used (e.g., between 5-10 amino acids), intrachain folding can be prevented. See, e.g., Hollinger et al., 1993 Proc Natl Acad. Sci. U.S.A. 90:6444-6448; U.S. Patent Application Publication Nos. 2005 / 0100543, 2005 / 0175606, 2007 / 0014794; and PCT Publication Nos. WO 2006 / 020258 and WO 2007 / 024715, which are incorporated herein by reference in their entirety. Commonly used linkers are, e.g., GSTSGSGKPGSGEGSTKG (SEQ ID NO: 66), GGGGSGGGGSGGGGS (SEQ ID NO: 67). The scFv can comprise the VH and VL joined in any order, e.g., VH-linker-VL or VL-linker-VH.

[0050] In one embodiment, the antibody or antigen-binding fragment thereof of the present application is a murine, chimeric, humanized or human antibody, preferably a humanized antibody.

[0051] As used herein, the term "chimeric antibody" refers to an antibody in which a portion of each heavy and light chain amino acid sequence is homologous to the corresponding sequence in an antibody from a particular species or belonging to a particular class, while the remaining segments of the chain are homologous to the corresponding sequences from another species or belonging to another class. Typically, the variable regions of both light and heavy chains are derived from the variable regions of an antibody from one species, while the constant regions are homologous to antibody sequences from another species. One clear advantage of this chimeric form is that the variable regions can be readily produced from currently known sources using readily available B cells or hybridomas from non-human hosts, while the constant regions with which they are combined are from, e.g., human cells. The variable regions have the advantage of being readily prepared, and the specificity is not affected by the source, while the likelihood that the antibody will elicit a human immune response upon injection is lower because the constant regions are from a human than if the constant regions are from a non-human source.

[0052] As used herein, a "humanized" antibody refers to an antibody in which all or substantially all CDR amino acid residues are derived from the CDR of a non-human species and all or substantially all FR amino acid residues are derived from human FRs. A "humanized form" of a non-human antibody, refers to a variant of the non-human antibody that has undergone humanization to typically reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), for example, to restore or improve antibody specificity or affinity.

[0053] Humanized antibodies and methods of making them are well known to those of skill in the art, see, e.g., Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008). Human framework regions that can be used for humanization include, but are not limited to, framework regions selected using the "best-fit" method; framework regions derived from a consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions; human mature (somatically mutated) framework regions; and framework regions derived from a human germline framework region.

[0054] As used herein, the term "human antibody" is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the application can include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).

[0055] In one embodiment, the present application provides an antibody or antigen-binding fragment thereof targeting ROR1, comprising:

[0056] (1) CDR-L1 as shown in SEQ ID NO: 1, CDR-L2 as shown in SEQ ID NO: 2, CDR-L3 as shown in SEQ ID NO: 3, CDR-H1 as shown in SEQ ID NO: 4, CDR-H2 as shown in SEQ ID NO: 5, and CDR-H3 as shown in SEQ ID NO: 6;

[0057] (2) CDR-L1 as shown in SEQ ID NO: 1, CDR-L2 as shown in SEQ ID NO: 2, CDR-L3 as shown in SEQ ID NO: 7, CDR-H1 as shown in SEQ ID NO: 4, CDR-H2 as shown in SEQ ID NO: 8, and CDR-H3 as shown in SEQ ID NO: 9;

[0058] (3) CDR-L1 as depicted in SEQ ID NO: 10, CDR-L2 as depicted in SEQ ID NO: 11, CDR-L3 as depicted in SEQ ID NO: 12, CDR-H1 as depicted in SEQ ID NO: 13, CDR-H2 as depicted in SEQ ID NO: 14, and CDR-H3 as depicted in SEQ ID NO: 15;

[0059] (4) CDR-L1 as depicted in SEQ ID NO: 16, CDR-L2 as depicted in SEQ ID NO: 17, CDR-L3 as depicted in SEQ ID NO: 18, CDR-H1 as depicted in SEQ ID NO: 19, CDR-H2 as depicted in SEQ ID NO: 20, and CDR-H3 as depicted in SEQ ID NO: 21; or

[0060] (5) CDR-L1 as depicted in SEQ ID NO: 1, CDR-L2 as depicted in SEQ ID NO: 22, CDR-L3 as depicted in SEQ ID NO: 7, CDR-H1 as depicted in SEQ ID NO: 4, CDR-H2 as depicted in SEQ ID NO: 5, and CDR-H3 as depicted in SEQ ID NO: 23.

[0061] In one embodiment, the antibody or antigen-binding fragment thereof of the application comprises a heavy chain variable region that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to, or has one or a few (e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) modifications as compared to, the amino acid sequence selected from the group consisting of SEQ ID NO: 25, 28, 31, 34, 37, 69, 73, 77, 81, 85, 89, and 93; and a light chain variable region that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to, or has one or a few (e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) modifications as compared to, the amino acid sequence selected from the group consisting of SEQ ID NO: 24, 27, 30, 33, 36, 68, 72, 76, 80, 84, 88, and 92. Preferably, the modifications are conservative modifications, e.g. conservative substitutions, additions and deletions of amino acids. In a preferred embodiment, the antibody or antigen-binding fragment thereof of the application comprises a heavy chain variable region selected from the group consisting of SEQ ID NO: 25, 28, 31, 34, 37, 69, 73, 77, 81, 85, 89, and 93 and a light chain variable region selected from the group consisting of SEQ ID NO: 24, 27, 30, 33, 36, 68, 72, 76, 80, 84, 88, and 92. In one embodiment, the antibody or antigen-binding fragment thereof of the application comprises a heavy chain variable region and a light chain variable region selected from the group consisting of:

[0062] (a) a heavy chain variable region as depicted in SEQ ID NO: 25 and a light chain variable region as depicted in SEQ ID NO: 24;

[0063] (b) a heavy chain variable region as depicted in SEQ ID NO: 28 and a light chain variable region as depicted in SEQ ID NO: 27;

[0064] (c) a heavy chain variable region as depicted in SEQ ID NO: 31 and a light chain variable region as depicted in SEQ ID NO: 30;

[0065] (d) a heavy chain variable region as depicted in SEQ ID NO: 34 and a light chain variable region as depicted in SEQ ID NO: 33; and

[0066] (e) a heavy chain variable region as depicted in SEQ ID NO: 37 and a light chain variable region as depicted in SEQ ID NO: 36;

[0067] (f) a heavy chain variable region as depicted in SEQ ID NO: 69 and a light chain variable region as depicted in SEQ ID NO: 68;

[0068] (g) a heavy chain variable region as depicted in SEQ ID NO: 73 and a light chain variable region as depicted in SEQ ID NO: 72;

[0069] (h) a heavy chain variable region as depicted in SEQ ID NO: 77 and a light chain variable region as depicted in SEQ ID NO: 76;

[0070] (i) a heavy chain variable region as depicted in SEQ ID NO: 81 and a light chain variable region as depicted in SEQ ID NO: 80;

[0071] (j) a heavy chain variable region as depicted in SEQ ID NO: 85 and a light chain variable region as depicted in SEQ ID NO: 84;

[0072] (k) a heavy chain variable region as depicted in SEQ ID NO: 89 and a light chain variable region as depicted in SEQ ID NO: 88;

[0073] (l) a heavy chain variable region as depicted in SEQ ID NO: 93 and a light chain variable region as depicted in SEQ ID NO: 92.

[0074] Optionally, the heavy chain variable region and light chain variable region have at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the heavy chain variable region and light chain variable region of any one of groups (a)-(l);

[0075] Optionally, the heavy chain variable region and light chain variable region have one or several modifications of amino acids, e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modifications of amino acids, from the heavy chain variable region and light chain variable region of any one of groups (a)-(l); preferably, the modifications are conservative modifications, e.g. conservative substitutions, additions, and deletions of amino acids.

[0076] In one embodiment, the antibody or antigen-binding fragment thereof of the application has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 26, 29, 32, 35, 38, 70, 74, 78, 82, 86, 90, and 94, or has one or several modifications of amino acids, for example a modification of up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, compared to an amino acid sequence selected from the group consisting of SEQ ID NO: 26, 29, 32, 35, 38, 70, 74, 78, 82, 86, 90, and 94. Preferably, the modifications are conservative modifications, for example conservative substitutions, additions and deletions of amino acids. Preferably, the amino acid sequence of the antibody or antigen-binding fragment thereof of the application is selected from the group consisting of SEQ ID NO: 26, 29, 32, 35, 38, 70, 74, 78, 82, 86, 90, and 94.

[0077] As used herein, the term "conservative modification" refers to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody or antibody fragment containing the amino acid sequence. These conservative modifications include conservative substitutions, additions and deletions of amino acids. Modifications can be introduced into the chimeric antigen receptor of the application by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are substitutions of an amino acid residue by another amino acid residue having similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Conservative modifications can be selected, for example, based on similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the involved residues.

[0078] As used herein, the term "sequence 'identity'" means the extent to which two (nucleotide or amino acid) sequences have the same residues at a given position in an alignment, and is usually expressed as a percentage. Preferably, identity is determined over the entire length of the sequences being compared. Thus, two copies of a sequence that are identical have 100% identity. Those skilled in the art know that sequence identity can be determined using a number of algorithms, such as Blast (Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402), Blast2 (Altschul et al. (1990) J. Mol. Biol. 215:403-410), Smith-Waterman (Smith et al. (1981) J. Mol. Biol. 147:195-197) and ClustalW.

[0079] In one aspect, the present application also provides a multispecific antibody (preferably a bispecific antibody or a trispecific antibody) comprising an anti-ROR1 antibody or antigen binding fragment thereof as described above, which further comprises one or more second antibodies that specifically bind to other antigens.

[0080] As used herein, the term "multispecific" means that the antigen binding protein has polyepitopic specificity (i.e., is capable of specifically binding to two, three or more different epitopes on one biological molecule or is capable of specifically binding to epitopes on two, three or more different biological molecules). As used herein, the term "bispecific" means that the antigen binding protein has two different antigen binding specificities.

[0081] In one embodiment, the second antibody can be in any antibody or antibody fragment format, such as a full-length antibody, Fab, Fab', (Fab')2, Fv, scFv, scFv-scFv, minibody, diabody or sdAb.

[0082] Thus, in one embodiment, the second antibody targets an antigen selected from the group consisting of BCMA, CD4, CD5, CD7, CD8, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD80, CD126, CD138, B7, MUC-1, la, HM1.24, HLA-DR, tenascin, angiogenic factors, VEGF, PIGF, ED-B fibronectin, an oncoprotein, an oncoprotein product, CD66a-d, a necrosis antigen, Ii, IL-2, T101, TAC, IL-6, DR4, DR5, tEGFR, Her2, L1-CAM, mesothelin, CEA, hepatitis B surface antigen, anti-folate receptor, CD24, CD30, CD44, EGFR, EGP-2, EGP-4, EPHA2, ErbB2, ErbB3, ErbB4, ErbB dimers, EGFRvIII, FBP, FCRL5, FCRH5, fetal acetylcholine receptor, GD2, GD3, GPRC5D, HMW-MAA, IL-22R-alpha, IL-13R-alpha2, kdr, kappa light chain, Lewis Y, L1-CAM, MAGE-A1, MAGE-A3, MAGE-A6, PRAME, survivin, EGP2, EGP40, TAG72, B7-H6, IL-13Ra2, CA9, CD171, G250 / CAIX, HLA-A1, HLA-A2, NY-ESO-1, PSCA, folate receptor-a, CD44v6, CD44v7 / 8, avb6 integrin, 8H9, NCAM, VEGF receptors, 5T4, fetal AchR, NKG2D ligands, dual antigens, antigens associated with universal tags, cancer-testis antigens, MUC1, MUC16, NY-ESO-1, MART-1, gp100, carcinoembryonic antigen, VEGF-R2, CEA, prostate specific antigen, PSMA, Her2 / neu, estrogen receptor, progesterone receptor, ephrinB2, CD123, c-Met, GD-2, OGD2, CE7, WT-1, cyclin A2, CCL-1, hTERT, MDM2, CYP1B, WT1, IL-7, AFP, p53, cyclin (D1), CS-1, BAFF-R, TACI, CD56, TIM-3, CD123, L1-cell adhesion molecule, cyclins (such as cyclin Al (CCNA1)), and / or pathogen specific antigens, biotinylated molecules, molecules expressed by HIV, HCV, HBV, and / or other pathogens; and / or neoepitopes or neoantigens.

[0083] Nucleic acids, vectors, host cells

[0084] In another aspect, the present application relates to nucleic acid molecules encoding the anti-ROR1 antibodies or multispecific antibodies of the present application. The nucleic acids of the present application can be RNA, DNA or cDNA. According to one embodiment of the present application, the nucleic acids of the present application are substantially isolated nucleic acids.

[0085] In one embodiment, the nucleic acid molecule encoding the anti-ROR1 antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 39-43, 71, 75, 78, 83, 87, 91 and 95 and which encodes an anti-ROR1 antibody that is capable of specifically binding to ROR1 (i.e. which does not bind to non-target antigens to a significant extent). Preferably, the nucleic acid molecule encoding the anti-ROR1 antibody is selected from the group consisting of SEQ ID NOs: 39-43, 71, 75, 78, 83, 87, 91 and 95.

