Application of PRSS56 protein expression and enzyme activity regulation in myopia treatment

Abstract

The present invention relates to the application of PRSS56 protein expression and enzyme activity regulation in myopia treatment. The present invention uses a method for whole-genome linkage analysis, haplotype analysis, whole-genome sequencing combined with Sanger sequencing verification to detect and verify pathogenic sites for two large families with hereditary high myopia and 236 cases of early-onset high myopia in children. Combined with the family's genetic pattern, mutant gene frequency and animal model data, it is confirmed that mutations in the upstream promoter region of the PRSS56 gene translation start c.-187G>T, c.-187G>C, c.-297C>T, c.-378G>A, c.-382C>T and c.-421G>A can lead to the occurrence of hereditary high myopia, and the mutation is an autosomal heterozygous mutation. Based on this, a hereditary high myopia screening kit and a high myopia animal model for detecting the above mutation sites are provided. The application of the animal model and the kit of the present invention can provide a scientific basis for the early diagnosis, differential diagnosis and drug treatment of hereditary high myopia, which is conducive to early prevention and treatment and improves the quality of life of patients.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and more specifically, to detecting PRSS56 gene-related mutations in genomic DNA extracted from patients' peripheral blood for assessing the risk of developing hereditary high myopia, and constructing a mouse model of hereditary high myopia by intravitreal injection of adeno-associated virus AAV-Prss56. Background Art

[0002] Myopia, the most common eye disease in the world, primarily occurs during adolescence. It manifests as excessive elongation of the eyeball, causing distant objects to focus on the retina, ultimately leading to blurred vision. According to statistics, the number of myopic people in my country exceeds 600 million, and the myopia rate among adolescents exceeds 50%. Myopia can be divided into refractive myopia and axial myopia based on the refractive component. Based on the degree of myopia, myopia can be divided into mild myopia (≤300 degrees), moderate myopia (300 to 600 degrees), and high myopia (>600 degrees). Most cases of myopia are related to excessive axial growth of the eye, manifesting as an imbalance in eye growth. In medicine, an axial length exceeding 26mm is generally classified as high myopia, at which point the risk of glaucoma and cataracts increases significantly. Based on the age of onset, myopia can be divided into congenital, preschool, adolescent, and adult-onset forms, with adolescent-onset being the most common form in my country. Congenital myopia, also known as hereditary myopia, first appears in infancy, and most hereditary myopia is high. Genetics play a crucial role in the development of myopia. Studies have found that the earlier the onset of myopia, the greater the contribution of genetic factors. The heritability of high myopia is approximately 0.65-0.68.

[0003] Results from numerous large-scale family surveys and epidemiological studies have shown that hereditary high myopia often clusters in families, exhibiting a monogenic dominant inheritance pattern. To date, numerous genome-wide linkage analyses and genome-wide association studies (GWAS) of myopia or related phenotypes (pathological myopia, refractive error, and axial length) have identified over 25 myopia-associated loci, one of which is the PRSS56 gene. The PRSS56 gene, short for serine protease 56, is located on chromosome 2, region 2q37.1, within the myopia-associated locus MYP12. The PRSS56 protein it encodes has been identified as a secreted protein with serine protease activity. Studies have shown that homozygous frameshift mutations in PRSS56 can cause angle-closure glaucoma or microphthalmia through related molecular mechanisms.

[0004] The Chinese journal "International Ophthalmology Review", Volume 44, Issue 3, 2020, published a paper titled "Relationship between Eye Development-Related Genes and Primary Angle-Closure Glaucoma", which disclosed that sequence variations in extracellular matrix metalloprotease (MMP) genes and MMP regulatory genes (such as HSP70, eNOS, MTHFR), true microphthalmia-related genes (MFRP, PRSS56), axial length and refractive power-related genes (HGF, MYOC), and anterior chamber depth-related genes (ABCC5) may be related to susceptibility to primary angle-closure glaucoma (PACG). Membrane frizzled-related protein (MFRP) is expressed in the ciliary epithelium and retinal pigment epithelium and is related to scleral growth and differentiation.

