Application of CFP1 gene in the preparation of products for treating or detecting lung adenocarcinoma

Abstract

The present invention discloses the application of the CFP1 gene in the preparation of products for treating or detecting lung adenocarcinoma. The present invention discovers that inhibiting the expression of the CFP1 gene can significantly reduce the malignant phenotypes of lung adenocarcinoma. Therefore, it provides the application of CFP1 inhibitory products in the preparation of products for treating lung adenocarcinoma, inhibiting the malignant phenotypes of lung adenocarcinoma by inhibiting CFP1 expression; provides the application of reagents for detecting the expression level or protein activity of CFP1 protein in the preparation of diagnostic kits for lung adenocarcinoma, provides a new diagnostic marker for lung adenocarcinoma; provides a method for screening drugs for treating or preventing lung adenocarcinoma targeting the CFP1 gene to develop new drugs for treating lung adenocarcinoma; provides a method for constructing a lung adenocarcinoma cell model by knocking out the CFP1 gene and a lung adenocarcinoma cell model in which the CFP1 gene is knocked out to further study the pathogenesis of lung adenocarcinoma.

Description

Technical Field

[0001] The present invention relates to the field of clinical applications, and particularly to the application of the CFP1 gene in the preparation of products for the treatment or detection of lung adenocarcinoma. Background Art

[0002] Lung cancer is a malignant tumor with the highest incidence and mortality. As the main subtype of lung cancer, the clinical treatment effect of lung adenocarcinoma is still not satisfactory. Aberrant epigenetic modifications are considered to be the key reasons for tumorigenesis and progression. All along, the H3K4me3 modification has been considered to be the key to promoting gene expression. The basic transcription factor TFIID subunit TAF3 binds to H3K4me3 and is enriched at the promoter to initiate transcription, and this phenomenon is considered to be prevalent in eukaryotes. H3K4me3 shows differential regulatory effects in different cancer types and cell types. The key regulator of H3K4me3, CFP1 (CxxC finger protein-1, CXXC1), plays a core role in the process of H3K4me3-mediated tumor biological changes.

[0003] According to existing reports, CFP1 is involved in the normal development of oocytes and the normal differentiation and maturation of thymocytes. There is little research on CFP1 in tumor research. When Derks S and his colleagues studied the epigenetic changes in colorectal cancer, they found that the decreased expression of the CXXC1, SMAD4, and MBD2 genes was related to the deletion of 18q21 in colorectal cancer cell lines. The deletion of chromosome 18q21 is a common event in the development of colorectal cancer. On the contrary, Sun J et al. detected the expression level of CFP1 in tumor specimens of 84 gastric cancer patients by immunohistochemistry and found that the survival time of gastric cancer patients with high CFP1 expression was lower than that of gastric cancer patients with low CFP1 expression. These results indicate that CFP1 plays an important role in the occurrence and development of colorectal cancer and gastric cancer, but the research on CFP1 in lung adenocarcinoma has not been reported. Summary of the Invention

[0004] The present invention discovers that inhibiting the expression of the CFP1 gene can significantly reduce the malignant phenotype of lung adenocarcinoma. Therefore, the application of the CFP1 gene in the preparation of products for the treatment or detection of lung adenocarcinoma is provided, including the application of products or methods based on inhibiting the expression of the CFP1 gene in the preparation of products for the treatment or prevention of lung adenocarcinoma, or the application of products for detecting the expression level of the CFP1 gene in the preparation of products for detecting or predicting lung adenocarcinoma.

[0005] The first object of the present invention is to provide the application of CFP1 inhibitory products in the preparation of products for the treatment of lung adenocarcinoma, and to inhibit the malignant phenotype of lung adenocarcinoma by inhibiting CFP1 expression.

[0006] The second object of the present invention is to provide the use of a reagent for detecting the expression level or protein activity of CFP1 protein in the preparation of a diagnostic kit for lung adenocarcinoma, so as to provide a new diagnostic marker for lung adenocarcinoma.

[0007] The third object of the present invention is to provide a method for screening drugs for treating or preventing lung adenocarcinoma with the CFP1 gene as a target, so as to develop new drugs for treating lung adenocarcinoma.

