A biomarker for cervical cancer and its application

Abstract

The present invention first discloses a biomarker DDOST that can be used for the diagnosis and treatment of cervical cancer. This biomarker DDOST affects the malignant phenotype of cervical cancer cells, and its expression is negatively correlated with the prognosis of cervical cancer. Knocking down DDOST can inhibit tumor growth, proliferation, migration and invasion, and promote apoptosis. Further, the present invention also provides an interacting protein SMARCA4 that can synergistically promote the progression of cervical cancer with DDOST. In addition, the present invention also provides the application of DDOST as a biomarker for screening cervical cancer and a drug target for the diagnosis and treatment of cervical cancer, which has greatly promoted the clinical diagnosis and treatment and scientific research of cervical cancer.

Description

Technical Field

[0001] The present invention relates to the field of tumors. More specifically, the present invention relates to a biomarker for cervical cancer and its application. Background Art

[0002] Cervical cancer is one of the common malignant tumors in the world and is also a major cause of cancer death in women. Despite the widespread application of early screening programs and various treatment strategies, the prognosis of advanced cervical cancer patients remains poor compared to early-stage patients. Once distant metastasis occurs in cervical cancer patients, it is rarely curable, and the 5-year survival rate drops sharply from over 80% in stage I to less than 20% in stage IV. Given the high incidence of cervical cancer globally, especially in developing countries, it is necessary to further estimate metastatic biomarkers and determine the involved molecular mechanisms.

[0003] DDOST is a polypeptide subunit identified from pancreatic microsomal membranes, and its genomic sequence was first reported by Momoi in 1997. The conserved protein AGER1 encoded by it participates in the AGE cycle and clearance as a related receptor. Alternatively, the AGER1 protein glycosylates the amino terminus of key kidney proteins to maintain kidney health and function. Two clinical studies with conflicting conclusions reported the involvement of AGER1 in the progression of diabetic nephropathy. The role of DDOST in glycosylation disorders, diabetes, and non-alcoholic steatohepatitis is still unclear. SMARCA4 encodes a protein of the same name, which is necessary for activating the transcription of certain genes. It acts as a tumor suppressor and is inactivated in tumors without available drugs. Recently, the alteration spectrum of SMARCA4 in solid tumor patients has been elucidated. Multiple tumors have been shown to be related to defects or mutations in SMARCA4. Impaired DDOST expression usually leads to the accumulation of AGEs, resulting in the pathogenesis of hyperglycemia and aging. However, most of the limited studies have reported the correlation between DDOST and non-tumor diseases. Its potential oncogenic role in tumors, especially in cervical cancer, remains unclear. Summary of the Invention

[0004] In order to make up for the defects existing in the prior art, the present invention first discloses the biological function of DDOST in cervical cancer and finds that DDOST promotes tumor growth, proliferation, migration, and invasion. These malignant phenotypes can be inhibited by knocking down DDOST both in vitro and in vivo. More specifically, the present invention provides the following technical solutions:

[0005] In the first aspect of the present invention, there is provided an application of a reagent for detecting a biomarker in a sample in the preparation of a product for diagnosing cervical cancer, wherein the biomarker includes DDOST, and the diagnosis includes diagnosing the progression of cervical cancer.

[0006] In one embodiment, the reagent for detecting biomarkers in the test sample includes a reagent for detecting the mRNA expression level of the biomarker in the test sample or a reagent for detecting the protein expression level of the biomarker in the test sample.

[0007] In one embodiment, the biomarker further includes SMARCA4.

[0008] In the second aspect of the present invention, there is provided a product for diagnosing cervical cancer progression, wherein the product includes a reagent for detecting the biomarker DDOST.

[0009] In one embodiment, the product further includes a reagent for detecting the biomarkers DDOST and SMARCA4.

[0010] In one embodiment, the product includes a kit, a chip, a test strip, and a high-throughput sequencing platform.

[0011] In the third aspect of the present invention, there is provided an application of a reagent for downregulating the expression level of DDOST in the preparation of a drug for treating cervical cancer.

[0012] In one embodiment, the reagent is shRNA.

[0013] In one embodiment, the drug further contains a reagent for downregulating the expression level of SMARCA4.

