Molecular marker, primer, detection method and application related to pig muscle fiber, rib number and backfat thickness

Abstract

The application discloses a molecular marker, a primer, a detection method and application related to pig muscle fiber, rib number and back fat thickness, and relates to the technical field of molecular markers. The molecular marker is located in a MYLPF gene, and a sequence of the molecular marker is shown as SEQ ID NO: 4. The sequence is located at a first exon of a 202 transcript of the MYLPF gene, and is used for detecting SNP site mutation. The application determines a cause mutation affecting the circumference, area of pig muscle fiber, rib number and average back fat thickness by using a MYLPF gene promoter constructed to replace a double luciferase reporter vector. A specific primer is designed on the mutation site of the promoter and amplification is performed. The site is detected for polymorphism by using a restriction endonuclease NlaIII. According to the result of the polymorphism detection, differences in the circumference, area of muscle fiber, rib number and average back fat thickness among pig individuals are distinguished, and a large population scale sampling and determination is not needed.

Description

Technical Field

[0001] The present application relates to the field of molecular marker technology, and specifically to molecular markers, primers, detection methods and applications related to pig muscle fibers, rib number and backfat thickness. Background Art

[0002] my country is a major producer and consumer of pork. Genetic improvement of meat quality has become a key research focus in pork breeding. Myofibers are the basic structural units of muscle tissue, and their characteristics and types are closely related to meat quality. Previous studies have shown that the diameter, number, and type of myofibers influence meat quality.

[0003] The study of meat quality traits through quantitative trait loci (QTL) mapping is currently a popular topic. A small number of major genes and quantitative trait nucleotides (QTNs) have been reported to affect muscle fiber function, including the MyHC gene cluster and the MRF gene family. MYLPF (Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle gene, also known as HUMMLC2B) encodes a fast myosin regulatory light chain (RLC) specific to fast twitch muscle fibers. MYLPF is crucial for normal muscle fiber development, playing a role in the development of both fast and slow skeletal muscle fibers and is primarily expressed in fast twitch fibers (Schiaffino and Reggiani 2011).

[0004] The porcine MYLPF gene is differentially expressed in the longissimus dorsi muscle of Changda and Large White pigs (Xu et al. 2005), and its expression level is highly correlated with shear force (Lobjois et al. 2008). Wang et al., through spatial expression analysis of Tongcheng and Large White pigs, found that the MYLPF gene is highly expressed in skeletal muscle, with very low expression in adipocytes and no expression in the brain, heart, kidney, lung, liver, lymph nodes, spleen, stomach, and large and small intestines (Wang et al. 2006). The SNP polymorphisms within the gene are significantly associated with meat quality traits such as drip loss and pH. Studies have shown that MYLPF may be regulated by myocyte enhancer factor (MEF2) and myogenic basic helix-loop-helix (bHLH) proteins, which bind to several MEF2 binding sites and E-boxes in the zebrafish MYLPF promoter region. Therefore, the MYLPF gene may be a candidate gene that regulates skeletal muscle development and affects meat quality.

[0005] It can be seen that the MYLPF gene is an important functional candidate gene affecting pig muscle fibers, but to date, there has been no research report on the identification of functional mutation sites of this gene. Summary of the Invention

[0006] In response to the shortcomings of the existing technology, this application provides a molecular marker, primer, detection method and application related to the circumference, area, number of ribs and average backfat thickness of pig muscle fibers. The purpose is to obtain a molecular marker related to the circumference, area, number of ribs and average backfat thickness of pig muscle fibers, and to establish a method that can determine the correlation between the circumference, area, number of ribs and average backfat thickness of pig muscle fibers in a relatively short period of time, and to assist in breeding.

[0007] In order to achieve the above technical objectives, this application mainly adopts the following technical solutions:

[0008] In the first aspect, the present application provides a molecular marker related to the circumference, area, number of ribs and average backfat thickness of pig muscle fibers. The molecular marker is located in the MYLPF gene, and the molecular marker sequence is shown in SEQ ID NO: 4. The sequence is located in the first exon of the 202 transcript of the MYLPF gene and is used to detect SNP site mutations.

