Application of hsa-miR-144-5p as a diagnostic marker for postmenopausal osteoporosis

By screening and validating hsa-miR-144-5p using high-throughput gene chips and quantitative real-time PCR technology, the problems of cumbersome detection and low sensitivity in the diagnosis of postmenopausal osteoporosis have been solved, providing a highly accurate diagnostic tool suitable for simple detection of postmenopausal osteoporosis.

CN114807341BActive Publication Date: 2026-03-03THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210068249.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-01-20
Publication Date
2026-03-03
Estimated Expiration
2042-01-20

AI Technical Summary

Technical Problem

Existing technologies for diagnosing postmenopausal osteoporosis suffer from problems such as cumbersome testing procedures, difficulty in obtaining samples, and low sensitivity and specificity. The application of traditional bone turnover markers is limited, making it difficult to achieve early and timely diagnosis.

Method used

High-throughput gene chip technology was used to screen differentially expressed serum microRNAs, and the expression level of hsa-miR-144-5p was verified by real-time quantitative PCR. A specific detection tool was developed for the diagnosis of postmenopausal osteoporosis.

Benefits of technology

It provides a simple, easy-to-use, and highly accurate diagnostic method. The relative difference fold screening threshold of hsa-miR-144-5p is high, and its sensitivity and specificity are superior to traditional bone turnover markers. It avoids the radiation of traditional imaging examinations and is suitable for minimally invasive blood sampling procedures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114807341B_ABST
    Figure CN114807341B_ABST
Patent Text Reader

Abstract

The application discloses application of hsa-miR-144-5p as a postmenopausal osteoporosis diagnosis marker. The application adopts high-throughput gene chip technology to detect serum miRNA expression profiles of PMOP patients, and compares with postmenopausal non-osteoporosis population, screens differential expression miRNAs between the two, further verifies the differential level of the selected miRNA between the PMOP patients and n-PMOP through real-time fluorescent quantitative PCR technology, confirms the clinical application value of the screened marker, and finally provides a simple and easy, high-precision biomarker for clinical PMOP diagnosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to molecular diagnostics, to novel applications of serum microRNAs, and particularly to the application of hsa-miR-144-5p as a diagnostic biomarker for postmenopausal osteoporosis. Background Technology

[0002] Postmenopausal osteoporosis (PMOP) is a metabolic disease characterized by bone loss and destruction of bone microstructure, with an increased risk of fractures being the primary clinical manifestation. With rising medical costs, disability rates, and mortality rates, clinical and public health systems face immense pressure and unprecedented challenges. Therefore, timely diagnosis of PMOP and early intervention can help minimize its harm to the bone health of postmenopausal women.

[0003] Dual-energy X-ray absorptiometry (DXA) is an internationally recognized clinical method for assessing bone mass. However, according to the 2013 Asia-Pacific Audit Report of the International Osteoporosis Foundation (IOF), China has less than one DXA device per million people. Less than one-fifth of postmenopausal women are able to undergo DXA examination. Portable quantitative ultrasound and high-resolution CT can serve as alternatives to DXA, but their adoption rates in my country are far lower than DXA due to lower measurement accuracy, economic constraints, and limited access to facilities.

[0004] As indicators that directly reflect the activity levels of osteoblasts and osteoclasts, serum bone turnover markers (BTMs), such as 25-hydroxyvitamin D (25(OH)D), N-terminal middle segment osteocalcin (N-MID), N-terminal propeptide of Type I procollagen (P1NP), and β-C-terminal telopeptide of Type I collagen (β-CTX), are commonly used for the auxiliary diagnosis and treatment monitoring of PMOP. Because BTMs are derived from circulating serum and are readily available, they can be easily measured in clinical practice using established methods. Many researchers have focused on their relationship with bone mineral density (BMD) to try and reflect changes in BMD. However, it has been recognized that BTMs have inherent limitations in reflecting PMOP, exhibiting relatively low sensitivity and specificity. Literature reports that serum BTM levels have a poor correlation with bone formation and resorption results assessed by bone histomorphometry (correlation coefficients are mostly between 0.21 and 0.36). Furthermore, BTM levels can also be elevated in some non-PMOP metabolic bone diseases. In summary, existing PMOP detection methods suffer from cumbersome procedures, limited availability, single methodologies, and low sensitivity and specificity, which are significant factors hindering the early and timely diagnosis of PMOP. Therefore, there is an urgent clinical need to find a simple, readily available, and novel biomarker that balances high sensitivity and specificity.

