L-threonine-producing strain, method for constructing the same, and use thereof

By introducing the R77P mutation into the creC gene of Escherichia coli, a CreC protein variant strain MHZ-0221-4 was constructed, optimizing the threonine production pathway and solving the problems of slow growth and excessive byproducts caused by traditional mutagenesis breeding, thus achieving a significant improvement in L-threonine production capacity.

CN115572717BActive Publication Date: 2026-03-24HEBEI MEIHUA MSG GRP CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202110761641.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-07-06
Publication Date
2026-03-24
Estimated Expiration
2041-07-06

AI Technical Summary

Technical Problem

Traditional mutagenesis breeding results in slow growth and numerous byproducts in L-threonine-producing strains, making it difficult to obtain high-yielding strains and failing to meet the ever-increasing global demand.

Method used

By introducing the R77P mutation into the creC gene of Escherichia coli, a CreC protein variant was generated, the threonine production pathway was optimized, and the CreC protein mutant strain MHZ-0221-4 was constructed using genetic engineering to enhance the threonine synthesis capacity.

Benefits of technology

The modified strain MHZ-0221-4 significantly improved the production and conversion rate of L-threonine. The average conversion rate of the modified strain MHZ-0221-4 was increased by 4.39% in shake flasks, and the threonine yield was higher than that of the control strain. The mutation site had no effect on the fermentation yield of other amino acids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The application provides an L-threonine production strain and a construction method and application thereof. The production strain is obtained by introducing a mutation into a genome of a bacterium with threonine production capacity by using genetic engineering means, so that the CreC protein coded by the genome comprises an R77P mutation site. Flask fermentation experiments show that the L-threonine yield of the Escherichia coli MHZ-0221-4 is higher than that of the control strain MHZ-0215-2, the average conversion rate of the R77P mutant strain MHZ-0221-4 after modification is 20.6%, which is increased by 4.39 percentage points compared with the starting strain. It can be concluded from the flask results that the threonine production capacity of the modified strain is obviously superior to that of the starting strain MHZ-0215-2, so it can be seen that the R77P point mutation of the gene creC can obviously improve the threonine production capacity.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a L-threonine producing strain and a construction method and application thereof. BACKGROUND

[0002] L-threonine is one of the eight essential amino acids for human and animal growth, which is widely used in feed, food additives and drug auxiliary material preparation, etc. At present, L-threonine is mainly produced by microbial fermentation, and various bacteria can be used for L-threonine production, such as wild type induced mutant strains of Escherichia coli, corynebacterium, serratia, etc. as production strains. Specific examples include amino acid analog resistant mutants or methionine, lysine, isoleucine and other various auxotrophs (Japanese patent application publication No. 224684 / 83; Korean patent application publication No. 8022 / 87). However, traditional mutagenesis breeding is not easy to obtain high-yield strains due to slow growth and more by-products caused by random mutation of strains.

[0003] With the increasing demand for threonine worldwide, it is particularly important to construct and modify high-yield threonine strains. In Chinese patent CN03811059.8 applied by CJ Corporation in South Korea in 2003, the expression of key genes thrABC for threonine synthesis was enhanced by deleting the 39bp sequence from -56 to -18 of the threonine operon sequence in Escherichia coli, and the threonine productivity was increased by 22%. Kwang Ho Lee (Kwang Ho Lee et al., Systems metabolic engineering of Escherichia coli for L-threonine production, Mol Syst Biol. 2007; 3: 149) et al. used a system metabolic engineering strategy to remove product feedback inhibition by mutating genes thrA and lysC encoding aspartokinase I and III, to remove byproducts glycine and isoleucine by knocking out tdh and weakening ilvA, and to provide more precursors for threonine synthesis by inactivating competing pathway genes metA and lysA. The TH28C (pBRThrABCR3) strain obtained finally can produce 82.4g / L of acid after 50h of fermentation, with a sugar-acid conversion rate of 39.3%. In Chinese patent ZL201611250306.8 applied by Meihua Group in 2020, the strain MHZ-0215-2 was obtained by strengthening the pntAB gene and heterologous introduction of the pyc gene, and the threonine yield of the strain was 12.4g / L, the conversion rate was about 16.2%, and there was no plasmid burden. The CreBC two-component system is a global sensing regulatory system, and like other global regulatory factors, CreBC affects many different aspects of bacterial physiology. Among them, CreC has an impact on carbon catabolism and intracellular redox state, and also affects the growth and fermentation characteristics of Escherichia coli under low oxygen conditions, and is therefore used for metabolic engineering production of metabolites. SUMMARY