[0008] The fourth object of the present invention is to provide a device for diagnosing lung adenocarcinoma or the tendency to develop lung adenocarcinoma in a subject.

[0009] The fifth object of the present invention is to provide a computer-readable storage medium in which a program can be executed by a processor to implement all steps of diagnosing lung adenocarcinoma or the tendency to develop lung adenocarcinoma in a subject.

[0010] The sixth object of the present invention is to provide a method for constructing a lung adenocarcinoma model by knocking out the CFP1 gene.

[0011] The seventh object of the present invention is to provide a lung adenocarcinoma cell model in which the CFP1 gene in lung adenocarcinoma cells is knocked out, so as to further study the pathogenesis of lung adenocarcinoma.

[0012] The technical solutions provided by the present invention are specifically as follows:

[0013] The present invention provides the use of a CFP1 inhibitory product in the preparation of a product for treating lung adenocarcinoma, and the CFP1 inhibitory product is a product that inhibits the expression of CFP1 protein by the CFP1 gene or inhibits the activity of CFP1 protein.

[0014] In some embodiments provided by the present invention, the CFP1 inhibitory product includes one or more of a polynucleotide sequence, a plasmid, a virus, an inhibitory antibody against CFP1, a protein, a polypeptide, an enzyme, and a small molecule compound that inhibits the activity of CFP1 protein.

[0015] In some embodiments provided by the present invention, the CFP1 inhibitory product allows entry into cells by one or more of the following methods: direct naked DNA injection method, liposome-encapsulated DNA direct injection method, gold-coated DNA gene gun bombardment method, replication-deficient bacteria carrying plasmid DNA method, replication-deficient adenovirus carrying the target DNA method, PEG-modified protein drug injection method, liposome-encapsulated protein intravenous injection method, and protein microsphere preparation subcutaneous injection method.

[0016] The present invention provides the use of a reagent for detecting the expression level or protein activity of CFP1 protein in the preparation of a diagnostic kit for lung adenocarcinoma.

[0017] In some embodiments provided by the present invention, the cells of lung adenocarcinoma are A549 cells or H1975 cells.

[0018] A method for screening drugs for treating or preventing lung adenocarcinoma provided by the present invention includes the following steps: taking CFP1 protein or CFP1 gene as the object of drug action, and selecting CFP1 protein activity inhibitors or CFP1 gene expression inhibitors as candidate primary screening drugs for the treatment of lung adenocarcinoma.

[0019] A device for diagnosing lung adenocarcinoma or the tendency to develop lung adenocarcinoma in a subject provided by the present invention includes the following two modules:

[0020] An evaluation module for evaluating the expression level of CFP1 gene in a biological sample derived from a subject;

[0021] A judgment module for judging whether the subject has lung adenocarcinoma or is at risk of developing lung adenocarcinoma according to the evaluation result of the evaluation module.

[0022] A computer-readable storage medium provided by the present invention includes a program that can be executed by a processor to implement all steps of diagnosing lung adenocarcinoma or the tendency to develop lung adenocarcinoma in a subject, and the all steps include:

[0023] Evaluating the expression level of CFP1 gene in a biological sample derived from a subject; and

[0024] Based on the evaluation result, judging whether the subject has lung adenocarcinoma or is at risk of developing lung adenocarcinoma.

[0025] A method for constructing a lung adenocarcinoma model provided by the present invention includes the following steps: transfecting an interference plasmid shown in nucleotide sequences such as SEQ ID NO.1-3 into lung adenocarcinoma cells to knock out the CFP1 gene in the lung adenocarcinoma cells.

[0026] On the basis of the above technical solution, Lip3000 liposome and P3000 are used in the transfection process; the lung adenocarcinoma cells are A549 or H1975 cells.

[0027] A lung adenocarcinoma cell model provided by the present invention has the CFP1 gene knocked out in the lung adenocarcinoma cells.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) Inhibiting the expression of CFP1 gene can significantly inhibit the malignant phenotype of lung adenocarcinoma, and the present invention provides a new therapeutic target for the drug development of lung adenocarcinoma.

