Construction of fluorescent protein-tagged tubulin and microtubule-binding protein universal bivalent vectors
By constructing a universal dual-vector for fluorescently labeled tubulin and microtubule-binding protein, the problem of time-consuming and labor-intensive multi-vector experiments was solved, enabling rapid identification and real-time observation of simultaneous expression of two genes, simplifying the experimental process and shortening the research cycle.
Patent Information
- Application Number
- CN202210953263.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-10
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2042-08-10
AI Technical Summary
In existing technologies, constructing multiple vectors is time-consuming and labor-intensive, it is difficult to express multiple genes simultaneously, the experimental process is complex, the protein interaction research cycle is long, and the identification of transgenic plants is cumbersome and unstable.
A universal bivalent vector for fluorescently labeled tubulin and microtubule-binding protein was constructed. By inserting 35S, mCherry, and NOS sequences into the multiple cloning site of the GFP-αtubulin vector and inserting single nuclease sites at both ends of the mCherry sequence, the co-expression of the two target genes was achieved.
It simplifies the experimental process, shortens the research cycle of protein interactions, and enables real-time observation and localization of tubulin and microtubule-binding proteins through live-cell microscopy, allowing for rapid and accurate identification of transgenic plants.
Smart Images

Figure CN115896146B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular design breeding technology, specifically to the construction of a universal bivalent vector for fluorescently labeled tubulin and microtubule-binding proteins. Background Technology
[0002] Tubulin is a cylindrical polymer mainly composed of heterodimers of α-tubulin and β-tubulin. It participates in various cellular activities such as cell division, intracellular transport, and signal transduction, and is present in almost all eukaryotes. Microtubule-associated proteins (MAPs) are proteins that specifically bind to microtubules and regulate their function.
[0003] Currently, most plant expression vectors insert the target gene at a multiple cloning site, with each vector expressing only one target gene. Therefore, to study the in vivo interactions of multiple proteins, it is necessary to construct multiple vectors, each containing a different target gene. In transient expression studies of protein interactions in tobacco, multiple vectors need to be transformed into Agrobacterium tumefaciens separately, and then these Agrobacterium tumefaciens are mixed and injected into tobacco. This is time-consuming and labor-intensive. Furthermore, because different genes reside on different vectors, cells often only express one gene, requiring the identification of cells simultaneously expressing two genes to study protein interactions, increasing the experimental difficulty. Currently, in stable transformation systems of rice, due to limitations in expression vectors, it is difficult to simultaneously express two target genes in transgenic rice. Generally, it is necessary to insert the two target genes into expression vectors separately, transform them separately, obtain positive lines, and then achieve the expression of both target genes on the same plant through hybridization. This method is time-consuming and labor-intensive. Therefore, constructing expression vectors that simultaneously express two target genes can overcome the above shortcomings, simplify the experimental process, save time and labor, and significantly shorten the cycle of protein interaction research.
[0004] Currently, the identification of transgenic plants generally uses Western blotting, but this method requires specific antibodies to bind to target proteins for detection. It involves multiple steps, including protein extraction, SDS-PAGE gel electrophoresis, membrane transfer, antibody incubation, and color development. This process is cumbersome, demands high skill levels from laboratory personnel, is time-consuming and labor-intensive, antibodies are expensive, and results are unstable. However, fusing the target gene with a fluorescent protein tag allows direct observation of the expression, localization, and real-time dynamics of the target protein within living cells under a microscope. This facilitates convenient and rapid screening of positive transformants and enhances the visualization of experimental results.
[0005] Microtubules, as a crucial member of the cytoskeleton, participate in many important physiological activities during cell growth and development. Microtubules are highly dynamic, constantly undergoing depolymerization and polymerization. Using fluorescently labeled microtubules, live-cell microscopy can be used to visualize and track the subtle dynamics of microtubules in vivo. Furthermore, the excitation and emission wavelengths of GFP and mCherry fluorescent proteins are far apart, avoiding errors caused by overlapping fluorescence signals and accurately reflecting the expression and localization of both proteins. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a universal bivalent vector for fluorescently labeled tubulin and microtubule-binding protein. The first stage involves constructing a GFP-αtubulin vector, and the second stage involves constructing a universal bivalent co-expression vector of GFP-αtubulin-mCherry. Specifically, in the second stage, 35S, mCherry, and NOS sequences are inserted into the KpnI restriction site of the multiple cloning site of the GFP-αtubulin vector constructed in the first stage. Furthermore, single nuclease restriction sites, XbaI, KpnI / Acc65I, and AscI sequences, are inserted into the 5' and 3' ends of the mCherry sequence, respectively, to obtain the universal bivalent vector. The universal bivalent vector provided by this invention can simultaneously express two target genes and exhibits both GFP and mCherry fluorescence signals. This allows for rapid and accurate identification of transgenic plants, facilitating the screening of positive seedlings. It can also be used in transient expression experiments in tobacco, shortening the experimental cycle and saving time and effort.