[0005] The Young Scientists Fund project, "Identification of a Novel Pathogenic Gene in a Family with High Myopia and Study of Its Pathogenic Mechanism," concluded on December 31, 2018. The project identified PRSS56 as a potential causative gene for high myopia, with mutations in this gene contributing approximately 0.75% to the risk of high myopia in the population. Using endogenous iPS cells and in vitro dual-luciferase reporter assays, the researchers found that a mutation in the PRSS56 promoter leads to overexpression of the PRSS56 gene. CRISPR-Cas9-generated KI mice expressing -144G>T revealed that this mutation also leads to overexpression of the PRSS56 gene. These results suggest that the PRSS56 gene is involved in early ocular development, and that elevated expression can cause ocular abnormalities, leading to early-onset high myopia. The discovery of PRSS56, a novel causative gene for high myopia, provides a solid foundation for genetic diagnosis, clinical intervention options, and drug target development.

[0006] However, there is no literature report on the impact of the newly discovered mutation sites in the non-coding region and promoter region of the PRSS56 gene on hereditary high myopia. Summary of the Invention

[0007] The inventors of the present application discovered new pathogenic genes and mutation sites for hereditary high myopia through whole-genome linkage analysis, haplotype analysis, and whole-genome analysis combined with Sanger sequencing verification, and completed the present invention based on this.

[0008] In a first aspect, the present invention provides an isolated nucleic acid molecule encoding a mutant or a fragment thereof, wherein the nucleic acid molecule or the fragment thereof is selected from any one of the following:

[0009] a) has a PRSS56 c.-187G>T mutation compared to the PRSS56 gene;

[0010] b) having a PRSS56 c.-187G>C mutation compared to the PRSS56 gene;

[0011] c) having a PRSS56 c.-297C>T mutation compared to the PRSS56 gene;

[0012] d) having a PRSS56 c.-378G>A mutation compared to the PRSS56 gene;

[0013] e) having a PRSS56 c.-382C>T mutation compared to the PRSS56 gene;

[0014] f) Compared with the PRSS56 gene, it has the PRSS56 c.-421G>A mutation.

[0015] In a second aspect, the present invention provides a kit for screening biological samples for axial myopia, comprising: a reagent suitable for detecting PRSS56 gene mutants, wherein the mutant has a PRSS56 c.-187G>T mutation compared to the PRSS56 gene, a PRSS56 c.-187G>C mutation compared to the PRSS56 gene, a PRSS56 c.-297C>T mutation compared to the PRSS56 gene, a PRSS56 c.-378G>A mutation compared to the PRSS56 gene, a PRSS56 c.-382C>T mutation compared to the PRSS56 gene, and a PRSS56 c.-421G>A mutation compared to the PRSS56 gene.

[0016] The kit also includes primers for detecting the c.-187G>T mutation, c.-187G>C mutation, c.-297C>T mutation, c.-378G>A mutation, c.-382C>T mutation or c.-421G>A mutation of the PRSS56 gene, and the primers are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0017] The axial myopia described is hereditary high myopia.

[0018] Use of any of the above kits in the preparation of a kit for detecting hereditary high myopia.

[0019] In a third aspect, the present invention provides primer pairs for detecting the c.-187G>T mutation, c.-187G>C mutation, c.-297C>T mutation, c.-378G>A mutation, c.-382C>T mutation or c.-421G>A mutation of the PRSS56 gene as shown in SEQ ID NO:4 and SEQ ID NO:5.

[0020] The primer pair is used in the preparation of a detection reagent, which can detect the PRSS56 c.-187G>T mutation site, c.-187G>C mutation site, c.-297C>T mutation site, c.-378G>A mutation site, c.-382C>T mutation site or c.-421G>A mutation site associated with hereditary high myopia.

