Inhibitor of the flavin-containing monooxygenase (FMO) for use in the treatment of cancer
An FMO4 inhibitor targets FMO4 to reduce lung cancer tumor proliferation and enhance cancerous cell death, addressing the limitations of current therapies and improving survival outcomes.
Patent Information
- Application Number
- PCT/EP2025/054358
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-19
- Filing Date
- 2025-02-18
- Publication Date
- 2025-08-28
AI Technical Summary
Current targeted therapies for lung cancer are ineffective for a high proportion of patients due to co-occurring gene alterations, and the role of flavin-containing monooxygenases (FMOs) in lung cancer initiation and maintenance is not well understood, necessitating the identification of new molecules for treatment.
Development of a Flavin-containing Monooxygenase 4 (FMO4) inhibitor to target and inhibit FMO4 activity or expression, which is strongly expressed in lung adenocarcinoma and associated with poor survival outcomes, thereby reducing tumor proliferation and increasing cancerous cell death induced by oxidative stress.
The FMO4 inhibitor effectively reduces tumor growth, increases cancerous cell death, and prolongs survival time in patients with lung cancer by modulating oxidative stress, providing a therapeutic option for treatment-resistant cases.
Smart Images

Figure 00000059_0000 
Figure 00000059_0001 
Figure 00000059_0002
Abstract
Description
[0001] INHIBITOR OF THE FLAVIN-CONTAINING MONOOXYGENASE (FMO) FOR
[0002] USE IN THE TREATMENT OF CANCER
[0003] FIELD OF THE INVENTION
[0004] The present invention is in the field of medicine. In particular the invention relates to the use of a FMO inhibitor for use in the treatment of cancer in a subject in need thereof.
[0005] BACKGROUND OF THE INVENTION
[0006] Despite intense research efforts and clinical advances, lung cancer remains the most common cause of cancer-related death worldwide. Targeted therapies have greatly increased the survival of patients with lung cancer harboring oncogenic driver mutations (Camidge D.R et al., 2019, Nat Rev Clin Oncol). However, co-occurring gene alterations might affect the response to tyrosine kinase inhibitors (TKI) (Skoulidis F et al., 2019, Nat Rev Cancer), and a high proportion of patients with lung cancer are not eligible for any of the available targeted therapies (Camidge D.R et al., 2019, Nat Rev Clin Oncol). Therefore, finding new molecules implicated in lung cancer development / maintenance is crucial to tackle this deadly disease. Here, during the characterization of a new mouse model of MET-driven lung adenocarcinoma, as well as in three other lung cancer mice model respectively driven by oncogenic i) EGFR- mutations (L858R+T790M), ii) KRAS mutation (G12V) and with concomitant p53 deletion and iii) EML4 / ALK translocation (Maraver, A. et al, 2012, Cancer Cell; Bousquet Mur, E. et al. 2020, J Clin Invest; Maddalo, D. et al., 2014, Nature); we uncovered the role in lung cancer of flavin-containing monooxygenase 4 (FMO4), a largely unknown protein in cancer. This protein belongs to the FMO family with members present in all kingdoms of life (Mascotti M.L et al., 2016, J Mol Biol) and very well conserved throughout evolution (Nicoll C.R et al., 2020, Nat Struct Mol Biol). For long time, FMOs have been associated with detoxification of different xenobiotics (Cashman J.R et al., 2000, Curr Drug Metab). However, in recent years, several studies showed that FMOs are implicated in genetic diseases, for instance FM03 in trimethylaminuria; in different metabolic disorders, including diabetes; and finally also in aging (RossnerRet al., 2017, J Biol Chem). The expression of several FMOs is increased upon calorie restriction in several animal models (Rossner R et al., 2017, J Biol Chem), and overexpression of the C. elegans orthologue of human FM02 is sufficient to increase the lifespan in these worms (Leiser S.F et al., 2015, Science). Conversely, FMO putative roles in cancer are not well known. To the best of our knowledge, the only studies in lung cancer were focused mainly on their activity as detoxifiers of carcinogens (Zhang J.Y et al., 2006, Curr Drug Metab) or modifiers of therapeutic drugs (Hayashi H et al., 2019, Lung Cancer). Therefore, their direct roles in lung cancer initiation and / or maintenance remained to be explored. Here, we found that FM04 is strongly expressed in murine lung adenocarcinoma induced by different oncogenic drivers compared with healthy adjacent lung tissue, and also in clinical samples from patients with different lung cancer types including lung adenocarcinoma. Moreover, FM04 expression was inversely correlated with survival in patients with lung adenocarcinoma. Mechanistically, FM04 expression was increased by acute oxidative stress and decreased by incubation with the reactive oxidative stress (ROS) scavenger N-acetyl-l-cysteine (NAC). We then identified aryl hydrocarbon receptor (AHR) as the mediator of the ROS-induced FM04 expression. Finally, FM04 loss of function increased ROS production and cell death in lung adenocarcinoma cells and hampered the transformation of human bronchioalveolar cells by oncogenic KRAS in vitro and in vivo. In summary, FM04 is a new player in lung adenocarcinoma with critical functions in controlling excess oxidative stress during cellular transformation and lung cancer development.
[0007] SUMMARY OF THE INVENTION
[0008] The present invention relates to :
[0009] - A FM04 inhibitor for use in the treatment of cancer in a subj ect in need thereof.
[0010] - A pharmaceutical composition for use in the treatment of cancer comprising a therapeutically effective amount of the FM04 inhibitor according to the invention.
[0011] - A kit of part comprising an FMO4 inhibitor and at least one further therapeutic agent as a combined preparation for simultaneous, separate or sequential use in the treatment of cancer.
[0012] - A method for predicting the survival time and / or the disease progression in a subject suffering from cancer, in particular lung cancer, breast cancer, hepatobiliary cancer, bladder cancer, sarcoma, esophagogastric cancer, melanoma, pancreatic cancer or prostate cancer comprising i) determining in a sample obtained from the patient the expression level of FM04, ii) comparing said expression level determined at step i) with a predetermined reference value and iii) concluding that the method provides a good prognostic when the level of gene expression is higher than the predetermined reference value, or provides a bad prognostic when the level of gene expression is lower than the predetermined reference value. The present invention is defined by the claims. The following detailed description, figures and examples do not fall under the scope of the present invention and are present for understanding and illustration purposes only.
[0013] DETAILED DESCRIPTION OF THE INVENTION
[0014] In the present study, the inventors discovered that flavin-containing monooxygenase 4 (FMO4) expression was increased in lung tumor samples compared with lung healthy tissue. They found that this phenotype was a common feature in lung adenocarcinoma promoted also by translocation of EML4 / ALK as well as by oncogenic KRAS or EGFR using dedicated mouse models. Moreover, FM04 was strongly increased in human lung tumors compared with healthy lung tissue, and FM04 expression was inversely correlated with overall survival in patients with lung adenocarcinoma. Importantly, FMO4 protected lung cancer cells against ferroptosis- induced cell death and FM04 loss of function decreased oncogenic KRAS-induced human bronchoalveolar cells transformation in vitro and in vivo. Finally, they show that FMO4 plays a major role in protection against ferroptosis in lung adenocarcinoma human cells.
[0015] Therapeutic applications
[0016] A first object of the invention relates to a Flavin-containing Monooxygenase (FMO) inhibitor for use in the treatment of cancer in a subject in need thereof.
[0017] In one embodiment, the Flavin-containing Monooxygenase (FMO) inhibitor is a Flavin- containing Monooxygenase 1 (FMO 1) inhibitor, a Flavin-containing Monooxygenase 2 (FMO 2) inhibitor, a Flavin-containing Monooxygenase 3 (FMO 3) inhibitor or a Flavin-containing Monooxygenase 4 (FMO 4) inhibitor.
[0018] In particular, the FMO inhibitor is a FMO 4 inhibitor.
[0019] As used herein, the term “patient” or “subject” or “individual” refers to a subject to be treated by the methods disclosed herein. In particular, the patient suffers from Cancer. In one embodiment, the patient is a mammal. Non-limiting examples of mammals include rodents (e g., mice and rats), primates (e.g., lemurs, bushbabies, monkeys, apes and humans), rabbits, dogs, horses, cats, livestock (such as pigs, bovines, donkeys, mules, bison, goats, camels, and sheep), and deer. In one embodiment, the mammal is a human.
[0020] As used herein, the term "treatment" or "treat" refers to both prophylactic, preventive, and curative or disease-modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have been diagnosed as suffering from an illness or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disease to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder or to prolong the survival of a subject beyond that expected in the absence of such treatment.
[0021] As used herein, the term “curative treatment” or “therapeutic treatment” is focused on treating existing diseases, conditions, or health problems after they have already developed. The goal of curative treatment is to alleviate symptoms, eliminate the cause of the problem, and restore the patient to a healthier state. Curative treatment is reactive, as it addresses health issues that have already manifested and are causing problems for the patient. The term is thus distinguishable from the term “preventive treatment”. Curative treatment is administered after a health issue has developed, targets existing diseases or conditions and aims to provide relief and cure. Curative treatment addresses the symptoms and root causes of a specific health problem. Thus, the goal of curative treatment is to restore the patient's health and eliminate the disease or condition.
[0022] As used herein, the term “preventive treatment” or “prophylactic treatment” aims to prevent the development of diseases, conditions, or health problems before they occur. The goal of preventive treatment is to reduce the risk factors associated with a particular health issue and promote overall well-being. Preventive treatment is proactive, as it focuses on minimizing the likelihood of health problems arising in the first place. Preventive treatment is administered before any health problems arise and focuses on reducing the risk of developing diseases or conditions. Preventive treatment emphasizes lifestyle changes and interventions to minimize risk factors. Thus, the goal of preventive treatment is to maintain good health and avoid the onset of diseases. In particular, the method of the present invention is particularly suitable for reducing the tumors and cell proliferation, increasing cancerous cell death induced by oxidative stress process and / or increasing the survival time in subject suffering from cancer.
[0023] In one embodiment, the compound according to the invention is used as an alternative to one or more another specific compounds used for use in the treatment of cancer in subjects having or developing drug resistance
[0024] As used herein, the term “resistant patient” or “treatment-resistant patient” or “subject developing drug resistance” refers to a subject developing a resistance to one or more compounds used for treating the disease. More particular, it refers to a subject without biological reactivity after a therapeutic treatment. It also refers to a progressive decrease of the efficacy of a therapeutic treatment.
[0025] As used herein, the term “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. A therapeutically effective amount is also one in which any toxic or detrimental effects are outweighed by the therapeutically beneficial effects. The efficient dosages and dosage regimens depend on the disease or condition to be treated and may be determined by the persons skilled in the art. A physician having ordinary skill in the art may readily determine and prescribe the effective amount required. For example, the physician could start doses at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. Amedicine typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg / kg to about 20 mg / kg of body weight per day, especially from about 0.001 mg / kg to 7 mg / kg of body weight per day.
[0026] By "dosage regimen” or “therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]).
[0027] The therapeutically effective amount, the time of administration, route of administration, and the duration of the treatment may vary according to factors well known in the medical art such as the disease state, age, sex, and weight of the individual, and the ability of the compound of the invention to elicit a desired response in the individual.
[0028] As used herein, the term “Cancer” refers to a group consisting of adrenal cortical cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, brain and central nervous system cancer, breast cancer, Castleman disease, cervical cancer, colorectal cancer, endometrial cancer, esophagus cancer, esophagogastric cancer, gallbladder cancer, gastrointestinal carcinoid tumors, hepatobiliary cancer, Hodgkin's disease, non-Hodgkin's lymphoma, Kaposi's sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, liver cancer, lung cancer, melanoma, mesothelioma, plasmacytoma, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oral cavity and oropharyngeal cancer, ovarian cancer, pancreatic cancer, penile cancer, pituitary cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thymus cancer, thyroid cancer, vaginal cancer, vulvar cancer, and uterine cancer.
[0029] In one embodiment, the cancer is a cancer having an oncogenic KRAS mutation, in particular a KRASG12Vmutation, KRASG12Sor KRASG12Dmutation; a NRAS mutation, a EGFRT790M / L858Rmutation and / or a EML4 / ALK translocation.
[0030] In one embodiment, the cancer is a lung cancer.
[0031] In one embodiment, the cancer is a Lung Adenocarcinoma (LUAD), a Non-Cell Lung Cancer (NSCLC) or a Lung Squamous Cell Carcinoma (LUSC).
[0032] As used herein, the term “Lung Adenocarcinoma” or “LUAD” refers to the main nonsmall-cell lung cancer diagnosed. LUAD is a heterogeneous disease including several tumor subtypes, such as adenocarcinoma (which accounts for -50% of all lung cancer cases), squamous cell carcinoma, and large cell carcinoma. (Melocchi V et al., 2021, Oncogens)' .
[0033] As used herein, the term “Non-Small-Cell Lung Cancer” or “NSCLC” refers to any type of epithelial lung cancer other than Small-Cell lung Cancer (SCLC). It encompasses 85% of all lung cancer (2016, American Cancer Society); The most common types of NSCLC are squamous-cell carcinoma, large-cell carcinoma and adenocarcinoma.
[0034] As used herein, the term “Lung Squamous Cell Carcinoma” or “LUSC” or refers to lung cancers that begin in squamous cells. LUSC is a subtype of NSCLC and accounts for approximately 40% of all lung cancer. LUSC is associated with poor clinical prognosis and lacks available targeted therapy. (Li Y et al., 2018, Sci Rep).
[0035] In one embodiment, the cancer is a breast cancer. In some embodiments, the breast cancer is a metastatic breast cancer.
[0036] In one embodiment, the cancer is an Estrogen Receptor positive (“ER-positive”), a Progesterone Receptor positive (“PR-positive”), a Human Epidermal growth factor Receptor 2 positive (“HER2-positive”) or triple negative (“TNBC”) breast cancer.
[0037] Another object of the invention relates to a method for treating cancer in a subject in need thereof comprising administering a therapeutically effective amount of the FMO inhibitor according to the invention.
[0038] “Flavin-containing Monooxygenase” or “FMO” is well known in the state of the art. FMO is a protein family specialized in the oxidation of xeno- substrates in order to facilitate the excretion of these compounds from living organisms (Eswaramoorthy S et al., 2006, Proc Natl Acad Sci U.S.A). Compounds belonging to FMO family share several structural features such as a NADPH binding domain, FAD binding domain and a conserved arginine residue present in the active site. These proteins catalyze the oxygenation of multiple heteroatom-containing compounds that are present in our diet, such as amine-, sulfide-, phosphorus-, and other nucleophilic heteroatom-containing compounds (Cashman J R et al., 2006, Anmi rev Pharmacol Toxicol). FMO family comprises FM01 found in fetal liver, FM02 found in adult liver, FMO3 and FM04 expressed in many organ (Novick R.M et al., 2009, J Pharmacol Exp Ther). The Entrez reference number of the human gene coding for FMO1 is 2326 and the Uniprot reference number of FMO1 human protein is Q01740. The Entrez reference number of the human gene coding for FMO2 is 2327 and the Uniprot reference number of FMO2 human protein is Q99518. The Entrez reference number of the human gene coding for FMO3 is 2328 and the Uniprot reference number of FMO3 human protein is P31513.
[0039] Flavin-containing Monooxygenase 4 or “FMO4” is well known in the state of the art. FMO4 is a protein coding gene belonging to the FMO family. The Entrez reference number of the human gene coding for FM04 is 2329 and the Uniprot reference number of FM04 human protein is P31512. Studies demonstrated that FM04 may be used as hepatocellular carcinoma biomarker (Luo Y et al., 2022, Clin Transl Med). Moreover, no study demonstrated a FMO4 role in lung cancer, breast cancer, hepatobiliary cancer, bladder cancer, sarcoma, esophagogastric cancer, melanoma, pancreatic cancer or prostate cancer nor suggests the use of FM04 as a therapeutic target for treating cancer.
[0040] As used herein, the term “FMO inhibitor” refers to any compound natural or not which is capable of reducing or blocking the activity or expression of FMO. It comprises compounds that inhibits FMO directly or indirectly. The term “FMO inhibitor” encompasses any FMO inhibitor that is currently known in the art or that will be identified in the future and includes any chemical entity that, upon administration to a patient, results in inhibition or downregulation of a biological activity associated with activation of FMO. The term also encompasses inhibitor of expression.