[0004] The purpose of the present application is to provide an L-threonine producing strain and a construction method and application thereof.

[0005] To achieve the purpose of the present application, in a first aspect, the present application provides a CreC protein mutant, which comprises a mutation of the 77th amino acid of the CreC protein from R to P.

[0006] In the present application, the reference sequence number of the CreC protein on NCBI is NP_418816.1.

[0007] In a second aspect, the present application provides a nucleic acid molecule encoding the CreC protein mutant (comprising a CGC→CCC mutation).

[0008] In a third aspect, the present application provides a biological material containing the nucleic acid molecule, which includes but is not limited to recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

[0009] In a fourth aspect, the present application provides any of the following applications of the nucleic acid molecule or the biological material:

[0010] (1) for L-threonine fermentation production;

[0011] (2) for improving L-threonine fermentation yield;

[0012] (3) for constructing L-threonine-producing genetically engineered bacteria.

[0013] In a fifth aspect, the present application provides a method for constructing an L-threonine-producing strain, which introduces a mutation into the genome of a bacteria with threonine production capacity by means of genetic engineering, so that the encoded CreC protein contains an R77P mutation site.

[0014] Preferably, the bacteria is Escherichia, more preferably Escherichia coli, such as strain MHZ-0215-2 (see ZL201611250306.8).

[0015] The method for constructing strain MHZ-0221-4 (creC R77P) includes the following steps:

[0016] A. Construction of pTargetF-N20 (creC R77P) plasmid and Donor DNA

[0017] A1: Using pTargetF plasmid as template, pTF-sgRNA-F / pTF-sgRNA-R primer pair is used to amplify pTF linear plasmid with N20, and the linear plasmid is assembled at 37°C using seamless assembly ClonExpress kit, then Trans1-T1 competent cells are transformed to obtain pTargetF-N20 (creC R77P) plasmid, and PCR identification and sequencing verification are performed; A2: using W3110 genome as template, creC-UF / creC-UR primer pair is used to amplify upstream homologous arm ①; A3: using W3110 genome as template, creC-DF / creC-DR primer pair is used to amplify downstream homologous arm ②; A4: using ① and ② as templates, creC-UF / creC-DR primer pair is used to amplify up-creC-down fragment, also known as Donor DNA.

[0018] Among them, creC in NCBI Gene ID: 948609.

[0019] B. Preparation of competent cells and electroporation

[0020] B1: The pCas plasmid was electroporated into the competent cells of MHZ-0215-2 to obtain positive transformants MHZ-0215-2(pCas); B2: A single colony of MHZ-0215-2(pCas) was picked and inoculated in 5 mL LB medium containing kanamycin and 10 mM arabinose, and incubated at 30°C and 200 r / min until the OD 650 was 0.4; B3: The pTargetF-N20(creCR77P) plasmid was electroporated into the competent cells of MHZ-0215-2(pCas), and then plated on LB plates containing spectinomycin and kanamycin, and incubated at 30°C until single colonies were visible.

[0021] C. Verification of recombination

[0022] C1: Colony PCR amplification was performed on the single colony using the primer pair creC-F / creC-R; C2: The amplification product was sequenced to verify the integrity of the sequence.