[0086] The nucleic acids of the present application can also be in the form of, can be present in and / or can be part of a vector, such as a plasmid, cosmid or YAC. The vector can in particular be an expression vector, i.e. a vector which provides for the expression of the ROR1 antibody in vitro and / or in vivo, i.e. in a suitable host cell, host organism and / or expression system. Such an expression vector typically comprises at least one nucleic acid molecule of the present application operably linked to one or more suitable expression control elements (e.g. promoters, enhancers, terminators etc.). The selection of the control elements and their sequences for expression in a particular host is well known to the person skilled in the art. Particular examples of control elements and other elements useful or necessary for the expression of the ROR1 antibodies of the present application include, but are not limited to, promoters, enhancers, terminators, integration factors, selection markers, leader sequences, reporter genes.

[0087] In another aspect, the present application also provides host cells expressing the ROR1 antibodies, multispecific antibodies of the present application and / or containing the nucleic acids or vectors of the present application. Preferred host cells of the present application are bacterial cells, fungal cells or mammalian cells.

[0088] Suitable bacterial cells include cells of Gram-negative bacterial strains (e.g. Escherichia coli strains, Proteus strains and Pseudomonas strains) and Gram-positive bacterial strains (e.g. Bacillus strains, Streptomyces strains, Staphylococcus strains and Lactococcus strains).

[0089] Suitable fungal cells include cells of species of Trichoderma, Neurospora, and Aspergillus; or of species of Saccharomyces (e.g., Saccharomyces cerevisiae), Schizosaccharomyces (e.g., Schizosaccharomyces pombe), Pichia (e.g., Pichia pastoris and Pichia methanolica), and Hansenula.

[0090] Suitable mammalian cells include, for example, HEK293 cells, CHO cells, BHK cells, HeLa cells, COS cells, and the like.

[0091] However, the present application can also use amphibian cells, insect cells, plant cells, and any other cells used in the art for expressing heterologous proteins.

[0092] Recombinant receptors

[0093] In another aspect, the present application also provides a recombinant receptor comprising an anti-RORl antibody as described above, such as a T cell fusion protein, a T cell antigen coupler, a recombinant TCR receptor, or a chimeric antigen receptor. Preferably, the present application also provides a chimeric antigen receptor comprising an anti-RORl antibody as described above.

[0094] As used herein, the term "T cell fusion protein" or "TFP" refers to a recombinant polypeptide derived from each component of TCR, usually consisting of TCR subunit and antibody connected therewith and expressed on cell surface. Among them, the TCR subunit includes at least part of TCR extracellular domain, transmembrane domain, TCR intracellular signal domain.

[0095] As used herein, the term "T cell antigen coupler" or "TAC" comprises three functional domains: 1 a tumor targeting domain comprising a single chain antibody (e.g., an anti-RORl antibody of the present application), a designed ankyrin repeat protein (DARPin), or other targeting moiety; 2 an extracellular domain, a single chain antibody that binds to CD3, thereby bringing the TAC receptor into close proximity with the TCR receptor; and 3 a transmembrane domain and intracellular domain of a CD4 co-receptor, wherein the intracellular domain links the protein kinase LCK, which catalyzes phosphorylation of the immunoreceptor tyrosine activation motif (ITAM) of the TCR complex as an initial step in T cell activation.

[0096] As used herein, the term "T cell receptor" or "TCR" is a characteristic marker on the surface of T cells that forms a complex with CD3 in non-covalent linkage. Antigen presenting cells present antigenic peptides to T cells via major histocompatibility complex molecules (MHC) and bind to the TCR complex to induce a series of intracellular signaling. The TCR is composed of six peptide chains that form heterodimers, generally classified as αβ and γδ types. Each peptide chain includes a constant region and a variable region, with the variable region responsible for binding specific antigen and MHC molecules.

[0097] As used herein, the term "chimeric antigen receptor" or "CAR" refers to a hybrid polypeptide artificially constructed that generally includes a ligand binding domain (e.g., an antigen binding portion of an antibody), a transmembrane domain, an optional co-stimulatory domain, and an intracellular signaling domain, each connected by a linker. CARs are able to redirect the specificity and reactivity of T cells and other immune cells to a selected target in a non-MHC restricted manner, taking advantage of the antigen binding properties of antibodies.

[0098] In one embodiment, the present application provides a chimeric antigen receptor comprising an anti-RORl antibody or antigen binding fragment thereof as described above or a multispecific antibody containing the anti-RORl antibody, a transmembrane domain, and an intracellular signaling domain.

[0099] As used herein, the term "transmembrane domain" refers to a polypeptide structure that enables expression of a chimeric antigen receptor on the surface of an immune cell (e.g., a lymphocyte, NK cell, or NKT cell) and directs a cellular response of the immune cell against a target cell. The transmembrane domain can be natural or synthetic and can be derived from any membrane-bound or transmembrane protein. The transmembrane domain is capable of signaling when the chimeric antigen receptor binds to a target antigen. Particularly suitable transmembrane domains for use in the present application can be derived from, for example, TCRa chain, TCRP chain, TCRy chain, TCR5 chain, CD3y subunit, CD3e subunit, CD3y subunit, CD3d subunit, CD45, CD4, CD5, CD8a, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, CD154, and functional fragments thereof. Alternatively, the transmembrane domain can be synthetic and can comprise predominantly hydrophobic residues such as leucine and valine. Preferably, the transmembrane domain is derived from a CD8a chain or CD28 having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 44 or 46, or a coding sequence thereof having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 45 or 47.

[0100] As used herein, the term "intracellular signaling domain" refers to the portion of a protein that transduces a signal of an effector function and directs the cell to perform a specified function. In one embodiment, the intracellular signaling domain comprised by the chimeric antigen receptors of the present application can be the intracellular region sequences of T cell receptors and co-receptors that act in concert to initiate signaling upon antigen receptor engagement, as well as any derivative or variant of these sequences and any synthetic sequence with the same or similar function. The intracellular signaling domain can comprise a number of Immunoreceptor Tyrosine-based Activation Motifs (ITAMs). Non-limiting examples of intracellular signaling domains of the present application include, but are not limited to, the intracellular regions of FcRy, FcRP, CD3y, CD35, CD3s, CD3z, CD22, CD79a, CD79b, and CD66d, etc. In a preferred embodiment, the signaling domain of the CARs of the present application can comprise a CD3z intracellular region having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 52 or 54, or a coding sequence having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 53 or 55.

[0101] In one embodiment, the chimeric antigen receptor of the application can further comprise a hinge region between the antibody and the transmembrane domain. As used herein, the term "hinge region" generally refers to any oligo- or polypeptide that functions to link the transmembrane domain to the antibody. In particular, the hinge region serves to provide greater flexibility and accessibility to the antibody. The hinge region can comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. The hinge region can be derived in whole or in part from a natural molecule, such as the extracellular region of CD8, CD4 or CD28 in whole or in part, or from an antibody constant region in whole or in part. Alternatively, the hinge region can be a synthetic sequence corresponding to a naturally occurring hinge sequence, or can be a completely synthetic hinge sequence. In preferred embodiments, the hinge region comprises a hinge region portion of CD8a, CD28, FcyRIIIa receptor, IgG4 or IgGl, more preferably a CD8a, CD28 or IgG4 hinge having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 60, 62 or 64, or a coding sequence having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 61, 63 or 65.

[0102] In one embodiment, the chimeric antigen receptor can further comprise one or more costimulatory domains. The costimulatory domain can be an intracellular functional signaling domain from a costimulatory molecule, which comprises the entire intracellular portion of the costimulatory molecule, or a functional fragment thereof. A "costimulatory molecule" refers to a cognate binding partner that specifically binds with a costimulatory ligand on a T cell, thereby mediating a costimulatory response (e.g., proliferation) of the T cell. Costimulatory molecules include, but are not limited to, MHC class 1 molecules, BTLA, and Toll ligand receptors. Non-limiting examples of costimulatory domains of the present application include, but are not limited to, costimulatory signaling domains derived from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, ROR1, CD8, CD18 (LFA-1), CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD270 (HVEM), CD272 (BTLA), CD276 (B7-H3), CD278 (ICOS), CD357 (GITR), DAP10, LAT, NKG2C, SLP76, PD-1, LIGHT, TRIM, and ZAP70. Preferably, the costimulatory domain of the CAR of the present application is from 4-1BB, CD28, or 4-1BB+CD28. In one embodiment, the 4-1BB costimulatory domain has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity with the amino acid sequence set forth in SEQ ID NO: 50, or a coding sequence thereof has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity with the nucleic acid molecule set forth in SEQ ID NO: 51. In one embodiment, the CD28 costimulatory domain has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity with the amino acid sequence set forth in SEQ ID NO: 48, or a coding sequence thereof has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity with the nucleic acid molecule set forth in SEQ ID NO: 49.

[0103] In one embodiment, the CAR of the application can further comprise a signal peptide, such that when it is expressed in a cell, e.g., a T cell, the nascent protein is directed to the endoplasmic reticulum and subsequently to the cell surface. The core of the signal peptide can contain a long hydrophobic stretch of amino acids with a tendency to form a single a-helix. At the end of the signal peptide, there is usually a stretch of amino acids that is recognized and cleaved by a signal peptidase. The signal peptidase can cleave during or after translocation to produce a free signal peptide and a mature protein. The free signal peptide is then digested by specific proteases. Signal peptides useful in the application are well known to those skilled in the art, e.g., signal peptides derived from B2M, CD8a, IgGl, GM-CSFRa, etc. In one embodiment, the signal peptide useful in the application is from B2M or CD8a having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 56 or 58, or a coding sequence thereof having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 57 or 59.

[0104] In one embodiment, the CAR contains an anti-RORl antibody or antigen-binding fragment thereof as provided herein or a multi-specific antibody containing the anti-RORl antibody, a CD8a or CD28 transmembrane region, a CD28 and / or 4-1BB costimulatory domain, and a CD3 zeta intracellular signaling domain. In this embodiment, the CAR can further comprise a signal peptide from B2M, CD8a, IgGl, or GM-CSFRa.

[0105] The application also provides nucleic acid molecules encoding a chimeric antigen receptor targeting ROR1 as defined above, as well as vectors comprising said nucleic acid molecules.

[0106] As used herein, the term "vector" is a nucleic acid molecule that serves as a vehicle for transfer of (exogenous) genetic material into a host cell, where it can, for example, replicate and / or be expressed. Vectors generally include targeting vectors and expression vectors. A "targeting vector" is a vehicle for delivery of an isolated nucleic acid to the interior of a cell, for example, by homologous recombination or using a hybrid recombinase enzyme that is specific for sequences at a target site. An "expression vector" is a vehicle for the transcription of a heterologous nucleic acid sequence (such as those encoding the chimeric antigen receptor polypeptides of the application) in a suitable host cell, and the translation of their mRNA. Suitable vectors useful in the application are known in the art, and many are commercially available. In one embodiment, vectors of the application include, but are not limited to, plasmids, viruses (such as retroviruses, lentiviruses, adenoviruses, vaccinia viruses, Rous sarcoma virus (RSV, polyoma virus, and adeno-associated virus (AAV), etc.), bacteriophages, phagemids, cosmids, and artificial chromosomes (including BACs and YACs). Vectors themselves are generally nucleic acid molecules, typically DNA sequences comprising an insert (transgene) and a larger sequence that serves as the "backbone" of the vector. Engineered vectors often also contain an origin of replication for autonomous replication in a host cell (if stable expression of the polynucleotide is desired), a selection marker, and restriction enzyme cleavage sites (such as a multiple cloning site, MCS). Vectors can additionally contain elements such as promoters, polyadenylation tails (polyA), 3'UTRs, enhancers, terminators, insulators, operators, selection markers, reporter genes, targeting sequences, and / or protein purification tags. In a specific embodiment, the vector is an in vitro transcribed vector.

[0107] Engineered immune cells

[0108] In one aspect, the application also provides engineered immune cells expressing a recombinant receptor described herein, such as a T cell fusion protein, a T cell antigen coupler, a recombinant TCR receptor, or a chimeric antigen receptor.

[0109] As used herein, the term "immune cell" refers to any cell of the immune system having one or more effector functions (e.g., cytotoxic cell killing activity, secretion of cytokines, induction of ADCC and / or CDC). For example, an immune cell can be a T cell, a macrophage, a dendritic cell, a monocyte, an NK cell, and / or an NKT cell. In one embodiment, an immune cell is derived from a stem cell, such as an adult stem cell, an embryonic stem cell, a cord blood stem cell, a progenitor cell, a bone marrow stem cell, an induced pluripotent stem cell, a totipotent stem cell, or a hematopoietic stem cell, etc. Preferably, an immune cell is a T cell. A T cell can be any T cell, such as a T cell cultured in vitro, e.g., a primary T cell, or a T cell from a T cell line cultured in vitro, e.g., Jurkat, SupTl, etc., or a T cell obtained from a subject. Examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof. T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. T cells can also be concentrated or purified. T cells can be at any stage of development, including but not limited to, CD4+ / CD8+ T cells, CD4+ helper T cells (e.g., Thl and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), tumor infiltrating cells, memory T cells, naive T cells, gamma delta-T cells, alpha beta-T cells, etc. In a preferred embodiment, an immune cell is a human T cell. T cells can be obtained from the blood of a subject using a variety of techniques known to those of skill in the art, such as Ficoll separation.