[0007] The technical solution of the present invention is as follows:
[0008] The construction of a universal bivalent vector for fluorescently labeled tubulin and microtubule-binding proteins mainly includes two stages: the first stage is the construction of the GFP-αtubulin vector, and the second stage is the construction of the universal bivalent co-expression vector for GFP-αtubulin-mCherry.
[0009] The second stage specifically involves inserting 35S, mCherry, and NOS sequences into the KpnI restriction site of the multiple cloning site of the GFP-αtubulin vector constructed in the first stage, and inserting single nuclease restriction sites, namely XbaI, KpnI / Acc65I, and AscI sequences, at the 5' and 3' ends of the mCherry sequence, respectively, to obtain a universal bivalent vector.
[0010] Furthermore, in the first stage, the GFP-αtubulin expression vector was constructed as follows:
[0011] s1, Total RNA was extracted from the plant, and cDNA was obtained by reverse transcription using the extracted RNA as a template;
[0012] s2, Amplification of the target fragment and linearization: Using pBI221-GFP as a template, the GFP sequence was amplified by PCR; using cDNA as a template, the CDS sequence of αtubulin was obtained by PCR; using pBI221-GFP as a template, the NOS sequence was amplified by PCR; linearization of the pCAMBIA1301 vector;
[0013] S3, Electrophoresis and gel recovery of the target fragment:
[0014] The amplification products from step s2 were subjected to electrophoresis and gel extraction using the Monarch DNA Gel Extraction Kit (NEB) to obtain the corresponding target fragments.
[0015] s4, homologous recombination:
[0016] The αtubulin gene fragment, NOS sequence gene fragment, and GFP sequence gene fragment from step s3, along with the linearized pCAMBIA1301 vector, were subjected to a recombination reaction to obtain the recombinant product, which is the GFP-αtubulin expression vector.
[0017] Furthermore, in step s2, the PCR amplification system consists of: 5 μL 10X Buffer for Kod, 5 μL dNTPs (2 mmol / L), 3 μL MgSO4 (25 mmol / L), 1 μL primer F / R, 1 μL template, 1 μL Kod enzyme, and 33 μL ddH2O; wherein the primers and template are selected according to the different target fragments to be amplified.
[0018] Furthermore, in step s2, when amplifying the GFP sequence, the PCR reaction program is as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 30 s, 68℃ extension for 50 s, final extension at 68℃ for 10 min, and incubation at 10℃ for 32 cycles; when amplifying the αtubulin sequence, the PCR reaction program is as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 30 s, 68℃ extension for 1 min 20 s, final extension at 68℃ for 10 min, and incubation at 10℃ for 32 cycles; when amplifying the NOS sequence, the PCR reaction program is as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 30 s, 68℃ extension for 35 s, final extension at 68℃ for 10 min, and incubation at 10℃ for 32 cycles.
[0019] Furthermore, in step s2, the primer sequences for PCR amplification of the GFP sequence are shown in SEQ NO: 1; the primer sequences for PCR amplification of αtubulin are shown in SEQ NO: 2; and the primer sequences for PCR amplification of the NOS termination sequence are shown in SEQ NO: 3.
[0020] Furthermore, in step s2, the linearization process of the pCAMBIA1301 vector is as follows: the pCAMBIA1301 vector is linearized using BglII restriction enzyme.
[0021] Furthermore, in the second stage, the construction method of the universal dual-valent vector is as follows:
[0022] ss1, Amplification of the target fragment and linearization of the GFP-αtubulin vector: Using pBI221-H2B-mCherry as a template, the 35S sequence and mCherry sequence were amplified by PCR; restriction enzyme sites were added to both sides of the mCherry sequence; the GFP-αtubulin vector was linearized using KpnI-HF restriction enzyme.
[0023] SS2, electrophoresis and gel recovery of the target fragment:
[0024] The 35S, mCherry, and NOS sequences amplified in step ss1, along with the linearized GFP-αtubulin, were subjected to electrophoresis, followed by gel recovery to obtain the 35S sequence gene fragment, the NOS termination sequence gene fragment, and the mCherry sequence gene fragment.
[0025] SS3, seamless cloning (homologous recombination) and transformation of E. coli competent cells:
[0026] The 35S, mCherry, and NOS sequences recovered from the SS2 gel and GFP-αtubulin were subjected to homologous recombination to obtain the recombinant product, namely the universal bivalent co-expression vector.
[0027] Furthermore, in step ss1, the 35S sequence is obtained by PCR amplification through two rounds of amplification.
[0028] Furthermore, in step ss1, the two-step amplification process is as follows: the 35S sequence is amplified by the first pair of primers to obtain PCR product A; then, using PCR product A as a template, the 35S sequence is amplified again by the second pair of primers to obtain the 35S sequence; and XbaI, KpnI / Acc65I restriction site sequences are added to the 3' end of the 35S sequence.
[0029] Furthermore, in the two rounds of amplification, the first pair of primers is shown in SEQ NO:4, and the second pair of primers is shown in SEQ NO:5.
[0030] Furthermore, in step sss1, the primer sequences for PCR amplification of the mCherry sequence are shown in SEQ NO: 6; and the primer sequences for PCR amplification of the NOS sequence are shown in SEQ NO: 7.
