A SSR molecular marker primer set for rapid identification of Aesculus hippocastanum germplasm resources and its application

Abstract

The present invention discloses a primer set for rapid identification of Aesculus hippocastanum germplasm resources using capillary electrophoresis technology and its application. The primer base sequences are shown in SEQ ID NOs. 1-16. This invention enables rapid identification of Aesculus hippocastanum germplasm resources at the molecular level, unaffected by season, plant development period, and growth environment. It also provides reference and support for genetic diversity assessment, phylogenetic relationship analysis, and new variety protection of Aesculus hippocastanum germplasm resources.

Description

Technical Field

[0001] The present invention relates to the technical field of SSR molecular markers, in particular to SSR molecular marker primers for horse chestnut, and also to the application of the primers in identification and evaluation of horse chestnut germplasm resources, kinship analysis and protection of new variety rights. Background Art

[0002] Horse chestnut ( Chinese esculentus Bunge is a genus of the Hippocastanaceae family ( Aesculus. L) This broad-leaved tree is a rare species for viewing its foliage, flowers, and fruits. It is hailed as one of the world's four most famous ornamental trees and one of the world's four most beautiful street trees. It is native to the Yellow River Basin, eastern provinces, northern China, and northwestern China. It has strong adaptability and can withstand various adverse environments such as drought, sandstorms, saline-alkali soils, pollution, and cold weather, even reaching temperatures as low as -25°C. It tolerates partial shade and is not very particular about soil type, growing well in acidic, calcareous, and streamside gravel soils. It is an important timber forest, ecological protection forest, ornamental garden, and medicinal tree species in my country, with significant application value and broad market demand.

[0003] Traditional tree variety identification relies primarily on morphological differences in vegetative and reproductive organs, which are significantly affected by the environment and growth stage. This method cannot be effectively applied to young trees in their early stages. Furthermore, for varieties with similar phenotypic traits or close genetic relationships, unintentional interbreeding, inter-lineage mixing, and inter-plant mixing, as well as intentional copyright infringement, can easily occur. This creates significant inconvenience for production, scientific research, and the protection of new plant varieties. With the continuous development of molecular biology, DNA molecular markers are widely used for variety identification and revealing genetic diversity within tree species.

[0004] Since SSR markers can be used to identify varieties at the molecular level, they are accurate to the single nucleotide level, have high stability, good repeatability, good polymorphism, are more convincing, and can identify whether the detected site is homozygous or heterozygous. Therefore, it is very necessary to develop highly polymorphic SSR molecular markers for horse chestnuts and construct fingerprint maps for horse chestnut germplasm resources. This has important practical significance for solving the identification problems of horse chestnut germplasm resources in my country, genetic diversity evaluation, and early breeding of improved varieties.

[0005] However, so far there have been no research reports on the development and utilization of SSR molecular markers for Aesculus hippocastanum at home and abroad, nor have there been any polymorphic SSR primers for rapid identification of Aesculus hippocastanum germplasm resources using fluorescent SSR marker technology. Summary of the Invention

[0006] In view of the above-mentioned defects or deficiencies in the prior art, the present application hopes to provide an EST-SSR molecular marker primer for identifying Aesculus hippocastanum germplasm resources using SSR molecular markers.

[0007] The present application also provides the use of the above-mentioned Aesculus hippocastanum SSR molecular marker primers in the identification of Aesculus hippocastanum germplasm resources.

[0008] In order to achieve the above-mentioned purpose, the present invention is implemented by the following technical solutions:

[0009] A primer set for rapid identification of SSR molecular markers of Aesculus hippocastanum germplasm resources based on capillary electrophoresis technology is characterized by the following base sequences:

[0010] Primer 1: upstream primer 5'GTGGCCCATACCAGTAGAGC'3 (e.g., SEQ ID NO. 1), downstream primer 5'GCTTTTGGGTGCTGTTGAGG'3 (e.g., SEQ ID NO. 2);

[0011] Primer 2: upstream primer 5'ATTCCGCACAACTCACCAGT'3 (e.g., SEQ ID NO. 3), downstream primer 5'GCAGGAAACAGAGCACTTGC'3 (e.g., SEQ ID NO. 4);