[0005] Serum microRNAs (miRNAs / microRNAs) are short, non-coding, single-stranded RNAs ranging from 18 to 24 nucleotides in length. As one of the epigenetic regulatory mechanisms of gene expression, they bind to the 3' untranslated region (3'UTR) of target messenger RNA (mRNA) to form the RNA-inducing silencing complex (RISC), promoting mRNA degradation or inhibiting its post-transcriptional translation, thereby participating in the regulation of cell proliferation, differentiation, and apoptosis. The potential of miRNAs as biomarkers for early disease diagnosis, treatment, and prognostic monitoring has been well validated in diseases such as cancer, cardiovascular disease, obesity, and diabetes. Although a few studies have found differences in the expression levels of certain miRNAs in osteoporosis-induced cell and animal models, the miRNAs screened by different studies vary considerably due to differences in research subjects, sample sources and processing procedures, and non-standardized experimental conditions, resulting in inconsistent research quality. Furthermore, no studies have reported applying this method to the clinical diagnosis of diseases. Summary of the Invention

[0006] One of the objectives of this invention is to provide the application of hsa-miR-144-5p as a diagnostic marker for postmenopausal osteoporosis.

[0007] This invention uses high-throughput gene chip technology to detect the expression profile of serum miRNAs in PMOP patients and compares it with that of postmenopausal non-osteoporosis (n-PMOP) patients to screen differentially expressed miRNAs. The differential level of the selected miRNAs between PMOP patients and n-PMOP patients is further verified by quantitative real-time PCR (qRT-PCR) technology to confirm the clinical application value of the screened biomarkers and ultimately provide simple, easy-to-use, and highly accurate biomarkers for the clinical diagnosis of PMOP.

[0008] The second objective of this invention is to provide the application of a product that specifically detects hsa-miR-144-5p in the preparation of tools for diagnosing postmenopausal osteoporosis.

[0009] The products include formulations for detecting hsa-miR-144-5p expression levels using quantitative real-time PCR (qRT-PCR). These formulations include primers that specifically amplify hsa-miR-144-5p and diagnostic kits containing these primers.

[0010] As an embodiment of the present invention, the primers for specifically amplifying hsa-miR-144-5p are as follows:

[0011] GSP:5'GGGGGGGGATATCATCATATAC3';

[0012] R:5'GTGCGTGTCGTGGAGTCG3'.

[0013] The present invention has the following advantages:

[0014] 1. The invention was validated using different clinical samples through high-throughput gene chip technology and qRT-PCR technology. The relative difference fold change screening threshold of hsa-miR-144-5p was set high, with logFC>4, while the general screening threshold is logFC>2. It can be seen that the invention has higher sensitivity and specificity than traditional BTMs.

[0015] 2. Using hsa-miR-144-5p as a biomarker, PMOP diagnosis is not limited by traditional BMD examination equipment and medical conditions. It can be done with minimally invasive blood sampling, which is convenient, easy to operate, time-saving, labor-saving, highly feasible, and avoids the radiation caused by traditional imaging examinations. Attached Figure Description

[0016] Figure 1 Volcano plot of miRNAs showing significant differential expression levels between the PMOP and n-PMOP groups.

[0017] Figure 2 To detect the relative differential expression fold of hsa-miR-144-5p between the PMOP and n-PMOP groups using both high-throughput gene chip technology and qRT-PCR.