[0014] In the fourth aspect of the present invention, there is provided an application of DDOST in the preparation of a product for screening poor survival rate of cervical cancer.

[0015] The present invention has achieved the following remarkable progress compared with the prior art :

[0016] 1. The present invention first discloses the effect of DDOST on the malignant phenotype of cervical cancer cells: the expression of DDOST is negatively correlated with the prognosis; it reveals the promoting effect of DDOST in the progression of cervical cancer;

[0017] 2. The present invention discloses that knocking down DDOST can inhibit tumor growth, proliferation, migration, and invasion, and promote apoptosis; after overexpressing SMARCA4, it was observed that the functional recovery of tumor growth and migration was obtained;

[0018] 3. The present invention verifies the synergistic effect of DDOST and SMARCA4 on the progression of cervical cancer through in vivo animal experiments;

[0019] 4. The present invention first proves that DDOST can be used as a biomarker for cervical cancer tumor progression and a potential therapeutic target, and the interaction between DDOST and SMARCA4 may be a potential mechanism;

[0020] 5. The present invention verified the potential role of DDOST as an effective screening predictor for poor survival rate in cervical cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The drawings are used to provide a further understanding of the present invention, and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention, and do not constitute a limitation to the present invention. In the drawings:

[0022] Figure 1 In TCGA data and the clinical samples collected by us, upregulation of DDOST was associated with poor survival: (A) Representative IHC images of DDOST in normal (left) and tumor tissues (low and medium expression on the right, high expression on the right). Magnification, 200×. (B) Kaplan-Meier overall survival curve of cervical cancer patients from TCGA with the median DDOST expression as the cut-off value.

[0023] Figure 2 Tool vector maps of knockdown vector and overexpression vector;

[0024] Figure 3 DDOST promoted the malignant phenotypes of cervical cancer cells: (A) The mRNA (left) and protein (right) expression levels of DDOST in HeLa and SiHa cells were tested by RT-qPCR and Western blotting. Representative fluorescence images of cells (B) and DDOST knockout efficiency (C) mRNA (left) and protein (right) three days after transfection with shRNA. Magnification, 100×. (D) The number of cells with green fluorescence was calculated by Celigo method, HeLa (left) and SiHa (right). CCK-8 (E), colony formation (F), transwell (G) and invasion (H) assays of HeLa (left) and SiHa (right) cells. All experiments were independently repeated 3 times.

[0025] Figure 4 SMARCA4 interacted with DDOST and played a synergistic role in cervical cancer cells: (A) Apoptosis was detected by flow cytometry in HeLa (top) and SiHa (bottom) cells after transfection and incubation for 3 days and 2 days respectively. (B) The results of co-IP and Western blotting experiments confirmed the interaction between DDOST and the identified proteins. (C) Venn diagram of total proteins identified by LC-MS analysis in the NC and OE groups of SiHa cells. NC, negative control; OE, DDOST overexpression. (D) GO analysis of specifically expressed genes in the DDOST overexpression group. (E) Growth, (F) proliferation and (G) migration abilities in stably transfected SiHa cells. NC: negative control; KD: DDOST knockdown; OE: SMARCA4 overexpression.

[0026] Figure 5 Overexpression of SMARCA4 reversed the reduced tumor growth caused by DDOST knockdown in xenograft mouse models: Animal analysis protocol (A), xenograft model images (B), tumor growth (C), and body weight (D) of nude mice bearing tumors subcutaneously injected with shDDOST- and NC-transfected SiHa cells. Animal analysis protocol (E), xenograft model images (F), tumor growth (G), and body weight (H) of nude mice bearing tumors subcutaneously injected with shDDOST- and SMARCA4 co-transfected SiHa cells. Detailed implementation manners

[0027] The preferred embodiments of the present invention will be described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0028] All experiments were independently repeated three times and analyzed using GraphPad Prism 7.0 and Photoshop. Survival analysis was performed using the Kaplan-Meier method and the log-rank test. Spearman correlation analysis was performed in SPSS 22.0. Student's t-test (two-tailed) was used to identify differences between two groups, and one-way ANOVA was used for comparison among multiple groups of data. P < 0.05 was considered statistically significant. Quantitative variables with non-normal distributions were compared using the Mann-Whitney U test.