[0012] Primer 3: upstream primer 5'TCTGCTTTGACCTCGCCATT'3 (e.g., SEQ ID NO. 5), downstream primer 5'GCTGTCTCCTTTGACGGTGA'3 (e.g., SEQ ID NO. 6);

[0013] Primer 4: upstream primer 5'CGGTCCCATTCAACTCACGA'3 (e.g., SEQ ID NO. 7), downstream primer 5'TTTCACGATCTCCGGCGTAG'3 (e.g., SEQ ID NO. 8);

[0014] Primer 5: upstream primer 5'GCAGCATCTCCAGCCTTAGT'3 (e.g., SEQ ID NO. 9), downstream primer 5'AATTTGGTTGCAAGCGCCTT'3 (e.g., SEQ ID NO. 10);

[0015] Primer 6: upstream primer 5'GTCTGTCCGTCCGCGATTAT'3 (e.g., SEQ ID NO. 11), downstream primer 5'CGCAAACTTGTCGACGGATC'3 (e.g., SEQ ID NO. 12);

[0016] Primer 7: upstream primer 5'CCCTGGAGGCACAAACTGAT'3 (e.g., SEQ ID NO. 13), downstream primer 5'AGTCCACATCTCACTGCTGC'3 (e.g., SEQ ID NO. 14);

[0017] Primer 8: upstream primer 5'CCAACTCGGCCATCTTGACT'3 (eg, SEQ ID NO. 15), downstream primer 5'GGAAGAAATGGCGCATGCTT'3 (eg, SEQ ID NO. 16).

[0018] The invention relates to an application of the Aesculus hippocastanum SSR molecular marker primers in identifying Aesculus hippocastanum germplasm resources.

[0019] The application comprises the following steps:

[0020] (1) Extraction of genomic DNA from Aesculus hippocastanum;

[0021] (2) using the above-mentioned Aesculus hippocastanum SSR molecular marker primer set to perform PCR amplification on the DNA extracted in step (1);

[0022] (3) detecting the number of alleles in the PCR product amplified in step (2) by capillary electrophoresis;

[0023] (4) Based on the banding results of each pair of SSR primers, the SSR fingerprint of the Aesculus hippocastanum germplasm resources was formed.

[0024] Preferably, the PCR amplification program in step (2) is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 20 cycles; extension at 72°C for 10 min.

[0025] Preferably, the M13 linker screening PCR amplification in step (2) adopts a 20 μL system: DNA (20 ng·μL -1 ) 0.5 μL, 2× Taq PCR Master Mix 10 μL, 10 μM concentration of M13F / F / R 0.2 / 0.1 / 0.3 μL, sterile deionized water 8.9 μL.

[0026] Preferably, the capillary electrophoresis detection step in step (3) is as follows: 0.3 μL of each PCR amplification product of step (2), 0.5 μL of molecular weight internal standard and 9.5 μL of deionized formamide are mixed and added to the PCR plate, denatured at 95°C for 5 minutes, cooled at 4°C and centrifuged, and then detected by the machine with 1× Buffer.

[0027] Preferably, the detection is performed using a capillary electrophoresis instrument ABI3730XL, and the detection parameters are as follows: operating voltage 15.0 kV, injection voltage 1.6 kV, injection duration 15 s, and regulated current 30.0 μA.

[0028] The invention relates to an application of the Aesculus hippocastanum SSR molecular marker primer set in the identification of Aesculus hippocastanum germplasm resources, molecular marker-assisted breeding and genetic diversity evaluation.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention realizes the rapid identification of Aesculus hippocastanum germplasm resources at the molecular level, which is not affected by season, plant development period and growth environment, and provides a reference and basis for the rapid identification of Aesculus hippocastanum germplasm resources, protection of new varieties, genetic diversity evaluation and molecular marker-assisted breeding.