[0018] Figure 3 The difference in relative expression levels of hsa-miR-144-5p between the PMOP group and the n-PMOP group.

[0019] Figure 4 ROC curve for hsa-miR-144-5p in the validation set for diagnosing PMOP. Detailed Implementation

[0020] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0021] This invention first uses high-throughput gene chip technology to detect the expression profiles of serum miRNAs in 6 PMOP patients and 4 postmenopausal non-osteoporosis participants (n-PMOP), comparing and screening differentially expressed miRNAs between the two groups. Based on this, the top 10 miRNAs with the most significant differential expression were selected for qRT-PCR validation of the original chip samples. The candidate miRNAs were further screened based on the consistent expression trend in the gene chip and qRT-PCR results and log2FoldChange(FC)>4. The miRNA that met the criteria was identified as hsa-miR-144-5p. An independent validation set of miRNAs (73 samples) based on new clinical samples was constructed to verify the diagnostic ability of hsa-miR-144-5p for PMOP.

[0022] Part 1: Test Methods

[0023] I. Research Subjects and Grouping

[0024] Participants were postmenopausal women who visited the First Affiliated Hospital of Sun Yat-sen University between June 2020 and August 2021. Inclusion criteria: (1) age ≥ 50 years; (2) duration of menopause ≥ 1 year; (3) cooperation with the study and signing of informed consent. Exclusion criteria: history of chronic diseases that may affect bone or soft tissue metabolism (such as diabetes, kidney disease, connective tissue disease or tumors, etc.), history of medication use (anti-osteoporosis drugs, steroids, etc.) or history of treatment (history of radiotherapy and chemotherapy, etc.).

[0025] All participants underwent DXA examination upon admission [including three sites: lumbar vertebrae 1–4 (LS 1–4), total hip (TH), and femoral neck (FN)]. Clinical data included in the study were: (1) age; (2) height; (3) weight; (4) BMI; (5) years since menopause; and (6) serum BTMs and general biochemical indicators, including 25(OH)D, N-MID, P1NP, β-CTX, UA, ALP, Calcium, Phosphorus, etc. This study was conducted in accordance with the guidelines of the Declaration of Helsinki and was approved by the Medical Ethics Committee of the First Affiliated Hospital of Sun Yat-sen University (Ethics Review

[2020] 291–1).

[0026] According to the guidelines for the diagnosis and treatment of osteoporosis (2017) issued by the Chinese Society of Osteoporosis and Bone Mineral Diseases, the study subjects were divided into an experimental group (PMOP group; T-score ≤ –2.5) and a control group (n-PMOP group; T-score > –2.5).

[0027] II. Obtaining Serum Samples

[0028] All participants underwent fasting blood collection via cubital vein sampling by outpatient or inpatient nurses in the morning (fasting ≥8 hours). Blood samples were delivered to the hospital laboratory within 3 hours and centrifuged at 3500 rpm for 10 minutes to obtain serum. Serum UA, ALP, Calcium, and Phosphorus were quantitatively analyzed using an AU5800 fully automated biochemical analyzer and its reagents. Serum 25(OH)D, N-MID, P1NP, and β-CTX levels were measured using a Cobas 6000 series analyzer and its reagents. Remaining serum was aliquoted into 1.5 mL EP tubes (500 μL per tube) and stored at –80°C for further gene chip analysis (gene chip analysis was performed by Shanghai Kangcheng Biotechnology Co., Ltd. using the Exiqon platform).

[0029] III. miRNA microarray detection

[0030] 1. Extraction of total RNA from serum

[0031] (1) Add 0.25 mL of serum and 2–8 μL of Polyacryl Carrier to 0.75 mL of TRI Reagent BD, cap it and vortex for 10 s to homogenize thoroughly.

[0032] (2) After mixing, let the centrifuge tube stand at room temperature (15–30℃) for 5 minutes to fully dissociate the nucleic acid protein complex.