[0023] D. Construction of related plasmid loss

[0024] D1: The correct single colony verified by sequencing was inoculated in 5 mL LB medium containing kanamycin and 0.5 mM IPTG, and incubated at 30°C overnight, and then streaked on LB plates containing kanamycin; D2: Single colonies were picked and plated on LB plates containing kanamycin, spectinomycin, and LB plates containing only kanamycin, and incubated at 30°C overnight. If the colonies could not grow on the LB plates containing kanamycin and spectinomycin, but grew on the LB plates containing only kanamycin, it indicated that the pTargetF-N20(creCR77P) plasmid had been lost; D3: Positive colonies in which the pTargetF-N20(creCR77P) plasmid had been lost were picked and inoculated in LB medium without antibiotics, and incubated at 42°C for 8 h, and then streaked on LB plates and incubated at 37°C overnight; D4: Single colonies were picked and plated on LB plates containing kanamycin and LB plates without antibiotics. If the colonies could not grow on the LB plates containing kanamycin, but grew on the LB plates without antibiotics, it indicated that the pCas plasmid had been lost, and the L-threonine production strain MHZ-0221-4(creCR77P) was obtained.

[0025] The primer sequences used in the above method are as follows:

[0026] pTF-sgRNA-F: 5'-AGTCGCCCGTTTCGCGCCAATATGTTTTAGAGCTAGAAATAGCAA-3'

[0027] pTF-sgRNA-R: 5′-ATATTGGCGCGAAACGGGCGACTAGTATTATACCTAGGACTGAGCTAGCT-3′

[0028] N20-F: 5′-TCGCCCGTTTCGCGCCAATATG-3′

[0029] creC-UF: 5′-AATGAACCCGCGGCGCAGATC-3′

[0030] creC-UR: 5′-TAATGCCACCGATATTGGCGCGAAACGGGGGATGTTGTAGCTGATTAAACGCCTG-3′

[0031] creC-DF: 5′-CAGGCGTTTAATCAGCTACAACATCCCCCGTTTCGCGCCAATATCGGTGGCATTA

[0032] creC-DR: 5′-CAGCGCCTGCGCGAGTTTACG-3′

[0033] creC-F: 5′-ACCTTACTGCGTCGGGTGAAG-3′

[0034] creC-R: 5′-AATGCGTAAACATACTGCTC-3′.

[0035] In a sixth aspect, the present invention provides an L-threonine-producing strain constructed according to the above method.

[0036] In a seventh aspect, the present invention provides the application of the L-threonine producing strain in the fermentation production of L-threonine or in increasing the yield of L-threonine fermentation.

[0037] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0038] This invention uses MHZ-0215-2 as the starting strain and modifies its genome by introducing a point mutation in the creC gene to generate the CreC protein variant (R77P). The threonine-producing *E. coli* strain containing the CreC variant was subjected to shake-flask fermentation. The results showed that the L-threonine production of *E. coli* MHZ-0221-4 was higher than that of the control strain MHZ-0215-2. The average conversion rate of the modified R77P mutant strain MHZ-0221-4 was 20.6%, an increase of 4.39 percentage points compared to the starting strain. The shake-flask results indicate that the threonine production capacity of the modified strain is significantly better than that of the starting strain MHZ-0215-2, demonstrating that the R77P point mutation in the creC gene can significantly improve threonine production capacity. Detailed Implementation

[0039] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions.

[0040] In the following examples, MHZ-0215-2 (ZL201611250306.8) was used as the starting strain. Based on the metabolic pathway of L-threonine in Escherichia coli and the genetic background of the starting strain MHZ-0215-2, relevant modifications were made to its genome to enhance the expression of genes regulated by creBC. Specifically, the arginine (R) at position 77 of creC was mutated to proline (P) (CGC→CCC). This mutation site may affect carbon catabolism and intracellular redox status, thereby promoting bacterial growth and metabolism.

[0041] The genome editing of Escherichia coli mainly refers to the CRISPR-Cas9 gene editing technology reported by Jiang Y et al. (Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Jiang Y, Chen B, et al. Appl. Environ Microbiol, 2015).