[0110] Nucleic acid sequences encoding chimeric antigen receptors can be introduced into immune cells using conventional methods known in the art (e.g., by transduction, transfection, transformation, etc.). “Transfection” is the process of introducing a nucleic acid molecule or polynucleotide (including a vector) into a target cell. One example is RNA transfection, i.e., the process of introducing RNA (such as in vitro transcribed RNA, ivtRNA) into a host cell. The term is used primarily for non-viral methods in eukaryotic cells. The term “transduction” is generally used to describe viral-mediated transfer of nucleic acid molecules or polynucleotides. Transfection of animal cells typically involves opening transient pores or “holes” in the cell membrane to allow uptake of material. Transfection can be performed using calcium phosphate, by electroporation, by cell squeezing, or by mixing cationic lipids with the material to produce liposomes that fuse with the cell membrane and deposit their cargo into the interior. Exemplary techniques for transfecting eukaryotic host cells include liposome vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (calcium phosphate / DNA co-precipitation), microinjection, and electroporation. The term “transformation” is used to describe non-viral transfer of nucleic acid molecules or polynucleotides (including vectors) into bacteria, and also into non-animal eukaryotic cells, including plant cells. Thus, transformation is a genetic alteration of a bacterium or non-animal eukaryotic cell that results from direct uptake of exogenous genetic material (nucleic acid molecules) from its surroundings through the cell membrane and subsequent incorporation into the genome. Transformation can be achieved by artificial means. In order for transformation to occur, the cell or bacterium must be in a state of competence. For prokaryotic transformation, techniques can include heat shock-mediated uptake, fusion with intact cells of bacterial protoplasts, microinjection, and electroporation. After introducing nucleic acids or vectors into immune cells, the resulting immune cells can be expanded and activated by routine techniques by those of skill in the art.

[0111] In one embodiment, to reduce the risk of graft versus host disease, the engineered immune cell further comprises at least one gene selected from the group consisting of CD52, GR, dCK, TCR / CD3 genes (e.g. TRAC, TRBC, CD3y, CD35, CD3s, CD3z), MHC-related genes (HLA-A, HLA-B, HLA-C, B2M, HLA-DPA, HLA-DQ, HLA-DRA, TAP1, TAP2, LMP2, LMP7, RFX5, RFXAP, RFXANK, CIITA) and immune checkpoint genes such as PD1, LAG3, TIM3, CTLA4, PPP2CA, PPP2CB, PTPN6, PTPN22, PDCD1, HAVCR2, BTLA, CD160, TIGIT, CD96, CRTAM, TNFRSF10B, TNFRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, FAS, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT, FOXP3, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2 and GUCY1B3. Preferably, the engineered immune cell further comprises at least one gene selected from the group consisting of TRAC, TRBC, HLA-A, HLA-B, HLA-C, B2M, RFX5, RFXAP, RFXANK, CIITA, PD1, LAG3, TIM3, CTLA4, more preferably TRAC, TRBC, HLA-A, HLA-B, HLA-C, B2M, RFX5, RFXAP, RFXANK, CIITA.

[0112] Methods to inhibit gene expression or to silence a gene are well known to the person skilled in the art. For example, antisense RNA, RNA decoy, RNA aptamer, siRNA, shRNA / miRNA, trans dominant negative protein (TNP), chimeric / antibody conjugate, chemokine ligand, anti-infectious cellular protein, intracellular antibody (sFv), nucleoside analog (NRTI), non-nucleoside analog (NNRTI), integrase inhibitor (oligonucleotide, dinucleotide and chemical agent) and protease inhibitor can be used to inhibit the expression of a gene. In addition, a gene can also be silenced by, for example, DNA breakage mediated by meganucleases, zinc finger nucleases, TALE nucleases or Cas enzymes in the CRISPR system.

[0113] In one embodiment, the engineered immune cell further comprises a second chimeric antigen receptor targeting other tumor antigens. The other tumor antigens targeted by the second chimeric antigen receptor can be selected from, for example, BCMA, CD4, CD5, CD7, CD8, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD33, CD37, CD38, CD40, CD40L, CD46, CD52, CD54, CD80, CD126, CD138, B7, MUC-1, HM1.24, Angio- genic factors, VEGF, PIGF, ED-B fibronectin, CD66a-d, IL-2, T101, TAC, IL-6, DR4, DR5, tEGFR, Her2, L1-CAM, Mesothelin, CEA, Hepatitis B surface antigen, Anti-folate receptor, CD24, CD30, CD44, EGFR, EGP-2, EGP-4, EPHA2, ErbB2, ErbB3, ErbB4, ErbB dimers, EGFR vIII, FBP, FCRL5, FCRH5, Fetal acetylcholine receptor, GD2, GD3, GPRC5D, HMW-MAA, IL-22R-alpha, IL-13R-alpha2, Kappa light chain, Lewis Y, L1-CAM, MAGE-A1, MAGE-A3, MAGE-A6, PRAME, Survivin, EGP2, EGP40, TAG72, B7-H6, IL-13Ra2, CA9, CD171, G250 / CAIX, HLA-A1, HLA-A2, NY-ESO-1, PSCA, Folate receptor-alpha, CD44v6, CD44v7 / 8, avb6 integrin, 8H9, NCAM, VEGF receptors, 5T4, Fetal AchR, MUC1, MUC16, NY-ESO-1, MART-1, gp100, Carcinoembryonic antigen, VEGF-R2, CEA, Prostate specific antigen, PSMA, Her2 / neu, Estrogen receptor, Progesterone receptor, ephrinB2, CD123, c-Met, GD-2, O-acetylated GD2 (OGD2), CE7, WT-1, Cyclin A2, CCL-1, hTERT, MDM2, CYP1B, WT1, IL-7, AFP, p53, D1, CS-1, BAFF-R, TACI, CD56, TIM-3, CD123, L1-cell adhesion molecule, MAGE-A1, MAGEA3, CCNA1, and / or pathogen specific antigens, biotinylated molecules, molecules expressed by HIV, HCV, HBV, and / or other pathogens.

[0114] In one embodiment, a plurality of immune cells is provided, each of which is engineered to express one or more chimeric antigen receptors. For example, in some embodiments, one immune cell is engineered to express a chimeric antigen receptor that binds and / or targets ROR1 (e.g., a CAR comprising an anti-RORl antibody described herein), and another cell is engineered to express a chimeric antigen receptor that binds and / or targets another antigen. In one embodiment, the immune cells can also express a multi-specific chimeric antigen receptor that targets one or more antigens, including ROR1. For example, such a multi-specific chimeric antigen receptor can comprise a multi-specific antibody that targets ROR1, or both an anti-RORl antibody described herein and an antibody that targets another antigen. In such embodiments, the plurality of engineered immune cells can be administered together or separately. In one embodiment, the plurality of immune cells can be in the same composition or in different compositions. Exemplary compositions of cells include those described in the following sections of this application.

[0115] Antibody conjugates

[0116] In one aspect, the present application provides an antibody conjugate comprising an anti-RORl antibody as defined herein and a second functional moiety, wherein the second functional moiety is selected from the group consisting of an Fc, a radioisotope, a half-life extending moiety, a detectable label, and a drug.

[0117] In one embodiment, the present application provides an antibody conjugate comprising an anti-RORl antibody as defined herein and an Fc. As used herein, the term "Fc" is used to define the C-terminal region of an immunoglobulin heavy chain, which includes native Fc and variant Fc. "Native Fc" refers to a molecule or sequence comprising a non-antigen binding fragment produced by digestion of an intact antibody, whether in monomeric form or in multimeric form. The immunoglobulin source from which the native Fc is produced is preferably derived from a human. Native Fc fragments are composed of monomeric polypeptides that can be linked into dimeric or multimeric form by covalent (e.g., disulfide bonds) and noncovalent linkages. Depending on the class (e.g., IgG, IgA, IgE, IgD, IgM) or subclass (e.g., IgGl, IgG2, IgG3, IgAl, IgGA2) of the molecule, there are 1-4 intermolecular disulfide bonds between the monomeric subunits of the native Fc molecule. One example of a native Fc is a disulfide-linked dimer produced by digestion of IgG with papain (see Ellison et al. (1982), Nucleic Acids Res. 10:4071-9). The term "native Fc" as used herein refers generally to monomeric, dimeric, and multimeric forms. "Variant Fc" refers to an amino acid sequence that differs from the amino acid sequence of a "native" or "wild type" Fc due to at least one "amino acid modification" as defined herein, also referred to as "Fc variant". Thus, "Fc" also includes single chain Fc (scFc), i.e., a single chain Fc composed of two Fc monomers connected by a polypeptide linker, which is capable of folding into a functional dimeric Fc region naturally. In one embodiment, the Fc is preferably an Fc of a human immunoglobulin, more preferably an Fc of human IgGl.

[0118] In one embodiment, the present application provides an antibody conjugate comprising an anti-RORl antibody as defined herein and a radioisotope. Examples of radioisotopes useful in the present application include, but are not limited to, At 211 , I 131 , I 125 , Y 90 , Re 186 , Re 188 , Sm 153 , Bi 212 , P 32 , Pb 212 , 99m Tc, 123 I, 18 F and 68 Ga.

[0119] In one embodiment, the present application provides an antibody conjugate comprising an anti-ROR1 antibody as defined by the present application and a half-life extending moiety selected from the group consisting of a binding structure of albumin, a binding structure of transferrin, a polyethylene glycol molecule, a recombinant polyethylene glycol molecule, human serum albumin, a fragment of human serum albumin and a white polypeptide (including an antibody) that binds human serum albumin.

[0120] In one embodiment, the present application provides an antibody conjugate comprising an anti-ROR1 antibody as defined by the present application and a detectable label. The term "detectable label" means herein a compound that generates a detectable signal. For example, the detectable label can be an MRI contrast agent, a scintigraphic contrast agent, an X-ray imaging contrast agent, an ultrasound contrast agent, an optical imaging contrast agent. Examples of detectable labels include fluorophores (such as fluorescein, Alexa or cyanine), chemiluminescent compounds (such as luminol), bioluminescent compounds (such as luciferase or alkaline phosphatase), enzymes (such as horseradish peroxidase, glucose-6-phosphatase, beta-galactosidase), antibiotic (e.g. kanamycin, ampicillin, chloramphenicol, tetracycline, etc.) resistance genes and contrast agents (such as nanoparticles or gadolinium). The skilled person can select a suitable detectable label depending on the detection system used.

[0121] In one embodiment, the present application provides an antibody conjugate comprising an anti-RORl antibody as defined herein and a drug, e.g., a cytotoxin or an immunomodulatory agent, coupled to the anti-RORl antibody (i.e., an antibody drug conjugate). Typically the drug is linked to the antibody covalently, and often depends on a linker. In one embodiment, the drug is a cytotoxin. In another embodiment, the drug is an immunomodulatory agent. Examples of cytotoxins include, but are not limited to, methotrexate, aminopterin, 6-mercaptopurine, 6-thioguanine, cytosine arabinoside, 5-fluorouracil, dacarbazine, mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), 1-methyl- l-nitrosourea, cyclophosphamide, nitrogen mustard, busulfan, dibromomannitol, streptozotocin, mitomycin, cis-dichlorodiamine platinum (II) (DDP), cisplatin, carboplatin, daunombicin, doxorubicin, detorubicin, carminomycin, idarubicin, epirubicin, mitoxantrone, dactinomycin, bleomycin, calicheamicin, duocarmycin, anthramycin (AMC), vincristine, vinblastine, paclitaxel, ricin, pseudomonas exotoxin, gemcitabine, cytochalasin B, gramicidin D, ethidium bromide, emetine, etoposide, teniposide, colchicin, dihydroxy anthracin dione, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, procarbazine, hydroxyurea, asparaginase, corticosteroids, mitotane (O, P'-(DDD)), interferons, and combinations thereof. Examples of immunomodulatory agents include, but are not limited to, ganciclovir, etanercept, tacrolimus, sirolimus, voclosporin, cyclosporin, rapamycin, cyclophosphamide, azathioprine, mycophenolate mofetil, methotrexate, glucocorticoids and analogs thereof, cytokines, stem cell growth factors, lymphotoxin, tumor necrosis factor (TNF), hematopoietic factors, interleukins (e.g., IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, and IL-21), colony stimulating factors (e.g., G-CSF and GM-CSF), interferons (e.g., interferon-alpha, interferon-beta, and interferon-gamma), stem cell growth factor named "S1 factor", erythropoietin, and thrombopoietin, or combinations thereof.

[0122] Kits and pharmaceutical compositions

[0123] In another aspect, the present application also provides a detection kit comprising the humanized antibody, multispecific antibody, antibody conjugate, engineered immune cell, or chimeric antigen receptor of the present application.

[0124] In another aspect, the present application also provides a pharmaceutical composition comprising the humanized antibody, chimeric antigen receptor, multispecific antibody, engineered immune cell or antibody conjugate of the present application, and one or more pharmaceutically acceptable excipients.