[0033] (3) Add 0.2 mL of chloroform to each 1 mL homogenized sample, cover and vortex for 10 s, then incubate at room temperature for 2–3 min.

[0034] (4) After standing, centrifuge the centrifuge tubes at 4℃ and 12000g for 15 min. The centrifuged mixture will separate into a lower red phenol-chloroform phase, a middle layer, and an upper colorless aqueous phase. At this point, the RNA will be completely in the aqueous phase.

[0035] (5) Transfer the aqueous phase to a new centrifuge tube, add 0.5 mL of isopropanol to each 1 mL of aqueous phase, mix well and incubate at room temperature for 10 min.

[0036] (6) Centrifuge the centrifuge tube at 4℃ and 12000g for 10 minutes. At this time, the RNA has precipitated to the bottom of the tube and appears as a gel or milky white.

[0037] (7) Remove the supernatant from the centrifuge tube and add at least 1 mL of pre-prepared 75% ethanol to each 1 mL of TRIzol reagent homogenate to wash the RNA precipitate. After vortexing thoroughly, centrifuge at 4 °C and 7500 × g for 5 min.

[0038] (8) Remove the upper ethanol washing solution and air dry the RNA precipitate for 5–10 min.

[0039] (9) Add RNase-free water that has been pretreated with DEPC to the centrifuge tube, pipette and blow repeatedly until fully mixed, and incubate at 55–60°C for 10 min.

[0040] (10) The obtained RNA solution was stored at -80°C for subsequent experiments.

[0041] 2. RNA quality testing

[0042] use The ND-1000 was used to detect the optical density (OD) of the RNA solution at wavelengths of 230 nM, 260 nM, and 280 nM, thereby determining the RNA concentration and purity.

[0043] (1) Concentration determination: A reading of 1 at 260 nM indicates 40 nG RNA / μL. The formula for calculating the sample RNA concentration is: A = 260 × 40 ng / μL.

[0044] (2) Purity determination: i.e., the A260 / A280 ratio.

[0045] 3. miRNA markers

[0046] (1) Place other reagents besides the enzyme label on ice to dissolve for 15–20 min. After dissolving completely, shake to mix and centrifuge appropriately.

[0047] (2) Prepare the reaction solution according to the table below, mix thoroughly, and incubate at 37°C for 30 min:

[0048]

[0049] (3) Place the reaction tube in a 95°C constant temperature water bath to stop the enzyme reaction, and then immediately place it on ice for 5 minutes and centrifuge appropriately.

[0050] (4) Add the labeling reagent to the CIP reaction solution according to the table below, and mix thoroughly:

[0051]

[0052] (5) Incubate at 16℃ in the dark for 1 hour.

[0053] (6) Incubate at 65℃ for 15 min to terminate the fluorescent labeling reaction, then centrifuge the labeled product appropriately and store it in a 4℃ refrigerator for subsequent experiments.

[0054] 4. miRNA microarray hybridization

[0055] (1) Prepare the hybridization solution according to the table below:

[0056]

[0057] (2) Incubate the hybridization mixture at 95°C in the dark for 2 min, and then immediately place it on ice for 5 min.

[0058] (3) Remove the coverslip and carefully place the chip on the coverslip with the chip side facing the coverslip. At this time, the gap between the chip and the coverslip forms a reaction hybridization chamber.

[0059] (4) The hybridization reaction system consisting of coverslip and chip is placed into a 3.1×9cm heat-shrink hybridization bag.

[0060] (5) Secure the opening of the hybridization bag with a metal clamp, and quickly immerse the heat-shrink hybridization bag in 95°C hot water. During the operation, ensure that the upper edge of the chip is always above the water surface to prevent water from seeping in. At this time, the hybridization bag will shrink and tightly wrap around the hybridization reaction system.

[0061] (6) Take out the tightened hybridization bag and wipe off the surface moisture. Cut off the excess hybridization bag at the top and place it in a 50℃ constant temperature drying oven to dry for about 10 minutes.