[0030] (2) The present invention provides a new gene marker for detecting lung adenocarcinoma or predicting the risk of lung adenocarcinoma. Description of the Drawings

[0031] The accompanying drawings are used to provide an understanding of the technical solution of the present invention and form a part of the specification. Together with the embodiments of the present invention, they are used to explain the technical solution of the present invention and do not constitute a limitation to the technical solution of the present invention.

[0032] Figure 1 : Figure A shows the comparison of CFP1 expression in adjacent tissues and cancer tissues in the TCGA lung adenocarcinoma cohort; Figure B shows the comparison of CFP1 expression in paired tumor and adjacent tissues in the GSE63459 lung adenocarcinoma cohort; Figures C and D show the effects of high CFP1 expression on overall survival (Figure C) and disease-free survival (Figure D) of patients in the GSE30219 lung adenocarcinoma cohort; Figure E shows the univariate COX regression analysis.

[0033] Figure 2 : Figure A shows the detection of CFP1 knockdown effect by Q-PCR experiment; Figure B shows the detection of CFP1 knockdown effect by Western blot; Figure C shows the effect of CFP1 knockdown on the migration and invasion of H1975 and A549 cells by Transwell experiment; among them, the magnification of the picture is 20×, * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001.

[0034] Figure 3 : Figure A shows the detection of the proliferation of H1975 and A549 cells by CCK-8 experiment; Figure B shows the detection of the colony formation ability of H1975 and A549 cells by colony formation experiment; Figure C shows the detection of the cell cycle changes of H1975 and A549 cells by flow cytometry experiment.

[0035] Figure 4 : Flow cytometry was used to detect the apoptosis level of cisplatin-induced H1975 and A549 lung adenocarcinoma cells after CFP knockdown and statistical analysis.

[0036] Figure 5 : Figure A shows the pictures of tumor formation in mice and the physical pictures of the tumors; Figure B shows the growth curve of subcutaneous tumor formation with the extension of tumor formation time; Figure C shows the comparison of the subcutaneous tumor weights between the CXXC1 knockdown group and the negative control; Figure D shows the study of the effect of CXXC1 knockdown on tumor proliferation by Ki67 immunofluorescence staining; Figure E shows the statistical analysis of the fluorescent positive cells in Figure D; Figure F shows the detection of the apoptosis level of cells in the tumor by the tunel kit; Figure G shows the statistics of the apoptosis level in Figure F, scale bar = 50μm. Detailed implementation manners

[0037] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0038] The reagents and cell lines involved in the experiments of the present invention were all purchased from domestic and foreign markets or prepared according to the formulas in the instructions. The experimental methods not specifically described are all conventional methods known in the art.

[0039] Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt the conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related fields in the present technical field.

[0040] Cell line and culture: The A549 and H1975 cell lines were purchased from ATCC. The A549 and H1975 cell lines were cultured in complete RPMI 1640 medium containing 10% fetal bovine serum at 37°C and 5% CO 2 conditions. Main reagents: RPMI 1640 medium, fetal bovine serum, puromycin, 4% paraformaldehyde, Triton solution, PBS, primary antibody dilution solution, apoptosis detection kit, cell proliferation kit.

[0041] Example: Construct A549 and H1975 lung adenocarcinoma cell lines with low expression of CFP1, and verify in vitro and in vivo experiments whether knockdown of CFP1 can inhibit the malignant phenotypes of lung adenocarcinoma cells:

[0042] 1. Design 3 interfering plasmids (CFP1-sh1, CFP1-sh2, CFP1-sh3) that can target CFP1 and an interfering plasmid (CFP1-NC) for the negative control of CFP1 knockdown:

[0043] CFP1-sh1: 5’CGACTCTTCTGTGATGTGTAT3’ (see Sequence Listing Seq_1);

[0044] CFP1-sh2: 5’CCGGGAATCGTACAAGTACTT3’ (see Sequence Listing Seq_2);

[0045] CFP1-sh3: 5’CATCCGGATCACTGAGAAGAT3’ (see Sequence Listing Seq_3);

[0046] CFP1-NC: 5’TTCTCCGAACGTGTCACGT3’ (see Sequence Listing Seq_4).

