Application of miRNA in preparing diagnostic reagent or kit for evaluating breast cancer drug resistance

Abstract

The present invention relates to the field of genetic engineering technology, and specifically relates to the application of miRNA in the preparation of diagnostic reagents or kits for evaluating breast cancer drug resistance. The present invention has for the first time discovered biomarkers hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, hsa-miR-8485 that have high diagnostic value for chemotherapy resistance in hormone receptor-positive breast cancer; through the development and application of serum miRNA markers and diagnostic kits, it is possible to detect at an early stage whether breast cancer patients are resistant to traditional chemotherapy regimens, timely change treatment strategies, lay a foundation for clinicians to quickly and accurately grasp the patient's condition, improve individualized precision treatment, and provide assistance for discovering new small molecule drug targets with potential therapeutic value.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology. Specifically, it relates to the application of miRNA in the preparation of diagnostic reagents or kits for evaluating breast cancer drug resistance. Background Art

[0002] Breast cancer (BC) is one of the most common causes of death among women globally and is a malignant tumor that occurs in the breast epithelium or ductal epithelium. Moreover, breast cancer is a type of advanced multi-drug resistant (MDR) breast cancer with a high recurrence rate in the first three to five years and a short overall survival (OS). Breast cancer drug resistance is an important factor in the failure of breast cancer treatment. Effectively predicting breast cancer drug resistance and accurately changing the treatment plan are crucial for breast cancer treatment.

[0003] However, due to the high heterogeneity of tumors, there are no clear clinical determinants for breast cancer-specific diagnostic or chemotherapy markers. Previous evidence has shown that miRNAs promote tumor growth, migration, invasion, angiogenesis, cell survival, and immune evasion by targeting mRNAs. miRNAs have the potential to become biomarkers for various diseases, including cancer. However, up to now, there is still no good practical method for differentiating the diagnosis of breast cancer with different drug resistances, especially for accurately distinguishing the types of breast cancer. Therefore, there is an urgent need to provide corresponding solutions. Summary of the Invention

[0004] The object of the present invention is to provide the application of miRNA in the preparation of diagnostic reagents or kits for evaluating breast cancer drug resistance, which can at least partially overcome the deficiencies in the prior art.

[0005] According to one aspect of the present invention, there is provided an application of miRNA in the preparation of diagnostic reagents or kits for evaluating breast cancer drug resistance, wherein the miRNA is selected from at least two of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485, and the nucleotide sequences of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 respectively.

[0006] By detecting the expression levels of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485, a relatively accurate typing of breast cancer in the population to be tested can be performed.

[0007] Preferably, the diagnostic reagent or kit is a serological diagnostic reagent, and the kit is a serological diagnostic kit.

[0008] Using such a kit, by detecting the expression levels of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485, a relatively accurate typing of breast cancer in the population to be tested can be performed.

[0009] Preferably, the diagnostic reagent or the kit is used to detect the expression levels of miRNAs of at least two of the hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 in a biological sample.

[0010] This can improve the accuracy of the evaluation of breast cancer drug resistance typing.

[0011] Preferably, the biological sample is serum.

[0012] This can facilitate the acquisition of samples, and the concentration of biomarkers in the samples is relatively high.

[0013] Preferably, the diagnostic reagent or the kit further includes: PCR primers for at least two of the hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-84859, and at least two probes and / or gene chips with detection specificity.

[0014] This can facilitate the evaluation of breast cancer drug resistance.

[0015] Preferably, the nucleotide sequences of the PCR primers specific for detecting hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 are shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively.

[0016] Such primers can accelerate the drug resistance evaluation process.

[0017] Preferably, the diagnostic reagent or kit is a reagent or kit for detecting the expression level of miRNA by fluorescence quantitative PCR method.

[0018] The detection results by fluorescence quantitative PCR method are easier to observe.

[0019] Preferably, the breast cancer drug resistance is obtained based on the respective expression levels of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485.

[0020] This can improve the accuracy of breast cancer drug resistance classification evaluation.

[0021] Preferably, the breast cancer drug resistance is equal to 0.252 × the expression level of hsa-miR-364 - 0.314 × the expression level of hsa-miR-4741 + 0.348 × the expression level of hsa-miR-937-5p + 0.182 × the expression level of hsa-miR-6730-3p - 0.143 × the expression level of hsa-miR-6831-5p - 0.126 × the expression level of hsa-miR-8485.