[0031] The primer set exemplified in the present invention has a range of 7-11 alleles with an average of 8.00 when the sample size of Aesculus hippocastanum is 8 (Table 1); the effective allele number is Don't Between 4.92 and 9.14, with an average of 6.126; Shannon Information Index I Between 1.75-2.31, with an average of 1.92; expected heterozygosity Hey The values ​​ranged from 0.797 to 0.891, with an average of 0.831. The above genetic diversity parameters fully demonstrated that the eight SSR primer pairs were polymorphic, efficient, and applicable.

[0032] Table 1: 8 pairs of EST-SSR primers and genetic diversity

[0033]

[0034] Note: N represents the sample size; Na represents the number of alleles; Don't represents the effective number of alleles; I represents the Shannon information index; Oh represents the observed heterozygosity; Hey represents the expected heterozygosity.

[0035] The fingerprints of the above 8 samples were constructed by using the above 8 primer combinations as shown in Table 2, and the sources of the 8 samples are shown in Table 3. It can be seen that any one pair of SSR primers, primer 2, primer 3, primer 6 or primer 8 provided by the present invention, can completely distinguish the 8 Aesculus hippocastanum germplasm resources. Primer 1, primer 4, primer 5 and primer 7 can all distinguish the 6 germplasm resources. The fingerprint band patterns of the SSR loci corresponding to the 8 primer pairs in different Aesculus hippocastanum are shown in Table 2. Figure 1~Figure 4The test results of these primers or primer combinations have good repeatability and high polymorphism, and can quickly, accurately and efficiently complete the identification of horse chestnut germplasm resources.

[0036] Table 2: Fingerprints constructed from 8 EST-SSR primer combinations

[0037]

[0038] Table 3: Sources of 8 genetic resources

[0039] BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a capillary electrophoresis diagram of some PCR amplification products of SSR primers 3 and 8 according to an embodiment of the present invention.

[0041] Figure 2 Capillary electrophoresis diagram of some PCR amplification products of SSR primers 1 and 2 according to an embodiment of the present invention.

[0042] Figure 3 This is a capillary electrophoresis diagram of some PCR amplification products of SSR primers 4 and 5 according to an embodiment of the present invention.

[0043] Figure 4 This is a capillary electrophoresis diagram of some PCR amplification products of SSR primers 6 and 7 according to an embodiment of the present invention. DETAILED DESCRIPTION

[0044] In order to better understand the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments.

[0045] Example 1

[0046] The SSR molecular marker primers for rapid identification of Aesculus hippocastanum germplasm resources were obtained by the following steps:

[0047] 1. Extraction of Total RNA and Transcriptome Sequencing of Aesculus hippocastanum

[0048] Total RNA was extracted from Aesculus hippocastanum using Trizol reagent. All pipette tips, mortars, and spoons used in the experiment were treated with DEPC (diethylpyrocarbonate) for 4 hours and then sterilized by autoclaving for 1 hour. Total RNA was then extracted according to the Trizol reagent protocol. The integrity of the extracted RNA was assessed by electrophoresis on a 1.0% nondenaturing agarose gel. The purity and concentration of the extracted RNA were determined using a Nanodrop (IMPLEN, CA, USA) instrument (OD 260 / 230 ratio and OD 260 / 280 ratio). RNA integrity was assessed using an Agilent 2100 (Agilent Technologies, CA, USA).

[0049] After the RNA sample passes the test, in order to ensure high-quality transcriptome data, it must go through procedures such as library construction and library testing.

[0050] The specific steps are as follows:

[0051] ① Enrich mRNA using magnetic beads with Oligo (dT);

[0052] ② Use fragmentation buffer to break the mRNA into small fragments. Then, use the mRNA as a template to synthesize single-strand cDNA. Then, add buffer, dNTPs, DNA polymerase I, and RNase H to synthesize double-stranded cDNA. Finally, use AMPure XP magnetic beads to purify the double-stranded cDNA.

