A compound for preventing and treating alopecia and application thereof
By using a compound of oleuropein, glycyrrhizin, and neosafflowerin, the androgen receptor is inhibited, the proliferation of dermal papilla cells is promoted, and the Wnt10b/β-catenin signaling pathway is activated, thus solving the problem of the limited efficacy of oleuropein in treating alopecia and achieving a natural alternative to Western medicine.
Patent Information
- Application Number
- CN202310056088.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-17
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2043-01-17
AI Technical Summary
In existing technologies, oleuropein has limited effectiveness in treating alopecia, requires large amounts of Western medicine, and has drug resistance and side effects, and cannot effectively replace traditional Western medicine.
A compound is provided, consisting of oleuropein, glycyrrhizin, and neosafflowerin, which promotes dermal papilla cell proliferation by inhibiting androgen receptor expression, activates the Wnt10b/β-catenin signaling pathway, and increases the expression of skin growth factors, and is used for the prevention and treatment of androgenetic alopecia.
It enhances the hair growth-promoting efficacy of oleuropein, making it a complete alternative to traditional Western medicine for the prevention and treatment of androgenetic alopecia, providing a natural treatment option.
Smart Images

Figure CN116019821B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a compound for preventing and treating alopecia and application thereof. BACKGROUND
[0002] Human hair is an important appendage on the skin, with a complex structure. Once the cycle is broken, various hair loss and alopecia problems will occur after the hair follicle is formed. Androgenic alopecia (AGA) is the most common type of alopecia caused by irregular hair growth cycle. The overactivity of dihydrotestosterone (DHT) produced by 5-alpha-reductase in human hair papilla cells (DPC) is considered to be the main cause of AGA. DHT has the highest affinity for androgen receptor (AR), about 5 to 10 times the affinity of androgen receptor, then, AR-bound DHT up-regulates the expression of hair growth inhibitors such as dikkopf-related protein 1 (DKK-1), interleukin-6 (IL-6) and transforming growth factor beta (TGF-beta), thereby promoting the regression of hair follicles. These secretory factors from aging DPCs prevent the transition from the resting phase (resting phase) to the growth phase by inhibiting hair follicle neogenesis, differentiation and growth of hair follicle stem cells, thereby inducing alopecia.
[0003] Oleuropein has anti-inflammatory, antifungal, antiviral, antioxidant, and anticancer and hypoglycemic effects. Studies have shown that the activation of the Wnt / beta-catenin pathway can also be well confirmed to positively regulate the growth phase of the skin hair growth cycle. Oleuropein not only promotes the proliferation of human hair follicle papilla cells, but also induces LEF1 and Cyc-D1 mRNA expression and beta-catenin protein expression in dermal papilla cells, and up-regulates IGF-1, KGF, HGF and VEGF gene expression in skin tissue. It is not difficult to find that oleuropein has the effect of improving and treating alopecia, but its treatment effect is very limited, and still needs to be combined with other western medicine treatment drugs to effectively improve and treat alopecia. However, long-term use of western medicine will produce drug resistance and side effects, etc. problem, which seriously affects the physical and mental health of alopecia patients. Therefore, the present application provides a natural compound for preventing and treating androgenic alopecia to overcome the defects of western medicine. SUMMARY
[0004] The purpose of the present application is to provide a compound for preventing and treating alopecia and application thereof to solve the problems existing in the prior art, which can enhance the efficacy of oleuropein in promoting hair growth, and can completely replace traditional western medicine for preventing and treating androgenic alopecia.
[0005] To achieve the above purpose, the present application provides the following solutions.
[0006] The application provides a compound for preventing and treating alopecia, which comprises oleuropein, glycyrrhetinol and neored gospermidine in a weight ratio of (1-32):(4-8):(4-8).
[0007] Further, the weight ratio of the oleuropein, glycyrrhetinol and neored gospermidine is 2:1:1.
[0008] The application also provides a use of the compound in the preparation of a product for preventing and / or treating alopecia.
[0009] Further, the product exerts the efficacy of preventing and / or treating alopecia by inhibiting the expression of androgen receptor (AR), promoting the proliferation of hair papilla cells, improving the cell cycle of hair follicles, activating the Wnt10b / β-catenin signaling pathway and increasing the expression of growth factors in skin tissues.
[0010] Further, the activation of the Wnt10b / β-catenin signaling pathway specifically increases the expression of β-catenin, lymphocyte enhancer factor 1 (LEF1) and Cyclin-D1.