[0009] In a second aspect, the present application provides a primer pair for amplifying molecular markers related to the circumference, area, number of ribs, and average backfat thickness of pig muscle fibers as described in the first aspect, wherein the forward nucleotide sequence of the primer pair is:

[0010] MYLPF_M_F: TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACTCAT, as shown in SEQ ID NO: 5,

[0011] The reverse nucleotide sequence of the primer pair is:

[0012] MYLPF_M_R: ACGGAGGGCAGGAAGGTATG, as shown in SEQ ID NO:6.

[0013] In a third aspect, the present application provides an application of the molecular marker described in the first aspect in molecular marker-assisted breeding related to pork quality traits.

[0014] In a fourth aspect, the present application provides an application of the primer pair described in the second aspect in molecular marker-assisted breeding related to pork quality traits.

[0015] In a fifth aspect, the present application provides a method for detecting porcine MYLPF using the molecular markers described in the first aspect, comprising the following steps:

[0016] S1: Design primers for the SNP mutation detected in the first exon of the MYLPF gene 202 transcript.

[0017] MYLPF_M_F: TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACTCAT, as shown in SEQ ID NO: 5,

[0018] MYLPF_M_R: ACGGAGGGCAGGAAGGTATG, as shown in SEQ ID NO: 6;

[0019] S2: PCR amplification of porcine genomic DNA;

[0020] S3: Digest the PCR product and perform electrophoresis to determine the genotype.

[0021] In a sixth aspect, the present application provides a method for detecting pig MYLPF gene mutations as described in the fifth aspect for use in assisted breeding of pork quality traits.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] MYLPF (Myosin Light Chain, Phosphorylatable, Fast Skeletal Muscle gene, also known as HUMMLC2B) encodes the fast myosin regulatory light chain (RLC), which is specific to fast twitch muscle fibers and is essential for normal muscle fiber development. Although primarily expressed in fast twitch muscle fibers, MYLPF plays a role in the development of both fast and slow skeletal muscle fibers (Schiaffino and Reggiani 2011).

[0024] This application designs specific primers and amplifies the SNP mutation site on the first exon of the MYLPF gene 202 transcript, uses the restriction endonuclease NlaIII to perform polymorphism detection on the site, and distinguishes the differences in muscle fiber circumference, area, number of ribs and average backfat thickness among individual pigs based on the results of the polymorphism detection.

[0025] The detection method provided in this application is convenient, easy to operate, and can identify MYLPF gene polymorphisms in a relatively short period of time, thereby detecting differences in pig muscle fiber circumference, area, rib number, and average backfat thickness, without the need for expensive equipment.

[0026] This method has good specificity. The specific primers designed for the SNP site in the present application based on the MYLPF gene sequence have high specificity.

[0027] The detection method provided by this application is low-cost. It can be detected by PCR amplification and enzyme digestion, without the need for large-scale group sampling and measurement to compare the differences in muscle fiber circumference, area, rib number and average backfat thickness between different pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the electrophoresis diagram of the PCR product of the MYLPF gene promoter region;

[0029] Figure 2 This is the electrophoresis diagram of PCR products of individuals with three different genotypes of the MYLPF gene;

[0030] Figure 3 This is the electrophoresis diagram of the genotyping results using restriction endonuclease NlaIII;

[0031] Figure 4 These are the 24 mutation sites identified in the MYLPF promoter vectors of two different haplotypes;

[0032] Figure 5 is the relative luciferase activity of the MYLPF promoter expression vectors with two different haplotypes;

[0033] Figure 6 is the relative luciferase activity of the MYLPF replacement (SNP site) promoter expression vector of two different haplotypes;

[0034] Figure 7 This is the electrophoresis diagram of the PCR products used to verify the overexpression vector constructed by the transcription products of different alleles of the MYLPF gene;

[0035] Figure 8 It is the result of detecting the transcripts of different loci of MYLPF gene;

[0036] Figure 9 This is the EMSA result diagram of the binding of different alleles of the rs330629900 site to unknown factors; DETAILED DESCRIPTION

[0037] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the present application is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely for the purpose of explaining this application and are not intended to limit this application. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0038] It should be noted that the terms "first", "second", etc. in the specification and claims of the present application and the above-mentioned drawings are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequence, nor do they play a substantial limiting role on the subsequent technical features. It should be understood that the data used in this way can be interchangeable where appropriate, so that the embodiments of the present application described herein can be implemented in an order other than those illustrated or described herein. In addition, the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions, for example, a process, method, system, product or device comprising a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.