[0029] Expression of DDOST in tumor samples of cervical cancer patients in Example 1

[0030] 1. To determine the role of DDOST in cervical cancer patients, we analyzed the clinical correlation of DDOST in TCGA data. A total of 303 patients with RNA expression levels and pathological information were identified in the TCGA database. As shown in Table 1, there were significant differences in the mRNA levels of DDOST among cervical cancer patients with different degrees of differentiation (P = 0.008).

[0031] Table 1 Clinical correlation of DDOST mRNA expression and pathological information in cervical cancer patients

[0032]

[0033]

[0034] Kaplan-Meier survival analysis showed that in the TCGA database, compared with patients with lower expression, the overall survival (OS) of patients with higher mRNA levels of DDOST was significantly worse (P = 0.014, Figure 1 B).

[0035] 2. A total of 51 cervical cancer specimens were collected from Jiangsu Cancer Hospital. This study was approved by the Biomedical Research Ethics Committee and written informed consent was obtained from eligible patients. IHC results of clinical patient specimens confirmed that the protein expression of DDOST was higher in tumors compared with normal tissues ( Figure 1 A).

[0036] The above results elucidated the adverse effects of DDOST on the malignant progression and poor prognosis of cervical cancer.

[0037] Construction of plasmids and lentiviral vectors and cell infection in Example 2

[0038] Lentiviral vectors (LVs) carrying short hairpin RNA (shRNA) sequences of DDOST knockdown (shDDOST) and control (shCtrl) were constructed using GV115 (hU6-MCS-CMV-EGFP, Figure 2 A), and the target sequence for knockdown was CACATTCAAGACCGCTGAT.

[0039] GV491 (Ubi-3FLAG(sigma)-MCS-SV40-puromycin, Figure 2 B), CV224 (Ubi-MCS-SV40-Cherry-IRES-puromycin, Figure 2 C), and GV661 (CMV-MCS-3FLAG-EF1-mCherry-T2A-puromycin, Figure 2 D) were used to construct overexpression LVs of DDOST, SMARCA4, and CTNNB1, respectively, and the empty vector was used as a negative control (NC). Recombinant lentiviruses were harvested from 293T cells and then purified. Knockdown or overexpression LVs were co-infected using polybrene (50 μg / mL). The volume of virus added was calculated by multiplicity of infection (MOI) = 20. The fluorescence intensity was determined 72 hours after infection. Stable cell lines were screened using puromycin (3 μg / mL). All the above plasmids or sequences were synthesized and provided by Shanghai GeneChem Co., Ltd. Transfection efficiency was verified by fluorescence (green or red), qRT-PCR, and Western blotting. The primer sequences are shown in Table 2.

[0040] Table 2. Primer sequences for shRNA synthesis information

[0041]

[0042]

[0043] Abbreviations: sh, short hairpin; oe, overexpression.

[0044] Example 3 Real-time fluorescence quantitative PCR (Quantitative Reverse Transcription PCR, RT-qPCR)

[0045] Total RNA of T293 cells was extracted by Trizol method (Invitrogen), and transcribed into cDNA using Promega M-MLV kit. Real-time fluorescence quantitative PCR was performed using Takara SYBR Master Mix and MX3000p system (Agilent). The relative expression of mRNAs of DDOST and SMARCA4 was calculated by 2-ΔΔCT method, with GAPDH as the internal reference. The primer sequences are shown in Table 3 below:

[0046] Table 3. RT-PCR primer sequences

[0047]

[0048] Example 4 Cell experiments

[0049] 1. Cell culture:

[0050] Human cervical cancer cells Hela and SiHa were purchased from the Cell Bank of the Chinese Academy of Sciences and cultured in DMEM (Gibco) complete medium containing 10% fetal bovine serum (Gibco). The culture conditions were in a humidified incubator at 37 °C with 5% CO 2 . Cells in the logarithmic growth phase were digested with trypsin, passaged, or used for subsequent experiments.