[0011] Further, the growth factors include vascular endothelial growth factor (VEGFA), insulin-like growth factor (IGF1) and keratinocyte growth factor (KGF).
[0012] Further, the alopecia includes androgenetic alopecia.
[0013] Further, the product includes a pharmaceutical product, a cosmetic product or a personal care product.
[0014] Further, the product further comprises a pharmaceutically acceptable carrier.
[0015] Further, the carrier comprises one or more of excipients, emulsifiers and surfactants.
[0016] Further, the excipients are selected from one or more of calcium carbonate, lactose, calcium phosphate and sodium phosphate; the emulsifiers are selected from one or more of egg yolk, acacia, tragacanth, gelatin, magnesium hydroxide, aluminum hydroxide, silicon dioxide, calcium hydroxide, zinc hydroxide, magnesium stearate, calcium hydroxide, zinc hydroxide, magnesium stearate, MC, acacia, cetyl alcohol, stearic acid; and the surfactants are selected from one or more of sodium dodecyl sulfate (SDS), stearate, oleate, a Span (fatty acid sorbitan esters), a Tween (polyoxyethylated sorbitol esters), Pluronic F68, sucrose stearate, a polyoxyethylene fatty alcohol ether (Brij), a polyoxyethylene fatty acid ester.
[0017] The present application discloses the following technical effects:
[0018] The present application finds that the natural extract licorice flavanone and neored gins can enhance the drug efficacy of oleuropein in promoting human hair papilla (DP) cell proliferation, inhibiting AR expression, and improving hair follicle cell cycle, and can stimulate the Wnt10b / beta-catenin signal pathway and up-regulate the expression of growth factors IGF-1, KGF and VEGF genes in skin tissue to promote hair growth, and can completely replace traditional western medicine, and is used for preventing and treating androgenic alopecia, and provides a new idea for the prevention and treatment of alopecia patients. BRIEF DESCRIPTION OF DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below, and obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.
[0020] Figure 1 Effects of different treatments on human hair papilla (DP) cell proliferation;
[0021] Figure 2 Effects of different treatments on human hair papilla (DP) cell androgen receptor (AR) expression;
[0022] Figure 3 Activities of different treatments in relieving alopecia model mice caused by dihydrotestosterone (DHT);
[0023] Figure 4 Effects of different treatments on IGF-1, KGF and VEGFA gene expression in skin tissue of model mice;
[0024] Figure 5 Effects of different treatments on the expression of LEF, beta-catenin, LEF1 and Cyclin-D1 in the Wnt10b / beta-catenin signal pathway in the skin of model mice and the expression of androgen receptor (AR). DETAILED DESCRIPTION
[0025] Now, various exemplary embodiments of the present application will be described in detail, which should not be considered as limiting the present application, and should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.
[0026] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where a range of values is provided, it is understood that each intervening value, to the upper and lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intervening value in the stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also encompassed by the application, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included.
[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials which are related to the present application. In the case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.
[0028] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the present application. Other embodiments of the present application will be apparent to those skilled in the art from consideration of the specification and practice of the present application. The specification and examples are illustrative only.
[0029] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", and the like are open-ended terms that are intended to mean including, but not limited to.
[0030] Glycyrrhetin and neored gins have a wide range of biological activities, including antioxidant, anti-inflammatory, etc. The present application compounding glycyrrhetin and neored gins with oleuropein promotes the effect of oleuropein in preventing and treating androgenic alopecia. The English name of the oleuropein used is oleuropein, the CAS number is: 32619-42-4, the molecular weight is 540.5, the chemical name is: methyl(4S,5E,6S)-4-[2-[2-(3,4-dihydroxyphenyl)ethoxy]-2-oxoethyl]-5-ethylidene-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-3-carboxylate, the molecular formula is C 25 H 32 O 13 The chemical structural formula is as follows:
[0031]
[0032] Licoflavanone, English name, CAS number: 119240-82-3, molecular weight: 340.4, chemical name: 5,7-dihydroxy-2-[4-hydroxy-3-(3-methylbut-2-enyl)phenyl]-2,3-dihydrochromen-4-one, molecular formula: C 20 H 20 O5, the chemical structure is as follows:
[0033]
[0034] Neocarthamin, English name, CHEBI number: 81267, molecular weight: 450.4, chemical name: (2S)-6,7-dihydroxy-2-(4-hydroxyphenyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydrochromen-4-one, molecular formula: C 21 H 22 O 11 , the chemical structure is as follows:
[0035]
[0036] The human hair papilla (DP) cells in the following examples were purchased from Applied Biological Materials Inc. (Richmond, BC, Canada).