[0039] In order to address the limitations of the existing technology regarding the influence of the MYLPF gene on pig muscle fibers, the embodiments of the present application disclose a molecular marker related to the circumference, area, number of ribs and average backfat thickness of pig muscle fibers. The molecular marker is located in the MYLPF gene, and the molecular marker sequence is shown in SEQ ID NO: 4. The sequence is located in the first exon of the 202 transcript of the MYLPF gene and is used to detect SNP site mutations.

[0040] Based on the above molecular markers, the present invention provides a primer pair for amplifying the molecular markers related to the circumference, area, number of ribs and average backfat thickness of pig muscle fibers. The forward nucleotide sequence of the primer pair is:

[0041] MYLPF_M_F: TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACTCAT, as shown in SEQ ID NO: 5,

[0042] The reverse nucleotide sequence of the primer pair is:

[0043] MYLPF_M_R: ACGGAGGGCAGGAAGGTATG, as shown in SEQ ID NO:6.

[0044] Based on the above molecular markers, an embodiment of the present application provides an application of the above molecular markers in molecular marker-assisted breeding related to pork quality traits.

[0045] Based on the above primers, an embodiment of the present application provides an application of the above primer pair in molecular marker-assisted breeding related to pork quality traits.

[0046] The present application embodiment provides a method for detecting pig MYLPF using the molecular marker, comprising the following steps:

[0047] S1: Design primers for the SNP mutation detected in the first exon of the MYLPF gene 202 transcript.

[0048] MYLPF_M_F: TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACTCAT, as shown in SEQ ID NO: 5,

[0049] MYLPF_M_R: ACGGAGGGCAGGAAGGTATG, as shown in SEQ ID NO: 6;

[0050] S2: PCR amplification of porcine genomic DNA;

[0051] S3: Digest the PCR product and perform electrophoresis to determine the genotype.

[0052] In some embodiments, in step S2, the total PCR reaction system is 10 μL, including 1 μL of porcine genomic DNA at a concentration of 50 ng / μL; 5 μL of 2×Taq PCR Mix; 0.2 μL each of 10 μM forward and reverse specific primers; 3.6 μL of sterile water; the amplification conditions are: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 12 s; 35 cycles; termination extension at 72°C for 5 min; cooling at 15°C for 2 min; and the PCR product is detected by 2% agarose gel electrophoresis.

[0053] In some embodiments, in step S3, the enzyme digestion reaction volume is 5 μL, including 0.5 μL of 10×NEBuffer, 1.5 μL of PCR product, 0.1 μL of NlaIII restriction endonuclease, and 2.9 μL of sterile water; the reaction is oscillated and then centrifuged; the enzyme digestion is then performed at 37° C. for 15 minutes; the enzyme digestion products are subjected to electrophoresis on a 6% non-denaturing polyacrylamide gel to detect the enzyme digestion results and determine the genotype.

[0054] Based on the above detection method, an embodiment of the present application provides an application of the above-mentioned method for detecting pig MYLPF gene mutation in assisted breeding of pork quality traits.

[0055] The application principle of this application is further described in detail below with reference to the accompanying drawings.

[0056] This application discloses a molecular marker, primer, detection method and application related to the circumference, area, number of ribs and average backfat thickness of pig muscle fibers, as shown below.