[0051] 2. Cell growth and proliferation:

[0052] Cell growth and proliferation were evaluated by fluorescence, CCK-8 (Dojindo), and colony formation, respectively. Briefly, Hela and SiHa cells in different treatment groups 3 days after infection were seeded at 2,000 cells / well in 96-well plates. The number of cells with green fluorescence was counted daily using Celigo Image Cytometer (Nexcelom) for 3 - 5 days to detect cell growth. Or detected by CCK-8 for 5 days to detect cell proliferation. In the colony formation assay, 1,500 cells / well were seeded in 6-well plates, and the number of clones was observed after 9 days, photographed, and counted using Image J software.

[0053] 3. Cell apoptosis:

[0054] Cell apoptosis was detected using AnnexinV-APC / PI apoptosis kit (eBioscience). Briefly, the treated cells were collected and washed 3 times with pre-cooled PBS. Staining was performed according to the instructions and analyzed by flow cytometry (BD).

[0055] 4. Cell migration and invasion:

[0056] Cell migration and invasion abilities were evaluated using Transwell and Invasion kits (Corning) according to the instructions. Briefly, 8×10 4 cells were seeded in the upper chamber, and serum-free medium was added to the 24-well plate, while complete medium was added to the lower chamber. The migration pores in the Transwell kit had a pore size of 8 μm and were coated with Matrigel in the Invasion kit. After incubation for 24 hours, the migrated or invaded cells were fixed, stained, and counted under the microscope.

[0057] 5. Western blot (WB):

[0058] Cells were collected and incubated with pre-cooled lysis buffer on ice for 10 minutes. The lysates were sonicated and centrifuged to extract total proteins, and the protein concentration was determined by the BCA method (Beyotime). Protein samples were separated by 10% SDS-PAGE gels and transferred to PVDF membranes (Millipore). After blocking with 5% non-fat milk at room temperature, they were incubated overnight with DDOST (1:200, Abcam), SMARCA4 (1:10,000, Abcam), CTNNB1 (1:1,000, Abcam), Flag (1:2,000, Sigma), and GAPDH (1:2,000, Abcam). The secondary antibody (1:10000) was purchased from CST (Cell Signaling Technology). The ECL-PLUS kit (Thermo) was used to detect the immunoreactive bands.

[0059] 6. Co-immunoprecipitation (co-IP):

[0060] A stable cell line overexpressing DDOST with a Flag tag was constructed using SiHa and screened with 3 μg / mL puromycin. The transfection results were verified by WB. Total proteins were extracted and incubated overnight with Flag magnetic beads (Sigma). After washing and exchanging with 3×Flag peptide, the precipitated proteins were detected by SDS-PAGE gel strip mass spectrometry or by WB.

[0061] 7. Liquid chromatography with tandem mass spectrometry (LC-MS):

[0062] Perform proteomic analysis of interactions using liquid chromatography with tandem mass spectrometry (LC-MS). Briefly, SDS-PAGE gels were stained with Coomassie Brilliant Blue, then digested with trypsin, desalted, and separated using an Easy nLC system. Finally, the samples were analyzed using a Q-Exactive Plus mass spectrometer. The raw data were analyzed using Proteome Discoverer 2.1 (Thermo Fisher Scientific) and MASCOT 2.2 (Matrix Science).

[0063] 8. Analyze the expression of DDOST in tumor and adjacent tissues from cervical cancer patients by immunohistochemistry

[0064] Performed according to the immunohistochemistry kit instructions. Briefly, fresh tumor specimen tissues were fixed, dewaxed, and rehydrated. After antigen retrieval, enzyme inactivation, and blocking, the sections were incubated overnight at 4°C with the DDOST antibody (1:100, Proteintech). After incubating with the secondary antibody for 50 minutes, the sections were developed with DAB, then counterstained with hematoxylin for the cell nuclei, dehydrated, and mounted. Then, two pathologists separately interpreted the immunohistochemistry results of the paraffin sections and scored the IHC. Positive cells in tissue sections <10% were scored 0; 10%-25% were scored 1; 26%-50% were scored 2; 51%-75% were scored 3; >75% were scored 4. The staining intensity criteria were: no staining was scored 0, light brown was scored 1, brown was scored 2, and dark brown was scored 3. The IHC score of DDOST was the product of the proportion of positive cells and the intensity. An IHC score <8 was considered low expression, and ≥8 was considered high expression.