[0021] In a fourth aspect, the present invention provides an animal model of high myopia, which is constructed by the following method: the overexpression gene mouse Prss56 DNA sequence is packaged and injected into the cells in the vitreous cavity by adeno-associated virus type 2, and the animal is a newborn mouse.

[0022] In a fifth aspect, the present invention provides the use of a mutated PRSS56 gene in the development of therapeutic targets and in assessing the risk of developing hereditary high myopia, wherein the patient has a PRSS56 c.-187G>T mutation, a PRSS56 c.-187G>C mutation, a PRSS56 c.-297C>T mutation, a PRSS56 c.-378G>A mutation, a PRSS56 c.-382C>T mutation or a PRSS56 c.-421G>A mutation.

[0023] The upstream promoter sequence of the PRSS56 gene is shown in SEQ ID NO: 1.

[0024] The PRSS56 gene sequence (human) is shown in SEQ ID NO: 2.

[0025] The PRSS56 gene sequence (mouse) is shown in SEQ ID NO: 3.

[0026] The PRSS56 gene, short for serine protease 56, is located on chromosome 2 at region 2q37.1, within the myopia-associated locus MYP12. The PRSS56 protein it encodes has been identified as a secreted serine protease. The inventors used genome-wide linkage analysis, haplotype analysis, and whole-genome analysis combined with Sanger sequencing to identify and validate the causative loci in two large pedigrees with hereditary high myopia and 236 cases of early-onset high myopia in children. Combining the pedigrees' inheritance patterns, mutant gene frequencies, and animal model data, the inventors confirmed that mutations in the PRSS56 c.-187G>T, c.-187G>C, c.-297C>T, c.-378G>A, c.-382C>T, and c.-421G>A regions upstream of the translation start promoter of the PRSS56 gene can cause hereditary high myopia. The mutation point is -187G>T / C (-187 refers to the translation start site ATG (the upstream promoter sequence of the PRSS56 gene is shown in SEQ ID NO: 1) and is 187 positions above), the mutation point is c.-297C>T (-297 refers to the translation start site ATG (the upstream promoter sequence of the PRSS56 gene is shown in SEQ ID NO: 1) and is 297 positions above), and the other mutation sites are c.-378G>A, c.-382C>T and c.-421G>A and so on.

[0027] Herein, the type of "nucleic acid molecule" is not particularly limited and can be any polymer containing deoxyribonucleotides and / or ribonucleotides corresponding to the gene encoding the mutant, including but not limited to DNA, RNA or cDNA. It should be understood by those skilled in the art that the nucleic acid actually includes any one or both of the complementary double strands. For convenience, in this specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually also disclosed. For example, when referring to SEQ ID NO: 1, its complementary sequence is actually included. Those skilled in the art will also understand that one strand can be used to detect the other strand, and vice versa.

[0028] The type of the "biological sample" is not particularly limited, as long as a nucleic acid sample reflecting whether a mutation exists in the biological sample can be extracted from the biological sample. According to an embodiment of the present invention, the biological sample can be at least one selected from human blood, skin, and subcutaneous tissue, preferably peripheral blood. Thus, sampling and detection can be conveniently performed, thereby further improving the efficiency of screening biological samples susceptible to DCM. According to an embodiment of the present invention, the term "nucleic acid sample" used herein should be understood in a broad sense, and it can be any sample that can reflect whether a mutation exists in a biological sample, for example, it can be whole genome DNA directly extracted from a biological sample, or it can be a part of the whole genome containing a pathogenic gene coding sequence, it can be total RNA extracted from a biological sample, or it can be mRNA extracted from a biological sample.