[0057] Nucleotide sequence cloning of the MYLPF gene promoter region and dual-luciferase reporter gene vector experiments

[0058] 1. Primer Design

[0059] TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACT A ATGGGAAAGGT ACAGAATGATGCCCTAAAGGACCCAACCAAGGATAATCTGCCCAGACACTCCACTCTCAGGAGCCCAGTGCCCCTCA AAGCTTGATCCATACCTTCCTGCCCTCCGT CTTCTGAAAAACCCCTGCAATCAACCAGGCAAGAACACCCGCTCCTTTTTTTTTTTTTTTTCTTTGTCTTTTTAGGGCCATACCTTCAGCATATGGAGGTTCCCAGGCTAGGAGTCAAATTGGAGCTGCAGCTGCCAGCCCACACCACAGCCACAGCAATGCCAGATCCTTAACCCACCACGCAAGGCCAGGGATCAAACCCTCGACCTCATGGATACTAGTCAGGTTCATTACTGCTGAGCCACAATGGGAACTCCCTTCACTCCCATTTCGTAAATGAGAAACTAGAGGTTTAAACAGGGTGATGAGTGAATCTGGGTCACACAGCAAGTCTAGGACTTGGATGAGCCAGGCTCCGGGCACCGAGAAGGGGAGGGACCTCCCACCTGTTGGGTAGAGTGGAAGGCTATGAATAGGAATTTGAGGCTACAACTGAAGCAATTCCCCTCAGCAGAGAGGTCGTAGGAAGGGGATGCCTGGAGCCAGAAGAGTTACTTTAAAAGAGTGGACTCGGAGAACGCTGAATCTAATCCATTGCCTCCAGAGAGGGGTAAGGATTGTCCACAAACTCCTTTGTCCGATCCTCATCCCTCAGGCACCCAAGAAGGCCAAGAGAAGGGCAGCGGCAGAAGGAAGCTCCAACGTCTTCTCC

[0060] 设计克隆MYLPF基因的启动子的引物DNA序列如下:

[0061] 正向引物:MYLPF_1890_F:5’CGGGGTACCGAACTCCTCCCCACTTTCACCT 3’,见SEQ IDNO:2;

[0062] 反向引物:MYLPF_1890_R:5'CTAGCTAGCGGAGAAGACGTTGGAGCTTCCTT 3',见SEQ IDNO:3。

[0063] 2.针对MYLPF基因表达量极端个体的选择

[0064] In line with the results of previous eQTL analysis, we found highly significant inter-individual differences in MYLPF gene expression (FPKM) among 189 individuals undergoing RNA-seq sequencing. We then selected three individuals from the extreme high and extreme low MYLPF expression groups for SNP polymorphism analysis. The high-expression group was designated H1, H2, and H3, respectively, while the low-expression group was designated L1, L2, and L3.

[0065] 3. Amplification, Purification and Cloning of PCR Products

[0066] A 10 μL PCR reaction system contained 1 μL of porcine DNA template at a DNA concentration of 50 ng / μL, 0.2 μL of Phanta Max Super-Fidelity DNA Polymerase, 5 μL of 2× Phanta Max Buffer, 0.2 μL of dNTP Mix, 0.2 μL of 10 μM forward and reverse primers, and 3.2 μL of sterile water. Amplification conditions were: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 60 s, 35 cycles, 72°C termination extension for 5 min, and cooling at 15°C for 2 min. In this example, the phenol-chloroform method was used to extract porcine genomic DNA, and Phanta Max Super-Fidelity DNA Polymerase was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0067] The PCR products were detected by 1% agarose gel electrophoresis. Figure 1 The amplified product is 1890 bp in size, as confirmed by agarose gel electrophoresis. Lane M is the DL2000 DNA marker, lanes 2 to 7 are the PCR products, and lane 8 is the negative control.

[0068] Purification of PCR products: The gel containing the target fragment was cut from the agarose gel under UV microscope and placed in a 2 mL centrifuge tube. The agarose gel DNA recovery kit purchased from OMEGA was then used for recovery and purification. All operations were performed according to the kit instructions.

[0069] Ligation reaction: Ligation was performed using Takara's pMD18-T vector kit. 4 μL of the recovered PCR product was mixed with 1 μL of pMD18-T vector, and 5 μL of Solution I in the kit was added. The mixture was incubated at 16°C in a metal bath for 1 hour to obtain the ligation product.