[0041] FMO inhibitors are well known in the state of the art and include those described in : Stdrmer E et al., 2001, Br J Clin Pharmacol Fang J et al., 2000, Eur J Drug Metab Pharmacokinet Lee J.W et al., 2003, Toxicol Lett Liao B.M et al., 2016, Mol Endocrinol ; Janmohamed Aet al., 2004, Biochem Pharmacol. In particular, FM04 inhibitors are well known in the state of the art and include those described in : Itagaki K et al., 1996, J Biol Chem & Janmohamed A et al., 2004, Biochem Pharmacol.
[0042] In the context of the present invention, “FMO inhibitor” is an inhibitor which neutralizes, blocks, inhibits, abrogates, reduces or interferes with the biological activity of FMO. In particular it refers to an inhibitor reducing the tumors and cell proliferation, increasing cancerous cell death induced by oxidative stress process and / or increasing the survival time in subject suffering from cancer.
[0043] In one embodiment, the FMO inhibitor according to the invention is :
[0044] 1) an inhibitor of FMO activity and / or
[0045] 2) an inhibitor of FMO expression.
[0046] In one embodiment, the inhibitor of FMO activity according to the invention is a small molecule, an anti-FMO neutralizing antibody, a neutralizing aptamer and / or a polypeptide.
[0047] In one embodiment, the inhibitor of FMO expression according to the invention is a siRNA, a nuclease, a ribozyme and / or an antisense oligonucleotide. In one embodiment, the inhibitor of FMO expression according to the invention is a shRNA against FMO4.
[0048] By "biological activity" of FMO is meant, in the context of the present invention, reducing the tumors and cell proliferation, increasing cancerous cell death induced by oxidative stress process and / or increasing the survival time in subject suffering from cancer.
[0049] Tests for determining the capacity of a compound to be an FMO inhibitor are well known to the person skilled in the art. In a particular embodiment, the ability of the inhibitor to inhibits the biological activity of FMO is well known to the person skilled in the art. The ability to reduce tumors may be determined by assaying cell proliferation with histopathological analysis and by assaying FMO level and FMO expression with Western blot, PCR analysis, proteomic analysis or immunohistochemistry (see results & Fig. 2). The ability to increase survival time in subject suffering from cancer may be determined by assaying overwall survival of patients with Kaplan Meier curves (see results & Fig. 3). Finally, the ability to increase cancerous cell death induced by oxidative stress may be determined by assaying ROS level and by assaying FMO level and FMO expression with Western blot, PCR analysis, proteomic analysis or immunohistochemistry (see results & Fig. 4 to 6).
[0050] Inhibitor of the FMO activity
[0051] In one embodiment, the FMO inhibitor according to the invention is an inhibitor of FMO activity. As used herein, the term “inhibitor of the FMO activity” refers to a natural or synthetic compound that has a biological effect to inhibit the activity of FMO. In some embodiments, said inhibitor of FMO activity is a small organic molecule, a neutralizing antibody, a neutralizing aptamer and / or a polypeptide. Inhibitors of FMO activity are well known in the state of the art
[0052] • Small organic molecule
[0053] In one embodiment, the compound according to the invention is low molecular weight compound, e.g. a small organic molecule. In one embodiment, the small organic molecule as FMO inhibitor reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0054] As used herein, the term “small organic molecule” refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and most preferably up to about 1000 Da. The small organic molecules as inhibitors of FMO are well known in the state of the art. Methods for selecting an appropriate small organic molecule are well known in the art. In particular, the methods for selecting small molecules specifically inhibiting FMO are known in the prior art. Examples of small molecules inhibitors of FMO include but are not limited to Methimazole (Storm er E et al., 2001, BrJClin Pharmacol & Lee J.W et al., 2003, Toxicol Lett), Thiourea (Fang J et al., 2000, Eur J Drug Metab Pharmacokinet). In particular, small molecules inhibitors of FMO include but are not limited to Magnesium chloride and Sodium Cholate (Itagaki K et al., 1996, J Biol Chem).
[0055] • Antibody
[0056] In one embodiment, the compound according to the invention is an anti-FMO neutralizing antibody that can block directly or indirectly the FMO activity. In particular, the antibody selected is a neutralizing antibody. For this invention, neutralizing antibodies of FMO are selected for their capacity to reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0057] As used herein, "antibody" includes both naturally occurring and non-naturally occurring antibodies. Specifically, "antibody" includes polyclonal and monoclonal antibodies, and monovalent and divalent fragments thereof. Furthermore, "antibody" includes chimeric antibodies, wholly synthetic antibodies, single chain antibodies, and fragments thereof. The antibody may be a human or nonhuman antibody. A nonhuman antibody may be humanized by recombinant methods to reduce its immunogenicity in man. Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W. R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The Fc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope-binding ability in isolation. Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDRS). The CDRs, and in particular the CDRS regions, and more particularly the heavy chain CDRS, are largely responsible for antibody specificity. It is now well-established in the art that the non CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which nonhuman CDRs are covalently joined to human FR and / or Fc / pFc' regions to produce a functional antibody.
[0058] The antibodies as inhibitors of FMO are well known in the state of the art and commonly sold in the trade. Antibodies are prepared according to conventional methodology. Monoclonal antibodies may generated using method of Kholer and Milstein (Nature, 256:495, 1975). Antibodies directed against FMO can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against FMO can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV-hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-FMO single chain antibodies. Compounds useful in practicing the present invention also include anti-FMO antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and / or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to FMO.
[0059] Thus, methods for selecting an appropriate antibody are well known in the art. In particular, the methods for selecting an antibody specifically inhibiting FMO are known in the prior art. For this invention, a neutralizing single domain of FMO is selected.
[0060] In another embodiment, the antibody according to the invention is a humanized antibody. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody will also optionally comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397). Humanized anti-FMO antibodies and antibody fragments there from can also be prepared according to known techniques. In one embodiment of the humanized forms of the antibodies, some, most or all of the amino acids outside the CDR regions have been replaced with amino acids from human immunoglobulin molecules but where some, most or all amino acids within one or more CDR regions are unchanged. However, using certain methods of humanization, the affinity and / or specificity of binding of the antibody may be increased using methods of "directed evolution", as described by Wu et al., I. Mol. Biol. 294:151, 1999, the contents of which are incorporated herein by reference. In vitro methods also exist for producing human antibodies. These include phage display technology (U.S. Pat. Nos. 5,565,332 and 5,573,905) and in vitro stimulation of human B cells (U.S. Pat. Nos. 5,229,275 and 5,567,610). The contents of these patents are incorporated herein by reference. Moreover, one of ordinary skill in the art will be familiar with other methods for antibody humanization. In another embodiment, the antibody according to the invention is a single domain antibody. The term “single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called “nanobody®”.
[0061] • Aptamer
[0062] In one embodiment, the compound according to the invention is a neutralizing aptamer. In one embodiment, the aptamer as FMO inhibitor reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0063] Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. The aptamers as inhibitors of FMO are well known in the state of the art. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al., 1996). Methods for selecting an aptamer specifically inhibiting FMO are known in the prior art. For this invention, neutralizing aptamers of FMO are selected.
[0064] • Polypeptide
[0065] In one embodiment, the compound according to the invention is a polypeptide. Particularly, the polypeptide can be a mutated FMO protein or a similar protein without the function of FMO. In one embodiment, the polypeptide as FMO inhibitor reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0066] A polypeptide is a chain of amino acids linked by peptide bonds. In particular, a polypeptide comprises an amino acid chain containing from 10 to 100 amino acids. The polypeptides as inhibitors of FMO are well known in the state of the art. Methods for selecting an polypeptide specifically inhibiting FMO are known in the prior art. The polypeptides of the invention may be produced by any suitable means, as will be apparent to those of skill in the art. In order to produce sufficient amounts of polypeptide or functional equivalents thereof for use in accordance with the present invention, expression may conveniently be achieved by culturing under appropriate conditions recombinant host cells containing the polypeptide of the invention. Preferably, the polypeptide is produced by recombinant means, by expression from an encoding nucleic acid molecule. Systems for cloning and expression of a polypeptide in a variety of different host cells are well known. When expressed in recombinant form, the polypeptide is preferably generated by expression from an encoding nucleic acid in a host cell. Any host cell may be used, depending upon the individual requirements of a particular system. Suitable host cells include bacteria mammalian cells, plant cells, yeast and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells. HeLa cells, baby hamster kidney cells and many others. Bacteria are also preferred hosts for the production of recombinant protein, due to the ease with which bacteria may be manipulated and grown. A common, preferred bacterial host is E coli. In specific embodiments, it is contemplated that polypeptides used in the therapeutic methods of the present invention may be modified in order to improve their therapeutic efficacy. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution. In example adding dipeptides can improve the penetration of a circulating agent in the eye through the blood retinal barrier by using endogenous transporters. A strategy for improving drug viability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water- soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain. Polyethylene glycol (PEG) has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. Attachment to various drugs, proteins, and liposomes has been shown to improve residence time and decrease toxicity. PEG can be coupled to active agents through the hydroxyl groups at the ends of the chain and via other chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids were explored as novel biomaterials which would retain the biocompatibility properties of PEG, but which would have the added advantage of numerous attachment points per molecule (providing greater drug loading), and which could be synthetically designed to suit a variety of applications. Those of skill in the art are aware of PEGylation techniques for the effective modification of drugs. For example, drug delivery polymers that consist of alternating polymers of PEG and tri -functional monomers such as lysine have been used by VectraMed (Plainsboro, N. J.). The PEG chains (typically 2000 daltons or less) are linked to the a- and e-amino groups of lysine through stable urethane linkages. Such copolymers retain the desirable properties of PEG, while providing reactive pendent groups (the carboxylic acid groups of lysine) at strictly controlled and predetermined intervals along the polymer chain. The reactive pendent groups can be used for derivatization, cross-linking, or conjugation with other molecules. These polymers are useful in producing stable, long-circulating pro-drugs by varying the molecular weight of the polymer, the molecular weight of the PEG segments, and the cleavable linkage between the drug and the polymer. The molecular weight of the PEG segments affects the spacing of the drug / linking group complex and the amount of drug per molecular weight of conjugate (smaller PEG segments provides greater drug loading). In general, increasing the overall molecular weight of the block co-polymer conjugate will increase the circulatory half-life of the conjugate. Nevertheless, the conjugate must either be readily degradable or have a molecular weight below the threshold-limiting glomular filtration (e g., less than 60 kDa). In addition, to the polymer backbone being important in maintaining circulatory half-life, and biodistribution, linkers may be used to maintain the therapeutic agent in a pro-drug form until released from the backbone polymer by a specific trigger, typically enzyme activity in the targeted tissue. For example, this type of tissue activated drug delivery is particularly useful where delivery to a specific site of biodistribution is required and the therapeutic agent is released at or near the site of pathology. Linking group libraries for use in activated drug delivery are known to those of skill in the art and may be based on enzyme kinetics, prevalence of active enzyme, and cleavage specificity of the selected disease-specific enzymes. Such linkers may be used in modifying the protein or fragment of the protein described herein for therapeutic delivery.
[0067] Inhibitor of FMO gene expression
[0068] In one embodiment, the FMO inhibitor according to the invention is an inhibitor of FMO gene expression. As used herein the term “inhibitor of the FMO gene expression” refers to a natural or synthetic compound that has a biological effect to inhibit the expression of gene. In some embodiments, said inhibitor of gene expression is a siRNA, a nuclease, a ribozyme or an antisense oligonucleotide. Inhibitors of FMO gene expression are well known in the state of the art.
[0069] • Small inhibitory RNA
[0070] In one embodiment, the compound according to the invention is an Small inhibitory RNAs (siRNAs). In one embodiment, the siRNA as FMO inhibitor reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0071] Small inhibitory RNA (usually of 20-24 bp) interacting with an mRNA to decrease or inhibit a gene expression. siRNAs as inhibitors of FMO are well known in the state of the art. Examples of siRNAs inhibiting FMO include but are not limited to shRNA (Liao B.M et al., 2016, Mol Endocrinol). FMO gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that FMO gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01 / 36646, WO 99 / 32619, and WO 01 / 68836). In particular, the methods for selecting small inhibitory specifically inhibiting FMO gene expression are known in the prior art.
[0072] • Nuclease
[0073] In one embodiment, the compound according to the invention is a Nuclease. In one embodiment, the nuclease as FMO inhibitor reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0074] Nuclease or Endonuclease are synthetic nucleases consisting of a DNA binding site, a linker, and a cleavage module derived from a restriction endonuclease which are used for gene targeting efforts The synthetic nucleases according to the invention exhibit increased preference and specificity to bipartite or tripartite DNA target sites comprising DNA binding (i.e. TALEN or CRISPR recognition site(s)) and restriction endonuclease target site while cleaving at off-target sites comprising only the restriction endonuclease target site is prevented. The guide RNA (gRNA) sequences direct the nuclease (i.e. Cas9 protein) to induce a site- specific double strand break (DSB) in the genomic DNA in the target sequence. Restriction endonucleases (also called restriction enzymes) as referred to herein in accordance with the present invention are capable of recognizing and cleaving a DNA molecule at a specific DNA cleavage site between predefined nucleotides. In contrast, some endonucleases such as for example Fokl comprise a cleavage domain that cleaves the DNA unspecifically at a certain position regardless of the nucleotides present at this position. Therefore, preferably the specific DNA cleavage site and the DNA recognition site of the restriction endonuclease are identical. Moreover, also preferably the cleavage domain of the chimeric nuclease is derived from a restriction endonuclease with reduced DNA binding and / or reduced catalytic activity when compared to the wildtype restriction endonuclease. According to the knowledge that restriction endonucleases, particularly type II restriction endonucleases, bind as a homodimer to DNA regularly, the chimeric nucleases as referred to herein may be related to homodimerization of two restriction endonuclease subunits. Preferably, the restriction endonuclease from which the cleavage module of the chimeric nuclease is derived is a type IIP restriction endonuclease. The preferably palindromic DNA recognition sites of these restriction endonucleases consist of at least four or up to eight contiguous nucleotides. Preferably, the type IIP restriction endonucleases cleave the DNA within the recognition site which occurs rather frequently in the genome, or immediately adjacent thereto, and have no or a reduced star activity. Nucleases as inhibitors of FMO are well known in the state of the art.
[0075] • Ribozyme
[0076] In one embodiment, the compound according to the invention is a Ribozyme. In one embodiment, the ribozyme as FMO inhibitor reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0077] Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of FMO mRNA sequences are thereby useful within the scope of the present invention.
[0078] Ribozymes as inhibitors of FMO are well known in the state of the art. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays. Methods for selecting ribozymes specifically inhibiting FMO gene expression are known in the prior art.
[0079] • Antisense oligonucleotide
[0080] In one embodiment, the compound according to the invention is an Antisense oligonucleotide. In one embodiment, the antisense oligonucleotide as FMO inhibitor reduces the tumors and cell proliferation, increases cancerous cell death induced by oxidative stress process and / or increases the survival time in subject suffering from cancer.
[0081] Antisense oligonucleotides, including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of FMO mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of FMO, and thus activity, in a cell.
[0082] The antisense oligonucleotides as inhibitors of FMO are well known in the state of the art, in particular antisense oligonucleotides as inhibitors of FM04 (Janmohamed A et al., 2004, Biochem Pharmacol). Antisense oligonucleotides can be synthesized, e g., by conventional phosphodiester techniques. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732). In particular, the methods for selecting antisense oligonucleotides specifically inhibiting FMO gene expression are known in the prior art. The inhibitor of FMO gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoter. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and / or 3' ends of the molecule, or the use of phosphorothioate or 2'-O-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.
[0083] • Inhibitor of FMO gene expression can be associated with a vector
[0084] The inhibitor of FMO gene expression of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the inhibitor of the gene expression to the cells and preferably cells expressing FMO. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the inhibitor of the gene expression. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno- associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Preferred viral vectors are based on non- cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles are provided in Kriegler, 1990 and in Murry, 1991. Preferred viruses for certain applications are the adeno-viruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno-associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wildtype adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC / CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencap sul ati on .
[0085] In one embodiment, the inhibitor of FMO gene expression according to the invention is associated with a vector. In one embodiment, the inhibitor of FMO gene expression according to the invention is associated with a viral vector, adeno-viral vector, lentiviral vector or a plasmid vector.
[0086] Pharmaceutical composition
[0087] Another object of the invention relates to a pharmaceutical composition for use in the treatment of cancer comprising a therapeutically effective amount of the FMO inhibitor according to the invention. In one embodiment, the Flavin-containing Monooxygenase (FMO) inhibitor is a Flavin- containing Monooxygenase 1 (FMO 1) inhibitor, a Flavin-containing Monooxygenase 2 (FMO 2) inhibitor, a Flavin-containing Monooxygenase 3 (FMO 3) inhibitor or a Flavin-containing Monooxygenase 4 (FMO 4) inhibitor.