[0022] This can improve the accuracy of breast cancer drug resistance classification evaluation.

[0023] Preferably, the type of breast cancer to which the sample belongs is determined according to the breast cancer drug resistance.

[0024] This can improve the accuracy of breast cancer drug resistance classification evaluation.

[0025] The present invention has for the first time discovered biomarkers hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 that have high diagnostic value for hormone receptor-positive breast cancer resistance. Through the development and application of serum miRNA markers and diagnostic kits, it is possible to evaluate at an early stage whether breast cancer patients should choose chemotherapy treatment, timely change the treatment strategy according to the prediction results, lay a foundation for further personalized precise treatment, and provide assistance for discovering new small molecule drug targets with potential therapeutic value.

[0026] The kit of the present invention can effectively evaluate the sensitivity of hormone receptor-positive breast cancer to chemotherapy by detecting the expression levels of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485. If the expression levels of several miRNAs among hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 are higher than the normal value range, the patient has a higher risk of drug resistance and is not suitable for traditional chemotherapy regimens. The present invention adopts a combined mode of multiple biomarker miRNAs, and the use of in vitro diagnostic multivariate index analysis can promote the diagnostic effect. In addition, plasma miRNA is not affected by RNase, can be stored for a long time under low temperature conditions, is not affected by freeze-thaw, and is convenient to detect, enabling the standardization of detection technology. Therefore, miRNA in plasma, as a tumor diagnostic marker, has the advantages of being non-invasive and capable of dynamic monitoring, thus achieving the accurate identification of breast cancer types and increasing the possibility of targeted response. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Other features, objects, and advantages of the present invention will become more apparent by reading the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0028] Figure 1 It is a ROC curve graph of the combined detection of 6 miRNAs (hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, hsa-miR-8485) and TNM staging using the kit of the present invention;

[0029] Figure 2It is the melting curve peak diagram of hsa-miR-3646. The horizontal axis is temperature, and the vertical axis is the change value of fluorescence intensity (Derivative Reporter).

[0030] Figure 3 It is the melting curve peak diagram of hsa-miR-4741. The horizontal axis is temperature, and the vertical axis is the change value of fluorescence intensity (Derivative Reporter).

[0031] Figure 4 It is the melting curve peak diagram of hsa-miR-937-5p. The horizontal axis is temperature, and the vertical axis is the change value of fluorescence intensity (Derivative Reporter).

[0032] Figure 5 It is the melting curve peak diagram of hsa-miR-6730-3p. The horizontal axis is temperature, and the vertical axis is the change value of fluorescence intensity (Derivative Reporter).

[0033] Figure 6 It is the melting curve peak diagram of hsa-miR-6831-5p. The horizontal axis is temperature, and the vertical axis is the change value of fluorescence intensity (Derivative Reporter).

[0034] Figure 7 It is the melting curve peak diagram of hsa-miR-8485. The horizontal axis is temperature, and the vertical axis is the change value of fluorescence intensity (Derivative Reporter).

[0035] Figure 8 It is the melting curve peak diagram of the internal reference miR-39. The horizontal axis is temperature, and the vertical axis is the change value of fluorescence intensity (Derivative Reporter).

[0036] Figure 9 It is the scatter diagram of the correlation between the clinical prognosis and the predicted risk of the modeling group.

[0037] Figure 10 It is the scatter diagram of the correlation between the clinical prognosis and the predicted risk of the validation group. Specific implementation manners

[0038] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It can be understood that the specific embodiments described herein are only used to explain the related invention, rather than limiting the invention. For the convenience of description, only the parts related to the invention are shown in the drawings.

[0039] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other.

[0040] The specific embodiments provided by the present invention will be described in detail in combination with the embodiments. The reagents and raw materials used in the present invention are all commercially available or can be prepared according to the methods in the literature. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to the conventional conditions, such as those described in Sambrook et al., "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conventional conditions, or according to the conditions recommended by the manufacturer.

[0041] Example

[0042] Serum samples were collected from 138 patients with chemotherapy-sensitive and chemotherapy-resistant breast cancer in the Affiliated Tumor Hospital of Xinjiang Medical University from 2017 to 2021, serving as the "breast cancer case group". In addition, samples of healthy women matched with the cases in terms of age were selected as the "healthy women control group".