[0062] (7) Add 180 μL of the prepared hybridization mixture through the sample well, and then add 1×hybridization buffer until the liquid level is about 0.5 cm from the top of the reaction system.

[0063] (8) Take another heat-shrinkable hybridization bag and place it vertically over the first heat-shrinkable hybridization bag containing the hybridization reaction system, and cut off the excess part.

[0064] (9) Hold the top of the hybridization reaction system with tweezers and immerse it vertically in 95°C hot water. At this time, the second hybridization bag will shrink and tightly wrap around the hybridization reaction system.

[0065] (10) Place the hybridization reaction system in a 56°C drying oven and on a shaker overnight at 2 rpm.

[0066] 5. Chip cleaning

[0067]

[0068]

[0069] (1) Remove the chip from the heat-shrink hybridization bag and wash it with Wash buffer A for 2 min at 56°C.

[0070] (2) Clean the chip with Wash buffer B for 2 minutes at room temperature (first pass).

[0071] (3) Clean the chip with Wash buffer B for 2 minutes at room temperature (second pass).

[0072] (4) Clean the chip with Wash buffer C for 2 minutes at room temperature.

[0073] (5) Clean the chip with nuclease-free water for 2 minutes at room temperature.

[0074] (6) The chip was centrifuged at 200g for 5 minutes, dried, and then immediately scanned.

[0075] 6. miRNA microarray scanning

[0076] (1) Use an Axon GenePix 4000B chip scanner to scan the original image of the chip.

[0077] (2) Use GenePix pro V6.0 software to perform raw data analysis.

[0078] (3) Standardization of raw data: The green signal intensity of each probe on the chip was removed from the background, and the average value of repeated probes was taken. The median standardization method was used to standardize the raw data. Non-control probes with a correction value (foreground value - background value) ≥ 50 on each chip in the same batch of experiments were selected for standardization. The median value of this part of the probes was used as the standardization factor to standardize the points of the entire chip. That is, each miRNA correction value / median value = standard value, and finally the miRNA expression value of each group of samples was obtained.

[0079] IV. qRT-PCR Validation

[0080] 1. Synthesis of complementary DNA (cDNA)

[0081] 1.1 Reverse transcription primer sequences

[0082] hsa-miR-144-5p 5'GTCGTATCCAGTGCGTGTCGTGGAGTC

[0083] GGCAATTGCACTGGATACGACCTTACA3'

[0084] hsa-miR-425-5p (internal reference gene) 5'GTCGTATCCAGTGCGTGTCGTGGAGTC

[0085] GGCAATTGCACTGGATACGACTCAACG3'

[0086] 1.2 Operating Procedures

[0087] (1) Prepare the reverse transcription mixed reaction solution on ice. The components and volumes are as follows:

[0088]

[0089] (2) The temperature and time of the reverse transcription reaction of the PCR amplification instrument were set as follows: 16℃, 30min; 42℃, 40min; 85℃, 5min. After the reaction, it was placed on ice for later use or stored at -20℃.

[0090] 2. qRT-PCR

[0091] 2.1 List of miRNA primers

[0092]

[0093] Note: GSP is the specific primer for the corresponding miRNA, and R is the primer that matches the RT primer.

[0094] 2.2 Operating Procedures

[0095] (1) Thaw the reverse transcription product obtained above on ice and shake to mix.

[0096] (2) Prepare the qRT-PCR reaction system with the following components and volumes. Gently tap the bottom of the tube to mix the solutions, and briefly centrifuge at 5000 rpm.

[0097]

[0098] (3) Add 8 μL of the mixture to each well of the 384-PCR plate.

[0099] (4) Add 2 μL of cDNA to each well and centrifuge briefly to mix.

[0100] (5) Place the 384-PCR plate on the PCR instrument for reaction. The reaction conditions are set as follows: ① 95℃, 10min; ② 95℃, 10sec; 60℃, 60sec; for a total of 40 cycles.