[0042] In the following examples, the final concentration of kanamycin and spectinomycin in the culture medium was 50 μg / mL.

[0043] All reagents used in the following examples are commercially available. The parent strain of the high-conversion threonine production strain provided by this invention is MHZ-0215-2, belonging to W3110 (Escherichia spp.).

[0044] The primer sequences involved in this invention are shown in Table 1.

[0045] Table 1

[0046]

[0047] Example 1: Construction of strain MHZ-0221-4 (creC point mutation R77P) to enhance the genes regulated by creBC.

[0048] (1) Construction of pTargetF-N20(creC R77P) plasmid and Donor DNA

[0049] Step 1: Using pTargetF plasmid as a template (from the literature Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Jiang Y, Chen B, et al. Appl. Environ Microbiol, 2015), a pTF linear plasmid containing N20 was amplified using the pTF-sgRNA-F / pTF-sgRNA-R primer pair. This linear plasmid was then assembled at 37°C using the seamless assembly ClonExpress kit, followed by transformation into Trans1-T1 competent cells to obtain pTargetF-N20 (creC R77P), and perform PCR identification and sequencing verification; Step 2: Using the W3110 genome as a template, amplify the upstream homologous arm ① using the creC-UF / creC-UR primer pair; Step 3: Using the W3110 genome as a template, amplify the downstream homologous arm ② using the creC-DF / creC-DR primer pair; Step 4: Using ① and ② as templates, amplify the up-creC-down fragment, also known as Donor DNA, using the creC-UF / creC-DR primer pair.

[0050] (2) Preparation and electroporation of competent cells

[0051] Step 1: Electroporate the pCas plasmid (from the literature Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Jiang Y, Chen B, et al. Appl. Environ Microbiol, 2015) into MHZ-0215-2 competent cells (transformation method and competent cell preparation method are both from Molecular Cloning III); Step 2: Pick a single colony of MHZ-0215-2 (pCas) and place it in a 5 mL LB tube containing kanamycin and 10 mM arabinose, and incubate at 30℃ and 200 rpm until OD. 650 After 0.4, prepare electroporation competent cells (the method for preparing competent cells is as described in Molecular Cloning III). Step 3: Electroporate the pTargetF-N20 (creC R77P) plasmid into MHZ-0215-2 (pCas) competent cells (electroplation conditions: 2.5kV, 200Ω, 25μF), spread them on LB agar plates containing spectinomycin and kanamycin, and incubate at 30℃ until single colonies are visible.

[0052] (3) Recombination verification

[0053] Step 1: Use primer pair creC-F / creC-R to perform colony PCR amplification on the above single colony; Step 2: Send the amplification product for sequencing to verify the integrity of the sequence.

[0054] (4) Construction of related plasmids lost

[0055] Step 1: Select a single colony that has been correctly sequenced and inoculate it into a 5 mL LB tube containing kanamycin and 0.5 mM IPTG. Incubate overnight at 30°C and then streak it onto an LB agar plate containing kanamycin. Step 2: Select a single colony and spot it onto LB agar plates containing kanamycin, spectinomycin, and kanamycin only. Incubate overnight at 30°C. If the colony does not grow on LB agar plates containing kanamycin or spectinomycin, but grows on LB agar plates containing kanamycin, it indicates that the pTargetF-N20(creCR77P) plasmid has been lost. Step 3: Select a single colony from the pTargetF-N20(creCR77P) plasmid. Positive colonies with the loss of the R77P plasmid were inoculated into antibiotic-free LB tubes, incubated at 42°C for 8 hours, and then streaked onto LB plates and incubated overnight at 37°C. Step 4: Single colonies were picked and dotted onto LB plates containing kanamycin and LB plates without antibiotics. If the colonies could not grow on LB plates containing kanamycin but grew on LB plates without antibiotics, it indicated that the pCas plasmid was lost, and strain MHZ-0221-4 (creC R77P) was obtained.

