Use of ADAMTS1 gene polymorphism for predicting the risk of Alzheimer's disease

By detecting dupT insertion mutations in the ADAMTS1 gene, the problem of difficulty in predicting the risk of Alzheimer's disease in the prior art is solved, and higher prediction accuracy and early warning capabilities are achieved.

CN115404272BActive Publication Date: 2025-06-27INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202110590268.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-05-28
Publication Date
2025-06-27
Estimated Expiration
2041-05-28

AI Technical Summary

Technical Problem

The prior art is difficult to predict the risk of Alzheimer's disease in the early stage, and traditional cerebrospinal fluid detection methods have invasive and time-sensitive limitations.

Method used

By detecting the dupT insertion mutation of the ADAMTS1 gene on human chromosome 21 (rs3838078), PCR gene amplification and first-generation sequencing technology, the risk of AD in individuals was determined.

Benefits of technology

This method can significantly improve the accuracy of the incidence risk prediction in patients with Alzheimer's disease and provide the possibility of early warning and preventive measures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The present invention relates to the use of ADAMTS1 gene polymorphisms for predicting the risk of Alzheimer's disease. Specifically, the present invention relates to the use of ADAMTS1 gene polymorphisms as markers for predicting the risk of Alzheimer's disease in a subject; preferably, the ADAMTS1 gene polymorphisms include a dupT insertion mutation at position 268474067415 of human chromosome 26 (i.e., rs3838078). On the other hand, the present invention relates to a kit for predicting the risk of Alzheimer's disease in a subject, the kit comprising one or more primers and / or probes for detecting ADAMTS1 gene polymorphisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of ADAMTS1 gene polymorphism detection, and in particular, to the use of ADAMTS1 gene polymorphism in a biomarker for predicting the risk of Alzheimer's disease. Background Art

[0002] Alzheimer's disease (AD) is a degenerative disease of the central nervous system. Its clinical manifestations include progressive memory impairment, cognitive impairment, decreased ability to live daily, and mental disorders. It is currently listed as one of the three major diseases that cause death in the elderly, along with malignant tumors and cardiovascular diseases. The latest World Alzheimer's Report shows that there are approximately 46.8 million dementia patients worldwide, and the number will reach 131 million by 2050. Among the dementia population, AD patients account for 60-80% of the total. Surveys show (Lancet Public Health. 2020 Dec; 5(12): e661-e671.) that the rapid growth in the number of AD patients has caused a huge social and economic burden and posed a severe challenge to sustainable development. Geriatric diseases represented by AD have become a prominent problem threatening human health. However, the exact pathogenesis of AD has not yet been elucidated. Therefore, exploring the pathogenesis of AD and finding targeted prevention and treatment measures have become one of the major issues that need to be urgently addressed in today's society.

[0003] In the brain of AD patients, neuronal and synaptic dysfunction or death will first occur in the hippocampus and cortical entorhinal areas, followed by lesions in the cortical association areas of the frontal, temporal and parietal lobes, and finally spread to the limbic and neocortices, leading to the loss of neurons under the locus coeruleus of the basal nucleus, decreased choline and norepinephrine levels, causing the degeneration of neuronal function, and ultimately leading to dementia. The typical pathological characteristics of AD are the aggregation of amyloid βpeptide (Aβ) outside nerve cells to form amyloid plaques and neurofibrillary tangles caused by excessive phosphorylation of tau protein in cells. Since the phosphorylation of tau protein occurs in the late stage of neuronal damage, most studies believe that the deposition of amyloid protein is the key cause of Alzheimer's disease.

[0004] The main components of amyloid are Aβ40 and Aβ42, which are mixed with other polypeptides (such as Aβ26-39, Aβ26-40, Aβ26-42) and proteins (such as ApoE). Aβ is a small peptide of 38-43 amino acids obtained by the sequential cleavage of β-amyloid precursor protein (APP) by β-secretase and γ-secretase. Under pathological conditions, APP is first acted on by β-secretase (BACE1) to generate secreted amyloid precursor protein (sAPPβ) and a transmembrane carboxyl-terminal C99 (or CTF-β) containing 99 residues. The carboxyl-terminal fragment C99 formed by cleavage is then acted on by γ-secretase to produce a series of Aβ with different lengths (39-42 residues), which are named according to the number of amino acid residues. Among them, Aβ42 is more likely to aggregate and has stronger cytotoxicity.