[0037] Effect of the compound of Example 1 on the proliferation and migration of DP cells
[0038] The proliferation of hair follicle cells and the secretion of various growth factors play an important role in the process of hair growth. Therefore, in this example, DP cells were used as experimental materials to screen the best concentration of the compound of oleuropein.
[0039] 1 Experimental materials
[0040] 0.2, 0.4, 0.8, 1.6, 3.2, 6.4 μg / mL of oleuropein; 0.8, 1.6, 3.2 μg / mL of licoflavanone; 0.8, 1.6, 3.2 μg / mL of neocarthamin. Oleuropein, licoflavanone, and neocarthamin were purchased from Chengdu Efa Biological Technology Co., Ltd.
[0041] 2 Method:
[0042] 2.1 Oleuropein promotes DP cell proliferation
[0043] Freshly cultured DP cells were collected by centrifugation and plated at a concentration of 2 x 10 5 The cells were treated with 10 μL of 0.2, 0.4, 0.8, 1.6, 3.2, 6.4 μg / mL gradient concentrations of oleuropein for 20 h, and then the cell activity was detected by the MTT method. The specific method was to add 20 μL of MTT solution (5 mg / mL prepared with PBS, pH = 7.4) to each well. Incubate for another 3 h, terminate the culture, and carefully aspirate the culture supernatant in the well. For suspended cells, centrifugation was required before aspirating the culture supernatant in the well. Add 150 μL of dimethyl sulfoxide (DMSO) to each well, and shake for 10 min to fully dissolve the crystals. Select 490 nm wavelength, and measure the light absorption value of each well on an enzyme-linked immunosorbent assay instrument.
[0044] 2.2 Glycyrrhizanol and / or neoredgrenin complexed with oleuropein promotes the proliferation of DP cells by oleuropein
[0045] Freshly cultured DP cells were collected by centrifugation and plated at a concentration of 2 x 10 5 The cells were treated with 10 μL of 0.2, 0.4, 0.8, 1.6, 3.2, 6.4 μg / mL gradient concentrations of oleuropein for 20 h, and then the cell activity was detected by the MTT method. The specific method was to add 20 μL of MTT solution (5 mg / mL prepared with PBS, pH = 7.4) to each well. Incubate for another 3 h, terminate the culture, and carefully aspirate the culture supernatant in the well. For suspended cells, centrifugation was required before aspirating the culture supernatant in the well. Add 150 μL of dimethyl sulfoxide (DMSO) to each well, and shake for 10 min to fully dissolve the crystals. Select 490 nm wavelength, and measure the light absorption value of each well on an enzyme-linked immunosorbent assay instrument.
[0046] 2.3 Glycyrrhizanol and / or neoredgrenin complexed with oleuropein promotes the expression of AR and other proteins by oleuropein
[0047] Freshly cultured DP cells were collected by centrifugation and plated at a concentration of 2 x 10 5 / mL concentration to 24-well plates, 1 mL of DP cell special full nutrient culture solution was added to each well. 10 μL of 0.8, 1.6, 3.2 μg / mL gradient concentration of glycyrrhetinol or neored gins or 1.6 μg / mL of glycyrrhetinol and neored gins mixed solution with 3.2 μg / mL of oleuropein were used to treat the cells for 20 h, and then the AR protein content was detected by Western blot. The specific experimental method was referred to 2.3 in Example 3.
[0048] 3 Results and analysis:
[0049] The proliferation of DP cells can be observed in the process of hair follicle from the resting phase to the growth phase. In the in vitro culture system of the present application, the addition of oleuropein can promote the activity of DP cells, and when the concentration is 3.2 μg / mL, it shows statistical significance. After adding 1.6 μg / mL of glycyrrhetinol and neored gins, the cell activity is extremely significantly increased (P<0.01), and the expression of androgen receptor (AR) in the cells is significantly inhibited, which confirms that the combination of glycyrrhetinol and neored gins with oleuropein promotes the proliferation of DP cells and inhibits the expression of AR. Figure 1
[0050] Example 2 Combination of glycyrrhetinol and neored gins with oleuropein enhances the effect of oleuropein on the hair growth cycle in androgenic alopecia mouse model
[0051] 1 Reagents
[0052] Castor oil and ethanol were prepared into a mixed solution at a volume ratio of 7:3, and 3.20 g / L of oleuropein was prepared using the mixed solution; the mixed solution was used to prepare an oleuropein, glycyrrhetinol and neored gins combination solution, and the contents of the above three compounds in the combination solution were 1.60 g / L, 0.80 g / L and 0.80 g / L, respectively. The mixed solution was used to prepare a 50 g / L minoxidil solution.