[0031] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0032] 1. The universal dual-vector constructed in this invention can simultaneously express two target genes in the same vector, simplifying the experimental process for studying the interaction between tubulin and microtubule-binding proteins, shortening the research cycle of protein interaction, and laying the foundation for the study of the interaction between tubulin and microtubule-binding proteins.
[0033] 2. The universal bivalent vector constructed in this invention, by fusing tubulin with GFP and microtubule-binding protein with mCherry, enables real-time and direct observation of the expression, localization, and real-time dynamics of tubulin and microtubule-binding protein in living cells through live-cell microscopy during the highly dynamic process of microtubule depolymerization and polymerization. This allows for visualization and real-time tracking of the subtle dynamics of tubulin and microtubule-binding protein in cells, facilitating the analysis of their interaction relationships.
[0034] 3. By observing the fluorescence signals of GFP and mCherry, transgenic plants can be identified quickly and accurately, facilitating the screening of positive seedlings and saving time and effort. Attached Figure Description
[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0036] Figure 1 This is an electrophoresis diagram of the GFP sequence from Example 1.
[0037] Figure 2 This is an electrophoresis diagram of the α-tubulin sequence from Example 1.
[0038] Figure 3 This is an electrophoresis diagram of the NOS sequence in step s2 of Example 1.
[0039] Figure 4 This is an electrophoresis image of linearized pCAMBIA1301 in Example 1.
[0040] Figure 5 This is a PCR electrophoresis image of Escherichia coli colonies (GFP-αtubulin) in step s5 of Example 1.
[0041] Figure 6 This is a PCR electrophoresis image of Agrobacterium colonies (GFP-αtubulin) in step s6 of Example 1.
[0042] Figure 7 This is a confocal microscope image of the transient expression of GFP-αtubulin in tobacco during step s7 of Example 1.
[0043] Figure 8 This is an electrophoresis image of the 35S sequence from Example 1.
[0044] Figure 9 This is an electrophoresis image of the mCherry fragment from Example 1.
[0045] Figure 10 This is an electrophoresis diagram of the NOS sequence in step ss1 of Example 1.
[0046] Figure 11 This is an electrophoresis diagram of the linearized GFP-αtubulin vector in Example 1.
[0047] Figure 12 This is a PCR electrophoresis image of Escherichia coli colonies (GFP-αtubulin-mCherry) in step ss4 of Example 1.
[0048] Figure 13 This is a PCR electrophoresis image of Agrobacterium colonies (GFP-αtubulin-mCherry) in step ss5 of Example 1.
[0049] Figure 14 This is a confocal microscopy image of the transient expression of GFP-αtubulin in tobacco during step ss6 of Example 1.
[0050] Figure 15 This is a confocal microscopy image of the transient expression of mCherry tobacco in step ss6 of Example 1.
[0051] Figure 16 This is a confocal microscopy image of the transient expression of tobacco during step ss6 of Example 1.
[0052] Figure 17 The image shows the electrophoresis diagrams of the linearized universal bivalent vector (GFP-αtubulin-mCherry) and OsKCBP in Example 1.
[0053] Figure 18 This is a PCR electrophoresis image of Escherichia coli colonies (co-expression vector) in step sss4 of Example 1.
[0054] Figure 19This is a PCR electrophoresis image of Agrobacterium colonies (co-expression vector) in step sss5 of Example 1.
[0055] Figure 20 This is a confocal microscopy image of the transient expression of GFP-αtubulin in tobacco during step sss6 of Example 1.
[0056] Figure 21 This is a confocal microscopy image of the transient expression of mCherry-KCBP tobacco in step sss6 of Example 1.
[0057] Figure 22 This is a confocal microscopy image of the transient expression of tobacco during step sss6 of Example 1. Detailed Implementation
[0058] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.
[0059] Example 1
[0060] This invention provides a universal bivalent vector for fluorescently labeled tubulin and microtubule-binding protein, the process of which is as follows:
[0061] (1) First stage: Construction of the GFP-αtubulin vector, the process is as follows:
[0062] s1, Extraction and reverse transcription of total RNA from rice to obtain cDNA:
[0063] Total RNA was extracted from rice leaves using the RNeasy Plant Mini Kit (Qiagen). Using the extracted total RNA as a template, cDNA was obtained by reverse transcription using a reverse transcription kit (Invitrogen).
[0064] Amplification of s2, GFP sequence, αtubulin sequence, NOS terminator sequence, and vector linearization:
[0065] s21, amplified GFP sequence
[0066] Using pBl221-GFP as a template, the GFP sequence was amplified by PCR, as follows:
[0067] PCR amplification system: 5 μL 10X Buffer for Kod, 5 μL dNTPs (2 mmol / L), 3 μL MgSO4 (25 mmol / L), 1 μL primer F / R, 1 μL template, 1 μL Kod enzyme, 33 μL ddH2O; PCR reaction program as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 30 s, 68℃ extension for 50 s, final extension at 68℃ for 10 min, incubation at 10℃, for 32 cycles;
[0068] The primer sequences for PCR amplification of the GFP sequence are shown in SEQ NO: 1, as follows:
[0069] SEQ NO: 1
[0070] F: ACACGGGGGACTCTTGACC (vector overlapping sequence) + ATGGTGAGCAAGGGCGA (GFP-specific sequence)
[0071] R: GAGAAGACTATTAG (αtubulin overlapping sequence) + CTTGTACAGCTCGTCCA (GFP specific sequence);
[0072] s22, amplification of αtubulin sequence
[0073] Using cDNA as a template, the CDS sequence of αtubulin was obtained by PCR, as follows:
[0074] The PCR amplification system is the same as s21; the PCR reaction program is: 68℃ extension for 1 min 20 s, the rest is the same as s21.