[0047] 2. Construction of lentivirus for knocking down CFP1 and lentivirus for the negative control group of CFP1 knockdown:

[0048] Under the conditions of 37 °C and 5% CO 2 Separate the interference plasmids such as CFP1-sh1, CFP1-sh2, CFP1-sh3, and CFP1-NC in OptimMEM medium (Invitrogen), Lipo3000 (Invitrougen), and P3000 (Invitrougen) and transfect 293T cells. After culturing for 8 hours, replace with fresh medium. After culturing for 48 hours, collect the culture medium and centrifuge to obtain the lentiviral plasmids for knocking down CFP1 and the lentiviral plasmids for the negative control group of CFP1 knockdown.

[0049] 3. Construction of A549 and H1975 cell lines with stable low expression of CFP1:

[0050] CFP1-sh group: Co-culture the lentiviral plasmids for knocking down CFP1 with A549 and H1975 cells in the logarithmic growth phase in complete 1640 medium for 3 days, then change to complete 1640 medium containing 2.5 μg / mL puromycin and perform drug screening on the transfected A549 and H1975 cells for 7 to 14 days to obtain cell lines with stable knockdown of CFP1.

[0051] CFP1-NC group: Culture the lentiviral plasmids for the negative control group of CFP1 knockdown with A549 and H1975 cells in the logarithmic growth phase in complete 1640 medium for 3 days, then change to complete 1640 medium containing 2.5 μg / mL puromycin and perform drug screening on the transfected A549 and H1975 cells for 7 to 14 days to obtain stable cell lines for the negative control group of CFP1 knockdown.

[0052] 4. Detection of the effect of knocking down CFP1 in A549 and H1975 cells:

[0053] Collect the cells in the logarithmic growth phase in step 3, collect total cell RNA and protein, and detect the expression level of CFP1 in the cells by Q-PCR experiment and Western blot experiment. The results show that CFP1-shRNA can significantly inhibit the expression of CFP1 in A549 and H1975 cells.

[0054] 5. Expand the culture of the cells in step 3, and select the two knockdown cell lines CFP1-sh1 and CFP1-sh3 for further functional experiments according to the effect of knocking down CFP1 in step 4.

[0055] 6. Detection of the effects of CFP1 knockdown on cell migration and invasion by Transwell assay:

[0056] Take out the migration chamber and invasion chamber, and place them in the sterile operating table to restore to room temperature. Add 600 μL of serum-free medium into 12-well and 24-well plates. Use sterile forceps to place the Transwell chamber into the wells with medium, and then add pre-warmed serum-free medium into the Transwell chamber for hydration. Take out the cells in good growth state, digest and centrifuge them according to the conventional method, and then resuspend them. Dilute the cells to 2.5×10 6 cells / mL. Add 600 μL of complete medium containing 20% FBS into the wells below the chamber, and add 200 μL of cell suspension (containing 5×10 5 cells) into the chamber. After culturing for 24 hours, take out the Transwell chamber, use a small pipette tip to aspirate the medium in the chamber, and gently wipe the inner side of the membrane in the chamber with a cotton swab. Add 600 μL of 4% paraformaldehyde into the unused wells, gently place the chamber into the wells containing formaldehyde for fixation for 5 minutes, and pay attention to ensuring that there are no bubbles on the contact surface between the membrane and formaldehyde. Add 600 μL of crystal violet staining solution into the unused wells. Take out the fixed Transwell chamber, gently wipe off the paraformaldehyde solution with a cotton swab, and then place it into the wells containing crystal violet, and let it stand at room temperature for 30 minutes. Take out the chamber membrane. Observe the cell migration and invasion under an inverted microscope, Figure 2 The results shown indicate that CFP1 knockdown significantly inhibits the migration and invasion abilities of A549 and H1975 cells.