[0043] The serum specimens of patients with chemotherapy-sensitive and chemotherapy-resistant breast cancer were respectively detected by miRNA chip using high-throughput chip technology. Combining bioinformatics analysis and literature, we selected hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 for verification. And a miRNA signature diagnostic model was established through one-way analysis of variance, multivariate analysis of variance, Lasso regression, etc., and a 6-miRNA signature model for diagnosing TNBC resistance was determined.

[0044] An embodiment of the kit for evaluating the prognosis risk of breast cancer according to the present invention, the kit includes amplification primers for 6 miRNAs (hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, hsa-miR-8485) and internal reference miR-39; reagents for extracting RNA; reagents for preparing the reverse transcription reaction system; and reagents for preparing the quantitative PCR reaction system.

[0045] The nucleotide sequences of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 respectively:

[0046] SEQ ID NO:1: aaaaugaaaugagcccagccca;

[0047] SEQ ID NO:2: cgggcuguccggaggggucggcu;

[0048] SEQ ID NO:3: gugagucaggguggggcugg;

[0049] SEQ ID NO:4: ccugacaccccaucugcccuca;

[0050] SEQ ID NO:5: uagguagagugugaggaggagguc;

[0051] SEQ ID NO:6: cacacacacacacacacguau.

[0052] The reagents for preparing the reverse transcription reaction system include reverse transcriptase, dNTP, Random primers, Oligo(dT)12-18, RNasin, reverse transcription buffer, and pure water. The reagents for preparing the quantitative PCR reaction system are SYBR Green I and nuclease-free pure water.

[0053] Preferably, the procedure for the fluorescence quantitative PCR reaction and melting curve analysis can be as follows: Using SYBR Premix Ex Taq (purchased from TAKARA), add 2 μl of the reverse transcription product as a template, 10 μl of 2×SYBR Premix Ex Taq, 0.4 μl of the forward primer (10 μM), 0.4 μl of the reverse primer (10 μM), 0.4 μl of 50×ROX Reference Dye to a 20 μl real-time fluorescence quantitative PCR reaction system, and add sterilized distilled water to 20 μl. Set the real-time fluorescence quantitative PCR program: Step 1: 95°C, 10 minutes. Step 2: 95°C, 15 seconds. Step 3: Increase the temperature from 60°C to 95°C at a rate of 0.5°C per second and read the values to end the cycle. Use β-tubulin as the internal reference for catalase messenger RNA.

[0054] The nucleotide sequences of the PCR primers used for specifically detecting hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 are shown as SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12 respectively:

[0055] SEQ ID NO:7: gcgcagaaaatgaaatgagc;

[0056] SEQ ID NO:8: ctgtccggaggggtc;

[0057] SEQ ID NO:9: gcaggtgagtcagggt;

[0058] SEQ ID NO:10: ctgacaccccatctgc;

[0059] SEQ ID NO:11: cagtaggtagagtgtgaggag;

[0060] SEQ ID NO:12: agcacacacacacacac.

[0061] Based on the above results, the inventors analyzed the expression levels of miRNAs in 2 groups of plasma samples ("breast cancer case group" and "healthy female control group") to explore the unilateral 95% reference value range of the expression levels of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, and hsa-miR-8485 in the healthy female control group of the exploratory population as the standard, scored these 6 miRNAs, scored 0 points if the expression level was less than the 95th percentile, scored 1 point if the expression level was greater than or equal to the 95th percentile, further obtained the risk score with the regression coefficient as the weight, used the median of the risk score as the cut-off value, plotted the ROC to evaluate the sensitivity and specificity of the prediction, and then evaluated the judgment ability of the high expression of these 6 miRNAs on the incidence of breast cancer. All data were expressed as mean ± standard deviation, and the SPSS19.0 software was used to perform statistical analysis on the gene content in each group. The rank sum test analysis method was used for statistics: P < 0.05 indicated significant differences. The ROC results plotted are as Figure 1 shown, from Figure 1It can be seen that the six miRNAs proposed by the present invention can better distinguish the types of breast cancer.

[0062] Such as Figures 2 to 8 Shown are the melting curves of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p, hsa-miR-8485 and the internal reference miR-39, all of which are single peaks and no non-specific peaks appear;

[0063] In a preferred case, a risk value can be used to determine whether it is a high-risk type of breast cancer resistant to chemotherapy. The specific formula is: Risk score = 0.252 (status of hsa-miR-3646) - 0.314 (status of hsa-miR-4741) + 0.348 (status of hsa-miR-937-5p) + 0.182 (status of hsa-miR-6730-3p) - 0.143 (status of hsa-miR-6831-5p) - 0.126 (status of hsa-miR-8485).