[0070] Transformation: Aseptically transfer 25 μL of Trans-5α chemically competent cells purchased from Beijing Quanshijin Co., Ltd. to a sterile 1.5 mL centrifuge tube. Add 5 μL of the ligation product and gently mix. Incubate on ice for 30 minutes, heat shock at 42°C for 90 seconds, and then incubate on ice for 2 minutes. Add 400 μL of antibiotic-free LB liquid medium and incubate at 37°C with shaking for 1 hour. After low-speed centrifugation, remove 200 μL of the supernatant, resuspend the pellet, and spread it evenly on a plate containing 60 μg / mL LB medium and ampicillin. Incubate flat at 37°C for 30 minutes, then invert and incubate overnight.

[0071] Positive single colony detection: Pick a single colony from the plate and inoculate it into 1 mL of LB liquid medium containing ampicillin. Incubate at 37°C, 180 rpm for 6-8 hours. Using the bacterial suspension as a template, perform PCR amplification according to the PCR amplification system described in step 3. After electrophoresis on a 1% agarose gel, select a positive single colony.

[0072] 4. Sequencing

[0073] The positive monoclonal bacterial solution was sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing, and the sequencing results were spliced ​​and aligned using the SeqMan program of DNAStar software.

[0074] 5. Construction of Dual Luciferase Reporter Gene Vector

[0075] Sequencing analysis of amplified products from individuals with high and low gene expression revealed variation between the high and low expression groups. Plasmids were extracted from one individual from each of the high and low expression groups. The plasmid extraction kit was purchased from OMEGA, and all procedures were performed according to the manufacturer's instructions, resulting in two distinct MYLPF gene promoter haplotypes.

[0076] Double enzyme digestion system: A dual-luciferase reporter gene vector was constructed using the pGL3-Basic vector (with KpnI and NheI restriction sites) as the backbone. A 20 μl double enzyme digestion reaction system consisted of 2 μl each of KpnI and NheI, 2 μl of 10× buffer, 10 μl of plasmid (including the pGL3-Basic vector backbone and two different haplotype promoter plasmids), and 4 μl of sterile water. The reaction was shaken to mix thoroughly, then centrifuged and digested at 37°C for 1 hour. The digestion products were analyzed on a 1.5% agarose gel, recovered, and ligated. Enzymes were purchased from Thermo Fisher Scientific. All experimental procedures were performed according to the manufacturer's instructions. The digestion products were purified as previously described for PCR products.

[0077] Ligation system: The ligation reaction system of 10μl target fragment and vector backbone contains 1μl T4 DNA Ligase, 1μl 10×T4 DNA Ligase buffer, 0.03pmol vector backbone, 0.06pmol target fragment, add sterile water to 10μl, and incubate in a metal bath at 22℃ for 1h.

[0078] Transformation and positive single colony detection were the same as above, and sequencing was used to detect whether the inserted fragment was correct.

[0079] There are 24 mutation sites in two different haplotype promoter vectors, such as Figure 4 As shown. The firefly luciferase reporter gene vector experiment was used to detect the transcriptional activity of two different MYLPF promoter expression vector plasmids in mouse myoblasts (C2C12). In order to reduce the error caused by the cell culture microenvironment, the plasmid pRL-TK expressing Renilla luciferase was used as an internal reference. C2C12 cells were transfected with the above plasmids for 48 hours and differentiated for 7 days. The enzyme activities of firefly luciferase and Renilla luciferase were measured. The ratio of the two, i.e. the relative luciferase activity, was used to represent the transcriptional activity of the target sequence. The experimental results are shown in Figure 2. Figure 5 As shown, the two different promoter expression vectors exhibited differential transcriptional activity. The blank rectangles represent the MYLPF gene promoter expression vector in the high-expression group, while the black rectangles represent the MYLPF gene promoter expression vector in the low-expression group. The results showed that the transcriptional activity in the high-expression group was significantly higher than that in the low-expression group, with a fold difference of approximately 2.16. The Dual-Luciferase Reporter Gene Assay Kit was purchased from Shanghai Yisheng Biotechnology Co., Ltd., and all experimental procedures were performed according to the manufacturer's instructions.