[0088] The composition of the present invention may e.g. be formulated for any mode of administration suitable for the treatment of cancer, in particular, lung cancer, breast cancer, hepatobiliary cancer, bladder cancer, sarcoma, esophagogastric cancer, melanoma, pancreatic cancer or prostate cancer. The form of the composition, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the subject, etc. Then, the uses are adjusted to provide the optimum desired response (e.g., a therapeutic response). The pharmaceutical compositions may contain vehicles which are pharmaceutically acceptable for a formulation capable of treating cancer.
[0089] As used herein, the term “pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administrated to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluents, encapsulating material or formulation auxiliary of any type. The carrier(s) must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
[0090] “Carriers” or “vehicles” include any such material known in the art and may be any liquid, gel, solvent, liquid diluent, solubilizer, or like, which is non-toxic and which does not interect with any components of the composition in a deleterious manner. Examples of nutritionally acceptable carriers include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, polyethylene glycols, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, perfume oil, fatty acid monoglycerides and diglycerides, petroethral fatty acid esters, hydroxymethyl-cellulose, polyvinylpyrrolidone, and the like.
[0091] Kit of parts
[0092] Another object of the invention relates to a kit of part comprising an FMO inhibitor and at least one further therapeutic agent as a combined preparation for simultaneous, separate or sequential use in the treatment of cancer. In one embodiment, the Flavin-containing Monooxygenase (FMO) inhibitor is a Flavin- containing Monooxygenase 1 (FMO 1) inhibitor, a Flavin-containing Monooxygenase 2 (FMO 2) inhibitor, a Flavin-containing Monooxygenase 3 (FMO 3) inhibitor or a Flavin-containing Monooxygenase 4 (FMO 4) inhibitor.
[0093] Particularly, the inhibitor of FMO is an inhibitor of FMO 4.
[0094] As used herein, the term “therapeutic agent” or “active agent” or “active substance” or “active principle” or “active ingredient” relates to a chemical substance inducing an effect such as a therapeutic or a preventive effect. It may be a bioactive chemical compound from a drug or the drug itself. Active agent can be a single molecule or a mixture of several substances.
[0095] As used herein, the term “simultaneous use” denotes the use of a FMO inhibitor and at least one active agent occurring at the same time. As used herein, the term “separate use” denotes the use of a FMO inhibitor and at least one active agent not occurring at the same time. As used herein, the term “sequential use” denotes the use of a FMO inhibitor and at least one active agent occurring by following an order.
[0096] In one embodiment, active agents may be added to the pharmaceutical composition or used in combination with the compound of the invention in the case of the treatment of cancer. In one embodiment, active agents used in combination with the compound of the invention comprising Melphalan, Vincristine (Oncovin), Cyclophosphamide (Cytoxan), Etoposide (VP- 16), Doxorubicin (Adriamycin), Liposomal doxorubicin (Doxil) and Bendamustine (Treanda). Others anti-cancer agents may be for example cytarabine, anthracyclines, fludarabine, gemcitabine, capecitabine, methotrexate, taxol, taxotere, mercaptopurine, thioguanine, hydroxyurea, cyclophosphamide, ifosfamide, nitrosoureas, platinum complexes such as cisplatin, carboplatin and oxaliplatin, mitomycin, dacarbazine, procarbizine, etoposide, teniposide, campathecins, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, L-asparaginase, doxorubicin, epimbicm, 5-fluorouracil, taxanes such as docetaxel and paclitaxel, leucovorin, levamisole, irinotecan, estramustine, etoposide, nitrogen mustards, BCNU, nitrosoureas such as carmustme and lomustine, vinca alkaloids such as vinblastine, vincristine and vinorelbine, imatimb mesylate, hexamethyhnelamine, topotecan, kinase inhibitors, phosphatase inhibitors, ATPase inhibitors, tyrphostins, protease inhibitors, inhibitors herbimycm A, genistein, erbstatin, and lavendustin A. In one embodiment, additional anticancer agents may be selected from, but are not limited to, one or a combination of the following class of agents: alkylating agents, plant alkaloids, DNA topoisomerase inhibitors, anti-folates, pyrimidine analogs, purine analogs, DNA antimetabolites, taxanes, podophyllotoxin, hormonal therapies, retinoids, photosensitizers or photodynamic therapies, angiogenesis inhibitors, antimitotic agents, isoprenylation inhibitors, cell cycle inhibitors, actinomycins, bleomycins, MDR inhibitors and Ca2+ ATPase inhibitors.
[0097] Additional anti-cancer agents may be selected from, but are not limited to, cytokines, chemokines, growth factors, growth inhibitory factors, hormones, soluble receptors, decoy receptors, monoclonal or polyclonal antibodies, mono-specific, bi-specific or multi-specific antibodies, monobodies, polybodies. Additional anti-cancer agent may be selected from, but are not limited to, growth or hematopoietic factors such as erythropoietin and thrombopoietin, and growth factor mimetics thereof.
[0098] In the present methods for treating cancer the further therapeutic active agent can be an antiemetic agent. Suitable antiemetic agents include, but are not limited to, metoclopromide, domperidone, prochlorperazine, promethazine, chlorpromazine, trimethobenzamide, ondansetron, granisetron, hydroxyzine, acethylleucine monoemanolamine, alizapride, azasetron, benzquinamide, bietanautine, bromopride, buclizine, clebopride, cyclizine, dunenhydrinate, diphenidol, dolasetron, meclizme, methallatal, metopimazine, nabilone, oxypemdyl, pipamazine, scopolamine, sulpiride, tetrahydrocannabinols, thiefhylperazine, thioproperazine and tropisetron. In a preferred embodiment, the antiemetic agent is granisetron or ondansetron.
[0099] In another embodiment, the further therapeutic active agent can be an hematopoietic colony stimulating factor. Suitable hematopoietic colony stimulating factors include, but are not limited to, filgrastim, sargramostim, molgramostim and epoietin alpha. In still another embodiment, the other therapeutic active agent can be an opioid or non-opioid analgesic agent Suitable opioid analgesic agents include, but are not limited to, morphine, heroin, hydromorphone, hydrocodone, oxymorphone, oxycodone, metopon, apomorphine, nomioiphine, etoipbine, buprenorphine, mepeddine, lopermide, anileddine, ethoheptazine, piminidine, betaprodine, diphenoxylate, fentanil, sufentanil, alfentanil, remifentanil, levorphanol, dextromethorphan, phenazodne, pemazocine, cyclazocine, methadone, isomethadone and propoxyphene. Suitable non-opioid analgesic agents include, but are not limited to, aspirin, celecoxib, rofecoxib, diclofinac, diflusinal, etodolac, fenoprofen, flurbiprofen, ibuprofen, ketoprofen, indomethacin, ketorolac, meclofenamate, mefanamic acid, nabumetone, naproxen, piroxicam and sulindac.
[0100] In yet another embodiment, the further therapeutic active agent can be an anxiolytic agent. Suitable anxiolytic agents include, but are not limited to, buspirone, and benzodiazepines such as diazepam, lorazepam, oxazapam, chlorazepate, clonazepam, chlordiazepoxide and alprazolam.
[0101] In yet another embodiment, the further therapeutic active agent can be a checkpoint blockade cancer immunotherapy agent (also known as Immune Checkpoint Inhibitor).
[0102] Typically, the checkpoint blockade cancer immunotherapy agent is an agent which blocks an immunosuppressive receptor expressed by activated T lymphocytes, such as cytotoxic T lymphocyte-associated protein 4 (CTLA4) and programmed cell death 1 (PDCD1, best known as PD-1), or by NK cells, like various members of the killer cell immunoglobulin-like receptor (KIR) family, or an agent which blocks the principal ligands of these receptors, such as PD-1 ligand CD274 (best known as PD-L1 or B7-H1).
[0103] Typically, the checkpoint blockade cancer immunotherapy agent is an antibody.
[0104] In some embodiments, the checkpoint blockade cancer immunotherapy agent is an antibody selected from the group consisting of anti-CTLA4 antibodies, anti-PDl antibodies, anti-PDLl antibodies, anti-PDL2 antibodies, anti-TIM-3 antibodies, anti-LAG3 antibodies, anti-IDOl antibodies, anti-TIGIT antibodies, anti-B7H3 antibodies, anti-B7H4 antibodies, anti- BTLA antibodies, and anti-B7H6 antibodies. In some embodiments, the checkpoint blockade cancer immunotherapy agent is selected from the list comprising ipilumab, pembrolizumab, nivolumab, atezolizumab, cemiplimab, avelumab, durvalumab, dostarlimab or toripalimab.
[0105] In another embodiment, the further therapeutic active agent can be an inhibitor of ferroptosis like ferrostatin, liproxstatin, and zileuton (see for example Xie Y. et al. Cell Death Differ 2016).
[0106] In another embodiment, the further therapeutic active agent can be an inducer of ferroptosis like small molecules inducers (e.g. erastin, sulfasalazine, sorafenib, 3- phenylquinazolinones, (15,3 ?)-RSL3, ML162, ML210 talaroconvulutin A, FIN56, Perillaldehyde, FA16 or N,N-Dimethyl-4-(4-((2-(trifluoromethyl)-lH-benzo[d]imidazole-l- yl)methyl) piperidin-l-yl)benzenesulfonamide, 26a or 2-(Benzo[b]thiophen-3-yl)-2-(2-chloro- N-(4-(oxazol-5-yl)phenyl)-acetamido)-N-phenethylacetamide, 6-TG or 6-Thioguanine, icFSPl or 3,4,5-Trimethoxy-N-[4-(2-methyl-4-oxo-3(4H)-quinazolinyl)phenyl]benzeneacetamide, Disulfiram) or nanoparticles inducers (e.g. CNPs, TCA, FA-FcS, NSBSO, VMT-PVP nanosheets, FesiRNA PNPs, GA-Fe(II)) (see for example Wenjing M. et al. Bioorganic Chemistry 2024) In some embodiments, the ferroptosis inducer is a Glutathione Peroxidase 4 (GPX4) inhibitor. In some embodiments, the GPX4 inhibitor is JKE-1674. Prognostic application
[0107] Another object of the invention relates to a method for predicting the survival time and / or the disease progression in a subject suffering from cancer, in particular lung cancer, breast cancer, hepatobiliary cancer, bladder cancer, sarcoma, esophagogastric cancer, melanoma, pancreatic cancer or prostate cancer comprising i) determining in a sample obtained from the patient the expression level of FMO, ii) comparing said expression level determined at step i) with a predetermined reference value and iii) concluding that the method provides a good prognostic when the level of gene expression is higher than the predetermined reference value, or provides a bad prognostic when the level of gene expression is lower than the predetermined reference value.
[0108] The method for predicting the survival and / or the disease progression in a subject suffering from cancer, in particular lung cancer, breast cancer, hepatobiliary cancer, bladder cancer, sarcoma, esophagogastric cancer, melanoma, pancreatic cancer or prostate cancer can comprise a further step of administering said subject with a FMO inhibitor when the level of gene expression is lower than the predetermined reference value. In one embodiment, the Flavin-containing Monooxygenase (FMO) inhibitor is a Flavin-containing Monooxygenase 1 (FMO 1) inhibitor, a Flavin-containing Monooxygenase 2 (FMO 2) inhibitor, a Flavin- containing Monooxygenase 3 (FMO 3) inhibitor or a Flavin-containing Monooxygenase 4 (FMO 4) inhibitor.
[0109] As used herein, the term “sample” relates to sample obtained from the subject. The sample can be blood, peripheral-blood, serum, plasma, circulating cells, sample obtained from biopsy. In particular, the sample can be lung cells, breast cells, hepatobiliary cells, bladder cells, soft tissue cells, esophagogastric cells, skin cells, pancreatic cells or prostate cells. As used herein, the term “normal sample” or “healthy sample” or “wild-type sample” refers to a sample from healthy tissue comprising, for example, a sample without mutation, a sample with a mutation inducing no metabolic dysfunctions or a sample without tumor. As used herein, the term “pathological sample” or “mutated sample” or “unhealthy sample” refers to any biological sample that contains a mutation, a cell, a tumor or any biological change inducing diseases or metabolic dysfunctions.
[0110] As used herein, the term “predicting” relates to anticipating the presence and / or the progress of the disease as well as the survival time and / or the survival rate of the subject.
[0111] As used herein, the term “good prognostic” predictives of a subject without a progress of the disease and / or with a good survival time and / or with a good survival rate. In the same way, “bad prognostic” predictives of a subject with a constant progress of the disease and / or with an increased progress of the disease and / or a with bad survival time and / or with a bad survival rate.
[0112] As used herein, the term “survival time” refers to the percentage of people in a study or treatment group who are still alive for a certain period of time after they were diagnosed with or started treatment for a disease, such as the disease according to the invention. The survival time rate is often stated as a five-year survival rate, which is the percentage of people in a study or treatment group who are alive five years after their diagnosis or the start of treatment. As used herein and according to the invention, the term “survival time” can regroup the term OS.
[0113] As used herein, the term “Overall survival (OS)” refers to the time from diagnosis of a disease such as the disease according to the invention until death from any cause. The overall survival rate is often stated as a two-year survival rate, which is the percentage of people in a study or treatment group who are alive two years after their diagnosis or the start of treatment.
[0114] In one embodiment, the method according to the invention is an in vivo method.
[0115] In one embodiment, the method according to the invention is an in vitro method.
[0116] As used herein, the term “reference value” or “predetermined reference value” refers to a number or value derived from population studies, including without limitation, patients of the same or similar age range, patients in the same or similar ethnic group, and patients having the same severity of disease. Such predetermined reference values can be derived from statistical analyses and / or risk prediction data of populations obtained from mathematical algorithms and computed indices of the disease. In the present invention, “reference value” refers to a value known compared with the value of the gene expression of the present invention Typically, the reference is a threshold value or cut-off value.
[0117] As used herein, the term “threshold value” or “cut-off value” refers to a value which can be determined experimentally, empirically, or theoretically A threshold value can also be arbitrarily selected based on the existing experimental and / or clinical conditions, as would be recognized by a person of ordinary skill in the art. For example, retrospective measurement in properly banked historical subject samples may be used in establishing the predetermined reference value. The threshold value has to be determined to obtain the optimal sensitivity and specificity according to the function of the test and the benefit / risk balance (clinical consequences of false positive and false negative). In routine work, the reference value (cut-off value) may be used in the present method to discriminate samples of interest for the studied disease and therefore the corresponding patients. Typically, the optimal sensitivity and specificity (and the threshold value) can be determined using a Receiver Operating Characteristic (ROC) curve based on experimental data. For example, after determining the level in a group of reference, one can use algorithmic analysis to statistically treat the levels determined in samples to be tested and thus obtain a classification standard having significance for sample classification. The full name of the ROC curve is the receiver operator characteristic curve, also known as the receiver operation characteristic curve. It is mainly used for clinical and biochemical diagnostic tests. The ROC curve is a comprehensive indicator that reflects the continuous variables of true positive rate (sensitivity) and false positive rate (1 -specificity). It reveals the relationship between sensitivity and specificity with the image composition method. A series of different cut-off values (thresholds or critical values, boundary values between normal and abnormal diagnostic test results) are set as continuous variables to calculate a series of sensitivity and specificity values. Then sensitivity is used as the vertical coordinate, and specificity is used as the horizontal coordinate to draw a curve. The higher the area under the curve (AUC), the higher the accuracy of diagnosis. On the ROC curve, the point closest to the far upper left of the coordinate diagram is a critical point with high sensitivity and specificity values. The AUC value of the ROC curve is between 1.0 and 0.5. When AUC>0.5, the diagnostic result improves as AUC approaches 1. When AUC is between 0.5 and 0.7, the accuracy is low. When AUC is between 0.7 and 0.9, the accuracy is moderate. When AUC is higher than 0.9, the accuracy is high. This algorithmic method is preferably done with a computer. Existing software or systems in the art may be used to draw the ROC curve, such as MedCalc 9.2.0.1 medical statistical software, SPSS 9.0, ROCPOWER SAS, DESIGNROC FOR, MULTIREADER POWER SAS, CREATE- ROC.SAS, GB STAT VIO.O (Dynamic Microsystems, Inc. Silver Spring, Md., USA), etc. For example the level of marker of intererst has been assessed for 100 samples of 100 patients. The 100 samples are ranked according to their expression level. Sample 1 has the best expression level and sample 100 has the worst expression level. A first grouping provides two subsets: on one side sample Nr 1 and on the other side the 99 other samples. The next grouping provides on one side samples 1 and 2 and on the other side the 98 remaining samples etc., until the last grouping: on one side samples 1 to 99 and on the other side sample Nr 100. According to the information relating to the actual clinical outcome for the corresponding ill patient, Kaplan Meier curves are prepared for each of the 99 groups of two subsets. Also for each of the 99 groups, the p value between both subsets was calculated. The reference value is selected such as the discrimination based on the criterion of the minimum p value is the strongest. In other terms, the expression level corresponding to the boundary between both subsets for which the p value is minimum is considered as the reference value. It should be noted that the reference value is not necessarily the median value of expression levels. Kaplan-Meier curves of percentage of survival as a function of time are commonly used to measure the fraction of patients living for a certain amount of time after treatment and are well known by the man skilled in the art.