[0005] Although therapeutic antibodies against Aβ have failed in clinical trials in recent years, it is believed that the time point when Aβ begins to damage the nervous system is much earlier than the time point when drugs are administered in clinical trials. In particular, in recent years, research results in emerging fields such as APOE4, TREM2, pTau, and immune inflammation have found that these molecular and cellular level abnormalities ultimately lead to the excessive accumulation of Aβ. Therefore, in the future, exploring the induction mechanism at the molecular and cellular levels in the early stage of AD development and developing early diagnosis and early intervention treatment strategies will be the key directions.

[0006] Currently, the early diagnosis of AD is mainly based on a cerebrospinal fluid detection kit to detect the level of amyloid protein in cerebrospinal fluid. However, this method requires the extraction of cerebrospinal fluid and can only predict the disease when the disease has already started. If high-risk genes are found at the genomic level, it may be possible to predict the onset risk of AD at an earlier stage.

[0007] ADAMTS (A Disintegrin and Metalloprotease with ThromboSpondin motifs) was first characterized in 1997. Among the 19 proteases in this family, the role of the first member, ADAMTS1, in cancer has been widely studied.

[0008] ADAMTS1 is a secreted protein with a signal peptide, a zinc-binding site, and a cysteine-rich region at the N-terminus. The ADAMTS1 gene is located on human chromosome 21. Summary of the Invention

[0009] The present invention provides a method for detecting the risk of Alzheimer's disease (AD) based on the polymorphism of the ADAMTS1 gene. Our research found that individuals carrying the insertion mutation (dupT) allele genotype of rs3838078 have a 1.5-fold increased risk of AD compared to the control group (OR value = 1.5). Detection of this locus only requires a pair of PCR primers to amplify the DNA region where this locus is located and first-generation sequencing detection. This locus can be used to predict the risk of AD, thereby assisting high-risk populations to prevent in the early stage with a healthy lifestyle that has an effect of resisting dementia.

[0010] Thus, in a first aspect, the present invention provides the use of the ADAMTS1 gene polymorphism as a biomarker for predicting the risk of Alzheimer's disease in a subject, wherein the ADAMTS1 gene polymorphism includes the dupT insertion mutation (i.e., rs3838078) at position 268474067415 of human chromosome 26.

[0011] In a specific embodiment, the present invention provides the use of the ADAMTS1 gene polymorphism in a sample containing the subject's DNA as a biomarker for predicting the risk of Alzheimer's disease in the subject.

[0012] In a specific embodiment, the sample containing DNA includes but is not limited to blood, serum, plasma, urine, saliva, semen, cerebrospinal fluid, mucus, lymph fluid, ascites, pleural effusion, amniotic fluid, bladder wash fluid, tracheal wash fluid, hair, feces. Preferably, DNA is extracted from the sample and then the ADAMTS1 gene polymorphism is detected.

[0013] The method for extracting DNA is not particularly limited, and known methods can be used for extraction. For example, the phenol / chloroform method, cetyltrimethylammonium bromide (CTAB) method, etc. can be mentioned. Commercially available kits can be used for DNA extraction.

[0014] One or more SNPs can be detected at the ADAMTS1 locus using known SNP detection methods. For example, direct sequencing method, polymerase chain reaction (PCR) method, restriction fragment length polymorphism (RFLP) method, hybridization method, TaqMan (registered trademark) PCR method. Methods using mass spectrometry, etc. can be mentioned.

[0015] On the other hand, the present invention provides the use of one or more primers and / or probes for detecting the ADAMTS1 gene polymorphism in the preparation of a kit for predicting the risk of Alzheimer's disease in a subject, wherein the ADAMTS1 gene polymorphism is selected from the dupT insertion mutation (i.e., rs3838078) at position 268474067415 of human chromosome 26.

[0016] As used herein, the term "gene polymorphism" refers to a locus of a gene in a population where there are several alleles with the same fitness, and this locus is called a polymorphic locus.

[0017] As used herein, "dupT insertion mutation at position 268474067415 of human chromosome" refers to the polymorphism with the accession number rs3838078 in the NCBI SNP database, where there are two genotypes: a double-base insertion of T (TT) or a single-base insertion of T (T) at position 268474067415 of human chromosome.