[0101] (6) After the amplification reaction is completed, set the parameters 95℃, 10sec; 60℃, 60sec; 95℃, 15sec; and slowly heat from 60℃ to 99℃ to establish the melting curve of the PCR product in order to determine the specificity and consistency of the reaction.

[0102] (7) The number of cycles when the fluorescence intensity reaches the threshold is recorded as the Ct value. Each reaction is repeated 3 times, and the average value is taken as the final analysis result.

[0103] 2.3 Determination of internal reference genes

[0104] During qRT-PCR, the sample loading volume was 2 μL. However, due to errors in RNA concentration quantification and reverse transcription efficiency, the cDNA content of each 2 μL sample volume was not entirely consistent. To correct for this difference, a miRNA with a relatively constant expression level across different samples was selected as the internal control gene. Based on the manufacturer's recommendation (https: / / www.exiqon.com / ls / Documents / Scientific / serumplasma-mirna-profiling.pdf) and previous literature reports, this study ultimately selected hsa-miR-425-5p as the internal control gene.

[0105] 2.4 Results Analysis

[0106] Each tested miRNA was standardized using the internal reference hsa-miR-425-5p, and the data were analyzed using 2... -△△CT The method is used for analysis.

[0107] 3. Statistical methods

[0108] Data analysis was performed using SPSS software (Version 22, IBM, Armonk, New York, NY). Continuous variables were expressed as mean ± standard deviation. Independent samples t-tests were used for comparisons between groups. Receiver operating characteristic (ROC) curves were constructed to evaluate the diagnostic efficacy of the included variables for changes in BMD. The area under the curve (AUC) was used as an accuracy measure for evaluating the diagnostic performance of the variable. Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated for each diagnostic indicator. P < 0.05 was considered statistically significant.

[0109] Part Two: Experimental Conclusions

[0110] I. Clinical Information of 10 Gene Chip Samples

[0111] The general information, BMD (LS 1–4, TH, FN), serum biochemical indicators, and clinical characteristics of BTMs of the 10 participants (6 in the PMOP group and 4 in the n-PMOP group) are shown in Table 1.

[0112] Table 1. General clinical data, serum biochemical indicators, and characteristics of BTMs of the participants.

[0113]

[0114] Data are expressed as mean ± standard deviation. All p-values ​​were calculated using a t-test. P < 0.05 was considered statistically significant (shown in bold). – indicates no reference value.

[0115] BTMs, bone turnover markers; BMI, body mass index; LS, lumbar spine; TH, total hip joint; FN, femoral neck; BMD, bone mineral density; 25(OH)D, 25-hydroxyvitamin D; N-MID, N-terminal mid-segment osteocalcin; P1NP, N-terminal propeptide of type I procollagen; β-CTX, β-crosslinked degradation products; UA, uric acid; ALP, alkaline phosphatase.

[0116] II. RNA Quality Control

[0117] The RNA concentration of the extracted samples was assessed using ultraviolet absorptiometry. The OD values ​​at 230 nM, 260 nM, and 280 nM represent the optical density values ​​of carbon source substances, nucleic acids, and proteins, respectively. OD 260 / 230 was used to assess the level of impurities in the extracted RNA. The results of this experiment show that the extracted RNA exhibited low degradation, good integrity, and its purity and total amount met the requirements for miRNA microarray experiments (Table 2).

[0118] Table 2. RNA quality test results of different samples

[0119]

[0120] QC, Quality Control.

[0121] III. Obtaining Differentially Expressed miRNAs

[0122] A total of 198 significantly differentially expressed miRNAs were identified between the PMOP group and the n-PMOP group. Figure 1 Of these, compared to the n–PMOP group, the PMOP group showed significantly upregulated expression levels of 148 miRNAs and significantly downregulated expression levels of 50 miRNAs. (Volcano diagram) Figure 1 The two-dimensional spatial distribution of all differentially expressed miRNAs is shown in Table 3, which shows the differences in expression levels of the top 5 significantly upregulated and downregulated miRNAs in 10 samples.