[0053] 2 Methods:
[0054] 2.1 The 7-week-old male C57BL / 6 mice were adapted for 1 week, and the mice were shaved with scissors and depilated with depilatory cream. On the first day, the seventh day and the fourteenth day, the androgenic alopecia mouse model was constructed by intraperitoneal injection of 0.1 mL of dihydrotestosterone DHT (10 mg / mL). The model mice were divided into four groups, the model group (100 μL of castor oil and ethanol mixed solution was applied), the oleuropein group (100 μL of oleuropein solution was applied), the combination group (100 μL of combination solution was applied) and the positive drug group (100 μL of minoxidil solution was applied, and 10 mg / kg of finasteride 200 μL was orally administered). Treatment was performed every 2 days. On the 18th day, the mice were captured at a distance of 20 cm using a digital camera to capture the back skin and hair growth state.
[0055] 3Results and analysis
[0056] C57BL / 6 mice are often used in the related research of androgenic alopecia because of their black fur. The back hair follicles of C57BL / 6 mice end the resting phase and gradually enter the growth phase at the end of the seventh week. After injection of DHT, the resting phase of the back hair follicles of the mice is prolonged. The positive drug group is treated with minoxidil combined with finasteride, which can significantly promote the hair follicles to enter the growth phase; compared with the model group, the compound group and the oleuropein group show certain activity in improving the cell cycle of hair follicles, and the effect of the compound is obviously better than that of oleuropein alone. Figure 3
[0057] Example 3 Molecular mechanism of glycyrrhetin and neored gosperma combined with oleuropein compound in preventing and treating androgenic alopecia
[0058] 1 Reagents:
[0059] Castor oil and ethanol are prepared into a mixed solution at a volume ratio of 7:3, and 3.20 g / L of oleuropein is prepared using the mixed solution. The mixed solution is used to prepare an oleuropein, glycyrrhetin and neored gosperma compound solution, and the contents of the above three compounds in the compound solution are 1.60 g / L, 0.80 g / L and 0.80 g / L, respectively. The mixed solution is used to prepare a 50 g / L minoxidil solution. Finasteride is 10 mg / kg.
[0060] 2 Method:
[0061] 2.1 The 7-week-old male C57BL / 6 mice are adapted for one week, and the mice are shaved with scissors and depilated with depilatory cream. On the first day, the seventh day and the fourteenth day, the androgenic alopecia mouse model is constructed by intraperitoneal injection of 0.1 mL DHT (10 mg / mL). The model mice are divided into four groups, a model group (100 μL of a castor oil and ethanol mixed solution is applied), an oleuropein group (100 μL of an oleuropein solution is applied), a compound group (100 μL of a compound solution is applied) and a positive drug group (100 μL of a minoxidil solution is applied, and 200 μL of finasteride is orally administered at 10 mg / kg). Treatment is performed every 2 days. On the 19th day, the back skin and hair growth state of the mice are captured by a digital camera at a distance of 20 cm. On the 20th day, the serum and skin samples of the mice are collected.
[0062] 2.2 Total RNA was isolated from skin tissue using TRIzol reagent (Invitrogen, CA, USA). Total RNA (4 μg) was reverse transcribed using Superscript II kit provided by Invitrogen. The transcriptional expression of growth factors: vascular endothelial growth factor (VEGFA), insulin-like growth factor (IGF1) and keratinocyte growth factor (KGF) in skin tissue of mice in each group was compared by the method of fluorescent quantitative PCR, with GADPH as control, and the primers used were as follows:
[0063] VEGFA F: GTCCGATTGAGACCCTGGTG,
[0064] VEGFA R: TTGACCCTTTCCCTTTCCTCG;
[0065] IGF1 F: TGGATGCTCTTCAGTTCGTG,
[0066] IGF1 R: CACTCATCCACAATGCCTGT;
[0067] KGF F: AGGGTGAGA AGACTGTTCTG,
[0068] KGF R: CTTTCCACCCCTTTGATTGC;
[0069] GADPH F: ATGTCGTGGAGTCTACTGGC,
[0070] GADPH R: TGACCTTGCCCACAGCCTTG.