[0018] On the other hand, the present invention provides a kit for predicting the risk of Alzheimer's disease in a subject, the kit comprising one or more primers and / or probes for detecting ADAMTS1 gene polymorphism. Preferably, the ADAMTS1 gene polymorphism includes the dupT insertion mutation at position 268474067415 of human chromosome.

[0019] On the other hand, the present invention provides an in vitro method for predicting the risk of Alzheimer's disease in a subject, the method comprising:

[0020] 1) Obtaining a sample containing the subject's DNA,

[0021] 2) Optionally, extracting DNA from the sample, and

[0022] 3) Detecting the ADAMTS1 gene polymorphism in the sample, the ADAMTS1 gene polymorphism including the dupT insertion mutation at position 268474067415 of human chromosome.

[0023] In the method of the present invention, if the subject has the following genotype in the ADAMTS1 gene, then the subject has a higher risk of developing Alzheimer's disease: a TT base insertion at position 268474067415 of human chromosome (i.e., rs3838078-TT genotype); or, if the subject has the following genotype in the ADAMTS1 gene, then the subject has a lower risk of developing Alzheimer's disease: T at position 268474067415 of human chromosome (i.e., rs3838078-T genotype).

[0024] The present invention will be further described by the following specific embodiments, but it is not intended to limit the present invention. The following provides the specific materials used in the embodiments of the present invention and their sources. However, it should be understood that these are merely exemplary and are not intended to limit the present invention. Materials having the same or similar types, models, qualities, properties or functions as the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. Specific Embodiments

[0025] Example 1. Collection and Preservation of Samples

[0026] The AD patients and healthy controls were Chinese Han patients or healthy subjects of corresponding age and gender from Peking Union Medical College Hospital. There were 518 patients and 493 healthy subjects in total. Informed consent forms were signed before the experiment began.

[0027] All subjects took 10 ml of fasting morning blood, which was collected in an EDTA anticoagulant tube and centrifuged at 800 g for 10 min. The upper plasma was aliquoted into 1.5 ml EP tubes and centrifuged at 12,000 g for 5 minutes using a Thermo SORVALL 21R cryogenic centrifuge to remove cell debris. The upper plasma was then aliquoted into 0.6 ml EP tubes and stored at -20 °C in a Thermo-UGL2320V refrigerator. The remaining blood cells were separated into monocytes and other blood cell components using lymphocyte separation medium and stored in liquid nitrogen.

[0028] Example 2. Extraction and Quantification of Peripheral Blood Genomic DNA

[0029] 1) Extraction of Peripheral Blood Genomic DNA

[0030] i) Put the blood sample into a 50 ml centrifuge tube, add 5 - 10 times the volume of ddH2O, mix well, and ice-bath for 10 min to make the solution clear and transparent.

[0031] ii) Centrifuge at 3500 rpm at 4 °C for 15 min, aspirate and discard the supernatant, and retain the bottom precipitate.

[0032] iii) Digest proteins. Add to each tube of precipitate:

[0033] 15 mM TES 5 ml

[0034] 10% SDS 250 μl

[0035] 10 mg / ml Protease K 25 μl

[0036] Mix the system, digest it in a water bath at 50 °C for 2 h, and digest it overnight in a water bath at 37 °C.

[0037] iv) Remove the protein in the system

[0038] a. Take out the centrifuge tube from the water bath, ice-bath for 5 min, add an equal volume of Tris-saturated phenol to each tube, and mix well at room temperature for 5 min.

[0039] b. Centrifuge at 3500 rpm for 15 min at 4 °C, and aspirate the upper aqueous phase into a new centrifuge tube.

[0040] c. Repeat steps a and b once each.

[0041] d. Add an equal volume of chloroform:isoamyl alcohol (24:1) to each centrifuge tube, and mix well at room temperature for 5 min.

[0042] e. Centrifuge at 3500 rpm for 5 min at 4 °C, and aspirate the upper aqueous phase into a new centrifuge tube.

[0043] f. Repeat steps d and e once each.

[0044] v) Precipitate DNA

[0045] a. Transfer the supernatant to a sterilized beaker, add 2.5 times the volume of 95% cold ethanol, and ice-bath for 20 min to cause most of the DNA to condense into flocs.