[0057] 7. Detection of the changes in the proliferation ability of lung adenocarcinoma cells after CFP1 knockdown by CCK8 assay:

[0058] After the cells in good growth state are digested, centrifuged, and resuspended conventionally, inoculate them into a 96-well plate, and inoculate 100 μL of cell suspension per well containing 1×10 4。Six replicate wells were set for each sample. The 96-well plate seeded with cells was placed in an incubator for cell culture. The time was set to 0 h, 24 h, 48 h, 72 h, and 96 h. Before detection, aspirate the old medium in the wells, and then gently add 110 μL of the mixture of CCK-8 reagent and complete medium (10 μL of CCK-8 and 100 μL of complete medium) to each well of the 96-well plate to be detected, avoiding introducing air bubbles to increase errors, and then incubate for 1-4 h. Use a microplate reader to detect the absorbance of each well at a wavelength of 450 nm every hour, and collect the absorbance of each well at 0 h, 24 h, 48 h, 72 h, and 96 h. The absorbance at 0 h was used as the base number, and the ratio of each subsequent detection result to the absorbance at 0 h was used to reflect the proliferation rate of cells at each time point. The research results showed that CFP1 knockdown significantly inhibited the proliferation ability of A549 and H1975 cells.

[0059] 8. Detection of cell cycle status using a cell cycle detection kit (KGA512):

[0060] For cells in the logarithmic growth phase, digest with trypsin, centrifuge, and resuspend and wash once with PBS to make the cell concentration reach about 1×10 6 or so (3-8 replicates per group). Take 1 mL of cell suspension and centrifuge at 2000 rpm / min for 5 min. Carefully aspirate the supernatant, add 500 μL of pre-cooled 70% ethanol solution to the cell pellet, and place it in a 4°C refrigerator for fixation for 2 h or overnight. Take out the fixed cells, centrifuge and discard the fixing solution, resuspend and wash the cells once with PBS, then discard the supernatant, add 100 μL of RNase A and incubate in warm water at 37°C for 30 min. Before loading, add 400 μL of PI staining solution, mix the PI staining solution and RNase A with a pipette, and incubate in the dark at 4°C for 30 min and then detect on the machine. The detection results showed that after CFP1 knockdown, the G1 phase of A549 and H1975 cells was prolonged. The G1 phase is the most important stage of the cell cycle, and the prolongation of the G1 phase indicates the prolongation of the cell cycle and the slowdown of cell proliferation. Figure 3 Showed the changes in cell proliferation, colony formation, and cell cycle after CFP1 knockdown detected by CCK8 assay, colony formation assay, and flow cytometry assay. Figure 3 A showed that CFP1 gene knockdown led to a significant decrease in the proliferation ability of H1975 cells and A549 cells; CFP1 gene knockdown led to a significant decrease in the colony formation ability of H1975 cells and A549 cells; CFP1 gene knockdown led to the prolongation of the G1 phase of H1975 cells and A549 cells, and at the same time, the S phase of the cells was shortened. The G1 phase is a critical period for cells to synthesize various RNAs and related proteins. The prolongation of the G1 phase leads to the prolongation of the cell cycle and even the arrest of cell division and the inability to enter the next cycle. Therefore, the prolongation of the G1 phase caused by CFP1 knockdown may be an important reason for the slowdown of tumor cell proliferation.

[0061] 9. Detection of the change in apoptosis level of A549 and H1975 cells after CFP1 knockdown using an apoptosis detection kit:

[0062] Cells in the logarithmic growth phase were digested, resuspended, and seeded in a 6-cm dish at a density of 5×10 5 cells per dish, and each sample was repeated 3 - 6 times. After the cells adhered, a certain amount of cisplatin was added (to a final concentration of 30 μM according to the volume of the medium and the concentration of cisplatin). After incubating in a cell culture incubator for 24 hours, the culture dishes were taken out. The old medium, PBS washing solution, and cell suspension after trypsin digestion were collected, mixed, and centrifuged at 2000 rpm / min for 5 min. The supernatant was discarded, and the cells were resuspended and washed once with PBS. After centrifugation again, the supernatant was discarded. The cell pellet was taken, resuspended in 500 μL of Binding Buffer, 5 μL of Annexin V antibody labeled with fluorescein APC was added, and after mixing evenly, it was incubated in the dark at room temperature for 10 min. Before loading onto the machine, 5 μL of PI staining solution was added to each sample, mixed well, and the detection was completed within 1 hour. The detection results indicated that the apoptosis level of cisplatin-induced A549 and H1975 lung adenocarcinoma cells was significantly increased after CFP1 knockdown.