[0065] 9. Data analysis:

[0066] The proteins specifically identified in the overexpression group were analyzed and annotated using GO (Gene Ontology) and KEEG (Kyoto Encyclopedia of Genes and Genomes). GO functional annotation was performed by NCBI BLAST (ncbi-blast-2.3.0) and Blast2GO methods, plus additional annotations from InterProScan and the database of The European Bioinformatics Institute (EBI). KEEG pathway analysis was completed using KOALA (KEGG Orthology And Links Annotation) software by matching the KEEG Genes database. The Venn diagram was drawn using the bioinformatics website (http: / / bioinformatics.psb.ugent.be / webtools / Venn / ).

[0067] 10. Results:

[0068] The mRNA and protein expression levels of DDOST in HeLa and SiHa cells were as Figure 3 shown in A. To explore the functional effects of DDOST on cervical cancer cells, we transfected cells with a lentiviral vector containing the shRNA sequence of DDOST. The cell status and infection efficiency were observed using GFP fluorescence three days after infection ( Figure 3 B). RT-qPCR and WB experiments confirmed that DDOST expression was successfully inhibited ( Figure 3 C). DDOST inhibition led to a significant decrease in cell growth ( Figure 3 D). In addition, compared with the control group, inhibition of DDOST significantly reduced the viability and colony formation of cervical cancer cells (all P values < 0.05, Figure 3 E-F). The migration and invasion abilities were significantly weakened after inhibition of DDOST (all P values < 0.05, Figure 3 G-H).

[0069] The apoptosis rate of cervical cancer cells after inhibition of DDOST was analyzed by Annexin V-APC / PI and flow cytometry. Compared with the control group, the percentage of apoptotic cells increased significantly (P < 0.05, Figure 4 A). These results indicate that DDOST promotes the malignant phenotype of cervical cancer cells, and its ability to promote the malignant phenotype is weakened after DDOST knockdown.

[0070] To explore the interacting proteins that bind to DDOST, co-IP and LC-MS experiments were performed in the SiHa cell line with overexpression of DDOST. The protein expression level of DDOST was detected by Flag(Figure 4 B). Digest the SDS-PAGE gel of the DDOST immunoprecipitate and then analyze it by LC-MS. 1,229 and 1,174 proteins were identified in the control and overexpression samples, respectively ( Figure 4 C). Among them, 333 proteins were specifically identified in the DDOST overexpression group and enriched by GO and KEGG analyses. In the enrichment results, we found that CTNNB1 and SMARCA4 are differentially expressed genes with tumor cell apoptosis or proliferation phenotypes and are ranked in the top 20 gene lists of the literature related to cervical cancer disease retrievable in PubMed (Table 4). Therefore, we used immunoprecipitation (IP) analysis and demonstrated a positive correlation and interaction between DDOST and the proteins encoded by the SMARCA4 and CTNNB1 genes. Figure 4 B). Subsequently, a rescue experiment was performed to verify the roles of SMARCA4 and CTNNB1 in the growth and migration of cervical cancer cells.

[0071] Table 4. GO analysis of the specifically expressed proteins in DDOST overexpressing cells

[0072]

[0073] Co-transfect lentiviral particles with green or red fluorescence and verify that after knocking down DDOST, cell growth slows down and is largely restored by overexpression of SMARCA4, but not by CTNNB1. Figure 4 E). Therefore, SMARCA4 was selected to further verify the function recovery experiment. The proliferation viability of SiHa cells with DDOST knockdown was significantly reduced (P < 0.05), which was consistent with expectations. After overexpression of SMARCA4, the viability increased to near the original level (P < 0.05, Figure 4 F), and the migration ability also increased to near the original level. Figure 4 G). These results indicate that overexpression of SMARCA4 restores the proliferation and migration inhibitory phenotypes of the DDOST group.

[0074] Example 5 Animal experiments

[0075] To confirm the above relationship between DDOST and SMARCA4 in vivo, we used a subcutaneous xenograft model in nude mice: Subcutaneously inject the SiHa cell line stably transfected with DDOST and SMARCA4 (5×10 6 ) into the right axilla subcutaneously of 5-week-old female BALB / c nude mice. Measure the subcutaneous tumors three times a week, and mice with a tumor size of 1,000 mm 3 or larger were sacrificed. The tumor volume calculation formula is as follows: Tumor volume = (length × width2 ) / 2。

[0076] Observation for 28 days after tumor implantation revealed that the tumor volume and weight were significantly inhibited after DDOST knockdown ( Figure 5 A-D). The inhibitory effect caused by DDOST knockdown was restored by SMARCA4 overexpression ( Figure 5 E-H), similar to the phenotype observed in vitro. These results indicate that the tumor progression ability downregulated after DDOST inhibition was reversed by SMARCA4.