[0075] The primer sequences for PCR amplification of αtubulin are shown in SEQ NO: 2, as follows:
[0076] SEQ NO: 2
[0077] F: GCTGTACAAG (GFP overlapping sequence) + ATGAGAGAGATCATCAGCATCCACA (αtubulin specific sequence)
[0078] R: CGGGGAAATTC (NOS overlapping sequence) + CTAATAGTCTTCTCCATCGTCGTT (αtubulin specific sequence);
[0079] s23, amplifying the NOS sequence
[0080] Using pBI221-GFP as a template, the NOS sequence was amplified by PCR, as follows:
[0081] The PCR amplification system is the same as s21; the PCR reaction procedure is: 68℃ extension for 35s, the rest is the same as s21.
[0082] The primer sequences for PCR amplification of the NOS terminator sequence are shown in SEQ NO: 3, as follows:
[0083] SEQ NO: 3
[0084] F: AAGACTATTAG (α-tubulin overlapping sequence) + GAATTTCCCCGATCGTCAAACATTTG (NOS specific sequence)
[0085] R: GGAGAAAAACTAGAAATTTACCCTCA (vector overlapping sequence) + GATCTAGTAACATAGATGACACCGC (NOS specific sequence);
[0086] Linearization of s24, pCAMBIA1301 vector
[0087] The pCAMBIA 1301 vector was linearized using BglII restriction enzyme. The enzyme digestion system consisted of 5 μL pCAMBIA1301, 2 μL BglII enzyme, 5 μL 10X NEB3.1 buffer, and 38 μL ddH2O. The reaction was carried out at 37°C for 2 h.
[0088] S3, Electrophoresis and gel recovery of the target fragment:
[0089] Prepare a 1% agarose gel using 1XTAE buffer and add nucleic acid dye. Add the amplified GFP sequence, αtubulin sequence, NOS termination sequence, and linearized vector from step s2 to bromophenol blue loading buffer and perform electrophoresis. See the electrophoresis diagram below. Figures 1-4 The target band was excised and recovered using a gel, and the gel was recovered using the Monarch DNA Gel Recovery Kit (NEB). The concentration of the recovered product was determined using a micro spectrophotometer (Thermo).
[0090] S4, seamless cloning (homological recombination) and transformation of E. coli competent cells:
[0091] The target fragment and linearized vector recovered in step s3 were subjected to a recombination reaction. The reaction system was as follows: 3 μL linearized pCAMBIA 1301 vector (35.2 ng / μL), 0.8 μL αtubulin (85.7 ng / μL), 0.7 μL NOS (72.5 ng / μL), 0.5 μL GFP (105.3 ng / μL), and 5 μL 2X Assembly. Mix (NEB) gently, place in a PCR instrument at 50°C for 30 min to obtain recombinant products; then add 2 μL of the recombinant product to 50 μL of competent E. coli cells (DH5α), gently tap the centrifuge tube to mix, and place on ice for 30 min; then heat shock in a 42°C water bath for 30 s, and immediately transfer to ice to cool for 2 min; then add 450 μL of room temperature LB medium (without Kan), and incubate at 37°C and 220 rpm for 1 h; then take 100 μL of the bacterial culture and spread it evenly on a solid LB plate containing Kan (50 μg / mL), invert the plate, and incubate overnight at 37°C;
[0092] s5, E. coli colony PCR, sequencing and GFP-αtubulin plasmid extraction:
[0093] In a clean bench, use an autoclave tip to pick up a single colony from the plate in step s4, place it in 20 μL of PCR reaction solution, and agitate it several times. Then perform PCR reaction and electrophoresis identification. Figure 5 As shown; the PCR amplification system is as follows: 8 μL ddH2O, 1 μL primer F / R, 10 μL 2X Taq Mastermix enzyme; the PCR reaction program is as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 66℃ annealing for 30 s, 72℃ extension for 50 s, final extension at 72℃ for 10 min, incubation at 10℃, for 32 cycles; the primer sequences for colony PCR amplification are shown in SEQ NO: 1.
[0094] Positive colonies were inoculated into 1.5 mL sterile centrifuge tubes containing 500 μL LB medium (Kan concentration of 50 μg / mL), and incubated at 37°C for at least 4 hours until the medium became turbid. 200 μL was sent to the company for sequencing, and 300 μL was used for preservation. 75% sterile glycerol was added (to a final glycerol concentration of 15%), and the culture was stored at -80°C. The correctly sequenced and preserved bacterial culture was inoculated into 4 mL LB medium (Kan concentration of 50 μg / mL), and incubated at 37°C and 220 rpm for 12-14 hours. GFP-αtubulin plasmid was extracted using the Monarch Plasmid Mini-Prep Kit (NEB), and stored at -20°C.