[0029] The advantages of the present invention are:

[0030] This study discovered new pathogenic genes and mutation sites for hereditary high myopia through whole-genome linkage analysis, haplotype analysis, and whole-genome analysis combined with Sanger sequencing verification. These include: PRSS56 c.-187G>T mutation, c.-187G>C mutation, c.-297C>T mutation, c.-378G>A mutation, c.-382C>T mutation, and c.-421G>A mutation. These can be used to screen carriers of autosomal hereditary high myopia pathogenic mutations and for molecular diagnosis of patients, providing a scientific basis for the early diagnosis, differential diagnosis, and drug treatment of hereditary high myopia. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Attachment Figure 1 It is a pedigree map of high myopia families and a sequencing verification map of mutation sites.

[0032] Attachment Figure 2 It is the PRSS56 mutation that enhances promoter activity.

[0033] Attachment Figure 3 It is the PRSS56 mutation that increases gene expression levels.

[0034] Attachment Figure 4 The axial length of the eye is elongated in mice overexpressing PRSS56. DETAILED DESCRIPTION

[0035] Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiments are only used to illustrate the present invention and are not used in limiting the scope of the present invention.In addition, should be understood that after reading the content of the present invention record, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall equally within the scope limited by the application's appended claims.

[0036] Example 1 Analysis and identification of potential pathogenic mutation sites in families with hereditary high myopia and children with early-onset high myopia as PRSS56 c.-187G>T, c.-187G>C, c.-297C>T, c.-378G>A, c.-382C>T and c.-421G>A

[0037] The study subjects were two multi-generational families with hereditary high myopia (Families 1 and 2) and 236 cases of early-onset high myopia in children (onset age less than 6 years old). Family 1 included 11 patients and 11 healthy members (member IV-4 was too young to be accurately identified at this time). Family 2 consisted of 4 patients and 6 healthy members. All family members and children underwent standard ophthalmological examinations and had data such as refraction, intraocular pressure, and axial length measured. Written informed consent was obtained from all participants involved in the study. The collected peripheral blood samples were used for genomic DNA extraction. Genomic DNA was extracted from family members' blood samples using the Tiangen Blood / Cell / Tissue Genomic DNA Extraction Kit and referred to its operating manual. The obtained DNA samples were measured for concentration and quality using NanoDrop 2000 and then stored in a -80°C freezer.

[0038] Whole-genome linkage analysis was performed on the 21 members of Family 1 using the Illumina Human Omni ZhongHua-8 Beadchip (>890,000 SNPs). Whole-genome sequencing (WGS) was performed on the Illumina HiSeq X platform using the Nano DNA library preparation kit. Variant detection, annotation, and database comparison were performed using relevant pipelines to identify candidate pathogenic loci.

[0039] 1. Sanger sequencing verification: Design amplification primers as shown in Table 1:

[0040] Table 1 PCR amplification primer sequences

[0041] Primer name Primer sequence (5'-3') PRSS56seqF CCAGAAGAATCCCACTGCCAG See SEQ ID NO:4 PRSS56seqR GGGTGCCTATCCTTTGGTGC See SEQ ID NO:5

[0042] 2×GC buffer I and Taq HotStart DNA polymerase were used for PCR amplification of the target fragment. The PCR reaction system is shown in Table 2:

[0043] Table 2 Components and dosages of PCR reaction system

[0044] Components Dosage 2×GC buffer I 10 μL dNTP Mix 2μL Primer (F+R, 10 μM) 1.5 μL template 50ng HS-Taq enzyme 0.2μL <![CDATA[ddH2O]]> Fill to 20 μL

[0045] The PCR amplification procedure is as follows:

[0046] Table 3 Temperature control time list for PCR amplification

[0047]

[0048] After purification, the product was sequenced on ABI 3730 Genetic Analyzer.

[0049] The high myopia patients in family 1 showed a dominant inheritance pattern. The family spanned four generations and included 11 hereditary high myopia patients and 12 healthy members ( Figure 1 -A). The proband (Family 1-III-8) is a 6-year-old girl with myopia of -16.00 / -0.75×166 OD (R) and -16.34 / -1.5×21 OS (L). Optical examinations revealed no typical fundus-related pathology. Family member interviews revealed that all 11 affected individuals developed poor vision during childhood.