[0125] As used herein, the term "pharmaceutically acceptable excipient" refers to a carrier and / or excipient that is compatible, in pharmacology and / or physiology, with the subject and the active ingredient (i.e., capable of eliciting the desired therapeutic effect without causing any undesirable local or systemic effects) and is well known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995). Examples of pharmaceutically acceptable excipients include, but are not limited to, fillers, binders, disintegrants, coating agents, adsorbents, antiadherents, glidants, antioxidants, flavoring agents, coloring agents, sweetening agents, solvents, cosolvents, buffers, chelating agents, surfactants, diluents, wetting agents, preservatives, emulsifiers, encapsulating agents, isotonic agents, absorption delaying agents, stabilizers, and tonicity adjusting agents. The selection of a suitable excipient to prepare the desired pharmaceutical composition of the present application is known to one skilled in the art. Exemplary excipients for use in the pharmaceutical compositions of the present application include saline, buffered saline, dextrose, and water. Generally, the selection of a suitable excipient depends, inter alia, on the active agent used, the disease to be treated, and the desired dosage form of the pharmaceutical composition.

[0126] The pharmaceutical composition according to the present application can be suitable for administration via a variety of routes. Typically, administration is accomplished parenterally. Parenteral delivery methods include topical, intra-arterial, intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, intrauterine, intravaginal, sublingual, or intranasal administration.

[0127] The pharmaceutical composition according to the present application can also be prepared in various forms, such as solid, liquid, gaseous or lyophilized forms, in particular in the form of an ointment, cream, transdermal patch, gel, powder, tablet, solution, aerosol, granule, pill, suspension, emulsion, capsule, syrup, elixir, extract, tincture or fluid extract, or in a form particularly suitable for the desired method of administration. Processes known in the art for the production of medicaments can include, for example, conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. The pharmaceutical composition comprising, for example, the immune cells described herein is typically provided in solution form, and preferably comprises a pharmaceutically acceptable buffer.

[0128] The pharmaceutical compositions according to the invention can also be administered in combination with one or more other pharmaceutical agents suitable for treating and / or preventing the disease to be treated. Preferred examples of pharmaceutical agents suitable for combination include known anticancer drugs, such as cisplatin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, sorfimer sodium photofrin II, temozolomide, topotecan, trimetreate glucuronate, and orlistatine E. E) vincristine and doxorubicin; peptide cytotoxins, such as ricin, diphtheria toxin, Pseudomonas aeruginosa exotoxin A, DNases and RNases; radionuclides, such as iodine-131, rhenium-186, indium-111, iridium-90, bismuth-210 and 213, actinium-225 and astatine-213; prodrugs, such as antibody-directed enzyme prodrugs; immunostimulants, such as platelet factor 4, melanoma growth stimulating protein, etc.; antibodies or fragments thereof, such as anti-CD3 antibodies or fragments thereof, complement activators, heterologous protein domains, homologous protein domains, viral / bacterial protein domains, and viral / bacterial peptides. Furthermore, the pharmaceutical compositions of the present invention can also be used in combination with one or more other treatment methods, such as chemotherapy and radiotherapy.

[0129] Therapeutic / prophylactic / diagnostic uses

[0130] In another aspect, the present invention also provides a method for treating and / or preventing and / or diagnosing diseases associated with ROR1 expression, comprising administering to a subject a humanized antibody, chimeric antigen receptor, multispecific antibody, antibody-drug conjugate, engineered immune cell, or pharmaceutical composition as described above.

[0131] In one implementation, diseases associated with ROR1 expression include, but are not limited to, B-cell leukemia, lymphoma, B-cell chronic lymphocytic leukemia (CLL), non-Hodgkin lymphoma (NHL), acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), Burkitt lymphoma, mantle cell lymphoma (MCL), non-small cell lung cancer (NSCLC), neuroblastoma, renal cell carcinoma, colon cancer, colorectal cancer, breast cancer, squamous cell carcinoma, melanoma, myeloma, gastric cancer, brain cancer, lung cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, prostate cancer, testicular cancer, thyroid cancer, uterine cancer, adrenal cancer, and head and neck cancer.

[0132] The present application will be described in detail below with reference to the accompanying drawings and examples. It should be noted that those skilled in the art should understand that the accompanying drawings and examples of the present application are only for illustrative purposes and cannot constitute any limitation on the present application. The examples in the present application and the features in the examples can be combined with each other without contradiction. BRIEF DESCRIPTION OF DRAWINGS

[0133] Figure 1 : shows the scFv expression level in CAR-T cells expressing ROR1 murine ScFv.

[0134] Figure 2 : shows the killing effect of CAR-T cells expressing ROR1 murine ScFv on target cells at different effector-to-target ratios.

[0135] Figure 3 : shows the release level of IFN-γ of CAR-T cells expressing ROR1 murine ScFv after co-culturing with various target cells and non-target cells.

[0136] Figure 4 : shows the scFv expression level in CAR-T cells expressing ROR1 humanized ScFv.

[0137] Figure 5 : shows the killing effect of CAR-T cells expressing ROR1 humanized ScFv on target cells Jeko-1-luci (A) and non-target cells K562-luci (B) at different effector-to-target ratios.

[0138] Figure 6 : shows the degranulation effect of CAR-T cells expressing ROR1 humanized ScFv on target cells MDA-MB-231, Jeko-1, A549 and non-target cells K562.

[0139] Figure 7 : shows the release level of IL2 (A) and IFN-γ (B) of CAR-T cells expressing ROR1 humanized ScFv after co-culturing with various target cells MDA-MB-231, Jeko-1, A549 and non-target cells K562. DETAILED DESCRIPTION

[0140] Example 1. Preparation of ROR1 antibody

[0141] The sequence of the extracellular region of ROR1 protein was cloned into the pCP vector with His tag, and the plasmid with correct sequence was transiently infected into CHO cells. After 8-10 days of culture, the cell culture solution was harvested, and the protein was purified by affinity chromatography to obtain the extracellular region of human LIR1 protein as an immunogen.

[0142] Primary and booster immunization were performed on 6-8 week old female Balb / c mice, and the antibody titer and specificity of the protein immunogen in the serum were detected by ELISA and FACS. After comprehensive evaluation, the mice were given the last booster immunization. The mice were sacrificed 3-4 days later, and the spleen cells were collected and mixed with mouse myeloma cells (SP2 / 0) at a certain ratio. The hybridoma cells after proliferation were identified by FACS and ELISA methods, and positive cell strains were screened. After multiple rounds of subcloning identification, hybridoma cells stably secreting ROR1 antibody were finally obtained. After purification of the antibody in the supernatant of the hybridoma cells, five anti-ROR1 antibodies were obtained.

[0143] The antibody was digested with trypsin, and high-quality primary and secondary spectra were obtained by DNA data acquisition. The preliminary amino acid sequence results were obtained by de novo analysis of the spectra with peaks software. The antibody was digested with multiple proteases, and all peptide peaks and complete and fragmented information of each peptide were obtained by MSE data acquisition. The more comprehensive mass spectrometry data were matched with the preliminary amino acid sequence, and the amino acid sequences of the five ROR1 antibodies obtained are shown in Table 1 below.

[0144] Table 1. Sequence of ROR1 antibody

[0145] ROR1-1 ROR1-2 ROR1-3 ROR1-4 ROR1-5 CDR-L1 SEQ ID NO: 1 SEQ ID NO: 1 SEQ ID NO: 10 SEQ ID NO: 16 SEQ ID NO: 1 CDR-L2 SEQ ID NO: 2 SEQ ID NO: 2 SEQ ID NO: 11 SEQ ID NO: 17 SEQ ID NO: 22 CDR-L3 SEQ ID NO: 3 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 7 CDR-H1 SEQ ID NO: 4 SEQ ID NO: 4 SEQ ID NO: 13 SEQ ID NO: 19 SEQ ID NO: 4 CDR-H2 SEQ ID NO: 5 SEQ ID NO: 8 SEQ ID NO: 14 SEQ ID NO: 20 SEQ ID NO: 5 CDR-H3 SEQ ID NO: 6 SEQ ID NO: 9 SEQ ID NO: 15 SEQ ID NO: 21 SEQ ID NO: 23 VL SEQ ID NO: 24 SEQ ID NO: 27 SEQ ID NO: 30 SEQ ID NO: 33 SEQ ID NO: 36 VH SEQ ID NO: 25 SEQ ID NO: 28 SEQ ID NO: 31 SEQ ID NO: 34 SEQ ID NO: 37 scFv SEQ ID NO: 26 SEQ ID NO: 29 SEQ ID NO: 32 SEQ ID NO: 35 SEQ ID NO: 38

[0146] Example 2. Preparation of CAR-T cells containing ROR1 murine antibodies

[0147] The sequence encoding the following proteins was synthesized and cloned into the pLVX vector (Public Protein / Plasmid Library (PPL), Cat No: PPL00157-4a): CD8a signal peptide (SEQ ID NO: 58), anti-ROR1 antibody, CD8a hinge region (SEQ ID NO: 60), CD8a transmembrane region (SEQ ID NO: 44), 4-1BB intracellular region (SEQ ID NO: 50), CD3 zeta intracellular signaling domain (SEQ ID NO: 52), and the correct insertion of the target sequence was confirmed by sequencing. Among them, the amino acid sequence of the anti-ROR1 scFv contained in ROR1-1 CAR is shown in SEQ ID NO: 26; the amino acid sequence of the anti-ROR1 scFv contained in ROR1-2 CAR is shown in SEQ ID NO: 29; the amino acid sequence of the anti-ROR1 scFv contained in ROR1-3 CAR is shown in SEQ ID NO: 32; the amino acid sequence of the anti-ROR1 scFv contained in ROR1-4 CAR is shown in SEQ ID NO: 35; the amino acid sequence of the anti-ROR1 scFv contained in ROR1-5 CAR is shown in SEQ ID NO: 38.

[0148] After diluting the above-mentioned plasmid with 3 mL of Opti-MEM (Gibco, Cat No: 31985-070) in a sterile tube, add the packaging vector psPAX2 (Addgene, Cat No: 12260) and the envelope vector pMD2.G (Addgene, Cat No: 12259) according to the ratio of plasmid:virus packaging vector:virus envelope vector = 4:2:1. Then, add 120 μL of X-treme GENE HP DNA transfection reagent (Roche, Cat No: 06366236001), mix immediately, incubate at room temperature for 15 min, then add the plasmid / vector / transfection reagent mixture dropwise to the culture flask of 293T cells. Collect the virus at 24 hours and 48 hours, combine them, and obtain concentrated lentivirus by ultracentrifugation (25000g, 4°C, 2.5 hours).

[0149] T cells were activated with DynaBeads CD3 / CD28 CTS TM (Gibco, Cat No: 40203D) and continued to culture at 37°C and 5% CO2 for 1 day. Then, add concentrated lentivirus, and after 3 days of continuous culture, obtain CAR-T cells expressing different ROR1 murine scFv, and unmodified wild-type T cells are used as negative control (NT).

[0150] The expression levels of scFv on ROR1-1 CAR-T cells, ROR1-2 CAR-T cells, ROR1-3 CAR-T cells, ROR1-4 CAR-T cells and ROR1-5 CAR-T cells were detected by flow cytometry using Biotin-SP (long spacer) AffiniPure Goat Anti-Mouse IgG, F(ab')2 Fragment Specific (min X Hu, Bov, Hrs Sr Prot) (jackson immunoresearch, item number 115-065-072) as the primary antibody, APC Streptavidin (BD Pharmingen, item number 554067) or PE Streptavidin (BD Pharmingen, item number 554061) as the secondary antibody, and the results are shown in Figure 1 .

[0151] As can be seen, the anti-ROR1 scFv in the CAR-T cells expressing different ROR1 murine scFv prepared by the present application can be effectively expressed.

[0152] Example 3. Detection of the killing effect of CAR-T cells expressing ROR1 murine scFv on target cells and cytokine release

[0153] 3.1 Detection of the killing effect of CAR-T cells on target cells

[0154] MDA-MB-231 target cells carrying the luciferase gene were plated in a 96-well plate at a concentration of 1×10 4 cells / well, and then NT cells and CAR-T cells expressing ROR1 murine scFv were plated into the 96-well plate at an effector-to-target ratio (i.e., the ratio of effector T cells to target cells) of 10:1 or 5:1 for co-culture, and after 16-18 hours, the fluorescence value was determined using a microplate reader. According to the calculation formula: (target cell fluorescence mean value - sample fluorescence mean value) / target cell fluorescence mean value × 100%, the killing efficiency was calculated, and the results are shown in Figure 2 .

[0155] As can be seen, compared with NT, the CAR-T cells expressing ROR1 murine scFv prepared by the present application have significant specific killing of target cells at different effector-to-target ratios.

[0156] 3.2 Detection of the cytokine release level of CAR-T cells

[0157] MDA-MB-231 target cells carrying the luciferase gene were plated in a 96-well plate at a concentration of 1×10 5The target cells (MDA-MB-231 cells, Hs-578T cells) or non-target cells (Jurkat cells, Huh7 cells) were plated in 96-well plates at a concentration of 1 cell / well, and then CAR-T cells or NT cells expressing ROR1 murine ScFv were added at a ratio of 1:1 for co-culture. After 18-24 hours, the cell co-culture supernatant was collected.