[0046] b. Pipette the liquid, let it stand for 10 - 15 min to cause the remaining DNA to also condense into flocs.

[0047] c. Gently shake the beaker to make the condensed DNA form into a mass.

[0048] vi) Collect DNA

[0049] a. Aspirate the DNA precipitate and wash it with 75% cold ethanol.

[0050] b. Aspirate the DNA precipitate into a 1.5 ml Eppendorf tube and remove the excess ethanol in the tube.

[0051] c. Seal it with a sealing film, pierce several small holes, and dry it at room temperature for 30 min or aspirate it with a vacuum centrifugal pump for 5 min.

[0052] d. Add 0.5 ml of TE to each tube to dissolve the DNA.

[0053] e. Store all DNA samples at -20 °C in a Thermo-UGL2320V refrigerator for long-term storage.

[0054] 2) Quantification of DNA

[0055] The DNA was quantified and its purity was determined using a NanoDrop ND1000 produced by Thermo Scientific, USA.

[0056] Example 3. Detection of Susceptibility Loci of the ADAMTS1 Gene

[0057] 1) Detection of Risk Loci on the ADAMTS1 Gene

[0058] The genes on ADAMTS1 of AD patients and controls were detected by the method of PCR gene amplification + first-generation sequencing.

[0059] The primer information for the rs3838078 locus is as follows:

[0060] Forward primer: GTACGGATGGCTTTGCCTTCAAGC (SEQ ID NO:1)

[0061] Reverse primer: GTCTCTTGGTTGGCTCCAAGTAG (SEQ ID NO:2)

[0062] The detection results were determined by Sanger sequencing, and it was found that there were two genotypes at rs3838078, T and TT, namely the dupT insertion mutation.

[0063] 2) Statistical Analysis

[0064] The Kolmogorov-Smirnov test was used to analyze the normal distribution of each group of data. The OR value was used to analyze and evaluate the predictive power of the risk locus combination for Alzheimer's disease patients.

[0065] 3) Results of SNPs on the ADAMTS1 Gene

[0066] The results of the single nucleotide polymorphism locus detection on the ADAMTS1 gene are shown in Table 1 below:

[0067]

[0068] In Table 1 above, Position represents the chromosome position information; m / M represents the minor allele / major allele; Case Count represents the number of patients carrying the minor allele / major allele; Case MAF represents the minor allele frequency of patients; Control Count represents the number of controls carrying the minor allele / major allele; Control MAF represents the minor allele frequency of controls; OR represents the odds ratio; 95% CI represents the 95% confidence interval; P: statistical P value, and <0.05 is considered to have a significant difference.

[0069] As can be seen from Table 1, we detected the single nucleotide polymorphism sites on the ADAMTS1 gene and found that there was a significant difference in the frequencies of the dupT polymorphism site at position 268474067415 (i.e., rs3838078) of the ADAMTS1 gene between AD patients and controls. The OR value = 1.5, which can significantly increase the risk of AD in patients. Sequence Listing <110> Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences <120> Use of ADAMTS1 Gene Polymorphism for Predicting the Risk of Alzheimer's Disease <130> 310123CG <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(24) <223> Forward primer <400> 1 gtacggatgg ctttgccttc aagc 24 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(23) <223> Reverse primer <400> 2 gtctcttggt tggctccaag tag 23

Claims

1. Use of one or more primers and / or probes for detecting polymorphisms of the ADAMTS1 gene in the preparation of a kit for predicting the risk of Alzheimer's disease in a subject, wherein the polymorphism of the ADAMTS1 gene is the polymorphism shown by rs3838078, and if the subject has the following genotype in the ADAMTS1 gene, then the subject has a high risk of developing Alzheimer's disease: the polymorphism shown by rs3838078 is dupT.

2. The use according to claim 1, wherein the polymorphism of the ADAMTS1 gene is obtained by detecting a sample containing the DNA of the subject.

3. The use according to claim 2, wherein the sample containing the DNA of the subject is one or more samples selected from the following: blood, serum, plasma, urine, saliva, semen, cerebrospinal fluid, mucus, lymph fluid, ascites, pleural effusion, amniotic fluid, bladder washings, tracheal washings, hair, and feces.