[0118] The man skilled in the art also understands that the same technique of assessment of the expression level of a protein should of course be used for obtaining the reference value and thereafter for assessment of the expression level of a protein of a patient subjected to the method of the invention. Such predetermined reference values of expression level may be determined for any genes of the invention defined above.
[0119] The result of which based on statistics, owing to its very good reliability, provides a very helpful information for the physician for making his clinical diagnosis and, where appropriate, prescribing steps to be taken for the management of the disease. It can help early identification of asymptomatic patients with high risk of disease progression. More generally, it advantageously allows a better monitoring and global disease management.
[0120] "Risk" relates to the probability that an event will occur over a specific time period, and can mean a subject's "absolute" risk or "relative" risk. Absolute risk can be measured with reference to either actual observation post-measurement for the relevant time cohort, or with reference to index values developed from statistically valid historical cohorts that have been followed for the relevant time period. Relative risk refers to the ratio of absolute risks of a subject compared either to the absolute risks of low risk cohorts or an average population risk, which can vary by how clinical risk factors are assessed
[0121] "Risk evaluation" or "evaluation of risk" in the context of the present invention encompasses making a prediction of the probability, odds, or likelihood that an event or disease state may occur, the rate of occurrence of the event or conversion from one disease state to another. Risk evaluation can also comprise prediction of future clinical parameters, traditional laboratory risk factor values, or other indices of the disease, such as cellular population determination in peripheral tissues, in serum or other fluid, either in absolute or relative terms in reference to a previously measured population.
[0122] The invention will be further illustrated by the following figures and examples. However, the examples and figures should not be interpreted in any way as limiting the scope of the present invention. FIGURES
[0123] Figure 1 MET overexpression in lungs induces adenocarcinoma in mice.
[0124] (A) Kaplan-Meier survival curves of CCSP and MET / CCSP mice (n = 8 and n = 27) fed a doxycycline-containing diet to induce human MET expression; p = 0.0002 [hazard ratio = 6.43 (95%CI = 2.35-17.59)] (Mantel-Cox log-rank test). (B) HE and immunohistochemical staining (Ki67, MET, phosphorylated ERK) of lung samples (tumors and normal tissue) from the mice described in A. Dot plots show the quantification (tumor area or positive cells) of the staining in the left panels. Scale bars: 500 pm. Values correspond to the mean ± SEM of samples from 5 CCSP and 10 CCSP / MET mice; n (normal lung) and T (tumor). *** p < 0.001, **** p < 0.0001 (two tailed unpaired Student / -test for HE and one-way ANOVA followed by Tukey’s post hoc test for immunohistochemistry). (C) Percentage (mean ± SEM) of hyperproliferation, adenoma and adenocarcinoma lesions in lungs from MET / CCSP (n = 6) and EGFRT790ML858R / CCSP (n = 5) mice; * p <0.05, *** p <0.001 (two-way ANOVA followed by the Sidak’s post hoc test). (D) Waterfall plots showing tumor response in mice exposed to doxycycline diet for 13 months. Tumor-bearing MET / CCSP mice were treated daily with vehicle (n = 4) or crizotinib (80mg / kg) (n = 4) five days per week for 31 days. Tumor area was monitored by computed tomography imaging before (baseline) and after the 31 days of treatment. Each bar represents the change from baseline of one tumor expressed in percentage.
[0125] Horizontal dotted lines indicate 30% decrease and 20% increase in tumor size (significant change according to the RECIST criteria), respectively. (E) Box and whisker plots showing MET (right panel) and Met mRNA (left panel) expression in liver, heart, spleen and lung samples from CCSP and CCSP / MET mice fed ad-libitum a doxycycline-containing (DOX) diet for 3 months; **** p < 0.0001 (two-way ANOVAfollowed by Tukey’s post hoc test). (F) Tumor area (percentage of lung area) evaluated at month 3 after doxycycline withdrawal (n = 5) or not (n = 5) in tumor-bearing CCSP / MET mice that were fed a DOX diet for 13 months before the change to normal diet. Values are the mean ± SEM; *** p < 0.001 (two-tailed unpaired Student’s t-test).
[0126] FMO4 is highly expressed in mouse lung adenocarcinoma induced by different oncogenic drivers.
[0127] Fmol, Fmo2, Fmo3, FMO4 and Fmo5 expression in normal lung tissue (normal, n = 8 mice) or lung tumors (tumors, n = 8 mice) from CCSP / MET mice. Results are the mean ± SEM; **** p < 0.0001 (two-tailed unpaired Student’s t-test). FMO4 expression in tumors was increased by 7-fold compared with healthy lung. Figure 3 : FMO4 is highly expressed in human lung cancer samples and its expression correlates with poor overall survival in patients with lung adenocarcinoma.
[0128] (A) FMO4 H-score in normal lung (n = 244) and tumor (n = 185) biopsies. Results are presented as box and whisker plots; **** p <0.0001 (two-tailed unpaired Student’s / -test). (B) FMO4 H-score in normal lung tissue (n = 244) and in the different lung cancer subtypes: lung adenocarcinoma (LUAD; n = 93), squamous cell carcinoma (LUSQ; n = 67) and other lung cancer subtypes (n = 25) from the same cohort as in A. Results are presented as box and whisker plots; **** / ? <0.0001 (one-way ANOVA with Tukey’s post hoc test). (C)FM01, FM02, FM03 and FM04 expression levels in patients with lung cancer and 2 copies (diploid; n = 199 for FM01 and FM04 and n = 200 for FM02 and FM03) or > 3 copies (amp; n = 26 for all genes) of each gene locus. Z-scores (log RNA Seq V2 RSEM) were obtained from two studies (TCGA and PanCancer Atlas and OncoSG); *p< 0.05 (two-tailed unpaired Student’s / -test). (D) Kaplan Meier curves showing overall survival of patients with lung adencarcinoma according to FMO4 expression (FMO4-low n = 88 and FMO4-high n = 18). Statistical significance was calculated with the Mantel-Cox log-rank test: p = 0.044 [hazard ratio = 0.2055 (95%CI = 0.84-5.03)]. (E) Dot plot representing the distribution of IHC H-score for FM04 expression in normal and tumor samples from the same lung cancer cohort. Dotted line indicates 97, that is the maximum H- score in healthy lung and differentiates between low and high FMO4 expression in the Kaplan- Meier curves. (F) Kaplan Meier curves showing overall survival of lung cancer patients from the same cohort used according to FM04 expression (FMO4-low n = 48 and FMO4 high n = 135). Statistical significance was calculated with the log-rank (Mantel -Cox) test, p = 0.118 [hazard ratio = 1.517 (95% CI = 0.94-2.44)].
[0129] Figure 4 : Oxidative stress induces FMO4 expression through the stress sensor aryl hydrocarbon receptor.
[0130] (A) Correlation analyses between FM04 protein expression and ROS levels in the same cell lines. Pearson correlation coefficient = 0.6571; p = 0.02. (B) Correlation between FMO4 and 4-HNE H-scores (same TMAused in Fig. 3a). Pearson correlation coefficient = 0.64; p < 0.0001 (C) ChIP analysis of AHR binding to the FM04 promoter in H1299 cells incubated with 3mM NAC or PBS overnight and in A549 cells incubated with 5pM H2O2 or PBS overnight. (D) A549 cells were incubated with the indicated H2O2 concentrations, and ROS was measured at 2 4h post-treatment. (E) Hl 299 cells were incubated with the indicated NAC concentrations, and ROS was measured at 24 h post-treatment. (F) Viability of A549 cells incubated with the indicated H2O2 concentrations for 24 h. (G) Viability of H1299 cells incubated with the indicated NAC concentrations for 24 h. FMO4 loss of function promote apoptosis induced by oxidative stress.
[0131] (A) Changes in cellular ROS levels in Hl 993 (upper panel) and H1299 (lower panel) harboring the shRNAs described after incubation with Ipg / ml doxycycline for 48 h. ROS levels were normalized to those in shNT cells without DOX (set to 1), and results are presented as the mean ± SD of three independent experiments; *p < 0.05, ** p < 0.01 (two-way ANOVA with
[0132] Dunnett’s post hoc test). (B) Representative images of clonogenic assay in control (shNT) and shll+12-infected H1993 (left panels) and H1299 (right panels) cells. Cells were plated at low density and incubated with PBS, doxycycline (DOX; Ipg / ml) or / and NAC (ImM) for 3 weeks (H1993) and 2 weeks (H1299), respectively. The upper histograms show the number of foci the bottom histograms the size of foci in each condition (mean ± SD) from three independent experiments; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (two-way ANOVA followed by Tukey’s post hoc test). (C) Correlation analysis between AHR and FM04 mRNA levels in human lung adenocarcinoma samples using the online tool http: / / gepia.cancerpku.cn / detail. php?clicktag=correlation. The linear relationship was calculated using the Pearson correlation coefficient and was 0.25 (**** p > 0.0001).
[0133] Figure 6 FMO4 loss of function promote apoptosis induced by oxidative stress in human bronchoalveolar cells during KRASG12Vtransformation.
[0134] (A) ROS levels in BEAS-2B-KRASG12V-shNT and -shFMO4 cells incubated with PBS, doxycycline (DOX; 1 pg / ml) or / and NAC (ImM) for 4 days. Data were relative to ROS level in the shNT-PBS condition (set to 1) and are the mean ± SD of four independent experiments; * p < 0.05, **** p < 0.0001 (two-way ANOVA with Dunnett’s post hoc test). (B) Representative images of focus formation assay in BEAS-2B KRASG12V-shNT and -shFMO4 cells. Cells were plated at low density, cultured in medium containing 0.5% serum and treated as in b for 15 days. The upper histogram shows the number of foci and the bottom histogram the size of foci (mean ± SD); # p < 0.1, * p < 0.05, ** p < 0.01, **** p < 0.0001 (two-way ANOVA followed by Tukey’s post hoc test).
[0135] Figure 7 FMO4 loss of function hampers in vivo KRASG12Vtransformation.
[0136] (A) RFP signal from BEAS-2B-KRASG12V-shNT and -shFMO4 tumors in mice fed a normal (n = 4 mice for each shRNA) or doxycycline-containing diet (DOX, n = 9 mice for each shRNA). Data represent the fold change in RFP signal intensity at day 30 versus day 10; * p <
[0137] 0.05 (two-way ANOVA followed by Tukey’s post hoc test). (B) Growth of BEAS-2B- KRASG12V-shNT and -shFMO4 tumors (n = 9 mice for each shRNA) in mice fed a DOX diet. At each time point, tumor growth is shown as the fold change versus day 5 post-cell injection; ** p < 0.01, **** p < 0.0001 (two-way ANOVA followed by Sidak’s post hoc test). (C) ROS level in tumors labeled ex vivo with CM-H2DCFDA (lOpM) for 1 h and analyzed by FACS. CM-H2DCFDA MFI data are the mean ± SEM (cells were gated for RFP+); * p < 0.05 (two- tailed, unpaired Student / -test). (D) Representative images of immunohistochemistry analysis of the indicated proteins in BEAS-2B-KRASG12V-shNT and -shFMO4 tumors. Histograms show the percentage of positive cells in the two groups (n = 9 for each shRNA). Scale bars: 250pm. Results are the mean ± SEM; * p < 0.05, ** p < 0.01 (two-tailed unpaired Student’s t- test).
[0138] Figure 8: Ferroptosis test on different cell lines.
[0139] H1299, H1993 and A549 human lung adenocarcinoma cell lines were subjected to FMO loss of function using doxycycline (DOX) inducible shRNAs . Cells were treated or not with DOX and inhibitors of ferroptosis (Ferrostatin and Liproxtatin) as well as inducers of ferroptosis (Erastin and RSL3). Strikingly, the 3 cell lines were sensitizes against ferroptosis upon loss of function, since there is synergistic effect upon co-treatment with the ferroptotic inducers, and, loss of function was rescue in all cases with ferroptosis inhibitors. Our data fully demonstrate that FM04 is protecting against ferroptosis.
[0140] Figure 9: FMO4 protect against ferroptosis in vivo and the effects of FMO silencing are increased by ferroptosis inducers
[0141] EXAMPLE 1:
[0142] Material & Methods
[0143] Mice and genotyping
[0144] To generate the MET-driven lung adenocarcinoma mouse model, the previously described Tet-on-MET and CCSP-rtTA mouse strains (Wang R et al., 2001, J Cell Biol & Tichelaar J.W et al., 2000, J Biol Chem) were crossed. The KRASG12V;p53flox / flox(Sanclemente M et al , 2021, Cancer Cell), EGFR1790^85® (Li D et al., 2007, Cancer Cell) and EML4 / ALK- driven lung adenocarcinoma (Maddalo D et al., 2014, Nature) mouse strains also were previously described. DNA was isolated using the REDExtract-N-Amp Tissue PCR Kit (Sigma) according to the manufacturer’s protocol. The p53 floxed allele, KrasG12VK.I. and rtTA, IME1T ''!I 2G5RRand MET transgenes were detected by PCR from tail DNA, as described previously (Sanclemente M et al., 2021, Cancer Cell ; Wang R et al., 2001, J Cell Biol ; Tichelaar J W et al., 2000, J Biol Chem & Li D et al., 2007, Cancer Cell). In inducible models, transgene expression was induced by feeding mice with a doxycycline diet (Img / kg), purchased from SAFE. In KRASG12V;p53flox / floxmice, tumors were induced by intratracheal delivery of adenoviruses particles expressing Cre recombinase (3 x 108pfu) obtained from Iowa University as previously described (Maraver A et al., 2012, Cancer Cell). To induce EML / ALK tumor development, adenoviruses particles expressing Cas9 and the appropriated sgRNAs (1.5 x 108pfu), obtained from ViraQuest, were intratracheally delivered into CD1 mice as previously described (Maddalo D et al., 2014, Nature). Tumor appearance and progression were monitored by computed tomography using a nanoScan device (Mediso). The tumor area was analyzed with InterView™ FUSION (Mediso). Crizotinib (#AB-M1765;
[0145] AbMole) was resuspended in vehicle [0.5% (w / v) methylcellulose, 0.2% Tween 80 (w / v)] and administered (80 mg / kg / day) by oral gavage 5 days per week for 5 weeks. For detection of Trp53 excision upon Cre recombination, genomic DNA was isolated from tumors using the REDExtract-N-Amp Tissue PCRKit (Sigma), and the following primers were used: mp53-int: forward 5’-CACAAAAACAGGTTAAACCCA-3’ (SEQ ID NO: 1) and mp53-intl0: reverse 5’-GAAGACAGAAAAGGGGAGGG-3’ (SEQ ID NO: 2). Primers to detect Kras gene were used as internal control: Kras2F_16B5 5’-CGTCCAGCGTGTCCTAGACTTTA-3’ (SEQ ID NO: 3) and Kras2r_15B9 5’-CTATTTCATACTGGGTCTGCCTT-3’ (SEQ ID NO: 4). For the detection of the WT Eml4 gene and Eml4 / Alk translocation, three-primer PCR strategy was performed using: Eml4-for: 5’-TGGAGTGGCAACTCACTAACAA-3’ (SEQ ID NO: 5) Eml4- rev: 5 ’ -GCAACTGCTCTAATGGTGCC-3 ’ (SEQ ID NO: 6) Alk-rev: 5’- GGTCATGATGGTCGAGGTCC- 3’ (SEQ ID NO: 7). All PCR products were run on a 1% agarose gel. All animal procedures were performed according to protocols approved by the French national committee of animal care.