[0064] In a preferred scenario, for high-risk patient screening: the cut-off value is 5.44. Samples with Risk score < 5.44 are low-risk, and Risk score ≥ 5.44 are high-risk.

[0065] Figure 9 And Figure 10 Shown is the scatter plot of the correlation between the clinical prognosis and the predicted risk of the modeling group and the validation group for detecting samples using the kit of the present invention. The results show that among 138 samples, there is basically no 5-year recurrence and metastasis for those predicted as low-risk by the present invention, and the samples with 5-year recurrence and metastasis are all high-risk cases predicted by the present invention.

[0066] The above description is only a preferred embodiment of the present application and an explanation of the technical principles applied. Those skilled in the art should understand that the scope of the invention involved in the present application is not limited to the technical solutions formed by the specific combination of the above technical features, but should also cover other technical solutions formed by any combination of the above technical features or their equivalent features without departing from the inventive concept. For example, the technical solutions formed by mutually replacing the above features with the (but not limited to) technical features having similar functions disclosed in the present application. Sequence Listing <110> The Third Affiliated Hospital of Xinjiang Medical University <120> Application of miRNA in the Preparation of Diagnostic Reagents or Kits for Evaluating Breast Cancer Drug Resistance <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 aaaaugaaau gagcccagcc ca 22 <210> 2 <211> 23 <212> RNA <213> Homo sapiens <400> 2 cgggcugucc ggaggggucg gcu 23 <210> 3 <211> 20 <212> RNA <213> Homo sapiens <400> 3 gugagucagg guggggcugg 20 <210> 4 <211> 22 <212> RNA <213> Homo sapiens <400> 4 ccugacaccc caucugcccu ca 22 <210> 5 <211> 24 <212> RNA <213> Homo sapiens <400> 5 uagguagagu gugaggagga gguc 24 <210> 6 <211> 21 <212> RNA <213> Homo sapiens <400> 6 cacacacaca cacacacgua u 21 <210> 7 <211> 20 <212> DNA <213> Homo sapiens <400> 7 gcgcagaaaa tgaaatgagc 20 <210> 8 <211> 15 <212> DNA <213> Homo sapiens <400> 8 ctgtccggag gggtc 15 <210> 9 <211> 16 <212> DNA <213> Homo sapiens <400> 9 gcaggtgagt cagggt 16 <210> 10 <211> 16 <212> DNA <213> Homo sapiens <400> 10 ctgacacccc atctgc 16 <210> 11 <211> 21 <212> DNA <213> Homo sapiens <400> 11 cagtaggtag agtgtgagga g 21 <210> 12 <211> 17 <212> DNA <213> Homo sapiens <400> 12 agcacacaca cacacac 17

Claims

1. Use of a reagent for detecting the expression level of serum miRNA in the preparation of a diagnostic reagent or kit for evaluating breast cancer chemotherapy resistance, characterized in that, the miRNA consists of hsa-miR-3646, hsa-miR-4741, hsa-miR-937-5p, hsa-miR-6730-3p, hsa-miR-6831-5p and hsa-miR-8485, and the nucleotide sequences of the hsa-miR-3646, the hsa-miR-4741, the hsa-miR-937-5p, the hsa-miR-6730-3p, the hsa-miR-6831-5p and the hsa-miR-8485 are respectively shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6; the diagnostic reagent or the kit is used for detecting the expression levels of the miRNAs of the hsa-miR-3646, the hsa-miR-4741, the hsa-miR-937-5p, the hsa-miR-6730-3p, the hsa-miR-6831-5p and the hsa-miR-8485 in a biological sample.

2. The use according to claim 1, characterized in that, the diagnostic reagent is a reagent for detecting the miRNA expression level by fluorescence quantitative PCR method, and the kit is a kit for detecting the miRNA expression level by fluorescence quantitative PCR method.

3. The use according to claim 1, characterized in that, the calculation formula of the breast cancer chemotherapy resistance Risk score is as follows: Risk score = 0.252 × the expression level of hsa-miR-3646 - 0.314 × the expression level of hsa-miR-4741 + 0.348 × the expression level of hsa-miR-937-5p + 0.182 × the expression level of hsa-miR-6730-3p - 0.143 × the expression level of hsa-miR-6831-5p - 0.126 × the expression level of hsa-miR-8485.

Images