[0050] By analyzing all members of family 1 (n=21, Figure 1 Linkage analysis of the family was conducted in 2014, when there were only 21 individuals (the other 2 individuals were not yet born and were not included in the calculations). Multi-point nonparametric whole-genome linkage analysis was performed and data from 22 pairs of autosomes were analyzed. We ultimately obtained a maximum logarithm of odds score (LOD score) of 3.81 at rs12621510 on chromosome 2q37.1, while no other regions of the remaining 21 pairs of autosomes had LOD scores greater than 1.20.

[0051] 2. Whole-exome sequencing (WES): Whole-exome sequencing of peripheral blood DNA from family members was performed, and no candidate mutations were found in any known genes on 2q37.1, meeting the filtering criteria of minimal allele frequency (MAF) < 0.001 and the requirement of disease co-segregation.

[0052] 3. Results: Whole genome sequencing (WGS) and Sanger sequencing results confirmed that all patients in family 1 carried the PRSS56 c.-187G>T mutation, while healthy members did not have this mutation; this mutation was the only candidate pathogenic variant site that met the disease co-segregation and population MAF < 0.001.

[0053] In family 2, a mutation at the same site, PRSS56 c.-187G>C, was identified, in which the base mutation G changes to C. A total of 10 family members were sampled, including 4 patients with hereditary high myopia and 6 healthy members ( Figure 1-B). The proband of Family 2 was a four-year-old boy (Family 2-IV-1) with myopia of -17.00 / -1.00×40 (R) and -16.00 / -2.00×150 (L). Relevant optical examination results excluded the presence of other typical ocular diseases. Sanger sequencing analysis of all members of Family 2 revealed that the mutation (PRSS56 c.-187G>C) cosegregated with four patients.

[0054] Sanger sequencing was used to analyze a 603 bp fragment in the upstream promoter region of the PRSS56 gene from 236 sporadic cases of early-onset high myopia in children and 653 healthy controls to screen for mutations that only appeared in the cases. A total of c.-187G>C, c.-297C>T, c.-378G>A, c.-382C>T, and -421G>A mutations were screened. Figure 1 ), the above mutation sites were not found in 653 healthy control samples. They are disease-specific mutation sites, have not been reported in the public database (GnomAD) or have a frequency of less than one thousandth, and are highly conserved in 36 species with advanced vision.

[0055] Example 2 PRSS56 c.-187G>T, c.-187G>C, c.-297C>T, c.-378G>A, c.-382C>T and c.-421G>A mutations enhance promoter activity

[0056] Sanger sequencing was used to analyze a 603 bp fragment in the upstream promoter region of the PRSS56 gene from 236 sporadic cases of early-onset high myopia in children and 653 healthy controls to screen for mutations that only appeared in the cases. A total of c.-187G>C, c.-297C>T, c.-378G>A, c.-382C>T, and -421G>A mutations were screened. Figure 1 ). This fragment was selected and ligated between the two restriction sites upstream of the luc+ gene in the pGL3-Basic plasmid through the NheⅠ and HindⅢ restriction sites.

[0057] The double enzyme digestion reaction system is as follows, and the digestion is carried out at 37°C for 4 hours:

[0058] Table 4 Components and dosages of double enzyme digestion reaction system

[0059] Components Dosage 10×NEBuffer2.1 5μL NheI 1.5 μL HindⅢ 1.5 μL DNA 2.5 μg <![CDATA[ddH2O]]> Fill to 50 μL

[0060] The ligation system is as follows, ligation is carried out at 16°C overnight:

[0061] Table 5 Components and dosage of the connection system

[0062] Components Dosage 10×T4 DNA ligase Buffer 2μL Destination fragment 350ng plasmids 50ng T4 DNA ligase 1 μL <![CDATA[ddH2O]]> Fill to 20 μL