[0063] 10. In vivo experiment to verify the effect of CFP1 knockdown on the growth of lung adenocarcinoma:

[0064] Ten nude mice were purchased in advance from Huafukang Experimental Animal Company (5 in each of the CFP1-sh group and the CFP1-NC group). Cells in the logarithmic growth phase of the CFP1-sh group and the CFP1-NC group were collected, and the cell concentration was adjusted to 1×10 7 / mL with PBS, and 150 μL of the cell suspension was injected subcutaneously into 5 - 6-week-old female nude mice. The size of the subcutaneous tumors in the mice was detected weekly; when the diameter of the subcutaneous tumors in some mice was close to 1.5 cm, all the mice were sacrificed by cervical dislocation, the tumor masses were dissected, and weighed. Generally, the subcutaneous tumors were taken out after about 5 weeks to compare the tumor sizes between the CFP1-NC group and the CFP1-sh group.

[0065] 11. Detection of the cell proliferation level in tumors by Ki67 fluorescence staining:

[0066] The mouse tumor tissues were routinely paraffin-embedded and sectioned. After dehydration, they were placed in an EDTA (pH 9.0) antigen retrieval solution in a microwave oven for retrieval, with 9 minutes at high fire, a 7-minute pause, and then 7 minutes at medium-low fire. During this process, prevent the slices from drying. Take out, let them dry naturally, and then wash them 3 times with PBS on a shaker, 5 minutes each time. Use a tissue pen to draw a circle on the dried tissue on the slide, drop a spontaneous fluorescence quenching agent in the circle to cover the tissue, incubate for 5 minutes, and then rinse with running water for 10 minutes. Drop BSA in the tissue circle for serum blocking for 30 minutes. Remove the blocking solution, drop the primary antibody prepared with PBS (anti-Ki67, diluted 1:200), and incubate overnight at 4°C in a wet dark box. Wash with PBS 3 times, 5 minutes each time, drop the red fluorescence secondary antibody in the tissue circle, and incubate at room temperature for 30 minutes. Wash the slices 3 times with PBS for 5 minutes each time and then dry by centrifugation. Drop DAPI staining solution in the tissue circle and incubate in a dark box at room temperature for 10 minutes. Wash the slices 3 times with PBS, 5 minutes each time, dry by centrifugation, and then drop an anti-fluorescence quenching mounting medium in the tissue circle to mount the slices. Place the slices under a fluorescence microscope to take pictures and collect images (DAPI blue light excitation wavelength 330 - 380 nm, emission wavelength 420 nm; CY3 excitation wavelength 510 - 560 nm, emission wavelength 590 nm, emitting red light).

[0067] 12. Detection of the level of apoptosis in tumors by Tunel fluorescence staining:

[0068] The mouse tumor tissues were routinely paraffin-embedded and sectioned. The sections were successively immersed in xylene solution for 5 min × 3 times, absolute ethanol for 10 min × 3 times, and rinsed with distilled water. Use a histochemical pen to draw a circle around the removed and dried tissue on the section to prevent liquid loss. Drop the working solution of protease K diluted 10 times onto the tissue to ensure complete coverage, and incubate in an incubator at 37°C for 25 min. Take out the slides, place them in PBS, and gently shake them on a horizontal shaker for 3 rinses, 5 minutes each time. Take out the sections, gently dry them by centrifugation, and then drop 0.1% triton permeabilization solution in the tissue circle and incubate at room temperature for 20 min. Then wash with PBS 3 times, 5 minutes each time. Slightly dry the sections by centrifugation, drop buffer to cover, incubate at room temperature for 10 min, dry the slides again by centrifugation, drop the TDT / dUTP / buffer mixture (prepared at a ratio of 1:5:50) to cover the tissue, place flat in a wet box, and incubate in an incubator at 37°C for 2 hours. Take out the slides, rinse with PBS 3 times, 5 minutes each time. Dry by centrifugation, drop DAPI staining solution, and incubate in the dark at room temperature for 10 min. Take out the slides, immerse them in PBS, and shake them on a shaker for 3 rinses, 5 minutes each time. Gently dry by centrifugation, drop an anti-fluorescence quenching mounting medium in the tissue circle to mount the sections. Place the sections under a fluorescence microscope to observe and collect fluorescence pictures. (DAPI blue light excitation wavelength 330 - 380 nm, emission wavelength 420 nm; CF488 green light excitation wavelength 490 nm, emission wavelength 515 nm.)