[0053] ③ Repair the ends of the purified double-stranded cDNA, add A tails and connect adapters;

[0054] ④ Use AMPure XP magnetic beads to select the size fragments, followed by PCR amplification, and purify the PCR products again with magnetic beads to establish a library;

[0055] ⑤ Initially test the library quality using Qubit 2.0 and dilute the library. Next, use an Agilent 2100 to check insert size. Once qualified, use quantitative PCR to determine the effective concentration of the library to ensure that the library quality meets the required standards. Qualified libraries are then pooled onto flow cells at the effective concentration, clustered using cBOT, and sequenced using an Illumina high-throughput sequencing platform (HiSeq PE150). After the sequencing quality assessment is qualified, clean reads are spliced ​​using Trinity software, and the Unigenes library is assembled using Cap3 software. The default parameters for Trinity and Cap3 are used.

[0056] 2. SSR locus development

[0057] The Unigenes library of Aesculus hippocastanum was searched for SSR loci using the MISA program with default parameters; MISA software (version 1.0, default parameters) was used to search for SSRs with the following criteria: the minimum number of repeats of 10, 6, 6, 6, 6, and 6 containing 1, 2, 3, 4, 5, and 6 nucleotides, respectively.

[0058] 3. SSR Primer Design

[0059] Primer 3.0 software was used to design SSR primers for Aesculus hippocastanum using the default parameters.

[0060] 4. Extraction of Aesculus hippocastanum genomic DNA

[0061] This experiment used 8 Aesculus hippocastanum germplasm resources as test materials. 1-8 are Aesculus chinensis ( Chinese esculentus Bunge), Aesculus hippocastanum 123 ( Horse chestnut tree L.), Aesculus hippocastanum 124 ( Horse chestnut tree L.), Tianshi chestnut 50 ( Aesculus wilsonii Rehd. 50)、Tianshi Li 78( Aesculus wilsonii Rehd. 78)、Tianshi Li 8( Aesculus wilsonii Rehd. 8), Aesculus hippocastanum ( Aesculus pavia L.), Aesculus hippocastanum 98 ( Horse chestnut tree L.). Materials were collected from the state-owned Daqingshan Forest Farm in Fei County, Shandong Province. Young leaves were collected, dried on silica gel, and set aside. Extraction was performed using the Plant Tissue Genomic DNA Extraction Kit (Magnetic Bead Method) (Cat. No. PTED-6030) from Yingruicheng Biochemical Technology (Shanghai) Co., Ltd. according to the manufacturer's instructions.

[0062] 5. PCR amplification using SSR primers

[0063] The total DNA sample of Aesculus hippocastanum extracted in step 4 was used as a template and the following 8 pairs of primers were used for SSR-PCR amplification. The present invention uses an M13 linker for labeling, and the primers can also be labeled with four fluorescent markers: FAM, HEX, ROX or TAMRA.

[0064] Primer 1: upstream primer 5'GTGGCCCATACCAGTAGAGC'3 (e.g., SEQ ID NO. 1), downstream primer 5'GCTTTTGGGTGCTGTTGAGG'3 (e.g., SEQ ID NO. 2);

[0065] Primer 2: upstream primer 5'ATTCCGCACAACTCACCAGT'3 (e.g., SEQ ID NO. 3), downstream primer 5'GCAGGAAACAGAGCACTTGC'3 (e.g., SEQ ID NO. 4);

[0066] Primer 3: upstream primer 5'TCTGCTTTGACCTCGCCATT'3 (e.g., SEQ ID NO. 5), downstream primer 5'GCTGTCTCCTTTGACGGTGA'3 (e.g., SEQ ID NO. 6);

[0067] Primer 4: upstream primer 5'CGGTCCCATTCAACTCACGA'3 (e.g., SEQ ID NO. 7), downstream primer 5'TTTCACGATCTCCGGCGTAG'3 (e.g., SEQ ID NO. 8);

[0068] Primer 5: upstream primer 5'GCAGCATCTCCAGCCTTAGT'3 (e.g., SEQ ID NO. 9), downstream primer 5'AATTTGGTTGCAAGCGCCTT'3 (e.g., SEQ ID NO. 10);

[0069] Primer 6: upstream primer 5'GTCTGTCCGTCCGCGATTAT'3 (e.g., SEQ ID NO. 11), downstream primer 5'CGCAAACTTGTCGACGGATC'3 (e.g., SEQ ID NO. 12);

[0070] Primer 7: upstream primer 5'CCCTGGAGGCACAAACTGAT'3 (e.g., SEQ ID NO. 13), downstream primer 5'AGTCCACATCTCACTGCTGC'3 (e.g., SEQ ID NO. 14);

[0071] Primer 8: upstream primer 5'CCAACTCGGCCATCTTGACT'3 (eg, SEQ ID NO. 15), downstream primer 5'GGAAGAAATGGCGCATGCTT'3 (eg, SEQ ID NO. 16).