[0123] Table 3. Top 5 upregulated and downregulated miRNAs by fold change in the microarray.

[0124]

[0125] The values ​​in parentheses are the first 5 of Log2FC.

[0126] IV. Relative expression level of hsa-miR-144-5p in the original sample (comparison between PMOP group and n-PMOP group)

[0127] like Figure 2 The results showed that hsa-miR-144-5p was the only miRNA with a relative differential expression fold greater than 4 in both the gene chip and qRT-PCR validation, which was the highest among all screened miRNAs. Therefore, hsa-miR-144-5p was selected for further validation.

[0128] V. Clinical information of 73 newly constructed sample participants

[0129] It can be seen that conventional BTMs such as 25(OH)D, N-MID, P1NP and β-CTX showed no difference between the two groups.

[0130] Table 4 Clinical characteristics of participants in the validation set

[0131]

[0132]

[0133] Data are expressed as mean ± standard deviation. All p-values ​​were calculated using a t-test. P < 0.05 was considered statistically significant (shown in bold).

[0134] BMI, Body Mass Index; LS, Lumbar Spine; TH, Total Hip Joint; FN, Femoral Neck; 25(OH)D, 25-hydroxyvitamin D; N-MID, N-terminal mid-segment osteocalcin; P1NP, N-terminal propeptide of type I procollagen; β-CTX, β-crosslinked degradation product; UA, Uric acid; ALP, Alkaline phosphatase.

[0135] VI. Expression level of hsa-miR-144-5p in the independent validation set ( Figure 3 )

[0136] like Figure 3 As shown, the relative expression level of hsa-miR-144-5p differed significantly between the PMOP and n-PMOP groups, and was superior to traditional BTMs.

[0137] VII. ROC curve for diagnosing PMOP with hsa-miR-144-5p: ROC curves were constructed using hsa-miR-144-5p as an independent indicator to evaluate its ability to distinguish PMOP and n-PMOP as a diagnostic biomarker in the validation set. Figure 4As shown, hsa-miR-144-5p exhibits good diagnostic accuracy [AUC = 0.828, 95% CI: 0.722–0.906]. When the relative expression level cut-off value of hsa-miR-144-5p is 0.02, the sensitivity for diagnosing PMOP is 100.0% (95% CI: 92.5–100.0%), the specificity is 61.5% (95% CI: 40.6–79.8%), the positive predictive value is 82.5% (95% CI: 70.1–91.3), and the NPV is 100.0% (95% CI: 79.4–100.0%). Figure 4 shows the cutoff values ​​for achieving optimal sensitivity and specificity. sequence list <110> The First Affiliated Hospital of Sun Yat-sen University <120> Application of hsa-miR-144-5p as a diagnostic marker for postmenopausal osteoporosis <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 54 <212> DNA <213> Artificial Sequence <400> 1 gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgacct taca 54 <210> 2 <211> 54 <212> DNA <213> Artificial Sequence <400> 2 gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactc aacg 54 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <400> 3 ggggggggat atcatcatat ac 22 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 gtgcgtgtcg tggagtcg 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 ggggaatgac acgatcactc 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 gtgcgtgtcg tggagtcg 18

Claims

1. Use of a product for specific detection of the expression level of hsa-miR-144-5p in serum for the preparation of a tool for the diagnosis of postmenopausal osteoporosis.

2. Use according to claim 1, characterized in that, The product comprises a preparation for the real-time fluorescent quantitative PCR detection of the expression level of hsa-miR-144-5p.

3. Use according to claim 2, characterized in that, The preparation comprises primers for specific amplification of hsa-miR-144-5p and a diagnostic kit comprising said primers.

4. Use according to claim 3, characterized in that, The primers for specific amplification of hsa-miR-144-5p are as follows: GSP: 5' GGGGGGGGATATCATCATATAC 3'; R: 5' GTGCGTGTCGTGGAGTCG 3'.