[0146] Histopathology and immunohistochemistry (mouse samples)
[0147] Mouse lung lobes and tumor xenografts were formalin-fixed, paraffin-embedded (FFPE) and stained with hematoxylin and eosin (HE) or used for immunohistochemistry (IHC). For IHC, FFPE tissue sections (3pm thick) were de-paraffinized in xylene and ethanol, and rehydrated. For antigen retrieval, sections were incubated in citrate pH 6.0 antigen unmasking solution at 100°C for 30 min, and then in 5% H2O2 at room temperature (RT) for 30 min to block endogenous peroxidase activity, followed by protein blocking of non specific epitopes with 5% normal horse serum. Sections were incubated with primary antibodies against MET (#8198), phosphorylated ERK (#4370) (Cell Signaling Technology), Ki67 (#M720 from DAKO) and cleaved caspase 3 (#966 IS from Cell Signaling) at 4°C overnight After washing with TBS-T, sections were incubated with Signal Stain Boost IHC Detection Reagent (Cell Signaling #8114) at RT for 30min. After washing with TBS-T, signal was revealed with the DAB Kit (Vector, #SK-4100). Sections were counterstained with hematoxylin, dehydrated, and mounted. For histopathology, tumor area and total lung area were measured using the Image J software, and staining intensity was measured with the QuPath software. For histopathological analysis of HE-stained tissue sections, classical cytological and architectural features (as tumor cell invasion or mitotic rate to name only a few) were evaluated by our expert pathologist (M.C.).
[0148] Western blotting
[0149] Cells were lysed in RIPA lysis buffer [1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 150mM NaCl, EDTA 5mM, 50mM Tris, pH 7.4, 2mM Na3VO4, phosphatase inhibitors (Sigma) and complete protease inhibitor mix (Roche], Lysates were then sonicated and cleared by centrifugation at 15.000g at 4 °C for 20 min. Protein concentration was determined using the BCA Protein Quantification Kit (Thermo Fisher). Equal amounts of lysates were separated on 9% SDS-PAGE and transferred to PVDF membranes (GE Healthcare). Membranes were blocked in 5% milk in TBS-T at RT for Ih, followed by incubation with primary antibodies at 4 °C overnight. Secondary antibodies (GE Healthcare) in TBS-T / 5% milk were added at RT for Ih. Chemiluminescence signals were revealed with RevelBlotPlus (Ozyme) and autoradiography films (GE Healthcare). The following antibodies were used: anti phosphorylated MET (#3077), -MET (#8198), -phosphorylated AKT (#4060), -AKT (#4685), -phosphorylated ERK (#4370), -ERK (#4695), -NRF2 (#12271) and AhR (#83200) from Cell Signaling Technology; anti-FMO2 (#HPA028261) and -tubulin (#4026) from Sigma; anti-FMO3 (#orb228818) and -FM04 (#orb97010) from Biorbyt; anti-FMOl (sc- 376924), -FM05 (#sc-393732) and -HSC70 (sc-7298) from Santa Cruz Biotechnology. Secondary antibodies were horseradish peroxidase-linked anti-rabbit (#7074) and anti-mouse (#7076) IgG from Cell Signaling Technology. Tubulin or HSC70 were used as loading controls.
[0150] RT-qPCR
[0151] Total RNA was isolated using the RNeasy Mini Kit (Quiagen). Complementary DNA (cDNA) was synthesized with SuperScriptlll (Invitrogen), and qPCR was performed using SYBR Green (Applied Biosystems) and the following primer pairs: Fmo forward 5’- GCCAGTCTTTACAAGTCTGTGG-3’ (SEQ ID NO: 8) and reverse 5’-
[0152] TCC AGGAATAGAGAATTTGGC AC-3 ’ (SEQ ID NO: 9). Fmo2 forward 5’-
[0153] CCCGGACTTCGCATCTTCTG-3’ (SEQ ID NO: 10) and reverse 5’-
[0154] GCGTCAAAGACAGTGCGTTG-3’ (SEQ ID NO: 11). Fmo3 forward 5’- ACTGGTGGTACACAAGGCAG-3’ (SEQ ID NO: 12) and reverse 5’- ATGGTCCCATCCTCAAACACA-3’ (SEQ ID NO: 13) FMOF forward 5’-
[0155] GATTGGAGCTGGCGTAAGTG-3’ (SEQ ID NO: 14) and reverse 5’-
[0156] TGTCAGCAAACTTCCACAGTC-3’ (SEQ ID NO: 15). Fmo5. forward 5’-
[0157] GAGGGCTTGGAACCTGTCTG-3’ (SEQ ID NO: 16) and reverse 5’-
[0158] CACGGACTGGTAAATACTGGC-3’ (SEQ ID NO: 17). Actb forward 5’- ATGCTCTCCCTCACGCCATC-3’ (SEQ ID NO: 18) and reverse 5’-
[0159] CACGCACGATTTCCCTCTCA-3 (SEQ ID NO: 19). MET'. forward 5’-
[0160] GGTCAATTCAGCGAAGTCCTCTTA-3’ (SEQ ID NO: 20) and reverse: 5’-
[0161] GGGTTGATGGTCCTGATCGA-3’ (SEQ ID NO: 21). Met. forward 5’-
[0162] GCCGGCTTAACCAAGTGCTCCTG-3’ (SEQ ID NO: 22) and reverse 5’-
[0163] GAGTGAGGTGTGCTGTTCGA-3’ (SEQ ID NO: 23). Real-time PCR was carried out on a LightCycler 480 II (Roche). Reactions were run in triplicate. Expression data were normalized to the geometric mean of the Actb housekeeping gene to control the variability in expression levels, and analyzed using the 2-DDCT method.
[0164] Proteomic analysis
[0165] Ten milligrams of snap-frozen tissue samples were crushed into powder and then resuspended in protein lysis buffer (1% SDS, 50mM Tris-HCL at pH 8.0). After sonication, samples were incubated at 4°C for 30 min, briefly vortexed, and centrifuged at 20.000g, 4°C, for 10 min. Supernatants were transferred to new tubes, and the protein content was determined using the BCA Protein Quantification Kit (Thermo Fisher). Proteomic analysis was performed with lOOpg of each protein sample. First, the protein containing solutions were reduced by incubation with 20mM DTT at 60°C for 30min. Then, protein samples were alkylated in 50mM 2-chloroacetamide at RT for 30 min. Next, proteins were precipitated using the 2D Clean-Up kit according to the manufacturer’s instructions (GE Healthcare). Protein pellets were suspended in 50pl of lOOmM ammonium bicarbonate / lmM calcium chloride buffer (pH 8), and 0.01% of Protease Max surfactant was added to the samples with I pg of trypsin. After overnight digestion at 37°C, 10% of each sample was transferred to a separate tube where all samples were mixed in a library. The rest of each sample was evaporated to dryness. The library sample underwent peptide fractionation using the High pH Reversed-Phase Peptide Fractionation Kit according to the manufacturer’s instructions (ThermoFisher). From the library sample, eight individual peptide fractions were derived that were then evaporated. All samples, including the library samples, were dissolved in 0.1% TFA, and desalted using ZipTip according to the manufacturer’s instructions (Merck). The peptide samples were analyzed using the ID-nano- HPLC system (Sciex) that was connected on-line with the electro spray Q-TOF mass spectrometer 6600 (Sciex). A total of Ipg of sample was injected on the Cl 8 analytical column Acclaim® 75pm x 150mm (Dionex) with a gradient of 0-40% phase B (90% acetonitrile, 9.9% water and 0.1% formic acid) for 100 min at the flow rate of 0.3 pl / min. Two acquisition modes were used: data dependent (DDA) for the library measurement, and SWATH for the samples. In the DDA mode, mass spectral data were acquired over a mass range from 400 to 1600m / z. One full MS scan was automatically followed by up to 30 MS / MS scans of the most intensive peptides found in this mass range (bearing +2 or +3 charges). The acquired data for each library sample fraction were merged and used for MS / MS database search with the Protein Pilot software (Sciex). For the SWATH acquisition, the DDA method was adapted using the automated method generator embedded in the Analyst software (Sciex). Proteins were identified and quantified with the Peak View software. Protein quantifications were then imported in R computational environment (version 4.0.2), the data were normalized for total signal and then using median. Statistically relevant modulations were further unveiled using SAM (significance analysis of microarrays) (Tusher VGet al., 2001, Proc Natl Acad Set U.S.A).
[0166] Immunohistochemistry (human samples)
[0167] Two previously described TMAs (Martinez- Terroba E et al., 2018, J Pathol & Ramos- Paradas J et al., 2021, J Immunother Cancer) were used. Slides were incubated with primary antibodies against FMO4 (#HPA049100 Sigma), 4NHE (#NHE11-S Alpha Diagnostic) at 4°C overnight. After washing with TBS-T, slides were incubated with the Signal Stain Boost IHC Detection Reagent (Cell Signaling #8114) at RT for 30 min. After washing with TBS-T, signal was revealed using the DAB Kit (Vector, #SK-4100). Slides were counterstained with hematoxylin, dehydrated, and mounted. For antibody validation, the following control / blocking peptides were used: #NHE11-P (Alpha Diagnostics) for 4HNE, and PrEST #APREST85285 (Sigma) for FM04. Staining intensity was analysed by H-score (Hirsch F.R et al., 2003, J Clin Oncol). In particular, H-score was obtained using QuPath software (Humphries M.P et al., 2021, Comput Struct Biotechnol J). Briefly, it represents a semiquantitative assessment of both the intensity of staining (using adjacent normal tissue as the median) and the percentage of positive cells. The range of possible score values vary from 0 to 300. The score represents the average of three different section from the same sample. Tumor staining level for the Kaplan-Meier curves were categorized as low or high according to the maximum H-score (97) in non-tumoral (normal) tissues (Fig. 3E). Cell culture, reagents and transfection
[0168] The BEAS-2B, A549, H1299, H2009, H23, HCC827, H1975, H2228, H3122 and Hl 993 cell lines were from the American Type Tissue Culture Collection (ATCC); the NL20 and PC9 cell lines were from Y. Yarden’s laboratory. The BEAS-2B-KRASG12Vcell line was generated by transfecting the p!nducer-HA-KRASG12Vplasmid, kindly provided by Ji Luo's laboratory, followed by selection with puromycin (1.5 pg / ml) for 1 week. NL20 cells were maintained in F12 / Ham medium supplemented with glucose (2.7g / L), non essential amino acids (O.lmM), insulin (0.005 mg / ml), EGF (lOng / ml), hydrocortisone (500ng / ml), glutamine (2mM), 10% fetal bovine serum (FBS), and antibiotics. BEAS-2B and BEAS-2B-KRASG12Vcells were maintained in DMEM supplemented with 10% FBS and antibiotics. All the other lung cancer cell lines were maintained in RPMI 1640 supplemented with 10% FBS and antibiotics. Doxycycline hyclate (#D9891), N-acetyl-L-cysteine (#A9165), and H2O2 (#H1009) from Sigma were diluted in culture medium and used as indicated in the figure legends. The non-targeting siRNA control (siNT) and the siRNAs against AHR (siAHR) and NRF2 (siNRF2) (purchased as smart pools from Dharmacon) were transfected at 20nM with the Dharmafect2 reagent following the manufacturer’s instructions.
[0169] Oxidative stress analysis in cell lines
[0170] H2O2 production was measured using the ROS-Glo™ H2O2 Assay kit (Promega) according to the manufacturer’s instruction. 15-20 xlO4cells were plated in opaque white 96- well plates, and 20pl of H2O2 substrate solution was added to the cells, to a final volume of 100 pl. Cells were incubated at 37°C in a 5% CO2 incubator for 1 h before addition of 100 pl of the ROS-Glo detection solution to each well. After incubation at RT for 20 min, luminescence was measured using a EnSpire Alpha® luminometer (PerkinElmer).
[0171] Clonogenic assay
[0172] Cells were seeded in 6-well plates in triplicates at a density of 200-400 cells / well (according to cell type) in 2 ml of medium containing 10% FBS After 24 h, cultures were replaced with fresh medium containing 1% FBS in the presence or absence of doxycycline (0.5- Ipg / ml) and / or N-acetyl-L-cysteine (0.5 or ImM), as indicated, and cultured at 37°C in a humidified atmosphere containing 95% air and 5% CO2 for 2-3 weeks. Cells were fixed with methanol and stained with a solution containing 0.5% crystal violet and 25% methanol for 15 min, followed by three rinses with water to remove dye excess. Colony numbers and total stained area were analyzed using the ImageJ software. Viability assay
[0173] Cells were plated in 96-well plates in quadruplicates at the desired density and treated as indicated. At the end of the treatment period, culture medium was removed and cells were fixed with cold 10% trichloroacetic acid (Sigma) at 4°C for 1 h. Then, cells were washed five times with water, and plates were left to dry. Plates were then stained with 200pl 0.1% sulforhodamine B (SRB) dissolved in 1% acetic acid for at least 15 min, followed by four washes with 1% acetic acid to remove unbound stain. Plates were left to dry at RT and bound protein stain was solubilized with 200pl of lOmM unbuffered TRIS base (tris(hydroxymethyl)aminomethane) and transferred to 96-well plates for optical density reading at 540nm (PherastarFS, BMG Labtech).
[0174] Apoptosis assay
[0175] Apoptotic cell death was assessed with the AnnexinV-FITC Apoptosis Detection Kit (BD Pharmigen # 556547) and DAPI (Sigma) double staining according to the manufacturer’s instructions. Cells were analyzed by flow cytometry (Cytoflex, Beckman Coulter) and the percentage of apoptotic and living cells was determined with the FlowJo software.
[0176] Generation of pTRIPZ -FM04 shRNA stable cell lines
[0177] The pTRIPZ doxycycline-inducible shRNA (non-targeting, shNT), and the shRNAs against FM04 [clone V3THS 385089 (#89), clone V3THS_385090 (#90), clone V3THS_385093 (#93), cloneV3THS_385094 (#94), clone V2THS_113911 (#11), clone V2THS 113912 (#12)] were purchased from Dharmacon. To generate stable cell lines, HEK293T cells were transfected with the pTRIPZ lentivirus vector, psPAX2, and pVSV G using lipofectamine 2000 (Life Technology) for 6-8 h. Medium was changed to DMEM with 10% FBS. Viruses were collected 48 and 72 h after transfection. shNT, shl 1, and shl2 lentiviral particles were used immediately to transduce BEAS-2B-KRASG12V, Hl 993 and H1299 cells, or stored at -80 °C. Cells were infected in the presence of polybrene (5-10pg / ml), and selected with puromycin (2ug / ml) (Sigma) for up to 1 week. Cells were then cultured in the presence of 0.5pg / ml of doxycycline overnight, and RFP+cells were sorted using an ARIAIIIU (Becton Dickinson) cell sorter. Sorted cells were maintained in culture in doxycycline-free medium. For functional assays, the tetracycline responsive element (TRE) was induced by incubation with I pg / ml of doxycycline. Chromatin immunoprecipitation (ChIP)
[0178] Chromatin was prepared as described previously (Fabbrizio E et al., 2002, EMBO Rep). The ChlP-Adem-Kit and ChIP DNA Prep Adem-Kit (Ademtech) were used for ChIP and DNA purification, respectively, on an AutoMag robot, according to the manufacturer’s instructions. The anti-AHR antibody was purchased from Cell Signaling (#83200) and the IgG rabbit control from Millipore. The immunoprecipitated DNA was analyzed by PCR using the following primers on FM04 promoter: forward GCCAATCCAACAGCTGTATTCT (SEQ ID NO: 24) and reverse GCCCTCAGTTTAAAACAAAAGC (SEQ ID No: 25).
[0179] Mouse xenografts
[0180] 2.5 x 106BEAS-2B-KRASG12Vcells (infected with shNT or shFMO4) were injected subcutaneously in the flank of 6-week-old, female athymic Nude-Foxnl mice (Charles River). From the week before the injection until the experiment end, mice were fed ad libitum with doxycycline-supplemented food (0.625mg / kg) purchased from SAFE. Tumor volumes were calculated with a caliper and according to the formula V = (D x d2) / 2, where D and d are the major and the minor perpendicular tumor diameters, respectively. Mice harboring KRASG12V- shNT cell xenografts were killed when tumors reached the volume of 1200 mm3 and we killed at the same time their shFMO4 counterparts. For tumor cell xenograft imaging, animals were anesthetized with isoflurane and the IVIS Lumina II (Caliper LifeSciences) filter DsRed 535 / 580 was used. Pseudo images were obtained by superimposing the emitted light over the gray-scale image of the body. Quantitative analysis was done with the Xenogen Living Image V2.50.1 software.