[0158] The 96-well plates were coated with a capture antibody, purified anti-human IFN-γ antibody (Biolegend, item number 506502), at 4°C overnight, then the antibody solution was removed, 250 μL of PBST (0.1% Tween in 1X PBS) containing 2% BSA (sigma, item number V900933-1kg) was added, and incubated at 37°C for 2 hours. Then the plates were washed with 250 μL of PBST (0.1% Tween in 1X PBS) for 3 times. 50 μL of cell co-culture supernatant or standard was added to each well, and incubated at 37°C for 1 hour, then the plates were washed with 250 μL of PBST (0.1% Tween in 1X PBS) for 3 times. Then 50 μL of detection antibody, Anti-Interferon gamma antibody [MD-1] (Biotin) (abcam, item number ab25017), was added to each well, and incubated at 37°C for 1 hour, then the plates were washed with 250 μL of PBST (0.1% Tween in 1X PBS) for 3 times. HRP Streptavidin (Biolegend, item number 405210) was added, and incubated at 37°C for 30 minutes, then the supernatant was discarded, 250 μL of PBST (0.1% Tween in 1X PBS) was added, and washed 5 times. 50 μL of TMB substrate solution was added to each well. The reaction was allowed to occur at room temperature in the dark for 30 minutes, after which 50 μL of 1 mol / L H2SO4 was added to each well to stop the reaction. Within 30 minutes of stopping the reaction, the absorbance at 450 nm was detected using a microplate reader, and the content of the cytokine was calculated according to the standard curve (drawn according to the read value and concentration of the standard), and the results are shown in Figure 3

[0159] It can be seen that the cells expressing ROR1 murine ScFv prepared by the present application did not release the cytokine IFN-γ after co-culture with non-target cells Jurkat and Huh27, but the release level of IFN-γ was significantly increased after co-culture with target cells MDA-MB-231 cells or Hs-578T cells. This indicates that the CAR-T cells expressing ROR1 murine ScFv prepared by the present application can produce specific killing on target cells.

[0160] Example 4. Humanization of ROR1 antibody

[0161] ​The mouse-derived antibody ROR1-4 was humanized in the following manner: first, the database of IG BLAST (https: / / www.ncbi.nlm.nih.gov / igblast / ) was searched for human antibody sequences with high similarity, and then the FR regions in the single-chain antibody were replaced with the corresponding human sequences; then individual amino acid residues were replaced according to their different physicochemical properties, and finally 7 humanized single-chain antibodies were obtained, the sequences of which are shown in Table 2.

[0162] Table 2. Sequences of ROR1 humanized antibodies.

[0163] VL VH ScFv (aa) ScFv (nt) 6V7 SEQ ID NO: 68 SEQ ID NO: 69 SEQ ID NO: 70 SEQ ID NO: 71 6V8 SEQ ID NO: 72 SEQ ID NO: 73 SEQ ID NO: 74 SEQ ID NO: 75 6V9 SEQ ID NO: 76 SEQ ID NO: 77 SEQ ID NO: 78 SEQ ID NO: 79 6V10 SEQ ID NO: 80 SEQ ID NO: 81 SEQ ID NO: 82 SEQ ID NO: 83 6V11 SEQ ID NO: 84 SEQ ID NO: 85 SEQ ID NO: 86 SEQ ID NO: 87 6V12 SEQ ID NO: 88 SEQ ID NO: 89 SEQ ID NO: 90 SEQ ID NO: 91 6V13 SEQ ID NO: 92 SEQ ID NO: 93 SEQ ID NO: 94 SEQ ID NO: 95

[0164] Example 5. Preparation of CAR-T cells containing ROR1 humanized antibodies

[0165] The sequence encoding the following protein was synthesized and cloned into the pLVX vector (Public Protein / Plasmid Library (PPL), Cat. No. PPL00157-4a): CD8a signal peptide (SEQ ID NO: 58), anti-ROR1 humanized antibody (one of SEQ ID NO: 70, 74, 78, 82, 86, 90, 94), IgG4 hinge region (SEQ ID NO: 64), CD8a transmembrane region (SEQ ID NO: 44), 4-1BB intracellular region (SEQ ID NO: 50), CD3 zeta intracellular signaling domain (SEQ ID NO: 52), and the correct insertion of the target sequence was confirmed by sequencing.

[0166] The above vector was packaged into lentivirus according to the method described in Example 2 and infected activated T cells to obtain CAR-T cells containing ROR1 humanized antibodies.

[0167] After 11 days of culture at 37°C and 5% CO2, the above CAR-T cells, ROR1-4 CAR-T-2 cells (replacing the CD8a hinge region in ROR1-4 CAR-T cells with an IgG4 hinge region), and wild-type T cells (NT, used as a negative control) were co-incubated with ROR1-hFc (Acrobio brand, Cat. No. R01-H5250) protein for 45 min, washed and then added with PE anti-human IgG Fc Antibody (Biolegend brand, Cat. No. 410708) for co-incubation for 30 min. The expression level of anti-ROR1 single-chain antibody on CAR-T cells was detected by flow cytometry, and the results are shown in Figure 4

[0168] ​It can be seen that the anti-ROR1 humanized antibody in the CAR-T cell prepared by the application can be effectively expressed.

[0169] Example 6. Detection of the killing effect, degranulation and cytokine release level of CAR-T cells expressing ROR1 humanized ScFv on target cells

[0170] 6.1 Detection of the killing effect of CAR-T cells on target cells

[0171] The target cells (Jeko-1-luci cells) or non-target cells (K562-luci cells) were plated in a 96-well plate at a concentration of 1x10 4 cells / well, and then the NT cells and each CAR-T cell were plated in the 96-well plate at an effector-to-target ratio (i.e. the ratio of effector T cells to target cells) of 16:1, 8:1, 4:1, 2:1, 1:1 for co-culture, and the fluorescence value was determined by using a microplate reader after 16-18 hours. According to the calculation formula: (target cell fluorescence mean value-sample fluorescence mean value) / target cell fluorescence mean value x 100%, the killing efficiency was calculated, and the results are shown in Figure 5

[0172] It can be seen that under different effector-to-target ratios, the CAR-T cells expressing ROR1 humanized ScFv prepared by the application show strong killing effect on the target cells Jeko-1-luci cells, and the killing on the non-target cells K562-luci cells is weaker, indicating that the CAR-T cells expressing ROR1 humanized ScFv only present specific killing on the cells expressing ROR1.

[0173] 6.2 Detection of the degranulation of CAR-T cells

[0174] The target cells (Jeko-1-luci cells) or non-target cells (K562-luci cells) were plated in a 96-well plate at a concentration of 1x10 5 ​Cell / well concentration: Target cells (MDA-MB-231 cells, Jeko-1 cells, A549 cells) and non-target cells (K562 cells) were seeded in 96-well plates, respectively. CAR-T cells expressing ROR1-humanized ScFv, ROR1-4 CAR-T-2 cells, and NT cells (negative control) were added to each well at a 1:1 ratio. Then, 10 μL of PE Mouse anti-human CD107a antibody (BD, catalog number 555801) was added to each well, and the plates were incubated at 37°C and 5% CO2 in the dark. After 1 h, 20 μL of Golgi Stop (BD, catalog number 51-2092K2) was added to each well, and the plates were incubated at 37°C and 5% CO2 in the dark for 2.5 h. Finally, 10 μL of APC anti-human CD8 (BD, catalog number 555369) was added to each well, and the plates were incubated at 37°C and 5% CO2 in the dark for 0.5 h. Cell samples from each well were analyzed by flow cytometry, and the proportion of CD107a+CD8+ cells to T cells was also analyzed. The results are as follows: Figure 6 As shown.

[0175] As can be seen, compared with NT cells, the CAR-T cells expressing ROR1 humanized ScFv prepared in this invention showed significantly increased specific degranulation activity against three target cell types: MDA-MB-231 cells, Jeko-1 cells, and A549 cells, while no significantly increased degranulation activity was observed against non-target cells.

[0176] 6.3 Detection of the cytokine release level of CAR-T cells

[0177] With 1×10 5 The target cells (MDA-MB-231 cells, Jeko-1 cells, A549 cells) and non-target cells (K562 cells) were seeded in 96-well plates at a concentration of 1 cell / well. CAR-T cells and NT cells (negative control) expressing ROR1 humanized ScFv were added at a 1:1 ratio. After co-culturing for 18-24 hours, the cell co-culture supernatant was collected.

[0178] As recommended by the manufacturer, the levels of IL2 and IFN-γ in the co-culture supernatant were detected using the Human IL-2 DuoSet ELISA Kit (R&D systems, catalog number DY202) and the Human IFN-gamma DuoSet ELISA Kit (R&D systems, catalog number DY285), respectively. The results are as follows: Figure 7 As shown.

[0179] As can be seen, compared with NT cells, the release of cytokines IL2 and IFN-g of the CAR-T cells expressing ROR1 humanized ScFv of the application after co-culture with three target cells is significantly increased, and this cytokine release is specific.