[0056] The threonine-producing genetically modified strains obtained in Example 1 are shown in Table 2.

[0057] Table 2 Genetically engineered bacteria constructed in this invention

[0058]

[0059] Example 2: Shake-flask fermentation experiment of L-threonine-producing genetically engineered bacteria

[0060] Step 1: Take two strains, MHZ-0215-2 and MHZ-0221-4, from the cryopreservation tubes, streak them on LB agar plates for activation, and incubate at 37°C for 24 hours; Step 2: Scrape a loopful of bacterial cells from the agar plate and inoculate it into a shake flask containing 50 mL of seed culture medium (Table 3). Incubate at 37°C and 180 rpm for approximately 5 hours to allow OD to develop. 650 Control the concentration to within 2; Step 3: Transfer 1 mL of seed culture to a shake flask containing 50 mL of fermentation medium (Table 4), and ferment on a shaker at 37°C and 115 rpm until the residual sugar is exhausted. After fermentation, measure the OD of the sample. 650 The L-threonine content was determined by HPLC, and the residual sugar content was determined by a biosensor method. To ensure the reliability of the experiment, the shake flasks were repeated three times, and the average values ​​of the acid production and conversion rate are shown in Table 5.

[0061] Table 3 Seed culture medium (g / L)

[0062] Ingredients Concentration Glucose 30 Corn steep liquor 25 Soybean hydrolysate 7 Yeast extract 4 KH2PO4 2 Magnesium sulfate heptahydrate 0.6 FeSO4, MnSO4 20 mg / L pH 7.0

[0063] Table 4 Fermentation medium (g / L)

[0064] Ingredients Concentration Glucose 70 Corn steep liquor 9 Soybean hydrolysate 9 Magnesium sulfate heptahydrate 1.2 KH2PO4 1.5 Aspartic acid 10 FeSO4 30 mg / L MnSO4 30 mg / L Thiamine 500 μg pH 7.0

[0065] Table 5 Comparison of productivity of threonine-producing genetically engineered bacteria

[0066]

[0067]

[0068] As shown in Table 5, the L-threonine production of the novel *Escherichia coli* MHZ-0221-4 described in this invention is higher than that of the control strain MHZ-0215-2. The average conversion rate of the modified R77P mutant strain MHZ-0221-4 in shake flasks was 20.60%, which is 4.39 percentage points higher than that of the original strain. The shake flask results at this site indicate that the threonine production capacity of the modified strain is significantly better than that of the original strain MHZ-0215-2. Therefore, the R77P point mutation in the creC gene can significantly improve the threonine production capacity.

[0069] If W3110 is used as the starting strain and the same mutation is introduced, the threonine production capacity of the recombinant strain W3110-creC(R77P) is also enhanced. The average sugar-acid conversion rate of the recombinant strain is 10.4%, which is 4.2 percentage points higher than that of the wild-type W3110, and the threonine production is increased by about 67.7%.

[0070] The results showed that the introduction of the mutation site R77P had no effect on the fermentation yield of other amino acids (such as serine and tyrosine).

[0071] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Application of L-threonine-producing strains in L-threonine fermentation production or to increase L-threonine fermentation yield; The method for constructing the L-threonine-producing strain includes: Using genetic engineering techniques, a mutation was introduced into the genome of a bacterium capable of producing threonine, causing its encoded CreC protein to contain the R77P mutation site; the reference sequence number of the CreC protein on NCBI is NP_418816.

1. The bacteria is Escherichia coli (E. coli) Escherichia coli MHZ-0215-2.

Citation Information

Patent Citations

  • Recombinant strains, their preparation methods, and methods for producing L-threonine

    CN106635945B

  • Nucleotide sequence of threonine operon irrepressible by isoleucine and method for producing L-threonine using transformed host cell containing the same

    CN1297665C

  • Recombinant strain and preparation method thereof and method for producing L-threonine

    CN106635945A