[0181] Flow cytometry analyses of oxidative stress in tumor cell xenografts
[0182] Tumors were prepared as single cell suspensions by collagenase / DNase I digestion using a gentle MACS Tissue Dissociator (Miltenyi). To measure oxidative stress levels, whole cell suspensions were incubated with CM-H2DCFDA (#C6827 ThermoFisher) for 1 h, according to the manufacturer’ s instructions. Cells were analyzed by flow cytometry (Cytoflex, Beckman Coulter) and the CM-H2DCFDA mean fluorescence intensity in RFP+ gated cells was calculated using the FlowJo software.
[0183] Statistical analysis
[0184] Unless otherwise specified, the data are presented as means ± SEM. One-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was performed to assess the significance of expression levels in IHC in Fig. IB and Fig. 3B. Two-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was performed to assess the significance of clonogenic and apoptosis assays (Fig. 5B, 6B & Data not shown), and for the differences among groups for changes in tumors size in Fig. 7A and mRNA expression levels in extended data Fig. 1A. Two-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test was performed to assess the changes in cellular ROS levels in Fig. 5 A and 6A. In Fig. 1C and 7B data were analyzed by 2-way ANOVA followed by Sidak’s post hoc test. In Fig. 1A, 3D and Fig. 3F the Kaplan-Meier survival curves were analyzed with Log-rank (Mantel-Cox) test. Hazard ratios were calculated using the log-rank test. The correlation between two groups in Fig. 4A, 4B and Fig. 5C was calculated using the Pearson r correlation coefficient. In Fig. IB, 3A, 3C, 7C, 7D, IF and Fig. 2 data were analyzed by unpaired two-tailed Student’s t test. Samples (patients, cells or mice) were allocated to their experimental groups according to their predetermined type. All statistical analyses were performed using the Prism GraphPad software, except for Fig. 5C. Investigators were blinded to the experimental groups in the analysis of data presented in Fig. 1C, 3D, 4B, 7C, 7D and in Fig. IF and 3F. The investigators were not blinded in the remaining analyses, p < 0.05 was considered significant. # p < 0.1, * p < 0.05, ** p < 0.01, *** p <0.001, **** p < 0.0001.
[0185] Results
[0186] MET overexpression in lungs induces adenocarcinoma in mice
[0187] State-of-the-art preclinical mouse models of cancer are useful to discover new players in cancer development and to develop / test innovative treatments. In our laboratory, we routinely use genetically engineered mouse models (GEMMs) of lung cancer induced by the lung-specific expression of oncogenic KRAS (Maraver A et al., 2012, Cancer Cell or EGFR (Bousquet Mur E et al., 2020, J Clin Invest), and the EML4 / ALK translocation (Maddalo D et al., 2014, Nature). By contrast, and to the best of our knowledge, a GEMM to study MET driven lung cancer has not been developed yet. To fill this caveat, we developed a mouse model of MET-driven lung adenocarcinoma by crossing a previously described Tet-on-MET mouse strain we used before to develop osimertinib resistance in the oncogenic EGFR genetic background 14 and the lung-specific CCSP-rtTA mouse strain (CCSP hereafter) to restrict the expression of the doxycycline-inducible MET transgene to the lungs (Bousquet Mur E et al., 2020, J Clin Invest) (this new compound mouse strain is called MET / CCSP hereafter). To confirm human MET expression in lungs of MET / CCSP mice, we analyzed murine Met and human MET mRNA expression in liver, heart, spleen, and lung. Murine Met mRNA was expressed in liver and to a lower extent in lung, regardless of human MET expression (Fig. IE). Conversely, human MET mRNA was only expressed in lungs (Fig. IE). To study the survival ofMET / CCSP mice, we keptMET / CCSP and CCSP mice with doxycycline diet and monitored breathing distress appearance. MET / CCSP mice died due to lung cancer after a median survival of 91 weeks, while none of the CCSP mice died during the same period (Fig. 1A). After the death of the last MET / CCSP mouse, we killed all CCSP controls to perform several analyses. First and as expected, the percentage of Ki67-positive proliferating cells (immunohistochemistry) was higher in MET / CCSP lung tumors (Fig. IB) as well as MET expression and phosphorylated ERK (pERK) levels compared with CCSP lung samples (no tumor detected in control animals) (Fig. IB). Similarly, western blot analysis of healthy lung tissue from MET / CCSP and CCSP mice and MET / CCSP lung tumors highlighted increased levels of MET, of phosphorylated MET (pMET) and of phosphorylated AKT and ERK (pAKT and pERK), two main downstream targets of MET signaling, in tumors compared with normal lungs (Data not shown). To characterize the MET / CCSP lung tumors, we then analyzed the presence of adenocarcinoma, adenoma (benign tumors) and hyperproliferation in lungs isolated from MET / CCSP and EGFRT790M / L858R / CSSP (a model of EGFRT790M / L858R-driven lung cancer generated using the same doxycycline inducible system) mice. The percentage of the three types of lesions were roughly comparable in MET / CCSP and EGFRT790M / L858R / CSSP lungs, although adenoma rate was higher and hyperproliferation rate was lower in MET / CCSP mice (Fig. 1C). As the median survival time of MET / CCSP and EGFRT790M / L858R / CSSP mice was 91 (Fig. 1A) and 18 weeks 14, respectively, we hypothesized that the increased malignization was promoted by the longer survival of MET / CCSP mice. To demonstrate the MET oncogenic addiction of MET / CCSP lung tumors, we performed two different experiments. First, we stopped doxycycline treatment in a subgroup of MET / CCSP mice harboring MET-driven tumors detected by computed tomography (CT) after 13 months of doxycycline exposure. When we repeated the CT 3 months later, we could not detect any lung tumor in this group (data not shown). Tumor burden analysis by immunohistochemistry showed that tumor area represented 34% of the lung area in mice still on doxycycline, but only 5% in mice in which doxycycline was stopped (Fig. IF). In the second experiment, after 13 months of doxycycline treatment, MET / CCSP mice underwent CT imaging before being randomly distributed in two groups: treatment with crizotinib, a clinically relevant MET TKI (n = 7), and treatment with vehicle (n = 7). After 5 weeks of treatment, mice underwent a new CT to evaluate the response to treatment using the RECIST evaluation criteria for solid tumors (Morgan R.L et al., 2018, J Thorac Oncol). While all tumors in the vehicle-treated group showed progressive disease (7 out of 7), 4 out 7 tumors in crizotinib-treated mice showed either complete or partial response and 2 out 7 presented stable disease while only one showed progressive disease (Fig. ID & Data not shown). In agreement, pMET, pAKT and pERK levels were strongly decreased in crizotinib- treated tumors compared with vehicle-treated tumors, indicating that that crizotinib reached its target (Data not shown). These data show that our MET / CCSP mouse model fully recapitulates important features of lung cancer with MET amplification, including MET addiction.
[0188] FM04 is highly expressed in mouse lung adenocarcinoma induced by different oncogenic drivers
[0189] Once validated the MET / CCSP mice, we performed a proteomic analysis of healthy lung and MET / CCSP adenocarcinoma samples (n = 10 / each) to identify putative new players in lung adenocarcinoma. We focused on the first 200 proteins upregulated and the 200 proteins downregulated in tumors versus healthy tissues. We found that 4 out of the 200 proteins that were decreased in tumors compared with healthy lung belonged to the same family, i.e., the FMO (FMO1, 2, 3 and 5; Data not shown). This family includes five paralogues in humans and mice (FM01 to 5) that play important roles in different diseases (Rossner R et al., 2017, J Biol Cherr), but their role in lung cancer is largely unknown and this prompted us to concentrated in these proteins. In mice and humans, FM01 to 4 are clustered on chromosome 1. Conversely, mouse Fmo5 is on chromosome 3, and human FMO 5 is on chromosome 1, but far away from the cluster (Rossner R et al., 2017, J Biol Chem), hence we perform an unsupervised clustering of the five FMOs in the 20 samples. Strikingly, we showed that unlike the other family members, FMO4 expression was decreased in healthy lung and increased in tumors (Data not shown). Western blotting (Data not shown) and quantitative PCR analysis (Fig. 2) of a different set of samples confirmed this unique finding for FMO4 among the different FMO paralogues. To uncover if FMO4 expression was restricted to MET-driven lung adenocarcinoma, we also compared FMO expression in healthy and tumor lung samples from mouse models in which lung adenocarcinoma is induced by oncogenic mutations in KRAS (KRASG12V;p53flox / flox, Data not shown) 16 or EGRF (EGFRT790M / L858R / CCSP, Data not shown) 12, and by the EML4 / ALK translocation (EML4 / ALK, Data not shown) (Maddalo D et al., 2014, Nature)' (Data not shown). FMO1, 2 and 3 expression levels were decreased in tumors from all three models. Conversely, FMO5 expression was decreased only in EML4 / ALK-driven lung adenocarcinoma samples compared with healthy lung tissue. Importantly, FMO4 expression level was very low in healthy lung tissue and strongly increased in lung adenocarcinoma samples from all three mouse models. This demonstrates that in murine lung adenocarcinoma, FMO4 is a new tumor marker induced by different oncogenic drivers.
[0190] FM04 is strongly expressed in human lung cancer and its expression correlates with poor overall survival in patients with lung adenocarcinoma
[0191] To test the clinical relevance of our findings, we analyzed FMO4 expression using histoscore (H-score) 17 in a previously published lung cancer tumor microarray (TMA) (Martinez-Terroba E et al., 2018, J Pathol) that included healthy lung tissue and non-small cell lung cancer samples (adenocarcinoma, squamous cell carcinoma and other minor subtypes). FMO4 expression level was increased by more than 4-fold in tumor samples compared with controls (Fig. 3 A, Fig. 3E & Data not shown). This was true also when we analyzed the different tumor subtypes separately (Fig. 3B). Then, we analyzed copy number alteration in -2000 lung adenocarcinoma samples from five publicly available databases in cBioPortal (Cancer Genome Atlas Research Network, 2014, Nature ; Imielinski M et al., 2012, Cell ; Chen J et al., 2020, Nat Genet ; Sanchez- Vega F et al., 2018, Cell & Cardin G.B et al., 2021, Sci Rep). We found that in all databases, the FM04 genomic region was amplified in 3 to 8% of samples (Data not shown). Conversely, we found only deep deletions, which are associated with tumorsuppressive functions, at this locus in two databases and at very low frequency (Data not shown). As FM01 to 4 are in the same cluster in chromosome 1, it is not surprising that copy number alteration frequency in FM01, 2 and 3 was similar to what observed for FM04 (data not shown). However, comparison of FM01, FM02, FM03 and FM04 mRNA levels in patients with two copies (diploid) and those with three or more copies (amplified) of their respective locus showed that only FM04 expression was increased in patients with locus amplification (Fig. 3C). This indicates that the increased copy number only affected FM04 expression in lung adenocarcinoma samples. We also analyzed in the same lung cancer TMA used to investigate FMO4 expression (Martinez-Terroba E et al., 2018, J Pathol), the correlation between FMO4 protein levels and 5-year overall survival (OS). We found a trend (p = 0.118) towards shorter survival in patients with lung adenocarcinoma with high FMO4 expression compared with low FMO4 expression (Fig. 3E & Fig. 3f). To further validate this data, we performed the same analysis using a different TMA from another cohort of only lung adenocarcinoma patients 24 showing that the 5-year OS rate was lower in patients with high than low FMO4 expression (hazard ratio 2.088, 95% CI 1.016-4.288, p = 0.04) (Fig. 3D). Together, these clinical data confirmed and expanded an important role for FMO4 in lung cancer and identified high FMO4 expression in lung adenocarcinoma as a poor prognostic factor.
[0192] Oxidative stress induces FM04 expression through the stress sensor aryl hydrocarbon receptor
[0193] As oxidative stress regulation is crucial in aging (Matheu A et al., 2007, Nature) and FM02 ectopic expression is sufficient to increase the life-span of C. elegans FM02 (Leiser S.F et al., 2015, Science), we asked whether FM04 could have a role in oxidative stress. To test this hypothesis, we first analyzed FM04 expression in human lung adenocarcinoma cell lines with different oncogenic driver mutations and in two non transformed human lung cell lines to correlate with ROS levels. FMO4 was expressed at different levels in all cell lines (Data not shown). Then, we measured ROS levels in these cell lines and found that they were positively correlated with FMO4 levels (Fig. 4A). To test for the clinical relevance of this correlation, we analyzed the expression of 4 hydroxynonenal (4-HNE), a surrogate marker of oxidative stress that is generated by peroxidation of polyunsaturated fatty acids (Esterbauer H et al., 1990, Methods Enzymol) and it is frequently used in IF and / or IHC in mouse and human samples to detect oxidative stress (Yang Y et al., 2016, Oncogene & Chui A et al., 2020, Development). We performed the 4-HNE H-score analysis in the same TMA where we analyzed before FM04 H-score. By plotting the H-scores of FM04 and 4-HNE we observed a very strong positive correlation between them (Fig. 4B & Data not shown), further validating the relation between FM04 and oxidative stress. To determine whether this finding was causative or just a correlation, we induced ROS production by incubation with hydrogen peroxide (H2O2) in A549 cells (lowFMO4 expression and low ROS, Data not shown). This led concomitantly to a strong increase in FM04 expression and in ROS levels (Data not shown). Conversely, incubation of H1299 cells (high FMO4 expression and high ROS, Data not shown) with the ROS scavenger NAC led to the concomitant decrease of FM04 expression and ROS levels (Fig. 4F & Data not shown). Importantly, in both experiments, H2O2 and NAC concentrations that were non-lethal for these cell lines were used (Fig. 4F & Fig. 4G). To understand how ROS regulates FMO4 expression, we focused on two very important regulators of the lung in response to oxidative and toxic stresses: nuclear factor erythroid 2-related factor 2 (NRF2) and aryl carbon receptor (AHR) (Rojo de la Vega M et al., 2018, Cancer Cell & Esser C et al., 2015, Pharmacol Rev) Loss of function of NRF2 in A549 and H1299 cells did not affect FM04 expression (Data not shown), indicating that NRF2 is not required for FM04 expression. Strikingly, AHR knockdown reduced FM04 protein levels in both cell lines (Data not shown), indicating that this transcription factor is implicated in FM04 expression regulation. Interestingly, AHR knockdown also reduced NRF2 levels in A549 and H1299 cells, in agreement with previous studies showing that NRF2 expression can be transcriptionally regulated by AHR (Miao W et al., 2005, J Biol Chem). We then incubated A549 cells in which AHR was knocked down (si AHR) or not (not targeting siRNA, siNT) with H2O2 or vehicle. In agreement with our above data, exposure to H2O2 increased FMO4 protein levels in control cells (siNT) but importantly, not in silenced cells (siAHR) (Data not shown). This demonstrates that AHR is implicated in controlling the oxidative stress-induced FMO4 expression. As AHR is a transcription factor, we asked whether AHR directly binds to the FM04 promoter. First, we used the online http: / / alggen.lsi.upc.es / tool to detect AHRE binding motifs in the FM04 promoter sequence to design specific primers to amplify them. Then, we performed chromatin immunoprecipitation (ChIP) experiments using an antibody against AHR and chromatin from H1299 cells (high ROS and FMO4 levels) incubated or not with NAC. In untreated cells (PBS), AHR immunoprecipitation resulted in enrichment of a FM04 promoter region containing one AHRE binding site, compared with the control immunoprecipitation (IgG) (Fig. 4C). This enrichment was decreased when cells were incubated with NAC. Even more, similar analysis in A549 cells (low ROS and FM04 levels) incubated or not with H2O2, showed that in this cell line there is little binding of AHR to the same FM04 promoter region containing the AHRE domain, and it was greatly increased upon H2O2 treatment (Fig. 4C). All these ChIP data further confirm that FMO4 is regulated by AHR in oxidative stress conditions (Fig. 4C). Finally, we assessed the correlation between FM04 and AHR mRNA levels in clinical samples of lung adenocarcinoma using the GEPIA online tool (Tang Z et al., 2017, Nucleic Acids Res), and found a strong positive correlation (Fig 5C), suggesting the existence of the AHR FM04 axis also in human lung adenocarcinoma.