[0180] It should be noted that the above is only a preferred embodiment of the present application and is not intended to limit the present application. Those skilled in the art can make various modifications and changes to the present application. Those skilled in the art understand that any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Nanjing Beiheng Biotechnology Co., Ltd. <120> Antibodies Targeting ROR1 and Uses Thereof <130> BHCN34 <150> 2021100376556 <151> 2021‑01‑12 <160> 95 <170> SIPOSequenceListing 1.0 <210> 1 <211> 11 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CDR‑L1 <400> 1 Ile Thr Ser Thr Asp Ile Asp Asp Asp Met Asn 1 5 10 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CDR‑L2 <400> 2 Glu Gly Asn Ala Leu Arg Pro 1 5 <210> 3 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L3 <400> 3 Leu Gin Ser Asn Lys Leu Pro Leu Thr 1 5 <210> 4 <211> 8 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H1 <400> 4 Gly Tyr Ser Ile Thr Ser Asp Tyr 1 5 <210> 5 <211> 5 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H2 <400> 5 Ser Tyr Ser Gly Tyr 1 5 <210> 6 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H3 <400> 6 Gly Thr Gly Thr Tyr Tyr Phe Asp Tyr 1 5 <210> 7 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L3 <400> 7 Leu Gin Ser Asn Asn Leu Pro Leu Thr 1 5 <210> 8 <211> 5 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H2 <400> 8 Thr Tyr Ser Gly Tyr 1 5 <210> 9 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H3 <400> 9 Gly Thr Gly Thr Tyr Tyr Phe Asp His 1 5 <210> 10 <211> 17 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L1 <400> 10 Lys Ser Ser Gin Ser Leu Leu Tyr Ser Gly Asn Gin Lys Asn Tyr Leu 1 5 10 15 Ala <210> 11 <211> 7 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L2 <400> 11 Trp Ala Ser Thr Arg Asp Ser 1 5 <210> 12 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L3 <400> 12 Gln Gln Tyr Ser Ser Tyr Pro Trp Thr 1 5 <210> 13 <211> 7 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H1 <400> 13 Gly Tyr Ser Phe Thr Gly Tyr 1 5 <210> 14 <211> 6 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H2 <400> 14 Asn Pro Tyr Ser Gly Asp 1 5 <210> 15 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H3 <400> 15 Arg Gly Asp Ala Val Pro Phe Ala Tyr 1 5 <210> 16 <211> 11 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L1 <400> 16 Ile Thr Ser Thr Asp Ile Asp Glu Asp Met Asn 1 5 10 <210> 17 <211> 7 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L2 <400> 17 Glu Gly Asn Thr Leu Arg Pro 1 5 <210> 18 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L3 <400> 18 Leu Gln Ser Asn Asn Met Pro Leu Thr 1 5 <210> 19 <211> 8 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H1 <400> 19 Ala Tyr Ser Ile Thr Ser Asp Tyr 1 5 <210> 20 <211> 5 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H2 <400> 20 Ser Tyr Ser Gly Phe 1 5 <210> 21 <211> 9 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-H3 <400> 21 Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr 1 5 <210> 22 <211> 7 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR-L2 <400> 22 Glu Gly Asn Ser Leu Arg Pro 1 5 <210> 23 <211> 9 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CDR-H3 <400> 23 Gly Arg Gly Thr Tyr Tyr Phe Asp Phe 1 5 <210> 24 <211> 107 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> ROR1-1 VL <400> 24 Glu Thr Thr Val Thr Gln Ser Pro Ala Ser Leu Ser Met Ala Ile Gly 1 5 10 15 Glu Lys Val Thr Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Asp Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Ala Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Ala Ile Glu Asn Met Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asn Lys Leu Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 25 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-1 VH <400> 25 Glu Val His Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gin Phe Pro Gly Asn Arg Leu Glu Trp 35 40 45 Met Gly Tyr Ile Ser Tyr Ser Gly Tyr Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gin Phe Phe 65 70 75 80 Leu Gin Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Lys Gly Thr Gly Thr Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 26 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-1 scFv <400> 26 Glu Thr Thr Val Thr Gln Ser Pro Ala Ser Leu Ser Met Ala Ile Gly 1 5 10 15 Glu Lys Val Thr Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Asp Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Ala Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Ala Ile Glu Asn Met Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asn Lys Leu Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val His Leu Val Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gin Ser Leu Ser Leu Thr Cys 130 135 140 Thr Val Thr Gly Tyr Ser lie Thr Ser Asp Tyr Ala Trp Asn Trp lie 145 150 155 160 Arg Gin Phe Pro Gly Asn Arg Leu Gin Trp Met Gly Tyr lie Ser Tyr 165 170 175 Ser Gly Tyr Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg lie Ser lie 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gin Phe Phe Leu Gin Leu Asn Ser Val 195 200 205 Thr Thr Gin Asp Thr Ala Thr Tyr Tyr Cys Ala Lys Gly Thr Gly Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 27 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-2 VL <400> 27 Asp lie Leu Leu Thr Gin Ser Pro Pro Ser Leu Ser Met Ala lie Gly 1 5 10 15 Glu Lys Val Thr lie Arg Cys lie Thr Ser Thr Asp lie Asp Asp Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Glu Pro Pro Lys Leu Leu lie 35 40 45 Ser Glu Gly Asn Ala Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Ala lie Glu Asn Met Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gin Ser Asn Asn Leu Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Asn 100 105 <210> 28 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-2 VH <400> 28 Glu Val His Leu Val Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gin 1 5 10 15 Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser lie Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp lie Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Met Gly Tyr lie Thr Tyr Ser Gly Tyr Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg lie Ser lie Thr Arg Asp Thr Ser Lys Asn Gin Phe Phe 65 70 75 80 Leu Gin Leu Asn Ser Val Thr Ser Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Lys Gly Thr Gly Thr Tyr Tyr Phe Asp His Trp Gly Gin Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 29 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-2 scFv <400> 29 Asp lie Leu Leu Thr Gin Ser Pro Pro Ser Leu Ser Met Ala lie Gly 1 5 10 15 Glu Lys Val Thr lie Arg Cys lie Thr Ser Thr Asp lie Asp Asp Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Glu Pro Pro Lys Leu Leu lie 35 40 45 Ser Glu Gly Asn Ala Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Ala Ile Glu Asn Met Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asn Asn Leu Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Asn Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val His Leu Val Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Ser Leu Ser Leu Thr Cys 130 135 140 Thr Val Thr Gly Tyr Ser Ile Thr Ser Asp Tyr Ala Trp Asn Trp Ile 145 150 155 160 Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Met Gly Tyr Ile Thr Tyr 165 170 175 Ser Gly Tyr Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg Ile Ser Ile 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe Leu Gln Leu Asn Ser Val 195 200 205 Thr Ser Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Lys Gly Thr Gly Thr 210 215 220 Tyr Tyr Phe Asp His Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 30 <211> 113 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-3 VL <400> 30 Asp Ile Val Met Thr Gln Ser Pro Ser Ser Gln Pro Val Ser Val Gly 1 5 10 15 Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Gly Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Asp Ser Gly Val 50 55 60 Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln 65 70 75 80 Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Ser Ser Tyr Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 100 105 110 Lys <210> 31 <211> 118 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> ROR1‑3 VH <400> 31 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Met Lys Pro Gly Ala 1 5 10 15 Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Asp Trp Ile 35 40 45 Gly Leu Ile Asn Pro Tyr Ser Gly Asp Thr Ser Tyr Asn Gln Gln Phe 50 55 60 Gln Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ser Arg Arg Gly Asp Ala Val Pro Phe Ala Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ala 115 <210> 32 <211> 246 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-3 scFv <400> 32 Asp Ile Val Met Thr Gln Ser Pro Ser Ser Gln Pro Val Ser Val Gly 1 5 10 15 Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Gly Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Asp Ser Gly Val 50 55 60 Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Ser Ser Tyr Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 100 105 110 Lys Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Glu Val Gin Leu Gin Gin Ser Gly Pro Glu Leu Met Lys Pro Gly Ala 130 135 140 Ser Met Lys He Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 145 150 155 160 Thr Met Asn Trp Val Lys Gin Ser His Gly Lys Asn Leu Asp Trp He 165 170 175 Gly Leu He Asn Pro Tyr Ser Gly Asp Thr Ser Tyr Asn Gin Gin Phe 180 185 190 Gln Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 195 200 205 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 210 215 220 Ser Arg Arg Gly Asp Ala Val Pro Phe Ala Tyr Trp Gly Gin Gly Thr 225 230 235 240 Leu Val Thr Val Ser Ala 245 <210> 33 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-4 VL <400> 33 Glu Thr Thr Val Thr Gln Ser Pro Ala Ser Leu Ser Val Ala Thr Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Thr Ile Glu Asn Thr Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 34 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-4 VH <400> 34 Glu Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Ser Leu Ser Leu Thr Cys Thr Val Thr Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Met Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Glu Phe Phe 65 70 75 80 Leu Gin Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 35 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-4 scFv <400> 35 Glu Thr Thr Val Thr Gin Ser Pro Ala Ser Leu Ser Val Ala Thr Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Thr Ile Glu Asn Thr Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Gln Gln 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Ser Leu Ser Leu Thr Cys 130 135 140 Thr Val Thr Ala Tyr Ser Ile Thr Ser Asp Tyr Ala Trp Asn Trp Ile 145 150 155 160 Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Met Gly Tyr Ile Ser Tyr 165 170 175 Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg Ile Ser Ile 180 185 190 Thr Arg Asp Thr Ser Lys Asn Glu Phe Phe Leu Gln Leu Asn Ser Val 195 200 205 Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Glu Ile Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 36 <211> 107 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> ROR1‑5 VL <400> 36 Glu Thr Thr Val Thr Gln Ser Pro Ala Ser Leu Ser Met Ala Ile Gly 1 5 10 15 Glu Lys Val Thr Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Asp Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Ser Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Thr Ile Glu Asn Met Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gin Ser Asn Asn Leu Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 37 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-5 VH <400> 37 Glu Val Gin Leu Gin Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gin 1 5 10 15 Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Met Gly Tyr Ile Ser Tyr Ser Gly Tyr Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Lys Gin Phe Phe 65 70 75 80 Leu Gin Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Arg Gly Thr Tyr Tyr Phe Asp Phe Trp Gly Gln Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 38 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-5 scFv <400> 38 Glu Thr Thr Val Thr Gln Ser Pro Ala Ser Leu Ser Met Ala Ile Gly 1 5 10 15 Glu Lys Val Thr Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Asp Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Ser Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Val Phe Thr Ile Glu Asn Met Leu Ser 65 70 75 80 Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asn Asn Leu Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gin Leu Gin Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gin Ser Leu Ser Leu Thr Cys 130 135 140 Thr Val Thr Gly Tyr Ser lie Thr Ser Asp Tyr Ala Trp Asn Trp lie 145 150 155 160 Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp Met Gly Tyr lie Ser Tyr 165 170 175 Ser Gly Tyr Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg lie Ser lie 180 185 190 Thr Arg Asp Thr Ser Lys Lys Gin Phe Phe Leu Gin Leu Asn Ser Val 195 200 205 Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Arg Gly Thr 210 215 220 Tyr Tyr Phe Asp Phe Trp Gly Gin Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 39 <211> 720 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> ROR1-1 scFv <400> 39 gaaacaacgg taactcaatc cccagccagt ctcagtatgg caataggaga gaaagtaaca 60 atcagatgta taaccagtac cgatatagac gatgacatga attggtacca gcagaaaccg 120 ggggagccac ccaagcttct gatcagtgag gggaatgcac tgcgccccgg tgtgccatct 180 cgcttcagta gtagcggata cggtaccgat ttcgtatttg ccatagaaaa catgctctct 240 gaagatgtag cagattatta ttgtcttcag tctaataagc tgcccctgac atttggcgcc 300 gggaccaaac tcgaacttaa agggggaggt gggtccgggg gaggggggtc aggaggaggc 360 ggttctgaag tgcatctcgt cgaaagtggg ccagggctcg tcaaaccaag tcagtcattg 420 agccttacct gcacagtgac cggctactct attacgtctg attacgcctg gaattggatt 480 aggcaatttc cgggcaacag actggaatgg atgggctata ttagctattc tgggtatact 540 agatacaacc ctagcttgaa gtctaggatt tccatcacga gagacaccag caagaaccag 600 ttcttcttgc agcttaacag cgtaacgaca gaagatacag caacatacta ttgcgcgaaa 660 ggtactggca cgtattattt cgattactgg gggcagggga ccactctgac tgtgtctagc 720 <210> 40 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-2 scFv <400> 40 gatattctcc tgacacagtc tcctccttca ctcagcatgg caatcggaga aaaggtaacg 60 attcggtgta ttacatccac ggacatagac gatgacatga attggtatca acagaaaccg 120 ggtgaaccac ccaaactgct tatttccgaa gggaatgccc ttagaccggg tgtaccaagc 180 agattctcct ccagcggata tggcaccgat tttgtttttg cgatagaaaa tatgttgtcc 240 gaggacgtgg ccgactatta ctgccttcaa tcaaataacc tcccattgac tttcggcgca 300 ggaactaaat tggagcttaa cggcggtgga ggtagcggag gaggtggttc cggcggtgga 360 ggctccgagg tccatttggt cgagtccgga ccgggattgg tgaaaccatc acagtcactc 420 tcacttacat gcacggttac tggctatagt attacatcag attacgcctg gaactggata 480 cgccaatttc cagggaataa actggaatgg atgggttaca ttacttacag tggttataca 540 cgatacaatc ctagtttgaa aagtcgcatt tccattacga gagataccag caaaaatcag 600 ttcttcctcc aacttaatag cgtgacgagc gaggacactg ctacgtacta ttgtgcaaag 660 ggtactggaa cctattattt cgaccattgg ggccaaggca caaccctcac ggtgtctagc 720 <210> 41 <211> 738 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> ROR1-3 scFv <400> 41 gatatagtaa tgactcaaag ccccagttcc caaccggttt cagttggtga gaaagtgact 60 atgagctgta agtcttccca atctcttctt tacagcggca atcaaaagaa ttatttggcc 120 tggtaccaac agaaacctgg gcagtcaccc aagctgttga tttactgggc ctctacgaga 180 gactctggag tgcctgatcg ctttacggga agcggtagtg gcacagactt caccttgaca 240 atatccagtg taaaagcgga ggatctggcc gtgtactatt gccagcaata tagtagttat 300 ccatggactt ttggcggagg cactaagctt gagataaaag ggggaggggg gtctggagga 360 ggaggctcag ggggcggggg ctcagaggtc caactccagc aatcaggccc agagttgatg 420 aaaccaggag cttcaatgaa aataagttgc aaggcttctg ggtactcttt cacgggatac 480 accatgaatt gggtcaaaca aagtcacgga aaaaacttgg attggatagg tctcataaat 540 ccctactcag gggacacaag ttataaccag cagtttcaag gaaaggctac cctcacggta 600 gataaatcat catccactgc atatatggaa ttgttgagct tgacaagtga agattcagcc 660 gtgtatttct gttccaggcg gggagatgct gtacctttcg cgtactgggg gcagggaact 720 cttgtgacgg tatctgcg 738 <210> 42 <211> 720 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> ROR1‑4 scFv <400> 42 gaaacgacag ttacccaaag tccggcttct cttagcgttg cgactgggga gaaagtaata 60 attcggtgca tcacaagtac cgacattgac gaagatatga attggtacca gcagaagccc 120 ggcgagcctc cgaaacttct gatcagcgag ggtaacacac tcaggccagg tgtgcccagc 180 cgattctcta gctctggcta tggcaccgat ttcgttttta cgattgagaa caccctctct 240 gaagatgtcg ccgattatta ctgcctgcag agcaacaaca tgcccttgac cttcggagct 300 ggcacgaagc tcgaactgaa aggaggtgga gggtcaggtg ggggaggcag cggcgggggt 360 ggttctgagg tacagctgca acaatcaggc cccggtcttg taaagccgtc acaatccctc 420 agtcttacct gtacagttac agcttattcc attacgtcag actatgcgtg gaactggata 480 cggcaatttc cgggcaataa actggagtgg atgggctata tcagttattc cggcttcacg 540 cgctacaacc cttctctgaa gtctaggatt agcattacgc gggacaccag caagaatgaa 600 tttttcctgc agcttaatag cgttacaacg gaggatactg ccacctacta ttgcgctaga 660 ggtgagataa cgtactattt cgactactgg ggtcaaggaa cgaccctcac cgtgtctagc 720 <210> 43 <211> 720 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> ROR1‑5 scFv <400> 43 gaaacgacgg taacgcaatc accggcatct ctgtctatgg ccataggtga gaaagtgaca 60 attcggtgca ttactagcac ggatatagat gacgacatga actggtacca gcaaaaaccc 120 ggagaacccc ccaaattgtt gatttctgaa ggcaactcac tccggcctgg ggtcccttca 180 cgctttagct catccggtta tggcacagac tttgttttca cgatcgaaaa catgttgagc 240 gaggacgtgg cggattatta ctgccttcag agtaataatc ttcctctcac tttcggtggg 300 ggtactaagc tggagataaa aggtggaggg ggttcagggg gcggaggatc aggcggcgga 360 gggagcgagg tgcaactgca agaatcaggg cccggtcttg tgaagccgtc ccagagtctt 420 agtttgacct gcacagtgac gggatacagt ataacttccg attacgcatg gaattggata 480 cgccagttcc cagggaataa attggaatgg atggggtaca tctcctatag cggctataca 540 aggtataacc caagtctcaa atcccgaatt tcaattacaa gagacacttc taaaaaacag 600 tttttcctcc agcttaactc cgtgacaacc gaagacaccg ctacatacta ctgtgcgaga 660 ggaaggggta catattattt cgacttttgg gggcagggaa caacgctgac cgtgtcaagc 720 <210> 44 <211> 25 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD8 alpha transmembrane domain <400> 44 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 1 5 10 15 Ser Leu Val Ile Thr Leu Tyr Cys Lys 20 25 <210> 45 <211> 75 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD8 alpha transmembrane domain <400> 45 atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60 accctttact gcaaa 75 <210> 46 <211> 27 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 transmembrane domain <400> 46 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu 1 5 10 15 Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val 20 25 <210> 47 <211> 81 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 transmembrane domain <400> 47 ttttgggtcc tcgtcgtagt tggaggggta cttgcctgtt atagcctcct ggttaccgta 60 gcatttatta tattctgggt g 81 <210> 48 <211> 41 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 costimulatory domain <400> 48 Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr 1 5 10 15 Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro 20 25 30 Pro Arg Asp Phe Ala Ala Tyr Arg Ser 35 40 <210> 49 <211> 123 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 costimulatory domain <400> 49 aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60 gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120 tcc 123 <210> 50 <211> 40 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 4-1BB costimulatory domain <400> 50 Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gin Pro Phe Met Arg 1 5 10 15 Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro 20 25 30 Glu Glu Glu Glu Gly Gly Cys Glu 35 40 <210> 51 <211> 120 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 4-1BB costimulatory domain <400> 51 cggggcagaa agaaactcct gtatatattc aaacaaccat ttatgagacc agtacaaact 60 actcaagagg aagatggctg tagctgccga tttccagaag aagaagaagg aggatgtgaa 120 <210> 52 <211> 113 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD3 