[0095] Transformation of Agrobacterium competent cells with s6, GFP-αtubulin plasmid and colony PCR:
[0096] Agrobacterium competent cells (EHA105) were transformed using the liquid nitrogen freeze-thaw method. 1 μg of plasmid was added to 100 μL of competent cells, gently mixed, and incubated in an ice-water bath for 10 min. Then, the cells were flash-frozen in liquid nitrogen for 5 min, incubated in a 37°C water bath for 5 min, and then rapidly transferred to an ice-water bath for 5 min. 800 μL of antibiotic-free LB broth was added to a clean bench, and the cells were incubated at 28°C with shaking at 220 rpm for 2-3 h. The culture was then spread onto solid LB plates containing Kan (50 μg / mL) and Rif (20 μg / mL) and incubated upside down at 28°C for 48-72 h. Agrobacterium colony PCR was performed as in S5. Colony PCR electrophoresis images are shown below. Figure 6 As shown;
[0097] S7, Injection of Agrobacterium (GFP-αtubulin) into tobacco and observation under a confocal microscope:
[0098] Based on the Agrobacterium colony PCR results, positive colonies were inoculated into 20 mL of LB medium containing Kan (50 μg / mL) and Rif (20 μg / mL) and cultured overnight at 28 °C and 220 rpm / min. 5000 g of Agrobacterium culture, shaken until OD600 was between 0.5 and 0.8, was centrifuged for 15 min, and the cells were collected at room temperature; the supernatant was discarded. The cells were resuspended in MES (pH 5.8) resuspension to a final concentration of OD600 = 0.5 and incubated at room temperature in the dark for 2-3 h. The resuspension formulation for 10 mL was as follows: 200 μL 0.5 M MES stock solution, 100 μL 100 mmol MgCl2 stock solution, and 10 μL 150 mmol MgCl2 stock solution. AS (dissolved in DMSO), 690 μL sterilized H2O; Selected approximately 4-week-old *Nicotiana benthamiana* leaves, specifically the 3rd-5th leaves from the top downwards. The resuspension was injected into the underside of the leaves using a syringe. The tobacco plants were returned to the culture room and managed as usual for 2-3 days. The expression was observed using a laser confocal microscope (ZEISS LSM 980), and the images were overlaid using the built-in software. The results are as follows: Figure 7 As shown, fluorescence is localized in microtubules, indicating that the GFP-αtubulin vector was successfully constructed.
[0099] (2) Second stage: Construction of the GFP-αtubulin-mCherry universal dual-valent co-expression vector, the process is as follows:
[0100] Based on the GFP-αtubulin vector constructed in the first stage, 35S, mCherry, and NOS sequences were inserted at the KpnI restriction site of the multiple cloning site of the vector, and single nuclease restriction sites, namely XbaI, KpnI / Acc65I, and AscI sequences, were inserted at the 5' and 3' ends of the mCherry sequence, respectively, to obtain a universal bivalent vector.
[0101] The specific process is as follows:
[0102] Amplification of ss1, 35S, mCherry, and NOS sequences and linearization of the GFP-αtubulin vector:
[0103] ss11, amplifying the 35S sequence
[0104] Using the pBI221-H2B-mCherry vector as a template, the 35S sequence was amplified using the first pair of primers (SEQ NO: 4) to obtain PCR product A; then, using PCR product A as a template, the 35S sequence was amplified again using the second pair of primers (SEQ NO: 5) to obtain the 35S sequence; XbaI, KpnI / Acc65I restriction enzyme site sequences (restriction site 1) were added to the 3' end of the 35S sequence.
[0105] PCR amplification system: same as s21; PCR reaction procedure: same as s21;
[0106] The primer sequences used for two rounds of PCR amplification of the 35S sequence are shown in SEQ NO: 4 and SEQ NO: 5, and are as follows:
[0107] SEQ NO: 4
[0108] F: ACGAATTCGAGCTCGGTA (vector overlapping sequence) + GGTCCCCAGATTAGCCTTTTCAAT (35S specific sequence)
[0109] R: TCTAGAGTCCCCCGTGTTC (overlapping sequence of restriction site 1) + TCTCCAAATGAAATGAACTTCCTT (35S specific sequence)
[0110] SEQ NO: 5
[0111] F: ACGAATTCGAGCTCGGTA (vector overlapping sequence) + GGTCCCCAGATTAGCCTTTTCAAT (35S specific sequence)
[0112] R: GGTACCCCGCTCGAGATCC (overlapping sequence of restriction site 1) + TCTAGAGTCCCCCGTGTTC (overlapping sequence of restriction site 1);
[0113] ss12, amplified mCherry sequence
[0114] Using the pBI221-H2B-mcherry vector as a template, the mCherry sequence was amplified by PCR, and an AscI restriction site sequence (restriction site 2) was added to the 3' end of the mCherry sequence.