[0072] The above SSR-PCR used a 20 μl system: 0.5 μL of DNA (20 ng μL-1), 10 μL of 2× Taq PCR Master Mix, 0.2 / 0.1 / 0.3 μL of 10 μM concentration of M13F / F / R, and 8.9 μL of sterile deionized water.

[0073] The fluorescent primer PCR amplification program used was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 20 cycles; and extension at 72°C for 10 min.

[0074] 6. Capillary electrophoresis detection

[0075] PCR products were analyzed for allele count using an ABI 3730XL capillary electrophoresis instrument. A mixture of 0.3 μL of each PCR product, 0.5 μL of molecular weight internal standard (ABI), and 9.5 μL of deionized formamide (ABI) was added to the PCR plate, denatured at 95°C for 5 minutes, cooled to 4°C, and centrifuged. The assay was performed using 1× buffer. The genetic analyzer was manufactured by ABI, model 3730XL DNA analyzer. The parameters used were as follows: operating voltage 15.0 kV, injection voltage 1.6 kV, injection duration 15 seconds, and constant current 30.0 μA.

[0076] 7. Primer Screening

[0077] The present invention initially randomly selected 58 pairs of primers from the designed primers and added 2 pairs of primers selected from the polymorphic primers of Robinia pseudoacacia for amplification of Aesculus hippocastanum. The test results showed that the PCR amplification result of the two pairs of polymorphic EST-SSR primers of Robinia pseudoacacia was 0, indicating that due to the genetic differences of species, SSR primers in different families are not universal, so it is necessary to design and screen special EST-SSR primers for Aesculus hippocastanum in order to carry out the next step of research. In addition, 48 pairs of 58 pairs of Aesculus hippocastanum SSR primers obtained PCR products, of which 31 pairs had high polymorphism, and their average allele number in 8 samples was 0. Na The average effective number of alleles is 5.387; Don't The average Shannon information index is 3.628; I The average observed heterozygosity was 1.380; Oh The average expected heterozygosity is 0.476; Hey The 8 pairs of SSR primers provided by the present invention are primers with higher polymorphism that were further screened out from the above 31 pairs of primers with higher polymorphism. The average values ​​of the five genetic diversity parameters are 7.75, 5.615, 1.870, 0.656 and 0.821, respectively, which are all greater than the average values ​​of the original 31 pairs of primers.

[0078] 8. SSR fingerprint construction and molecular identification

[0079] Genemarker2.2.0 software was used for data analysis. The SSR fingerprint of each germplasm resource was formed according to the peak value of each pair of SSR primers. The germplasm resources of Aesculus hippocastanum were identified based on the differences in the fingerprints.

[0080] The fingerprints of the eight samples constructed by the above eight pairs of SSR primer combinations are shown in Table 2. It can be seen that the eight Aesculus hippocastanum germplasm resources can be completely distinguished by using only one pair of primers, primer 2, primer 3 or primer 8 provided by the present invention. The eight Aesculus hippocastanum germplasm resources can also be completely distinguished by using the combination of primer 1 and primer 6, or primer 7 and primer 6. The fingerprint band patterns of the SSR loci corresponding to the eight pairs of primers in different Aesculus hippocastanum are shown in Table 2. Figure 1 The test results of these primers or primer combinations have good repeatability and high polymorphism, and can quickly, accurately and efficiently complete the identification of horse chestnut germplasm resources.

[0081] The above description is merely a preferred embodiment of the present application and an illustration of the technical principles employed. Those skilled in the art should understand that the scope of the invention herein is not limited to the technical solutions formed by the specific combination of the above-mentioned technical features, but also encompasses other technical solutions formed by any combination of the above-mentioned technical features or their equivalents without departing from the inventive concept. For example, a technical solution formed by replacing the above-mentioned features with (but not limited to) technical features having similar functions disclosed in this application.