[0063] Plasmid transformation and extraction were then performed. 5 μL of the ligation product was added to 100 μL of DH5α competent cells, incubated on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, and placed on ice for 2 minutes. 400 μL of resistance-free LB medium was added and cultured on a shaker at 37°C for 30-45 minutes. 100 μL was spread on an Amp+ solid medium plate and incubated inverted in a 37°C incubator overnight. Multiple monoclonal colonies were selected and added to a shaker tube containing 5 mL of Amp+LB medium. After incubation at 37°C for 12-14 hours, plasmids were extracted using the Tiangen Rapid Plasmid Miniprep Kit and verified by sequencing.

[0064] At the same time, corresponding point mutation primers (c.-187G>T, c.-187G>C) were designed, and the corresponding point mutation plasmids were constructed by circular PCR.

[0065] The circular PCR reaction system is as follows:

[0066] Table 6 Components and dosages of circular PCR reaction system

[0067] Components Dosage 10×KOD Buffer 5μL 2mM dNTPs 5μL <![CDATA[25mM MgSO4]]> 2μL Primer F+R (10 μM) 1.5 μL plasmid DNA 50ng KOD-Plus (1U / μL) 1 μL <![CDATA[ddH2O]]> Fill to 50 μL

[0068] The reaction conditions were a two-step method with an annealing temperature of 68°C:

[0069] Table 7 Temperature control time list of circular PCR reaction system

[0070]

[0071]

[0072] RPE1 cells were selected for in vitro overexpression, and the Promega Luciferase Reporter System was used to detect promoter region activity. Using Lipofectamine 3000 transfection reagent, 500 ng of PRSS56-WT / MUT / empty plasmid and 10 ng of pRLCMV-Renilla luciferase plasmid were co-transfected into RPE1 cells. Cells were harvested 36 hours after transfection and lysed using a Promega GloMax 96 microplate luminometer.

[0073] The results showed that compared with the wild-type plasmid, the PRSS56 c.-187G>T / C mutation significantly promoted the expression of the luciferase reporter gene. The PRSS56 c.-187G>T / C mutation significantly increased the promoter activity by 21%. In addition, the c.-297C>T, c.-378G>A, c.-382C>T, and -421G>A mutations also increased the expression of the reporter gene to varying degrees. Figure 2 These results largely support our hypothesis that rare mutations in the PRSS56 promoter region can functionally affect the activity of the promoter and thus affect the transcription of PRSS56.

[0074] Example 3 PRSS56 mutation increases gene expression level

[0075] Fresh peripheral blood samples (10 mL) were collected from the patient (Family 1-III-8) and their sibling (Family 1-III-7) in Family 1 for reprogramming and generation of iPS cells. iPSCs were established by IxCell Co., Ltd. (Shanghai, China). Four transcription factors, including OCT3 / 4, SOX2, c-Myc, and KLF4, were transfected into human peripheral blood mononuclear cells by electroporation. After a period of reprogramming, iPSC clones were selected and subjected to standard characterization procedures, including karyotyping for the stem cell markers NANOG, OCT4, and SOX2, immunostaining, and flow cytometry to assess the differentiation status of mesoderm, ectoderm, and endoderm, as well as the levels of exogenous transcription factors. This was done to determine whether iPS cells were successfully established.

[0076] The expression of PRSS56 in cells was detected by real-time fluorescence quantitative PCR, and the cells were collected and RNA was extracted. The steps are as follows:

[0077] (1) Collect cells and add 1 mL of trizol. Mix well on a vortex shaker and let stand for 10 minutes.

[0078] (2) After adding 200 μL of chloroform, shake up and down for 10 seconds, let it stand for 5 minutes, and centrifuge at 13000 rpm for 15 minutes.

[0079] (3) After careful removal, the liquid can be seen to be separated into layers. Carefully aspirate the upper layer of liquid into a new centrifuge tube, add one volume of isopropanol solution (600 μL), mix thoroughly, and centrifuge at 13,000 rpm for 10 minutes.