[0194] FM04 loss of function promote apoptosis induced by oxidative stress
[0195] To study FMO4 role in oxidative stress, we performed FM04 loss of function assays in H1299. To test for the effect in cells with different oncogenic drivers, we used H1993 that are also lung adenocarcinoma and have amplification of MET. We infected cells with two different shRNAs against FM04 (shl l or / and shl2) using a doxycycline-inducible lentiviral shRNA technology (TRIPZ). Western blot analysis showed that in both cell lines, shl2 induced a stronger FMO4 decrease than shl l, and that the combination worked better than each shRNA alone, compared with the non-targeting shRNA (shNT) control (Data not shown). We followed shRNA induction upon incubation with doxycycline by monitoring the expression of red fluorescent protein (RFP). Analysis of ROS changes upon FMO4 knock-down showed that ROS production was higher in cells (both cell lines) transfected with shl2 than shl l and that the highest increase was in cells transfected with both shRNAs (Fig. 5A). This indicates that FM04 controls an excess of ROS production in H1299 and H1993 cells. Several studies show that excessive oxidative stress can hinder the homeostasis of cancer cells (Hayes J.D et al., 2020, Cancer Cell). Therefore, we performed a clonogenic assay in both cell lines after infection with shl l or / and shl2, or shNT. Upon doxycycline addition, colony formation (number and size of colonies) was severely decreased in H1299 and H1993 cells (Fig. 5B). Interestingly, this effect was greatly diminished by incubation with doxycycline and the ROS scavenger NAC (Fig. 5B). These data reinforce the notion that FM04 is buffering ROS levels in H1299 and H1993 cells. Similarly, apoptosis quantification in H1299 and H1993 cells infected with shNT (control) or the shl 1+12 combination (shFMO4) showed that early and late apoptosis rates (Data not shown) were increased in cells where FM04 was knocked down. Once again, incubation with NAC abolished this effect, further confirming the role of FMO4 in accommodating ROS levels.
[0196] FM04 loss of function promote apoptosis induced by oxidative stress in human bronchoalveolar cells during KRASG12Vtransformation
[0197] As Hl 993 and Hl 299 cells are already transformed lung adenocarcinoma cells, FMO4 role in cell transformation could not be investigated. To address this relevant question, we used the human bronchoalveolar BEAS-2B cell line that is immortalized but not transformed. BEAS- 2B cells are widely used to study cell transformation caused by tobacco carcinogens 34 or ectopic expression of oncogenes, such as KRAS (Bousquet E et al., 2009, Cancer Res) First, we generated a BEAS-2B cell line in which the expression of the KRASG12Voncogene can be induced by doxycycline. Then, we infected this cell line with the shl l + 12 combination (shFMO4) or control shNT (KRASG12V-shFMO4 and -shNT cells, respectively) Interestingly, upon doxycycline addition to induce KRASG12Vand the shRNAs (monitored by RFP expression), FM04 expression was strongly increased in KRASG12V-shNT cells, and this induction was prevented in KRASG12V-shFMO4 cells (Data not shown). In accordance with previous studies (Dolado I et al., 2007, Cancer Cell), ROS levels was increased upon KRASG12Vexpression (KRASG12V-shNT cells), and was further increased in KRASG12VshFMO4 cells. As before, incubation with NAC abolished ROS induction, regardless of FMO4 levels (Fig. 6A) This indicates that also in BEAS-2B cells transformed by oncogenic KRAS, FM04 adjusts ROS levels. Clonogenic assays showed that BEAS-2B cells could form colonies only upon induction of KRASG12V expression (Fig. 6B). Notably, their number and size were significantly reduced in KRASG12V-shFMO4 cells (Fig. 6B). This effect was abolished by incubation with NAC: upon doxycycline addition, the number and size of foci were similar or higher in KRASG12V-shFMO4 cells exposed to NAC than in KRASG12V-shNT cells not exposed to NAC, demonstrating that the strong phenotype in colony reduction in KRASG12V- shFMO4 cells was ROS mediated. Apoptosis analysis showed that expression of oncogenic KRAS signaling induced apoptosis in BEAS-2B cells, in accordance with previous studies (Jinesh G.G et al., 2018, Oncogene). Expression of shFMO4 further increased the apoptosis rate, whereas incubation with NAC abolished the apoptosis increase promoted by FM04 knockdown and by oncogenic KRAS signaling alone (Data not shown). These data reinforced the notion that FM04 inhibits oxidative stress also during de novo oncogenic KRAS-induced cell transformation in vitro.
[0198] FM04 loss of function hampers in vivo KRASG12Vtransformation
[0199] Our previous data showed that FM04 is implicated in KRASG12V-driven cell transformation in vitro. To determine whether this occurs also in vivo, SNQ injected inducible BEAS-2B KRASG12V-shFMO4 or KRASG12V-shNT cells in the flank of nude mice. A group of mice was fed with normal diet as control, whereas the other mice received a doxycycline- supplemented diet (DOX diet) to induce both oncogenic KRAS and the shRNAs (as well as RFP). After 30 days of DOX or normal diet, tumor growth, monitored by RFP expression, showed that most of the BEAS-2B KRASG12V-shNT cell xenografts were out of scale for RFP measurement. Therefore, we calculated the fold change in RFP signal between day 30 and day 10 after doxycycline induction As expected, in mice fed with normal diet, BEAS-2B KRASG12V-shFMO4 and KRASG12VshNT cells did not form tumors, and the RFP signal did not increase over time (Fig. 7A). Conversely, in mice fed with the DOX diet (KRASG12Vand shRNA induction), the RFP signal of KRASG12V-shNT tumors increased by more than 400- fold, and that of KRASG12V-shFMO4 tumors by ~200-fold (Fig.7a). Tumor growth measurement with a caliper, as previously described (Bousquet Mur E et al., 2020, J Clin Invest), indicated that tumor growth was decreased (by more than 2-fold) by FM04 knockdown compared with shNT (Fig. 7B). These data, confirm and expand the role of FMO4 during oncogenic transformation to the in vivo setting. Once the KRASG12V-shNT tumors reached the maximum tumor size allowed, we killed all mice for tumor analysis. Western blot analysis showed that FMO4 levels were lower in all KRASG12VshFMO4 tumors compared with KRASG12V-shNT tumors (Data not shown). Moreover, ROS level measurement ex vivo in tumors by FACS indicated that ROS was increased by more than 2-fold in KRASG12V-shFMO4 tumors compared with KRASG12V-shNT tumors (Fig. 7C & Data not shown). Cell apoptosis (cleaved caspase 3) and proliferation (Ki67) analysis in tumors by immunohistochemistry indicated that the percentage of proliferating cells was lower and that of apoptotic cells was higher in KRASG12V-shFMO4 than in KRASG12V-shNT tumors (Figure 7D). Together, these findings showed that FM04 plays an important role during oncogenic transformation by limiting an excess of oxidative stress.
[0200] FM04 play a major role in protection against ferroptosis in lung adenocarcinoma human cells
[0201] Having observed that FM04 loss of function induces oxidative stress, and taking into account that FM04 levels in patients positively correlates with 4HNE, a surrogate marker of lipid peroxidation, we decided to test if ferroptosis, a specific type of cell death with strong lipid peroxidation was playing a role in the strong in vitro effect on clonogenic assay. In particular, we treated with 2 well-known inhibitors against ferroptosis, namely ferrostatin and liproxtatin (Xie Y. et al. Cell Death Differ 2016). Strikingly, in the 3 cell lines tested, i.e., H1299, Hl 993 and A549, both ferroptotic inhibitors totally abolished the deleterious effect of FM04 loss of function. Even more, 2 strong activators of ferroptosis, erastin and RSL3 (Xie Y. et al. Cell Death Differ 2016), used at low concentration, i.e., showing no effect on the cells with non-induced FM04 loss of function, strongly synergized with FM04 loss of function (after doxycycline induction of shFMO4). Taking together, our data fully demonstrate that FM04 play a major role in protection against ferroptosis in lung adenocarcinoma human cells.
[0202] EXAMPLE 2:
[0203] FM04 protect against ferroptosis in vivo and the effects of FMO silencing are increased by ferroptosis inducers
[0204] The therapeutic window to kill cancer cells without deleterious effects for the rest of healthy tissues is small. We hypothesized that FM04 LOF (Loss Of Function) should sensibilize cells to ferroptosis in vivo as it does in vitro. To prove this, we took advantage of a highly specific GPX4 inhibitor with improved in vivo stability compared to previous compounds as RSL3, i.e., JKE-1674 (Eaton, J. K. et al. Selective covalent targeting of GPX4 using masked nitrile-oxide electrophiles. Nature chemical biology 16, 497-506 (2020)) First, we injected inducible H1299-shFMO4 or H1299-shNT cells in the flank of NSG mice. When tumors were on average 250mm3, we randomized each cohort (H1299-shFMO4 or H1299- shNT) into two treatment groups, vehicle and JKE-1674. At this moment we also changed mice to a doxycycline supplemented food to express the shRNAs, generating a total of four arms: H1299-shNT vehicle treated, H1299-shNT JKE-1674 treated, H1299-shFMO4 vehicle treated and H1299-shFMO4 JKE-1674 treated. We followed tumor growth measurement with a caliper, as previously described (Bousquet Mur, E. et al. Notch inhibition overcomes resistance to tyrosine kinase inhibitors in EGFR-driven lung adenocarcinoma. J Clin Invest 130, 612-624 (2020)), and stop measuring an arm when at least one tumor raised the human end point, i.e., 1500mm3. This happened at day 7 for H1299-shNT vehicle treated, day 10 for H1299-shNT JKE-1674 treated, day 14 for H1299-shFMO4 vehicle treated and day 17 for H1299-shFMO4 JKE-1674 treated (Fig. 9A). These data could imply that mice harboring H1299-shFMO4 and treated with JKE-1674 could have a higher survival than any other arm, and indeed, they had a survival of 4 weeks vs 1.9, 2.4 and 2.9 weeks for H1299-shNT vehicle treated, H1299-shNT JKE-1674 treated and H1299-shFMO4 vehicle treated respectively (Fig. 9B). These new set of in vivo data revealed that FM04 LOF sensibilizes against ferroptosis also in vivo. We confirmed this notion by analyzing the expression of 4 hydroxynonenal (4-HNE), a surrogate marker of ferroptosis that is generated by peroxidation of polyunsaturated fatty acids (Esterbauer, H et al., 1990, Methods Enzymol) and it is frequently used in IF and / or H4C in mouse and human samples (Yang, Y. 2016, Oncogene; Chui, A., 2020, Development), as well as Ki67 to monitor proliferation (Fig. 9C). Finally, at the dosing used, JKE-1674 did not alter the weight of mice (data not shown). To test for the clinical relevance about the role of FM04 in ferroptosis, we performed the 4-HNE H-score analysis in the same TMA where we analyzed before FM04 H- score and interestingly, we observed that as FM04, 4-HNE is highly expressed in NSCLC when compared to adjacent healthy lung tissue (data not shown), suggesting that both FMO4 and 4- HNE could have a positive correlation. Indeed, by plotting the H-scores of FMO4 and 4-HNE we observed a very strong positive correlation between them (Fig. 9D-9E). This last piece of data confirms and extends the relation between FMO4 and ferroptosis also to the clinical setting.
[0205] FM 04 interacts with MAT2A and it is required for the proper function of the methionine cycle
[0206] In order to understand at the molecular level how FM04 was protecting against ferroptosis, we performed 2 approaches in parallel, first we performed quantitative proteomics to identify proteins interacting with FM04 and second we also performed targeted metabolomics upon FM04 LOF. For the proteomics, we overexpressed FMO4 with a tag that allowed us obtaining enough material for the proteomics. We performed a total of 3 different purifications comparing always with cells expressing the same tag vector but without FM04 as control. We focused into proteins that were present in the 3 independent experiments and with a Normalized Spectral Abundance Factor greater than 2.5 (see M&Ms for details), obtaining a total of 36 proteins (data not shown). Among them, we observed the presence of methionine adenosyltransferase 2A (MAT2A), a crucial enzyme in the methionine cycle, with important implications in cancer (Tassinari, V., Jia, W., Chen, W. L., Candi, E. & Melino, G. The methionine cycle and its cancer implications. Oncogene 43, 3483-3488 (2024)). Then, we performed targeted metabolomics as before (Turtoi, E. et al. Analysis of polar primary metabolites in biological samples using targeted metabolomics and LC-MS. STAR Protoc 4, 102400 (2023)), and we focused into metabolites that were decreased upon FM04 LOF. We analyzed these metabolites using the online tool https: / / www.metaboanalyst.ca / and we found two metabolic pathways with an FDR below 0.05: “cysteine and methionine metabolism” and “one carbon pool by folate” (data not shown). Interestingly both metabolic pathways contain the methionine cycle as well as the subsequent transsulfuration pathway that generates cysteine from homocysteine. This pathway can regenerate glutathione independently of the cystine uptake by system xc(-), the target of erastin (Stockwell, B. R. Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell 185, 2401-2421 (2022)), and accordingly, transsulfuration pathway inhibition sensitize cells to erastin (Hayano, M., Yang, W. S., Com, C. K , Pagano, N. C. & Stockwell, B. R. Loss of cysteinyl-tRNA synthetase (CARS) induces the transsulfuration pathway and inhibits ferroptosis induced by cystine deprivation. Cell Death Differ 23, 270-278 (2016)). Data not shown depicted the methionine- and transsulfuration pathways where we highlighted in red the metabolites that were decreased in our targeted metabolomics. Interestingly, the decreased metabolites followed a pattern that is explained if MAT2A activity was hampered data not shown). Conversely, cystine levels were non-affected upon FM04 LOF (data not shown), further linking the FMO4 ferroptosis protection to the methionine- and transsulfuration pathways. If this hypothesis is correct, then both reduced glutathione (GSH) and GPX4 activity should decrease upon FM04 LOF. Of note, H1299 cells subjected to siFM04 indeed decreased the GSH / GSSG ratio (data not shown). Even more, GPX4 activity was strongly reduced, in a similar fashion to erastin treatment, while RSL3 totally blunted its activity since it is a specific GPX4 inhibitor (data not shown). Taken together, our data indicate that FM04 is required for MAT2A activity. To further challenge the hypothesis, we performed rescue assays with the 4 products / substrates of the methionine cycle: methionine, SAM, SAH and homocysteine (data not shown). Since methionine is the substrate of MAT2A, it should never rescue while the other 3 should do it, and strikingly, this is exactly what happened (data not shown). As before, we worked at concentrations that were non deleterious for H1299 cells (data not shown). Taken together all our data indicate that FM04 is regulating MAT2A activity.
[0207] FM04 promotes the interaction between MAT2A and MAT2B
[0208] To deep light into how FM04 could affect MAT2A activity, we took advantage of AlphaFold technology, in particular we used AlphaFold 3 that substantially improved compared to previous versions, the modelling of protein structures from aminoacidic sequences using artificial intelligence (Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630, 493-500 (2024)). We started modeling the structure of MAT2A, and AlphaFold 3 predicted that it forms homodimers (data not shown). Even more, it is known that MAT2B binds to and stabilizes MAT2A (Wan, X. et al. MAT2B regulates the protein level of MAT2A to preserve RNA N6-methyladenosine. Cell Death & Disease 15, 714 (2024)), so we also modelled the structure of this protein complex (data not shown). Of note, both structures were already revealed by X-ray crystal structure and our modelling perfectly resemble those previously described structures. Then, we modelled the interaction of MAT2A and FMO4 that we previously found by proteomics (data not shown) and observed several interesting findings: 1) FM04 also forms homodimers as MAT2A, 2) FMO4 and MAT2A homodimers interact among them, and 3) the resultant predicted structure generates a groove for the perfect accommodation of MAT2B into the whole structure (data not shown). Prompted by this intriguing finding, we also modelled the protein complex having both FM04 and MAT2A dimers as well as MAT2B, and indeed the last one perfectly fits in the above- mentioned groove (data not shown). Upon generating all these structures, we hypothesized that FM04 could facilitate the binding of MAT2B to MAT2A, and hence, we calculated the free energy of interaction between MAT2A and MAT2B in presence or absence of FM04. Strikingly, we observed that during time MAT2A and MAT2B tend to increase this value, i.e., the interaction decreased with time, while, in the presence of FM04 is exactly the opposite, the free energy of interaction decreased during time, meaning that the strength of the interaction of MAT2A and MAT2B is enhanced with time (data not shown). To further support this notion, we performed immunoprecipitation of endogenous MAT2A in H1299 cells and analyze for presence of both FM04 and MAT2B. In data not shown, we saw two interesting features, first we confirmed the interaction of MAT2A and FMO4 with the endogenous proteins, where of note, MAT2B was also present. Second, upon FMO4 LOF as expected we detected less FMO4 interacting with MAT2A, and importantly, we also observed less MAT2B interacting with MAT2A. This last piece of data further confirmed the role of FM04 stabilizing the MAT2A- MAT2B complex. Taking together, our data revealed that FM04 play s a maj or role in MAT2A- MAT2B protein complex.