[0080] According to the results of the previous analysis, a SNP site (rs330629900) was predicted to be located upstream of the MYLPF gene. Using the original high-group promoter expression vector as a template and the original low-group promoter expression vector as a control, the mutation site was replaced to construct a dual-luciferase expression vector. The results are as follows Figure 6 The results showed that when the high promoter haplotype mutated to a G at this site, transcriptional activity decreased, similar to that of the low haplotype. The functional mutation site that affected the transcriptional activity of the two different promoter expression vectors was initially identified as G>A (rs330629900, 3:17940892).

[0081] All dual-luciferase reporter vector experimental data were repeated 3 times or more.

[0082] Detection method for MYLPF gene SNP variation

[0083] S1: Primer design. Specific primers were designed for the SNP mutation in the first exon of the 202 transcript of the MYLPF gene as follows:

[0084] MYLPF_M_F: TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACTCAT, see SEQ IDNO:5;

[0085] MYLPF_M_R: ACGGAGGGCAGGAAGGTATG, see SEQ ID NO: 6;

[0086] S2: PCR amplification, the total PCR reaction system is 10μL, including 1μL of porcine genomic DNA with a concentration of 50ng / μL; 5μL of 2×Taq PCR Mix; 0.2μL each of 10μM forward and reverse specific primers; 3.6μL of sterile water; amplification conditions are: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s; 60℃ annealing for 30s; 72℃ extension for 12s; 35 cycles; 72℃ termination extension for 5min; 15℃ cooling for 2min. 2×Taq PCR Mix was purchased from Beijing Aidelai Biotechnology Co., Ltd. The PCR product was detected by 2% agarose gel electrophoresis. Primers MYLPF_M_F and MYLPF_M_R were used for amplification, and the amplified product size was 156bp, as shown in the figure. Figure 3 As shown, the sequence is the horizontal line portion of the DNA sequence given in SEQ ID NO: 1, namely the sequence of SEQ ID NO: 4.

[0087] Afterwards, the gel containing the target fragment was cut from the agarose gel under a UV instrument and placed in a 2 mL centrifuge tube, and then recovered and purified using an agarose gel DNA recovery kit purchased from OMEGA. All operations were performed according to the kit instructions.

[0088] S3: Enzyme digestion and genotype determination. The enzyme digestion reaction volume is 5 μL, including 0.5 μL of 10×NEBuffer, 1.5 μL of PCR product, 0.1 μL of NlaIII restriction endonuclease, and 2.9 μL of sterile water. After oscillation mixing, centrifugation is performed. Then, the enzyme digestion is carried out at 37°C for 15 minutes. The enzyme digestion products are subjected to electrophoresis on 6% non-denaturing polyacrylamide gel to detect the enzyme digestion results and determine the genotype.

[0089] The enzyme digestion results are as follows Figure 3As shown, when the splice donor of MYLPF mutates, a restriction endonuclease NlaIII cleavage site with the sequence 5'CATGˇ3' is created, recognized by the restriction endonuclease NlaIII. The PCR product is 156 bp long. If the digestion product of an individual sample shows three bands (156 bp, 115 bp, and 41 bp in length), the individual's genotype is AB. If the digestion product of an individual sample shows a single band (156 bp in length), the individual's genotype is homozygous for BB. If the digestion product of an individual sample shows two bands (115 bp and 41 bp in length), the individual's genotype is homozygous for AA. Restriction digestion results revealed three genotypes for the SNP mutation in the MYLPF gene. The A allele is the dominant allele in lean pig breeds, representing an unmutated sequence relative to the reference genome sequence (GenBank accession number NC_010445.4). The B allele is a SNP mutation sequence.

[0090] Differential verification of transcripts from different alleles

[0091] 1. Amplification of the promoter region encompassing rs330629900 revealed that in individuals with high-risk phenotype, a "G" at this site creates a splice site, "AG," leading to the production of a new transcript. A protein expression vector was constructed and transfected into porcine kidney epithelial (PK15) cells to detect the presence of the transcript.