[0080] (4) Discard the supernatant, add 1 mL of 70% ethanol (diluted with RNase-free ddH2O) for washing, and centrifuge at 13000 rpm for 5 min.

[0081] (5) Repeat step (4).

[0082] (6) Aspirate the supernatant as much as possible, let it dry at room temperature for 5-10 minutes, add 40 μL RNase-free ddH2O to dissolve, measure the concentration, and store at -80℃ until use.

[0083] RNA reverse transcription was performed using the HiScript III RT SuperMix for qPCR first-strand cDNA synthesis kit, and real-time fluorescence quantitative PCR (Quantitative Realtime PCR) was performed using the ChamQ Universal SYBR qPCR MasterMix premix. The system is as follows:

[0084] Table 8 Components and dosages of fluorescence quantitative PCR reaction system

[0085] Components Dosage 2×ChamQ Universal SYBR qPCR Master Mix 10 μL Primer F / R (10 μM) 1 μL Template cDNA 1 μL <![CDATA[ddH2O]]> 8μL

[0086] The instrument used was a Roche LightCycler 480 fluorescence quantitative PCR instrument, and the qPCR reaction conditions were as follows:

[0087] Table 9 Temperature control time list of fluorescence quantitative PCR reaction system

[0088]

[0089] Protein expression was detected by Western blot. At the same time, protein expression was detected by Western blot. Cells were collected and rinsed with 1 mL of PBS solution. An appropriate amount of RIPA protein lysis buffer III (Sangon, Shanghai, China) was added to the cell pellet and lysed on ice for 30 min. The pellet was centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was transferred to a new centrifuge tube, and 1 / 4 volume of 5× protein loading buffer was added. The pellet was boiled in a 95°C metal bath for 8 min before subsequent experiments or storage at −80°C.

[0090] Select an appropriate volume of protein sample for loading, run electrophoresis at 80V for about 30 minutes, adjust the voltage to 100V and continue running until bromophenol blue runs out of the separation gel. After the electrophoresis is completed, remove the protein gel, and place the negative plate of the transfer clamp in the order of sponge, filter paper, protein gel, methanol-activated PVDF membrane, filter paper, and sponge. Make sure there are no bubbles between the gel and the membrane, buckle the transfer clamp and place it in the transfer tank, voltage 100V, and transfer the membrane in an ice water bath for two hours. After the transfer is completed, take out the PVDF membrane, cut it appropriately, and place it in a sealing box containing 5% milk. Place it on a vertical shaker and block it at room temperature for 1 hour. Place it in a diluted TBST solution containing the primary antibody, incubate it on a shaker at 4°C overnight, wash the membrane three times with TBST solution for 6 minutes each time, then add the secondary antibody, incubate it at room temperature for 1 hour, wash the membrane three times with TBST for 6 minutes each time, and then you can expose the bands on the Tianneng chemiluminescence imager.

[0091] Anti-PRSS56 polyclonal antibody was customized by abmart (Shanghai, China), and the polypeptide sequence selected for antibody preparation was GPLTCSEPGPRPRE.

[0092] Observation of the two iPS cell lines revealed no significant differences in cell cycle and cell morphology. RT-qPCR results showed that iPSCs from patients MUT The expression level of PRSS56 mRNA in cells was significantly higher than that in control iPSCs. WT cell( Figure 3 -A); Western blot experiments showed that iPSCs from patients MUT The PRSS56 protein level in the cells was significantly higher than that in the control iPSCs WT cell( Figure 3 -B) Example 4: Axial lengthening of Prss56-overexpressing mice

[0093] 1 Animal Model

[0094] 1.1 Experimental Materials

[0095] AAV adeno-associated virus was prepared by Shanghai Tai Leng Biotechnology Co., Ltd. The mouse overexpression gene Prss56 (NM_027084.2) was selected, the AAV virus type was AAV2 virus, the vector was pAAV2-CMV_bGl-MCS-pA, and a 3×Flag tag was added to the Prss56 sequence. At the same time, the EGFP element was added to the viral vectors of the experimental group and the control group to facilitate subsequent detection of infection efficiency. After the virus was obtained, it was packaged in 10 μL per tube and stored at -80°C for a long time.