[0069] Figure 5 The above-mentioned subcutaneous tumor formation experiment in mice verified the inhibitory effect and mechanism of CFP1 knockdown on lung adenocarcinoma. Compared with the CFP1-NC group, the growth of subcutaneous tumors in the CFP1-sh group of mice was significantly slower ( Figure 5 A, Figure 5 B). The average weight of tumors in the CFP1-sh group was about 300 mg, while the subcutaneous tumors in the CFP1-NC group reached about 500 mg ( Figure 5 C); Figure 5 D and Figure 5 E. The number of Ki67 fluorescence-positive cells in the tumors of the CFP1-sh group was significantly less than that in the CFP1-NC group, indicating that the level of cell proliferation in the tumors decreased after CFP1 knockdown; Figure 5 F and Figure 5 G. The number of apoptotic cells in the tumors of the CFP1-sh group was significantly more than that in the CFP1-NC group, indicating that the level of cell apoptosis in the tumors increased after CFP1 knockdown.

[0070] 13. Database verification:

[0071] Download the lung adenocarcinoma expression data and clinical prognosis information from the TCGA and GEO databases, and use R software ("R Version 3.6.1") and the "survival" package to evaluate the expression level and prognostic characteristics of CFP1 in various tumors and adjacent tissues. As Figure 1 shown, the expression of CFP1 in lung adenocarcinoma tissues was significantly higher than that in adjacent tissues ( Figure 1 A and 1B), and patients with high CFP1 expression had a worse long-term survival ( Figure 1 C and 1D). High CFP1 expression was an independent prognostic factor for poor prognosis in patients ( Figure 1 E). The results showed that the expression of CFP1 increased in lung adenocarcinoma, and patients with low CFP1 expression had a significant long-term survival advantage. The results of univariate COX regression analysis showed that high CFP1 expression was an independent risk factor for poor prognosis in patients. The results indicated that CFP1 was a potential target, and inhibitors targeting CFP1 might provide important help for the treatment of clinical lung adenocarcinoma.

[0072] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a CFP1 inhibitor product in the preparation of a product for treating lung adenocarcinoma, characterized in that: the CFP1 inhibitor product is at least one of the following interfering plasmids targeting CFP1: CFP1-sh1, CFP1-sh2, CFP1-sh3; wherein: the nucleotide sequence of CFP1-sh1 is as shown in Sequence Listing Seq_1; the nucleotide sequence of CFP1-sh2 is as shown in Sequence Listing Seq_2; the nucleotide sequence of CFP1-sh3 is as shown in Sequence Listing Seq_3.

2. The use according to claim 1, characterized in that: the CFP1 inhibitor product is allowed to enter cells by one or more of the following methods: direct naked DNA injection method, liposome-encapsulated DNA direct injection method, gold-coated DNA gene gun bombardment method, replication-defective bacteria carrying plasmid DNA method, replication-defective adenovirus carrying the target DNA method, PEG-modified protein drug injection method, liposome-encapsulated protein intravenous injection method, protein microsphere preparation subcutaneous injection method.

3. Use of an interfering plasmid targeting CFP1 in the preparation of a diagnostic kit for lung adenocarcinoma; the interfering plasmid targeting CFP1 is at least one of CFP1-sh1, CFP1-sh2, CFP1-sh3; wherein: the nucleotide sequence of CFP1-sh1 is as shown in Sequence Listing Seq_1; the nucleotide sequence of CFP1-sh2 is as shown in Sequence Listing Seq_2; the nucleotide sequence of CFP1-sh3 is as shown in Sequence Listing Seq_3.

4. The use according to claim 3, characterized in that: the cells of the lung adenocarcinoma are A549 cells or H1975 cells.

Images