[0092] 2. Construction of expression vector

[0093] The primer DNA sequences for cloning the novel transcript of the MYLPF gene are as follows:

[0094] Forward primer: MYLPF_955_F: 5'CTAGCTAGCTCCTTTCCAGCCAGAGCCACT 3', see SEQ ID NO: 7;

[0095] Reverse primer: MYLPF_955_R: 5'CGGGGTACCGGAGAAGACGTTGGAGCTTCCTT 3', see SEQ ID NO: 8;

[0096] The amplification, purification, cloning and sequencing of PCR products were the same as above, with amplification time of 30 s; the product amplification results were as follows Figure 7 As shown;

[0097] The double enzyme digestion system was the same as above, the vector backbone was pcDNA3.1(+) (with KpnI and NheI enzyme digestion sites), and the ligation, transformation, and plasmid extraction were the same as above;

[0098] 3. RNA Extraction and cDNA Preparation

[0099] The obtained two haplotype protein expression vectors were transfected into PK15 cells, and 24 hours later, the cell RNA was extracted and reverse transcribed into cDNA.

[0100] Forward primer: IGV_2_F: 5'TCCTTTCCAGCCAGAGCCACT 3', see SEQ ID NO: 9;

[0101] Reverse primer: IGV_2_R: 5'GGCATCATTCTGTACCTTT 3', see SEQ ID NO: 10;

[0102] The amplification steps of PCR products are the same as above, the amplification time is 10s, and the amplification results are as follows Figure 8 As shown, L1_DNA and H1_DNA represent the amplification results of the low group and high group individuals on their DNA, respectively, and L1_cDNA and H1_cDNA represent the amplification results of the low group and high group individuals on their cDNA, respectively.

[0103] The RT-PCR test results showed that the newly generated transcript IGV_2 existed in the high-group individuals but not in the low-group individuals. This result was consistent with the results of IGV detection. The newly generated transcript only existed in the high-group individuals. It was speculated that the mutation site G>A may be the reason for the differential expression of MYLPF expression.

[0104] There are unknown factors that interact with the rs330629900 site to affect the expression of the MYLPF gene

[0105] For the rs330629900 site, a wild-type probe (UG) carrying the "G" allele and a mutant probe (UA) carrying the "A" allele were designed to detect the binding of this DNA element to transcription factors. C2C12 cells were cultured, differentiated, and nuclear extracts were extracted for EMSA detection. The EMSA detection kit was purchased from Thermo Fisher, and all operations were strictly carried out according to the instructions. The results showed that the wild-type probe formed a blocking band (indicated by the arrow) after incubation with the cell nuclear extract, while the mutant probe could not generate it. The results are shown in Figure 2. Figure 9 As shown. This proves that there is indeed an unknown factor that binds to the DNA element containing the "G" base, resulting in differences in promoter activity of the MYLPF gene promoter expression vector between the high and low groups, further affecting the differences in gene expression. Genetic diversity detection and association analysis with traits

[0106] 1. Using the above-established detection method for MYLPF gene mutation, polymorphism detection was performed in three hybrid combinations (DLC, DDLC, and DLLC) of the Zhuangxiang Black Pig population. The results are shown in Table 1.

[0107] The results showed that in the "Zhuang Black Pig" population, individuals with the AA genotype were dominant, the AB genotype was rare, and there were no individuals with the BB genotype.

[0108] Table 1 Allele frequency of the SNP site of the MYLPF gene in the “Zhuangxiang Black Pig” population

[0109]

[0110] 2. Association analysis between trait phenotypic values ​​and marker polymorphisms

[0111] Based on the meat quality trait determination work conducted on 396 individuals of three hybrid combinations of "Zhuangxiang Black Pig" in the early stage, the results of the meat quality trait determination were analyzed with the genotype detection results of the SNP site in the MYLPF gene in the population, and the following linear model was established:

[0112] Y ijkl =μ+G i +B j +S k +F l +ε ijkl

[0113] where Y represents the observed value of the trait, G represents the genotype effect, B represents the batch effect of slaughter, S represents the sex effect, F represents the boar effect, and ε ijkl is a random error.