Claims

1. A primer set for rapid identification of SSR molecular markers of Aesculus hippocastanum germplasm resources based on capillary electrophoresis technology, characterized by: The base sequence is as follows: Primer 1: upstream primer 5'GTGGCCCATACCAGTAGAGC'3 (SEQ ID NO. 1), downstream primer 5'GCTTTTGGGTGCTGTTGAGG'3 (SEQ ID NO. 2); Primer 2: upstream primer 5'ATTCCGCACAACTCACCAGT'3 (SEQ ID NO. 3), downstream primer 5'GCAGGAAACAGAGCACTTGC'3 (SEQ ID NO. 4); Primer 3: upstream primer 5'TCTGCTTTGACCTCGCCATT'3 (SEQ ID NO. 5), downstream primer 5'GCTGTCTCCTTTGACGGTGA'3 (SEQ ID NO. 6); Primer 4: upstream primer 5'CGGTCCCATTCAACTCACGA'3 (SEQ ID NO. 7), downstream primer 5'TTTCACGATCTCCGGCGTAG'3 (SEQ ID NO. 8); Primer 5: upstream primer 5'GCAGCATCTCCAGCCTTAGT'3 (SEQ ID NO. 9), downstream primer 5'AATTTGGTTGCAAGCGCCTT'3 (SEQ ID NO. 10); Primer 6: upstream primer 5'GTCTGTCCGTCCGCGATTAT'3 (SEQ ID NO. 11), downstream primer 5'CGCAAACTTGTCGACGGATC'3 (SEQ ID NO. 12); Primer 7: upstream primer 5'CCCTGGAGGCACAAACTGAT'3 (SEQ ID NO. 13), downstream primer 5'AGTCCACATCTCACTGCTGC'3 (SEQ ID NO. 14); Primer 8: upstream primer 5'CCAACTCGGCCATCTTGACT'3 (SEQ ID NO. 15), downstream primer 5'GGAAGAAATGGCGCATGCTT'3 (SEQ ID NO. 16).

2. Use of the Aesculus hippocastanum SSR molecular marker primer set according to claim 1 in identifying Aesculus hippocastanum germplasm resources, evaluating genetic diversity, and analyzing kinship.

3. The application according to claim 2, characterized in that: Steps: (1) Extraction of genomic DNA from Aesculus hippocastanum; (2) performing PCR amplification on the DNA extracted in step (1) using the Aesculus hippocastanum SSR molecular marker primer set according to claim 1; (3) detecting the number of alleles in the PCR product amplified in step (2) by capillary electrophoresis; (4) Based on the banding results of each pair of SSR primers, the SSR fingerprint of the Aesculus hippocastanum germplasm resources was formed; (5) Genetic diversity evaluation, kinship analysis and germplasm resource identification based on the banding results of each pair of SSR primers.

4. The use according to claim 3, characterized in that: The PCR amplification program in step (2) is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 20 cycles; and extension at 72°C for 10 min.

5. The use according to claim 3, characterized in that: In step (2), PCR amplification adopts a 20 μL system: DNA 20 ng·μL -1 0.5μL, 2×Taq PCR Master Mix 10μL, 10μM concentration of M13F / F / R 0.2 / 0.1 / 0.3μL, sterile deionized water 8.9μL.

6. The use according to claim 3, characterized in that: The capillary electrophoresis detection step in step (3) is as follows: 0.3 μL of each PCR amplification product of step (2), 0.5 μL of molecular weight internal standard and 9.5 μL of deionized formamide are mixed and added to the PCR plate, denatured at 95° C. for 5 min, cooled at 4° C. and centrifuged, and then detected by the machine using 1× Buffer.

7. The use according to claim 3, characterized in that: The detection was performed using a capillary electrophoresis instrument ABI3730XL, and the detection parameters were as follows: operating voltage 15.0 kV, injection voltage 1.6 kV, injection duration 15 s, and regulated current 30.0 μA.

Images