[0115] PCR amplification system: same as s21; PCR reaction procedure: same as s21;
[0116] The primer sequences for PCR amplification of the mCherry sequence are shown in SEQ NO: 6, as follows:
[0117] SEQ NO: 6
[0118] F: TAGAGGATCTCGAGCGGGGTACC (overlapping sequence of restriction site 1) + ATGGTGAGCAAGGGCGAGGAG (mCherry-specific sequence)
[0119] R: AGGCGCGCCTA (restriction site 2 sequence) + TTACTTGTACAGCTCGTCCATGCCG (mCherry-specific sequence);
[0120] ss13, amplified NOS sequence
[0121] Using the pBI221-H2B-mcherry vector as a template, the NOS sequence was amplified by PCR, as follows:
[0122] The PCR amplification system is the same as s21; the PCR reaction procedure is: 68℃ extension for 35s, the rest is the same as s21.
[0123] The primer sequences for PCR amplification of the NOS terminator sequence are shown in SEQ NO: 7, as follows:
[0124] SEQ NO: 7
[0125] F: CGAGCTGTACAAGTAAT (mCherry overlapping sequence) + AGGCGCGCCT (restriction site 2 overlapping sequence) + GAATTTCCCCGATCGTCAAACATTTG (NOS specific sequence)
[0126] R: TTGTAAAACGACGGCCA (vector overlapping sequence) + GATCTAGTAACATAGATGACACCGC (NOS specific sequence);
[0127] Linearization of ss14, GFP-αtubulin vector
[0128] The GFP-αtubulin vector was linearized using KpnI-HF restriction enzyme; the enzyme digestion system was: 5 uL GFP-αtubulin, 2 uL KpnI-HF restriction enzyme, 5 uL 10X CutSmarter Buffer, 38 uL ddH2O; reaction at 37℃ for 2 h;
[0129] SS2, electrophoresis and gel recovery of the target fragment
[0130] The 35S, mCherry, and NOS sequences amplified in step ss1, along with the linearized GFP-αtubulin, were subjected to electrophoresis. The results are shown below. Figure 8 , Figure 9 , Figure 10 and Figure 11 Electrophoresis and gel recovery are performed. The electrophoresis and gel recovery methods are the same as in s3;
[0131] SS3, seamless cloning (homological recombination) and transformation of E. coli competent cells
[0132] The 35S, mCherry, and NOS sequences recovered from the gel in step ss2, along with GFP-αtubulin, were subjected to homologous recombination. The reaction system was as follows: 3 μL linearized GFP-αtubulin vector (31.2 ng / μL), 0.6 μL 35S (79.3 ng / μL), 0.6 μL mCherry (83.5 ng / μL), 0.8 μL NOS (94.2 ng / μL), and 5 μL 2X Assembly Mix (NEB) to obtain the recombinant product, i.e., a universal bivalent co-expression vector. The recombinant product was transformed into competent E. coli cells. The method was the same as in step s4.
[0133] ss4, E. coli colony PCR, sequencing and GFP-αtubulin-mCherry plasmid extraction
[0134] The method used is the same as s5. E. coli colony PCR electrophoresis image is shown below. Figure 12 As shown;
[0135] Transformation of Agrobacterium competent cells with ss5, GFP-αtubulin-mCherry plasmid and colony PCR
[0136] The method used is the same as for S6. Agrobacterium colony PCR electrophoresis image is shown below. Figure 13 As shown;
[0137] ss6, Agrobacterium (GFP-αtubulin-mCherry) injected into tobacco and observed under confocal microscopy
[0138] The method used is the same as s7, such as Figures 14-16 As shown, Figure 14 The GFP signal is green. Figure 15 The mCherry signal is red. Figure 16The green GFP signal was localized to the microtubules, while the red mCherry signal was dispersed throughout the cell and not localized to the microtubules, indicating that both GFP-αtubulin and mCherry genes were expressed, and the universal dual-valent co-expression vector was successfully constructed.
[0139] (3) Third stage: Validation and application of universal dual-valent co-expression vector:
[0140] To further verify the feasibility of the constructed universal bivalent co-expression vector, the CDS sequence of the predicted rice microtubule-binding protein gene OsKCBP was inserted at the 3' end (Acc65I restriction site) of the mCherry sequence of the universal bivalent co-expression vector obtained in the second stage, and the GFP-αtubulin-mCherry-OsKCBP co-expression vector was constructed and transformed into Nicotiana benthamiana to verify the feasibility of the vector and whether OsKCBP is a microtubule-binding protein.
[0141] The specific process is as follows:
[0142] Amplification of CDS sequences of sss1 and OsKCBP and linearization of universal dual-vector
[0143] sss11, amplifying the CDS sequence of OsKCBP
[0144] Using cDNA as a template, the CDS sequence of OsKCBP was obtained by PCR, as follows:
[0145] The PCR amplification system is the same as s21; the PCR reaction program is: 68℃ extension for 3 min 40 s, the rest is the same as s21.