[0209] Discussion
[0210] Development of state of the art GEMMs mimicking the human disease is crucial for the advance in cancer knowledge and but they are also essential preclinical tools to test new therapeutic approaches (Day C-P et al., 2015, Cell). Here, we describe a mouse model of MET-driven lung adenocarcinoma that mimics the MET amplification observed in patients with lung adenocarcinoma. Indeed, murine HGF does not bind to human MET (Rong S et al., 1992, Mol Cell Biol) and therefore, human MET expressed by these mice must be activated by accumulation at the cell membrane, like in patients with MET amplification. Proteomic characterization of this mouse model uncovered the over express! on of FM04 in lung adenocarcinoma, a protein with largely unknown functions in lung cancer. We found that FM04 was highly expressed in lung adenocarcinoma samples in another three different mouse models where lung adenocarcinoma is induced by the EML4 / ALK translocation, or oncogenic mutations in EGFR or KRAS. Together with MET amplifications, these genetic alterations represent -50% of all driver oncogenic events described in human lung adenocarcinoma (Cancer Genome Atlas Research Network, 2014, Nature). We also found that FMO4 expression was four times higher in clinical lung cancer samples compared with normal lung. Even more, FM04 was amplified in 3 to 8% of patients, and importantly, its expression correlated with shorter 5-year overall survival. All these features point towards oncogenic functions for FMO4 in lung adenocarcinoma. In agreement, FM04 silencing in KRASG12D / p53flox / £loxmice strongly reduced tumour burden and increased survival. Mechanistic analysis showed that FMO4 accommodates ROS levels. Controlling excess ROS production is important at different steps of tumorigenesis, from cell transformation to metastasis formation (Hayes J.D et al., 2020, Cancer Cell). Several proteins are implicated in controlling oxidative stress, particularly the oxidative stress master regulator NRF2 (Rojo de la Vega M et al., 2018, Cancer Cell). Our data indicate that NRF2 is not involved in controlling FM04 expression, conversely AHR, one of the known NRF2 transcriptional inducers, binds to the FM04 promoter and activates FMO4 expression both at steady state and in acute ROS induction. It is tempting to postulate that AHR activates in parallel NRF2 and FMO4 to better control ROS production. In this sense, FMO4 loss of function strongly affected H1299 and H1993 cells in which NRF2 activity is normal since they are respectively wild type and heterozygous for KEAP1 gene, a well-known NRF2 inhibitor 40. Conversely, A549 cells, in which KEAP1 is mutated 40 and display increased NRF2 activity, were more resistant to FM04 knock-down effects (data not shown). The finding that FMO4 decreased KRASG12V-induced transformation ofBEAS-2B cells is in accordance with the well-documented need of controlling ROS levels during KRAS oncogenic transformation (Jinesh G.G et al., 2018, Oncogene). In agreement, FM04 loss of function increased ROS induced apoptosis promoted by oncogenic KRAS, with a very strong effect on colony formation assay, and importantly this effect was abrogated by incubation with NAC. This is in accordance with recent work showing that oxidative stress plays a major role during cell transformation even in the absence of oncogenic insults (Zhang Y et al., 2021, Cell Metab). KRASG12VshFMO4 BEAS-2B tumors were hampered during in vivo transformation when compared with their KRASG12V-shNT tumor counterparts, further confirming the role of FMO4 controlling an excess of ROS also during in vivo transformation. Furthermore, in cells, FMO4 silencing decreased colony formation, and this effect was increased by ferroptosis inducers. We showed that ferroptosis inducers cooperate with FMO4 silencing also in vivo to reduce Hl 299 cell xenograft growth and increase survival, indicating that FM04 is an interesting new target in lung cancer. Taken together, our data suggest a feedback loop where oxidative stress increases FM04 levels to control the damage associated with excess oxidative stress. Additional mechanistic insights linked FM04 to MAT2A, a key enzyme in the methionine cycle that has a major role in cancer. Conversely, its role in ferroptosis is less clear. For instance, it was described that SAM, the production of which is catalysed by MAT2A, is required to promote ferroptosis (Xia, C. et al, 2024, Nat Commun). Conversely, the transsulphuration pathway, which is downstream the methionine cycle, can protect against ferroptosis because it provides cysteine in the absence of a functional xc system (Hayano, M et al, 2016, Cell Death Differ), suggesting that two different cysteine pools can be used by cells to generate reduced glutathione. Our data fit better with the second role because the phenotype due to FMO4 silencing (decreased colony formation) can be rescued by incubation with SAM, SAH or homocysteine. Of note, we used SAM, SAH and homocysteine at concentrations non- deleterious to cells because SAM is very toxic at higher concentrations (Haws, S. A. et al., 2020, Mol Cel ). This could also explain the disparities among studies. Our work also fits with a previous study in C. elegans where the FMO2 orthologue in the worm was linked to the methionine cycle (Choi, H.S. et al., 2023, Nat Commun), although the authors could not link the phenotype to any particular enzyme. Together with our data, this suggests a conserved role for FMOs in the animal kingdom in controlling this key metabolic pathway that fits with their high degree of conservation during evolution (Nicoll, C.R. et al., 2020, Nat Struct Mol Biol). We also modelled the interaction of FMO4 and MAT2A using AlphaFold3 (Callaway, E., 2024, Nature), and observed that FMO4 forms dimers that interact with MAT2A dimers. This analysis revealed that the interaction with MAT2B is facilitated in FM04 presence. Indeed, in cells where FMO4 was silenced, MAT2B interaction with MAT2A was decreased. A previous study showed that MAT2B increases MAT2A stability (Wan, X. et al., 2024, Cell Death & Disease), particularly upon increased oxidative stress (Pajares, M.A. et al., 2013, FEBS Lett). Our data confirmed and expanded these observations.
[0211] In summary, we identified FMO4, a previously unknown protein in lung cancer. Its wide presence in lung cancer developed by different oncogenes, as well as the strong effect promoted by its silencing in vivo indicate that this is a new target in lung cancer and warrants the generation of specific inhibitors.
[0212] REFERENCES
[0213] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.
[0214] Bousquet. E et al., 2009, Cancer Res, DOI : 10.1158 / 0008-5472.CAN-08-4147
[0215] Bousquet Mur E et al., 2020, J Clin Invest, DOI : 10.1172 / JCI126896
[0216] Callaway, E., 2024, Nature, DOI :10.1038 / d41586-024-03214-7
[0217] Camidge D.R et al., 2019, Nat Rev Clin Oncol, DOI : 10.1038 / s41571 -019-0173-9 Cancer Genome Atlas Research Network, 2014, Nature, DOI : 10.1038 / naturel3385 Cardin. G.B et al., 2021, Sci Rep, DOI : 10.1038 / s41598-021-92090-6
[0218] Cashman J R et al., 2000, Curr Drug Metab, DOI : 10.2174 / 1389200003339135
[0219] Cashman J.R et al., 2006, Annu rev Pharmacol Toxicol, DOI 10.1146 / annurev.pharmtox.46.120604.141043
[0220] Chen J et al., 2020, Nat Genet, DOI : 10.1038 / s41588-019-0569-6
[0221] Choi, H S et al., 2023, Nat Commun, DOI :10.1038 / s41467-023-36181-0
[0222] Chui A et al., 2020, Development, DOI : 10.1242 / dev.l84150
[0223] Day. C-P et al., 2015, Cell, DOI : 10.1016 / j .cell.2015.08.068
[0224] Dolado I et al., 2007, Cancer Cell, DOI : 10.1016 / j.ccr.2006.12.013
[0225] Esser C et al., 2015, Pharmacol Rev, DOI : 10.1124 / pr.114.009001
[0226] Esterbauer H et al., 1990, Methods Enzymol, DOI : 10.1016 / 0076-6879(90)86134-h Eswaramoorthy S et al., 2006, Proc Natl Acad Sci U.S.A, DOI : 10.1073 / pnas.0602398103 Fang. J et al., 2000, Eur J Drug Metab Pharmacokinet, DOI : 10.1007 / BF03190076 Fabbrizio E et al., 2002, EMBO Rep, DOI : 10.1093 / embo-reports / kvfl36
[0227] Hayano, M. et al., 2016, Cell Death Differ, DOI :10.1038 / cdd.2015.93
[0228] Haws, S.A et al., 2020, Mol Cell, DOI : 10.1016 / j.molcel.2020.03.004
[0229] Hayashi H et al., 2019, Lung Cancer, DOI : 10.1016 / j. lungcan.2019.05.013
[0230] Hayes J.D et al., 2020, Cancer Cell, DOI : 10.1016 / j.ccell.2020.06.001
[0231] Hirsch F.R et al., 2003, J Clin Oncol, DOI : 10.1200 / JC0.2003.11.069
[0232] Humphries. M.P et al., 2021, Comput Struct Biotechnol J, DOI : 10.1016 / j. csbj.2021.01.022 Imielinski M et al., 2012, Cell, DOI : 10.1016 / j. cell.2012.08.029
[0233] Itagaki K et al., 1996, JBiol Chem, DOI : 10.1074 / jbc.271.33.20102 lanmohamed A et al., 2004, Biochem Pharmacol, DOI : 10.1016 / j .bcp.2004.02.036
[0234] Jinesh G.G et al., 2018, Oncogene, DOI : 10.1038 / onc.2017.377
[0235] Lee. J.W et al., 2003, Toxicol Lett, DOI : 10.1016 / s0378-4274(02)00333-8
[0236] Leiser S.F et al., 2015, Science, DOI : 10.1126 / science.aac9257
[0237] Li D et al., 2007, Cancer Cell, DOI : 10.1016 / j . ccr.2007.06.005
[0238] Li Y et al. , 2018, Sci Rep, DOI : 10.1038 / s41598-018-34160-w
[0239] Liao B.M et al., 2016, Mol Endocrinol, DOI : 10.1210 / me.2015-1217
[0240] Luo. Y et al., 2022, Clin TranslMed, DOI : 10.1002 / ctm2.740
[0241] Maddalo D et al., 2014, Nature, DOI : 10.1038 / naturel3902
[0242] Maraver Aet al., 2012, Cancer Cell, DOI : 10.1016 / j . ccr.2012.06.014
[0243] Martinez-Terroba E et al., 2018, J Pathol, DOI : 10.1002 / path.5096
[0244] Mascotti M L et al., 2016, J Mol Biol, DOI : 10.1016 / j.jmb .2016.07.003
[0245] Matheu. A et al., 2007, Nature, DOI : 10.1038 / nature05949
[0246] Melocchi V et al., 2021, Oncogene, DOI : 10.1038 / s41388-021-01909-z
[0247] Miao W et al., 2005, J Biol Chem, DOI : 10.1074 / jbc.M412081200
[0248] Morgan R.L et al., 2W , J Thor ac Oncol, DOI : 10.1016 / j .jtho.2017.10.015
[0249] Nicoll C.R et al., 2020, Nat Struct Mol Biol, DOI : 10.1038 / s41594-019-0347-2
[0250] Novick. R M et al., 2009, J Pharmacol Exp Ther, DOI : 10 1124 / jpet .109.152058
[0251] Pajares, M.A. et al., 2013, FEBS Lett, doi:10.1016 / j .febslet.2013.04.034
[0252] Ramos-Paradas J et al., 2021, J Immunother Cancer, DOI : 10.1136 / jitc-2020-001 04 Rojo de la Vega M et al., 2018, Cancer Cell, DOI : 10.1016 / j.ccell.2018.03.022
[0253] Rong S et al., 1992, Mol Cell Biol, DOI : 10.1128 / mcb.12.11.5152-5158.1992
[0254] Rossner R et al., 2017, J Biol Chem, DOI : 10.1074 / jbc.Rl 17.779678 Sanchez- Vega. F et al., 2018, Cell, DOI : 10.1016 / j .cell.2018.03.035 Sanclemente M et al., 2021, Cancer Cell, DOI : 10.1016 / j.ccell.2021.01.008 Skoulidis F et al., 2019, Nat Rev Cancer, DOI : 10.1038 / s41568-019-0179-8 Tang Z et al., 2017, Nucleic Acids Res, DOI : 10.1093 / nar / gkx247
[0255] Tichelaar J.W et al., 2000, J Biol Chem, DOI : 10.1074 / jbc.275.16.11858 Tusher. V.G et al., 2001, Proc Natl Acad Sci U.S.A, DOI : 10.1073 / pnas.091062498 Wan, X. et al., 2024, Cell Death & Disease, DOI : 10.1038 / s41419-024-07093 -8 Wang R et al., 2001, JCellBiol, DOI : 10.1083 / j cb.153.5.1023 Xia, C. et al., 2024, Nat Commun, DOI : 10.1038 / s41467-024-53380-5 Xie Y. et al. Cell Death Differ 2016 Yang Y et al., 2016, Oncogene, DOI : 10.1038 / onc.2016.113 Zhang J.Y et al., 2006, Curr Drug Metab, DOI : 10.2174 / 138920006779010575 Zhang Y et al., 2021, Cell Metab, DOI : 10.1016 / j.cmet.2020.10.002
Claims
CLAIMS ;1. A FM04 inhibitor for use in the treatment of cancer in a subject in need thereof.
2. The FM04 inhibitor for use according to claim 1 wherein cancer is a cancer having an oncogenic KRAS mutation, in particular a KRASG12Vmutation, KRASG12Sor KRASG12Dmutation; a NRAS mutation, a EGFRT790M / L858Rmutation and / or a EML4 / ALK translocation.
3. The FM04 inhibitor for use according to claims 1 or 2 wherein cancer is a lung cancer, a breast cancer, a hepatobiliary cancer, a bladder cancer, sarcoma, an esophagogastric cancer, a melanoma, a pancreatic cancer or a prostate cancer.
4. The FM04 inhibitor for use according to claim 3 wherein cancer is a Lung Adenocarcinoma (LU AD), a Non-Cell Lung Cancer (NSCLC) or a Lung Squamous Cell Carcinoma (LUSC).
5. The FM04 inhibitor for use according to claim 3 wherein the cancer is a Triple Negative Breast Cancer (TNBC).
6. The FM04 inhibitor for use according to claims 1 to 5 wherein the FM04 inhibitor is an inhibitor of FM04 activity and / or an inhibitor of FM04 expression.
7. The FM04 inhibitor for use according to claim 6 wherein the inhibitor of FM04 activity is a small molecule, an anti-AP-1 neutralizing antibody, an neutralizing aptamer or a polypeptide.
8. The FM04 inhibitor for use according to claim 6 wherein the inhibitor of FM04 expression is a siRNA, a nuclease, a ribozyme or an antisense oligonucleotide.
9. A method for treating cancer in a subject in need thereof comprising administering a therapeutically effective amount of the FM04 inhibitor according to claims 1 to 8.
10. A pharmaceutical composition for use in the treatment of cancer comprising a therapeutically effective amount of the FM04 inhibitor according to claims 1 to 8.
11. A kit of part comprising the FM04 inhibitor according to claims 1 to 8 and at least one further therapeutic active agent as a combined preparation for simultaneous, separate or sequential use in the treatment of cancer.
12. The kit of part comprising the FM04 inhibitor according to claim 11, wherein the at least one further therapeutic active agent is a ferroptosis inducer.
13. A method for predicting the survival time and / or the disease progression in a subject suffering from cancer, in particular lung cancer, breast cancer, hepatobiliary cancer, bladder cancer, sarcoma, esophagogastric cancer, melanoma, pancreatic cancer or prostate cancer comprising i) determining in a sample obtained from the patient the expression level of FM04, ii) comparing said expression level determined at step i) with a predetermined reference value and iii) concluding that the method provides a good prognostic when the level of gene expression is higher than the predetermined reference value, or provides a bad prognostic when the level of gene expression is lower than the predetermined reference value.
Citation Information
Patent Citations
Multichain polypeptides or proteins and processes for their production
US4816397A
Single polypeptide chain binding molecules
US4946778A
Recombinant altered antibodies and methods of making altered antibodies
US5225539A
In-vitro method for producing antigen-specific human monoclonal antibodies
US5229275A
Production of chimeric antibodies - a combinatorial approach
US5565332A