[0096] Pregnant mice were prepared at a predetermined mating time and housed individually three days before delivery. Surgical instruments included: microtweezers, microscissors, silicone tubing (0.5 mm inner diameter, 1.5 mm outer diameter), glass capillaries (Drummond Scientific, USA), and microinjection needles (25 μL, Hamilton, USA). A micropipette needle puller was used to pull glass capillaries to make glass injection needles. A schematic diagram of the microinjection apparatus is shown below. Figure 4 -As shown in A.

[0097] 1.2 Experimental steps

[0098] P1 newborn mice were placed on ice and anesthetized under hypothermia, carefully controlling the anesthesia duration to avoid mouse death. The eyelids were gently lifted with microtweezers, and the eyelids and retina were cut open along the palpebral suture with microscissors. The eyes were slightly opened, and a glass injection needle was inserted into the vitreous cavity at a 45° angle along the corneal retinal junction. 0.5 μL of AAV virus solution was injected, and the mice were released after recovery. After the mice reached adulthood (8 weeks), spectral-domain optical coherence tomography (SDOCT) was used for ocular axial length measurement. Before axial length measurement, the mice were anesthetized with either 1.2% ketamine or 1% sodium pentobarbital injected intraperitoneally. After anesthesia, the mice were secured on a measurement platform, and the scanning probe and mouse position were adjusted to obtain appropriate OCT images. Three images were acquired for each eye, and the images were analyzed using MATLAB software to measure various ocular biological parameters.

[0099] Sixteen newborn P1 day wild-type mice were selected for the vitreous cavity injection experiment. The mice were divided into two groups of 8 in each group. Two different viruses were injected into the left and right eyes respectively. That is, 8 mice were injected with AAV-Prss56 virus in the left eye and AAV-Ctrl empty virus in the right eye. Another 8 mice were injected with AAV-Ctrl empty virus in the left eye and AAV-Prss56 virus in the right eye. The axial length of the eyes was measured after culturing for 8 weeks.

[0100] 1.3 Results

[0101] The results showed that the axial length of Prss56-overexpressing mice that were successfully infected with the virus was significantly elongated, showing a high myopia phenotype ( Figure 4 -B).

[0102] This study verified through in vitro and in vivo experiments that PRSS56 overexpression can cause the occurrence of high myopia, and provided a method for constructing a high myopia mouse model; at the same time, through peripheral blood sample sequencing screening of PRSS56 mutations, it was determined that related mutations cause increased gene expression, providing a new strategy for clinical risk assessment of hereditary high myopia.

[0103] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. An isolated nucleic acid molecule encoding a mutant, characterized in that The nucleic acid molecule is the upstream promoter of the PRSS56 gene, and the sequence is shown in SEQ ID NO:

1. Compared with SEQ ID NO: 1, the mutant only has the PRSS56 c.-187G>T mutation.

2. Use of a reagent for screening biological samples for axial myopia in the preparation of a kit for detecting hereditary high myopia, characterized in that: The reagent contains: a reagent suitable for detecting a PRSS56 gene upstream promoter mutant, the PRSS56 gene upstream promoter has a sequence as shown in SEQ ID NO: 1, and the mutant only has a PRSS56 c.-187G>T mutation compared to SEQ ID NO:

1.

3. The use according to claim 2, characterized in that The kit also includes primers for detecting the c.-187G>T mutation of the PRSS56 gene, and the primers are shown in SEQ ID NO:4 and SEQ ID NO:

5.

4. The use according to claim 2 or 3, characterized in that The axial myopia described is hereditary high myopia.

Images