zeta signaling domain <400> 52 Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin 1 5 10 15 Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 20 25 30 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 35 40 45 Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin 50 55 60 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu 65 70 75 80 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr 85 90 95 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro 100 105 110 Arg <210> 53 <211> 339 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD3 zeta signaling domain <400> 53 ctgagagtga agttcagcag gagcgcagac gcccccgcgt accagcaggg ccagaaccag 60 ctctataacg agctcaatct aggacgaaga gaggagtacg atgttttgga caagagacgt 120 ggccgggacc ctgagatggg gggaaagccg agaaggaaga accctcagga aggcctgtac 180 aatgaactgc agaaagataa gatggcggag gcctacagtg agattgggat gaaaggcgag 240 cgccggaggg gcaaggggca cgatggcctt taccagggtc tcagtacagc caccaaggac 300 acctacgacg cccttcacat gcaggccctg ccccctcgc 339 <210> 54 <211> 114 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CD3ζ is the source of the <400> 54 Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 1 5 10 15 Gly Gln Asn Gln Leu Phe Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 20 25 30 Phe Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 35 40 45 Lys Pro Gin Arg Arg Lys Asn Pro Gin Gin Gin Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly 50 55 60 Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly 65 70 75 80 Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Phe Gin Gly Leu Ser 85 90 95 Thr Ala Thr Lys Asp Thr Phe Asp Ala Leu His Met Gin Ala Leu Pro 100 105 110 Pro Arg <210> 55 <211> 342 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD3 zeta signaling domain <400> 55 ctgagagtga agttcagcag gagcgcagac gcccccgcgt accagcaggg ccagaaccag 60 ctctttaacg agctcaatct aggacgaaga gaggagttcg atgttttgga caagagacgt 120 ggccgggacc ctgagatggg gggaaagccg cagagaagga agaaccctca ggaaggcctg 180 tacaatgaac tgcagaaaga taagatggcg gaggcctaca gtgagattgg gatgaaaggc 240 Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Phe Gin Gly Leu SerGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTTCCAGGGTCTCAGTACAGCCACC AAG 300 GACACCTTTGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC 342 <210> 56 <211> 20 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> B2M signal peptide <400> 56 Met Ser Arg Ser Val Ala Leu Ala Val Leu Ala Leu Leu Ser Leu Ser 1 5 10 15 Gly Leu Glu Ala 20 <210> 57 <211> 60 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> B2M signal peptide <400> 57 atgtcccgct ctgttgcttt ggctgtgctg gcccttttgt cccttagcgg actggaggcc 60 <210> 58 <211> 21 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD8a signal peptide <400> 58 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 59 <211> 63 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> CD8 alpha signal peptide <400> 59 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccg 63 <210> 60 <211> 45 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CD8 alpha hinge region <400> 60 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala 1 5 10 15 Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 35 40 45 <210> 61 <211> 135 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> CD8 alpha hinge region <400> 61 accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60 tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120 gacttcgcct gtgat 135 <210> 62 <211> 39 <212> PRT <213> Artificial Sequence(Artificial Sequence) [[ID=We]]<220> <223> CD28 hinge region <400> 62 Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn 1 5 10 15 Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro Leu 20 25 30 Phe Pro Gly Pro Ser Lys Pro 35 <210> 63 <211> 117 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> CD28 hinge region <400> 63 attgaagtta tgtatcctcc tccttaccta gacaatgaga agagcaatgg aaccattatc 60[[ID=TO]] catgtgaaag ggaaacacct ttgtccaagt cccctatttc ccggaccttc taagccc 117 64 12 36 PRT Artificial Sequence (Artificial Sequence) 64 IgG4 hinge region 12Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro 1 5 10 36 64 DNA Artificial Sequence (Artificial Sequence) 64 IgG4 hinge region 12 gaaagcaaat acgggccgcc gtgtccaccc tgtccg 36 36 12 PRT Artificial Sequence (Artificial Sequence) 12 linker 12Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr 1 5 10 15Lys Gly 12 15 PRT Artificial Sequence (Artificial Sequence) 12 linker​​​​​​​​​​​​​​​​​​​​​​​​​​​​ <220> <223> linker <400> 67 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 68 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V7 VL <400> 68 Glu Thr Thr Leu Thr Gin Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Ile Leu Ser Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gin Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 69 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V7 VH <400> 69 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Ile Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe 65 70 75 80 Leu Lys Leu Asn Phe Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 70 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V7 ScFv <400> 70 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Ile Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe 65 70 75 80 Leu Lys Leu Asn Phe Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 71 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V7 ScFv <400> 71 gagactactc tgacccagtc accagcaaca ctttctgtct caccaggcga acgcgccatt 60 ctctcctgca tcacaagtac ggacattgac gaggatatga actggtatca gcagaagccc 120 ggacagccac ccaagttgct gatcagcgag ggtaatactc ttagacctgg ggtcccttcc 180 agattctcag gctcaggatc tggcactgac ttcacactga caatttcctc cctccaacct 240 gaggacgtgg ccacatacta ttgtcttcag tccaacaata tgccccttac gtttggcgcc 300 ggcaccaagc tggaactgaa aggtggtggg ggatccggtg gaggtggaag tggtggaggt 360 gggagccagg tacagcttca ggaaagcggc cctggcctgg tgaaaccatc acagactctg 420 tctctgacgt gtactgtgtc cgcctatagc atcacaagcg attatgcctg gaactggatc 480 cgacagtttc ccggaaataa actggaatgg attggttaca tttcctattc aggctttacc 540 aggtacaatc ccagtctcaa gtcccggatc tctatcacaa gagacacaag taagaatcag 600 ttctttttga aattgaattt cgtcacaact gaggacaccg cgacatatta ctgtgccagg 660 ggtgagatca cttattactt tgattactgg ggacaaggca caactctgac agtttctagc 720 <210> 72 <211> 107 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> 6V8 VL <400> 72 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 73 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V8 VH <400> 73 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Thr Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Met Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe 65 70 75 80 Leu Lys Leu Asn Phe Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 74 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V8 ScFv <400> 74 Glu Thr Thr Leu Thr Gin Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val He He Arg Cys He Thr Ser Thr Asp He Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu He 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr He Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gin Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gin Val Gin Leu Gin Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gin Thr Leu Ser Leu Thr Cys 130 135 140 Thr Val Thr Ala Tyr Ser He Thr Ser Asp Tyr Ala Trp Asn Trp He 145 150 155 160 Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp Met Gly Tyr He Ser Tyr 165 170 175 Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg He Ser He 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gin Phe Phe Leu Lys Leu Asn Phe Val 195 200 205 Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Glu He Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 75 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V8 ScFv <400> 75 gagacaactc ttacacaatc ccctgctaca ctcagcgtga gtcccggcga aaaggttatt 60 atccgatgta tcacttctac tgacattgac gaagacatga attggtatca gcagaaacca 120 ggccagcccc caaaactgct gattagtgaa gggaacaccc tgaggccagg agtaccctct 180 CGGTTTTCAG GAAGCGGCTC CGGCAC TGATTTTACATTGACTATCTCTAGCCTGCAGCCA 240 GAGGATGTCGCCACTTATATTGTCTGCAGAGCAACAATATGCCTCTGACTTTTG GTGC 300 GGGACAAGCTGGAGTTGAAGGGAGGTGGAGGTTCTGGCGGAGGAGGAAGCGGTG GTGGA 360 GGATCTCAAGTTCAGCTCCAGGAGTCAGGTCCTGGACTGGTCAAACCCTCCCA GACTCTG 420 TCTTTGACATGTACGGTCACGGCCTACTCAATCACTTCCGACTATGCA TGGAACTGGATT 480 CGCCAGTTCCCCGGAAACA AACTGGAATGGATGGGCTACATCAGTTACTCTGGCTTTACC 540 AGATATAACCCATC ACTCAAAGCAGAATCAGTATC ACTAGGGACACCAGCAAGAACCAG 600 TTTTTTCTGAAGCTGAATTTCTGACCACC GAAGACACC GCTACCTATATTGTGCCAGG 660 GGAGAGATCATT TACTTTCGATTACTGGGGCCAGGGGACCACCCTCACAGTCTCATCA 720 <210> 76 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V9 VL <400> 76 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 77 <211> 107 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> 6V9 VH <400> 77 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 78 <211> 240 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> 6V9 ScFv <400> 78 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys 130 135 140 Thr Val Ser Ala Tyr Ser Ile Thr Ser Asp Tyr Ala Trp Asn Trp Ile 145 150 155 160 Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Ile Gly Tyr Ile Ser Tyr 165 170 175 Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg Ile Ser Ile 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gln Tyr Tyr Leu Gln Leu Asn Ser Val 195 200 205 ​​​​​​​​​​​​​​​​​​​Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Glu lie Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 79 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V9 ScFv <400> 79 gaaactacac tcacccaaag tcctgccact ctgagtgtaa gtcctggcga gaaagtcata 60 ataagatgca ttacaagcac cgatattgat gaggacatga actggtatca acagaagccc 120 ggacagccac ctaaacttct catcagtgag ggcaacactt tgaggcctgg ggtccctagt 180 aggttcagtg gcagtggatc tggtactgat ttcaccctca caatctcttc attgcagcca 240 gaggacgtgg ccacctacta ctgcctgcag tccaataata tgccactcac ttttggggcc 300 ggcaccaagc tggaactcaa gggtggagga ggatcaggtg gtggtgggag tggaggaggc 360 ggaagtcaag tgcagctcca ggagtctggc ccaggccttg tgaaaccttc ccagaccctg 420 tccctgactt gcaccgtgtc agcatattct ataacttccg actacgcctg gaactggatt 480 cgacagtttc ccggcaacaa gctggagtgg atcggttaca tctcctacag cgggtttaca 540 aggtacaacc cctctttgaa gtcaagaatt agtatcacac gggatactag caagaatcag 600 tactatctgc agttgaattc tgtaaccaca gaagacaccg caacctatta ttgcgccagg 660 ggagagatca cctactactt tgactactgg ggacagggca ctaccctcac cgtcagctca 720 <210> 80 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V10 VL <400> 80 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 81 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V10 VH <400> 81 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Thr Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Met Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe 65 70 75 80 Leu Lys Leu Asn Phe Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 82 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V10 ScFv <400> 82 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys 130 135 140 Thr Val Thr Ala Tyr Ser Ile Thr Ser Asp Tyr Ala Trp Asn Trp Ile 145 150 155 160 Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Met Gly Tyr Ile Ser Tyr 165 170 175 Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg Ile Ser Ile 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe Leu Lys Leu Asn Phe Val 195 200 205 Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Glu Ile Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 83 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V10 ScFv <400> 83 gaaacaactc ttacccagag ccctgccact cttagtgtga gccctggaga aagagcaatc 60 atcagatgta tcaccagcac agacatagac gaggatatga actggtatca gcagaagcca 120 ggtcagcctc ctaagttgct gatctctgaa ggaaacacac tgagacctgg cgtgccaagc 180 agattttcag gatctgggag tggaacggac ttcaccctga ccatctcttc cttgcagccc 240 gaagatgttg ccacctatta ctgtctccag tcaaataaca tgccactcac ctttggggcc 300 ggcacaaagt tggagctgaa aggaggcgga ggaagtggag gaggcggaag tggaggaggt 360 ggctcacagg ttcagctgca ggagagcgga ccagggctgg taaagccttc acagaccctt 420 tctctgacct gtaccgttac agcctactca attacaagcg attatgcttg gaactggatc 480 cggcagttcc ctgggaacaa gctggaatgg atgggctata tttcttatag cggcttcact 540 cgatataacc catccctcaa aagtcggatc tccatcacac gggacacctc caagaatcag 600 ttttttctga aactgaattt tgtgaccact gaggataccg ccacctacta ttgcgctagg 660 ggggagatca cgtactactt cgattactgg ggacagggaa caactctcac tgtctcatct 720 <210> 84 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V11 VL <400> 84 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 85 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V11 VH <400> 85 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Ile Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Tyr Tyr 65 70 75 80 Leu Gln Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 86 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V11 ScFv <400> 86 Glu Thr Thr Leu Thr Gin Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Arg Ala Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gin Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gin Val Gin Leu Gin Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gin Thr Leu Ser Leu Thr Cys 130 135 140 Thr Val Ser Ala Tyr Ser lie Thr Ser Asp Tyr Ala Trp Asn Trp lie 145 150 155 160 Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp lie Gly Tyr lie Ser Tyr 165 170 175 Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg lie Ser lie 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gin Tyr Tyr Leu Gin Leu Asn Ser Val 195 200 205 Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Glu lie Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 87 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V11 ScFv <400> 87 gaaacaacgc tcactcagtc acctgccact ttgagcgtta gtccaggaga aagggcaatc 60 attcggtgca taacttctac cgatattgac gaggacatga actggtatca gcagaaacca 120 ggacagccac caaaattgct tatctccgag ggcaatactc tcagaccagg tgtcccctca 180 agattttcag ggtctggcag tggtacagac ttcaccttga ccattagttc cctgcagcca 240 gaagatgtgg ctacctatta ttgtctccag tctaacaaca tgcccctgac attcggcgct 300 gggacaaaac tggagctgaa aggaggcggt ggatctggcg gaggtggatc tggaggaggg 360 ggatcacagg tgcaactgca ggaaagtgga cccggacttg taaagccctc ccagactctg 420 agtctgactt gcacggtgtc agcctacagc attacgtccg actacgcctg gaactggatt 480 cggcagttcc ctggtaataa gctggagtgg atcggttaca tatcatactc tgggttcact 540 aggtacaacc caagcctcaa gtccagaatc agtataacaa gagacacttc aaaaaaccag 600 tactaccttc agctcaatag tgtgaccaca gaagacaccg ccacctatta ctgcgcaagg 660 ggcgaaataa catattactt cgactactgg ggccagggga ctaccttgac cgtaagcagc 720 <210> 88 <211> 107 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> 6V12 VL <400> 88 Glu Thr Thr Leu Thr Gin Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gin Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 89 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V12 VH <400> 89 Gln Val Gin Leu Gin Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gin 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Thr Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Met Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gin Phe Phe 65 70 75 80 Leu Lys Leu Asn Phe Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu Ile Thr Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 90 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V12 ScFv <400> 90 Glu Thr Thr Leu Thr Gin Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu lie 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gin Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gin Val Gin Leu Gin Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gin Thr Leu Ser Leu Thr Cys 130 135 140 Thr Val Thr Ala Tyr Ser lie Thr Ser Asp Tyr Ala Trp Asn Trp lie 145 150 155 160 Arg Gin Phe Pro Gly Asn Lys Leu Glu Trp Met Gly Tyr lie Ser Tyr 165 170 175 Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg lie Ser lie 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gin Phe Phe Leu Lys Leu Asn Phe Val 195 200 205 Thr Thr Gin Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Gin lie Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gin Gin Gin Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 91 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V12 ScFv <400> 91 gaaaccacgt tgacacaatc tcctgctaca ctgtcagtga gccccggaga aaaagtcatc 60 atccggtgca tcacatccac agacattgac gaggatatga actggtatca acagaagccc 120 ggacaacctc caaaactgct gatctcagaa ggcaacactc tcaggcctgg cgtcccatct 180 cgctttagct caagtggctc tggaaccgac ttcacactga ctatttcctc cttgcagcct 240 gaagacgtgg cgacatacta ctgcctccaa tccaataaca tgcccctgac ctttggggct 300 ggcacaaagc tggagcttaa aggtggtggt ggatctggtg gaggtggatc tgggggtggg 360 ggaagtcagg tgcaactgca agagtccggg cctggactgg tgaaacccag ccaaaccttg 420 agcctgacgt gtacagtgac agcctacagc attacatccg attatgcctg gaattggatc 480 cgccagtttc caggaaataa gttggagtgg atgggctaca tctcctacag cggttttacc 540 aggtacaacc catccctgaa aagccgcatc agtattacca gagacacttc aaagaaccaa 600 tttttcctga agctgaactt tgtcaccaca gaggacactg ccacttacta ttgcgcccgc 660 ggggagatta cttattactt cgactattgg ggccaaggga ccaccctgac tgtatcttcc 720 <210> 92 <211> 107 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> 6V13 VL <400> 92 Glu Thr Thr Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val Ile Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 93 <211> 118 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V13 VH <400> 93 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Ala Tyr Ser Ile Thr Ser Asp 20 25 30 Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Ile Gly Tyr Ile Ser Tyr Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg lie Ser lie Thr Arg Asp Thr Ser Lys Asn Gin Tyr Tyr 65 70 75 80 Leu Gin Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Glu lie Thr Tyr Tyr Phe Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 94 <211> 240 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V13 ScFv <400> 94 Glu Thr Thr Leu Thr Gin Ser Pro Ala Thr Leu Ser Val Ser Pro Gly 1 5 10 15 Glu Lys Val lie lie Arg Cys lie Thr Ser Thr Asp lie Asp Glu Asp 20 25 30 Met Asn Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu lie 35 40 45 Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Leu Gln Ser Asn Asn Met Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu 115 120 125 Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys 130 135 140 Thr Val Ser Ala Tyr Ser Ile Thr Ser Asp Tyr Ala Trp Asn Trp Ile 145 150 155 160 Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Ile Gly Tyr Ile Ser Tyr 165 170 175 Ser Gly Phe Thr Arg Tyr Asn Pro Ser Leu Lys Ser Arg Ile Ser Ile 180 185 190 Thr Arg Asp Thr Ser Lys Asn Gln Tyr Tyr Leu Gln Leu Asn Ser Val 195 200 205 Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Gly Glu Ile Thr 210 215 220 Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 225 230 235 240 <210> 95 <211> 720 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 6V13 ScFv <400> 95 gaaacaaccc tcacacagtc tcccgctaca ttgtctgtat ctccaggcga aaaggtaatc 60 attagatgca taacatccac agacatcgat gaggacatga attggtatca gcaaaagcct 120 ggacagcccc ctaaactgct catttctgag ggcaacaccc tgcgacctgg tgttcctagt 180 cgcttctcct caagtgggag cggaaccgac ttcaccttga ccatctccag cctgcagcca 240 gaagacgtag ccacttatta ttgcctgcag agcaacaaca tgccactgac ctttggggct 300 ggaactaagc tcgaacttaa aggtggggga ggtagtggtg gtggaggctc aggtggcgga 360 ggaagtcagg tgcagctcca ggaatctgga cctggcctgg tgaagccatc tcagactctg 420 tccttgacct gcacagtgag tgcttactcc atcaccagcg attatgcctg gaattggatc 480 cggcagttcc ctggcaacaa actcgaatgg atcggataca ttagttattc cgggtttacg 540 agatacaacc caagcctgaa gagtaggatt agcatcacga gggacactag caaaaatcag 600 tactacctgc agctgaattc tgtaaccacg gaggacaccg ccacctatta ctgcgccaga 660 ggcgagatca cttattactt tgactattgg ggccagggga ccacactgac cgtgagtagt 720