[0146] The primer sequences for PCR amplification of OsKCBP are shown in SEQ NO: 8, as follows:
[0147] SEQ NO: 8
[0148] F: CGGCATGGACGAGCTGTACAAG (universal vector overlapping sequence) + ATGAACGGTGGCGGCGC (OsKCBP specific sequence)
[0149] R: TTGACGATCGGGGAAATTCAGG (universal vector overlapping sequence) + TCAGCTAGTCAAGCGATTATCTGCTTT (OsKCBP specific sequence);
[0150] sss12, linearization of a universal bivalent carrier
[0151] The universal bivalent vector (GFP-αtubulin-mCherry) was linearized using the AscI restriction enzyme. The enzyme digestion system was as follows: 5 μL GFP-αtubulin-mCherry vector, 2 μL AscI enzyme, 5 μL 10X CutSmall Buffer, 38 μL ddH2O; reaction at 37℃ for 2 h.
[0152] SSS2, electrophoresis and gel recovery of the target fragment
[0153] The OsKCBP sequence amplified in step sss1 and the linearized GFP-αtubulin-mCherry were subjected to electrophoresis, see [link to electrophoresis]. Figure 17 And perform gel recovery; the electrophoresis and gel recovery methods are the same as s3.
[0154] SSS3, seamless cloning (homological recombination) and transformation of E. coli competent cells
[0155] The OsKCBP sequence recovered from the gel in step sss2 and GFP-αtubulin-mCherry were subjected to homologous recombination. The reaction system was: 3 μL linearized GFP-αtubulin-mCherry vector (23.8 ng / μL), 2 μL OsKCBP (94.2 ng / μL), and 5 μL 2X Assembly Mix. The recombination product was transformed into competent E. coli cells. The method was the same as in step s4.
[0156] sss4, E. coli colony PCR, sequencing and extraction of GFP-αtubulin-mCherry-OsKCBP plasmid
[0157] The method used is the same as s5. E. coli colony PCR electrophoresis image is shown below. Figure 18 As shown;
[0158] Transformation of Agrobacterium competent cells with plasmids sss5, GFP-αtubulin-mCherry-OsKCBP and colony PCR
[0159] The method used is the same as for S6. Agrobacterium colony PCR electrophoresis image is shown below. Figure 19 As shown;
[0160] sss6, Agrobacterium (GFP-αtubulin-mCherry-OsKCBP) injected into tobacco and observed under confocal microscopy.
[0161] The method used is the same as s7, such as Figures 20-22 As shown, Figure 20 The green GFP signal Figure 21 The mCherry signal is red. Figure 22The green GFP signal and the red mCherry signal were co-localized to microtubules, indicating that both GFP-αtubulin and mCherry-OsKCBP were expressed, verifying that OsKCBP is a microtubule-binding protein. The GFP-αtubulin-mCherry-OsKCBP co-expression vector was successfully constructed, demonstrating the feasibility of a universal dual-valent co-expression vector.
[0162] In this embodiment, rice was used as the experimental material. Total RNA was extracted from rice leaves, and cDNA was obtained through reverse transcription. Using the cDNA as a template, αtubulin and predicted microtubule-associated proteins (MAPs) were obtained by PCR. Using the plant expression vector pCAMB IA1301 as the basic backbone, GFP, αtubulin, and NOS sequences were inserted at the BglII restriction site using seamless cloning technology (homologous recombination) to obtain the GFP-αtubulin expression vector. The GFP-αtubulin gene expression was driven by the 35S promoter inherent in the vector. Based on this vector, 35S, mCherry, and NOS sequences were inserted at the multiple cloning site (KpnI), and single nuclease restriction sites, XbaI, KpnI / Acc65I, and AscI sequences, were inserted at the N-terminus and C-terminus of the mCherry sequence, respectively, to obtain a universal dual-parameter vector. This dual-vector allows for the insertion of predicted microtubule-binding proteins into the N- or C-terminus of mCherry molecules, enabling fusion expression and ultimately achieving simultaneous expression of αtubulin and the predicted microtubule-binding protein within a single vector. To verify the feasibility of this universal dual-vector, the predicted microtubule-binding protein OsKCBP was inserted into the vector, resulting in a co-expression vector of αtubulin and OsKCBP. Transient expression experiments in tobacco revealed that both proteins are co-localized to microtubules, indicating that OsKCBP is a microtubule-binding protein and the vector is feasible. The construction of this universal dual-vector can be used to verify predicted microtubule-binding proteins, significantly simplifying the experimental procedure and shortening the experimental cycle. The constructed co-expression vector can be used for transient expression in tobacco and stable transformation in rice, laying an important foundation for studying the interaction between microtubulein and microtubule-binding proteins in rice.
[0163] Although the present invention has been described in detail with reference to preferred embodiments, it is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention should be determined by the scope of the claims.
Claims
1. A method for constructing a universal bivalent vector for fluorescently labeled tubulin and microtubule-binding protein, characterized in that, The process mainly consists of two stages: the first stage is the construction of the GFP-α tubulin vector, and the second stage is the construction of the GFP-αtubulin-mCherry universal dual-valent co-expression vector. The second stage specifically involves inserting 35S, mCherry, and NOS sequences into the KpnⅠ restriction site of the multiple cloning site of the GFP-α tubulin vector constructed in the first stage, and inserting single nuclease restriction sites, namely XbaⅠ, KpnⅠ / Acc65Ⅰ, and AscⅠ sequences, at the 5' and 3' ends of the mCherry sequence, respectively, to obtain a universal bivalent vector.
2. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 1, characterized in that, In the first stage, the GFP-α tubulin expression vector was constructed as follows: s1, Total RNA was extracted from the plant, and cDNA was obtained by reverse transcription using the extracted RNA as a template; s2, Amplification of the target fragment and linearization: Using pBI221-GFP as a template, the GFP sequence was amplified by PCR; The CDS sequence of α-tubulin was obtained by PCR using cDNA as a template; the NOS sequence was amplified by PCR using pBI221-GFP as a template; and the pCAMBIA1301 vector was linearized. S3, Electrophoresis and gel recovery of the target fragment: The amplification products from step s2 were subjected to electrophoresis and gel extraction using the Monarch DNA Gel Extraction Kit (NEB) to obtain the corresponding target fragments. s4, homologous recombination: The α-tubulin gene fragment, NOS sequence gene fragment, and GFP sequence gene fragment from step s3, along with the linearized pCAMBIA1301 vector, were subjected to a recombination reaction to obtain the recombinant product, which is the GFP-α-tubulin expression vector.
3. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 2, characterized in that, In step s2, the PCR amplification system consists of: 5 μL 10X Buffer for Kod, 5 μL dNTPs (2 mmol / L), 3 μL MgSO4 (25 mmol / L), 1 μL primer F / R, 1 μL template, 1 μL Kod enzyme, and 33 μL ddH2O; wherein, the primers and template are selected according to the different target fragments to be amplified.
4. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 3, characterized in that, In step s2, when amplifying the GFP sequence, the PCR reaction program is as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 30 s, 68℃ extension for 50 s, final extension at 68℃ for 10 min, and incubation at 10℃ for 32 cycles; when amplifying the α-tubulin sequence, the PCR reaction program is as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 30 s, 68℃ extension for 1 min 20 s, final extension at 68℃ for 10 min, and incubation at 10℃ for 32 cycles; when amplifying the NOS sequence, the PCR reaction program is as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 66℃ annealing for 30 s, 68℃ extension for 35 s, final extension at 68℃ for 10 min, and incubation at 10℃ for 32 cycles.
5. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 4, characterized in that, In step s2, the primer sequences for PCR amplification of the GFP sequence are shown in SEQ NO:1; The primer sequences for PCR amplification of α tubulin are shown in SEQ NO:2; The primer sequences for PCR amplification of the NOS termination sequence are shown in SEQ NO:
3.
6. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 4, characterized in that, In step s2, the linearization process of the pCAMBIA1301 vector is as follows: the pCAMBIA1301 vector is linearized using BglII restriction enzyme.
7. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 1, characterized in that, In the second stage, the construction method of the general-purpose dual-valent vector is as follows: ss1, Amplification of the target fragment and linearization of the GFP-α tubulin vector: Using pBI221-H2B-mCherry as a template, the 35S sequence, mCherry sequence and NOS sequence were amplified by PCR; restriction enzyme sites were added to both sides of the mCherry sequence; the GFP-α tubulin vector was linearized using KpnⅠ-HF restriction enzyme. SS2, electrophoresis and gel recovery of the target fragment: The 35S, mCherry, and NOS sequences amplified in step ss1 and the linearized GFP-α tubulin were subjected to electrophoresis, followed by electrophoresis and gel recovery to obtain the 35S sequence gene fragment, the NOS termination sequence gene fragment, the mCherry sequence gene fragment, and the linearized GFP-α tubulin. SS3, seamless cloning and transformation of E. coli competent cells: The 35S, mCherry, and NOS sequences recovered from the SS2 gel and GFP-α tubulin were subjected to homologous recombination to obtain the recombinant product, namely the universal bivalent co-expression vector.
8. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 7, characterized in that, In step ss1, the 35S sequence is obtained by PCR amplification through two rounds of amplification.
9. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 8, characterized in that, In step ss1, the two-step amplification process is as follows: the 35S sequence is amplified by the first pair of primers to obtain PCR product A; then, using PCR product A as a template, the 35S sequence is amplified again by the second pair of primers to obtain the 35S sequence; and XbaⅠ, KpnⅠ / Acc65Ⅰ restriction enzyme sites are added to the 3' end of the 35S sequence.
10. The method for constructing a universal bivalent carrier of fluorescent protein-labeled tubulin and microtubule-binding protein as described in claim 9, characterized in that, In the two rounds of amplification, the first pair of primers is shown in SEQ NO:4, and the second pair of primers is shown in SEQ NO:5; in step ss1, the primer sequence for PCR amplification of the mCherry sequence is shown in SEQ NO:6; and the primer sequence for PCR amplification of the NOS sequence is shown in SEQ NO:7.
Citation Information
Patent Citations
Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes
AU2020102457A4
Method and related biological material for cultivating transgenic plant of fluorescent protein mCherry labeled microtubulin
CN105018521A