[0077] Obviously, those skilled in the art can make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations. SEQUENCE LISTING <110> Jiangsu Cancer Hospital <120> A Biomarker for Cervical Cancer and Its Application <130> 210965 <160> 16 <170> PatentIn version 3.5 <210> 1 <211> 52 <212> DNA <213> synthesized sequence <400> 1 ccggctcaca ttcaagaccg ctgatctcga gatcagcggt cttgaatgtg ag 52 <210> 2 <211> 58 <212> DNA <213> synthesized sequence <400> 2 aattcaaaaa ctcacattca agaccgctga tctcgagatc agcggtcttg aatgtgag 58 <210> 3 <211> 40 <212> DNA <213> synthesized sequence <400> 3 cagctagcgt tattgaattc atggagccca gcaccgcggc 40 <210> 4 <211> 45 <212> DNA <213> synthesized sequence <400> 4 ttccacagga atcagaattc tcagtcggac ttctccttct ccttc 45 <210> 5 <211> 48 <212> DNA <213> synthesized sequence <400> 5 gatctatttc cggtgaattc cgccaccatg gctactcaag ctgatttg 48 <210> 6 <211> 44 <212> DNA <213> synthesized sequence <400> 6 tccttgtagt ccatggatcc caggtcagta tcaaaccagg ccag 44 <210> 7 <211> 54 <212> DNA <213> synthesized sequence <400> 7 aggtcgactc tagaggatcc cgccaccatg tccactccag acccacccct gggc 54 <210> 8 <211> 48 <212> DNA <213> synthesized sequence <400> 8 cacacattcc acaggctagc tcagtcttct tcgctgccac ttcctgag 48 <210> 9 <211> 57 <212> DNA <213> synthesized sequence <400> 9 ccggttctcc gaacgtgtca cgtttcaaga gaacgtgaca cgttcggaga atttttg 57 <210> 10 <211> 57 <212> DNA <213> synthesized sequence <400> 10 aattcaaaaa ttctccgaac gtgtcacgtt ctcttgaaac gtgacacgtt cggagaa 57 <210> 11 <211> 19 <212> DNA <213> synthesized sequence <400> 11 atggggtact tccggtgtg 19 <210> 12 <211> 21 <212> DNA <213> synthesized sequence <400> 12 gaaaagcgaa tgagtctccc g 21 <210> 13 <211> 22 <212> DNA <213> synthesized sequence <400> 13 attgagaatg ccaagcaaga tg 22 <210> 14 <211> 20 <212> DNA <213> synthesized sequence <400> 14 acaccagcca ctccaaacct 20 <210> 15 <211> 21 <212> DNA <213> synthesized sequence <400> 15 tgacttcaac agcgacaccc a 21 <210> 16 <211> 21 <212> DNA <213> synthesized sequence <400> 16 caccctgttg ctgtagccaa a 21

Claims

Use of a reagent for detecting a biomarker in a sample in the preparation of a product for diagnosing cervical cancer, characterized in that, the biomarker includes DDOST, and the diagnosis includes diagnosing the degree of differentiation of cervical cancer.

2. The use according to claim 1, characterized in that, the reagent for detecting the biomarker in the sample includes a reagent for detecting the mRNA expression level of the biomarker in the sample or a reagent for detecting the protein expression level of the biomarker in the sample.

3. The use according to claim 1, characterized in that, the biomarker further includes SMARCA4.

4. Use of a reagent for downregulating the expression level of DDOST in the preparation of a drug for treating cervical cancer, characterized in that, the reagent is shDDOST shown as follows: Forward: CCGGCTCACATTCAAGACCGCTGATCTCGAGATCAGCGGTCTTGAATGTGAG; Reverse: AATTCAAAAACTCACATTCAAGACCGCTGATCTCGAGATCAGCGGTCTTGAATGTGAG.

Images