Claims

1. An antibody targeting ROR1, comprising CDR-L1 as shown in SEQ ID NO: 16, CDR-L2 as shown in SEQ ID NO: 17, CDR-L3 as shown in SEQ ID NO: 18, CDR-H1 as shown in SEQ ID NO: 19, CDR-H2 as shown in SEQ ID NO: 20, and CDR-H3 as shown in SEQ ID NO:

21.

2. The antibody of claim 1, wherein the antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region having at least 90% identity with an amino acid sequence selected from SEQ ID NO: 34, 69, 73, 77, 81, 85, 89 and 93, or having one or more conserved modifications of amino acids compared to an amino acid sequence selected from SEQ ID NO: 34, 69, 73, 77, 81, 85, 89 and 93; the light chain variable region having at least 90% identity with an amino acid sequence selected from SEQ ID NO: 33, 68, 72, 76, 80, 84, 88 and 92, or having one or more conserved modifications of amino acids compared to an amino acid sequence selected from SEQ ID NO: 33, 68, 72, 76, 80, 84, 88 and 92.

3. The antibody of claim 1, wherein the amino acid sequence of the antibody has at least 90% identity with the amino acid sequences selected from SEQ ID NO: 35, 70, 74, 78, 82, 86, 90 and 94, or has one or more conserved modifications of amino acids compared with the amino acid sequences selected from SEQ ID NO: 35, 70, 74, 78, 82, 86, 90 and 94.

4. The antibody according to any one of claims 1-3, wherein the antibody is a murine antibody, a chimeric antibody, or a humanized antibody.

5. The antibody of claim 4, wherein the antibody is selected from IgG, Fab, Fab', F(ab')2, Fv, scFv, sdFv, linear antibodies, and dimeric antibodies.

6. A nucleic acid molecule encoding the antibody according to any one of claims 1-5.

7. The nucleic acid molecule of claim 6, which has at least 90% sequence identity with the nucleotide sequences selected from SEQ ID NO: 39-43, and whose encoded antibody is capable of specifically binding to ROR1.

8. A multispecific antibody comprising the antibody according to any one of claims 1-5 and one or more second antibodies or their antigen-binding portions that specifically bind to other antigens.

9. The multispecific antibody of claim 8, wherein the second antibody or its antigen-binding portion is selected from full-length antibodies, Fab, Fab', (Fab')2, Fv, scFv, scFv-scFv, microantibodies, biantibodies, or sdAb.

10. A vector comprising a nucleic acid molecule encoding an antibody according to any one of claims 1-5 or a multispecific antibody according to claim 8 or 9.

11. A host cell expressing the antibody according to any one of claims 1-5 or the multispecific antibody according to claim 8 or 9.

12. A recombinant receptor comprising the antibody of any one of claims 1-5 or the multispecific antibody of claim 8 or 9, wherein the recombinant receptor is a recombinant TCR receptor or a chimeric antigen receptor.

13. The recombinant receptor of claim 12, further comprising a transmembrane domain and an intracellular signal transduction domain.

14. The recombinant receptor of claim 13, wherein the transmembrane domain is selected from the transmembrane domains of the following proteins: TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, CD3ζ subunit, CD3ε subunit, CD3γ subunit, CD3δ subunit, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, and CD154.

15. The recombinant receptor of claim 13, wherein the intracellular signal transduction domain is selected from the intracellular regions of the following proteins: FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, CD79a, CD79b, and CD66d.

16. The recombinant receptor of claim 13, wherein the recombinant receptor further comprises one or more co-stimulatory domains selected from the co-stimulatory signal transduction domains of the following proteins: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, ROR1, CD8, CD18 (LFA-1), CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD270 (HVEM), CD272 (BTLA), CD276 (B7-H3), CD278 (ICOS), CD357 (GITR), DAP10, LAT, NKG2C, SLP76, PD-1, LIGHT, TRIM, and ZAP70.

17. An engineered immune cell comprising the recombinant receptor as described in any one of claims 12-16.

18. The engineered immune cells of claim 17, wherein the cells are selected from T cells, NK cells, NKT cells, macrophages, and dendritic cells.

19. The engineered immune cell of claim 18, further comprising a second chimeric antigen receptor that targets other tumor antigens.

20. The engineered immune cells according to any one of claims 17-19 further comprise that the expression of at least one gene selected from the group consisting of: TRAC, TRBC, HLA-A, HLA-B, HLA-C, B2M, RFX5, RFXAP, RFXANK, CIITA, PD1, LAG3, TIM3, and CTLA4 is suppressed or silenced.

21. An antibody conjugate comprising the antibody of any one of claims 1-5 or the multispecific antibody of claim 8 or 9, and a second functional structure, wherein the second functional structure is selected from Fc, a radioisotope, a structural portion with extended half-life, and a detectable marker.

22. The antibody conjugate of claim 21, wherein the structural portion for extending the half-life is selected from: albumin-binding structures, transferrin-binding structures, polyethylene glycol molecules, recombinant polyethylene glycol molecules, human serum albumin, and fragments of human serum albumin; and the detectable marker is selected from fluorophores, chemiluminescent compounds, bioluminescent compounds, enzymes, antibiotic resistance genes, and contrast agents.

23. A detection kit comprising the antibody of any one of claims 1-5, the multispecific antibody of claim 8 or 9, the recombinant receptor of any one of claims 12-16, the engineered immune cell of any one of claims 17-20, or the antibody-drug conjugate of claim 21 or 22.

24. A pharmaceutical composition comprising an antibody according to any one of claims 1-5, a multispecific antibody according to claim 8 or 9, a recombinant receptor according to any one of claims 12-16, an engineered immune cell according to any one of claims 17-20, or an antibody-drug conjugate according to claim 21 or 22, and one or more pharmaceutically acceptable excipients.

25. Use of the antibody of any one of claims 1-5, the multispecific antibody of claim 8 or 9, the recombinant receptor of any one of claims 12-16, the engineered immune cell of any one of claims 17-20, or the antibody-drug conjugate of claim 21 or 22, or the pharmaceutical composition of claim 24 in the preparation of a medicament for treating and / or diagnosing diseases associated with ROR1 expression; wherein the diseases associated with ROR1 expression are selected from B-cell leukemia, lymphoma, neuroblastoma, renal cell carcinoma, colorectal cancer, breast cancer, squamous cell carcinoma, melanoma, myeloma, gastric cancer, brain cancer, lung cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, prostate cancer, testicular cancer, thyroid cancer, uterine cancer, adrenal cancer, and head and neck cancer.

Images