[0114] Table 2 Results of association analysis between SNP polymorphisms of the MYLPF gene and carcass and meat quality traits in the Zhuangxiang Black Pig population

[0115]

[0116]

[0117] Note: * indicates significant correlation (0.01 <P≤0.05),**表示极显著关联(P≤0.01)。

[0118] The analysis results of the simple mean and standard deviation of the observed values ​​of specific traits are summarized in Table 2. In the experimental population of "Zhuangxiang Black Pig", the association analysis of the polymorphism site of MYLPF gene rs330629900 with carcass traits and meat quality traits was conducted. The analysis results showed that in the experimental population of "Zhuangxiang Black Pig", the polymorphism of the SNP site was significantly associated with the number of vertebrae (0.01 <P≤0.05),与平均背膘厚极显著关联极显著关联(P≤0.01),且GA型个体的背膘厚显著大于GG型个体的背膘厚。与肌纤维的周长、面积显著关联(0.01<P≤0.05),且GA型个体的肌纤维周长和肌纤维的面积显著大于GG型。

[0119] The above is only a preferred specific implementation method of the present application, but the scope of protection of the present application is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed in this application should be covered by the scope of protection of the present application.

Claims

1. An application of a SNP molecular marker associated with pig muscle fiber circumference, area, number of ribs, and average backfat thickness in molecular marker-assisted breeding related to pork quality traits, wherein the molecular marker is located in the MYLPF gene, and the molecular marker sequence is shown in SEQ ID NO:4, which is located in the first exon of the 202 transcript of the MYLPF gene and is used to detect SNP site mutations; the polymorphism of the SNP site is significantly associated with pig muscle fiber circumference, pig fiber area, number of ribs, and average backfat thickness, and the SNP is rs330629900 SNP.

2. A primer pair for amplifying SNP molecular markers related to the circumference, area, number of ribs, and average backfat thickness of pig muscle fibers as described in claim 1, for use in assisted breeding of pork quality traits, wherein the forward nucleotide sequence of the primer pair is: MYLPF_M_F: TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACTCAT, as shown in SEQ ID NO: 5, the reverse nucleotide sequence of the primer pair is: MYLPF_M_R:ACGGAGGGCAGGAAGGTATG, as shown in SEQ ID NO:6; the polymorphism of the SNP site is significantly associated with pig muscle fiber circumference, pig fiber area, rib number, and average backfat thickness.

3. A method for detecting pig MYLPF using the SNP molecular marker described in claim 1 in pig quality trait assisted breeding, comprising the following steps: S1: Design primers for the SNP mutation detected in the first exon of the MYLPF gene 202 transcript. MYLPF_M_F: TCCACATCTCTCGTTAGAACCCTCCCTTGGTATCACTCAT, as shown in SEQ ID NO: 5, MYLPF_M_R: ACGGAGGGCAGGAAGGTATG, as shown in SEQ ID NO: 6; S2: PCR amplification of porcine genomic DNA; S3: digest the PCR product and perform electrophoresis to determine the genotype; The polymorphism of the SNP site is significantly associated with pig muscle fiber circumference, pig fiber area, rib number, and average backfat thickness.

4. The use according to claim 3, wherein in step S2, the total PCR reaction system is 10 L, which includes 1 μL of porcine genomic DNA at a concentration of 50 ng / μL; 5 μL of 2×Taq PCR Mix; 0.2 μL each of 10 μM forward and reverse specific primers; and 3.6 μL of sterile water; the amplification conditions are: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 12 s; 35 cycles; termination extension at 72°C for 5 min; and cooling at 15°C for 2 min; and the PCR products are detected by 2% agarose gel electrophoresis.

5. The method according to claim 3, wherein the volume of the enzyme digestion reaction is 5 μL, comprising 0.5 μL of 10×NE Buffer, 1.5 μL of PCR product, 0.1 μL of NlaIII restriction endonuclease, and 2.9 μL of sterile water; the reaction is mixed by oscillation and centrifuged; and the enzyme digestion is then carried out at 37° C. for 15 min. The digestion products are subjected to electrophoresis on a 6% non-denaturing polyacrylamide gel to detect the digestion results and determine the genotype.

Images