[0071] 2.3 The expression of AR and the expression of Wnt10b / beta-catenin signaling pathway components LEF, beta-catenin, LEF1 and Cyclin-D1 in the skin of mice were detected by Western blotting. The specific method is as follows: the skin tissue was ground and lysed with liquid nitrogen combined with 200 μL tissue lysis solution to release the proteins in the skin cells, collected into a 1.5 mL centrifuge tube, and centrifuged at 12000 rpm for 15 min at low temperature, and the supernatant was aspirated. The protein concentration was measured by a BCA protein concentration kit, then 2x loading buffer was added and mixed well, the protein sample was denatured by heating in a metal bath, and then centrifuged at 12000 rpm for 5 min. The proteins in the sample were separated by 10% SDS-PAGE gel electrophoresis and transferred to an acetyl cellulose membrane. After the transfer was completed, 5% skimmed milk powder was used for room temperature blocking, and then specific antibodies were prepared with 3% skimmed milk powder and incubated at 4°C overnight. After washing three times with 1x TBST solution, the detection antibody was prepared with 5% skimmed milk powder and incubated at room temperature for 2 h. Finally, after washing three times with 1x TBST solution, color developing solution was added and the membrane was scanned by an Odyssey fluorescence imaging system, and the images were analyzed by Odessey V3.0 software and Image J software.
[0072] 3 Results
[0073] The experimental results show that, compared with the model group, the expression of the three genes VEGFA, IGF1 and KGF in the skin tissue of the three treatment groups of mice is significantly enhanced, and the enhancement of the compound group is the most obvious, which is better than that of the positive drug group. Figure 4 ) It may be related to the fact that the hair of the mice in this group is proliferating rapidly, while the hair follicles of the mice in the positive drug group obviously enter the growth phase earlier and have already gone through the rapid proliferation phase of hair. Figure 3
[0074] The expression of AR, beta-catenin, LEF1 and Cyclin-D1 in the skin tissue of mice in each group was detected, and it can be known that Figure 5 Compared with the model group, the expression of AR in the skin tissue of the three treatment groups of mice is significantly decreased, and the expression of beta-catenin, LEF1 and Cyclin-D1 is significantly increased, and the effect of the compound group is enhanced compared with that of the oleuropein group, and is equivalent to that of the positive drug group, so the compound drug provided by the application can completely replace western medicine for preventing and treating androgenic alopecia.
[0075] In conclusion, the compound of oleuropein, glycyrrhizan flavanone and neored gospermidine provided by the application can stimulate the Wnt10b / beta-catenin signaling pathway and up-regulate the expression of growth factors IGF1, KGF and VEGFA in the skin tissue to promote hair growth.
[0076] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application as defined by the claims.
Claims
1. A compound for preventing and treating alopecia, characterized in that, The compound contains oleuropein, glycyrrhizin, and neosafflowerin in a weight ratio of (1-32):(4-8):(4-8).
2. The compound according to claim 1, characterized in that, The weight ratio of oleuropein, glycyrrhizin, and neosafflowerin is 2:1:
1.
3. The use of a compound as described in any one of claims 1-2 in the preparation of products for the prevention and / or treatment of hair loss.
4. The application according to claim 3, characterized in that, The product exerts its effects in preventing and / or treating alopecia by inhibiting androgen receptor expression, promoting dermal papilla cell proliferation, improving hair follicle cell cycle, activating the Wnt10b / β-catenin signaling pathway, and increasing growth factor expression in skin tissue.
5. The application according to claim 4, characterized in that, The activation of the Wnt10b / β-catenin signaling pathway specifically involves increasing the expression of β-catenin, lymphocyte enhancer 1, and cyclin D1.
6. The application according to claim 4, characterized in that, The growth factors include vascular endothelial growth factor, insulin-like growth factor, and keratinocyte growth factor.
7. The application according to claim 3, characterized in that, The hair loss mentioned includes androgenetic alopecia.
8. The application according to claim 3, characterized in that, The hair loss prevention products are pharmaceuticals, cosmetics, or personal care products; the hair loss treatment products are pharmaceuticals.
9. The application according to claim 3, characterized in that, The product also includes pharmaceutically acceptable carriers.
10. The application according to claim 9, characterized in that, The carrier includes one or more of excipients, emulsifiers, and surfactants.
Citation Information
Patent Citations
Traditional Chinese medicine composition capable of promoting hair growth and preparation method of traditional Chinese medicine composition
CN110538308A
Composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives
US20150119347A1