Bactrian camel milk production trait related gene evx2 and application thereof as a molecular marker
By identifying the gene EVX2 and its SNP loci associated with milk production traits in Bactrian camels through genome-wide association analysis, the problems of complex breeding processes and high costs were solved, enabling efficient screening of Bactrian camel breeds with superior traits and improving the non-fat solids content of camel milk.
Patent Information
- Application Number
- CN202211698740.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-28
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2042-12-28
AI Technical Summary
Existing technologies lack in-depth research at the molecular genetic level into the lactation mechanism and regulatory mechanisms of Bactrian camels, resulting in a complex, costly, and time-consuming breeding process, and also leading to low milk production in Bactrian camels, which affects the improvement of their dairy performance.
Genome-wide association analysis was used to identify the gene EVX2 and its single nucleotide polymorphism (SNP) associated with milk production in Bactrian camels. These SNPs were used as molecular markers to assist in breeding and to screen out Bactrian camel breeds with high or low non-fat solids content.
It provides a simple, time-saving, and highly accurate breeding method, which improves the non-fat solids content of Bactrian camels, enhances the quality of camel milk, and provides candidate gene resources for improving the milk performance of Bactrian camels.
Smart Images

Figure CN116042855B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to a Bactrian camel milk production trait related gene EVX2 and application thereof as a molecular marker. BACKGROUND
[0002] Bactrian camel milk is rich in nutrients, high in insulin content, easy to digest and absorb, and is deeply loved by consumers. It is in short supply in the domestic and foreign markets. However, the Bactrian camel breed in China is primitive, and directional breeding of milk-producing camels has not been carried out. The average milk production level is low, with daily milk production of only about 1 kg / peak, while individual camels can produce more than 6 kg per day, with a large difference between individuals. There is a large space for breeding to improve milk production. However, there are few reports on Bactrian camel milk production trait related genes, and the use of modern molecular marker assisted Bactrian camel breeding to improve milk production performance has not been reported. At present, research on milk traits at the molecular level is mainly focused on cattle and sheep, and research on Bactrian camel milk performance is mainly focused on the collection and arrangement of phenotype data and the analysis of initial lactation rules and lactation characteristics. Therefore, further research on the lactation mechanism and regulation mechanism of Bactrian camels from the molecular genetic level is urgently needed, which is one of the main ways to accelerate the improvement of Bactrian camel milk performance. Bactrian camel is a characteristic animal resource in Inner Mongolia, and the role of Bactrian camel has been greatly reduced. It is changing from a traditional single production mode to a specialized and commercialized production mode. Camel products mainly include camel milk, camel meat, camel skin, camel bone, etc. Camel milk is an important part of it. Camel milk is in short supply in the market because it is popular with consumers due to its health benefits. However, at the same time, the milk production of camels is low, resulting in low production efficiency and certain limitations. Therefore, how to improve milk production is directly related to the development of the camel milk industry, and is of great significance to the income increase of farmers and herdsmen in pastoral areas and social stability. Non-fat solids refer to the total of substances in camel milk other than fat and water, mainly including protein, carbohydrates, minerals, vitamins, etc. The higher the non-fat solid rate, the higher the content of nutrients in the milk, and the better the quality of the milk. Traditional breeding methods mainly use phenotype information and pedigree information for cross breeding. For traits with low heritability and complex measurement, there are problems of high cost, long time and complex breeding process. With the rapid development of high-throughput sequencing technology, bioinformatics and statistical methods, genome-wide association analysis (Genome Wide AssociaCion SCudy, GWAS) has become a main means for mining and identifying important traits of poultry and livestock. SUMMARY
[0003] Based on the lack of in-depth research on the lactation mechanism and regulation mechanism of Bactrian camels from the molecular genetic level in the prior art, the present application provides a Bactrian camel milk production trait related gene EVX2 and application thereof as a molecular marker.
[0004] The application applies selected molecular markers to screen bactrian camels with high / low non-fat solid rate, and provides technical support for breeding bactrian camel varieties with excellent traits.
[0005] The purpose of the application can be achieved by the following technical solutions.
[0006] The application first provides a bactrian camel milk production trait related gene EVX2 The application is a molecular genetic marker related to the milk production trait of bactrian camels.
[0007] Further, the milk production trait specifically refers to the non-fat solid rate of bactrian camels.
[0008] Further, a SNP molecular marker related to the non-fat solid rate of bactrian camels is provided, which is located at the nucleic acid site of 48754135 of the 5th chromosome of bactrian camels, the base of the site is C or A, and is contained in EVX2 the intron of the gene, wherein, EVX2 The nucleotide sequence of the gene is shown in SEQ ID NO. 1.
[0009] The application further provides a method for breeding or assisting in breeding bactrian camel lactation related varieties or strains by using the SNP molecular marker, specifically breeding or assisting in breeding bactrian camels with high / low non-fat solid rate.
[0010] Further, the detailed steps for breeding or assisting in breeding bactrian camels with high / low non-fat solid rate based on the SNP molecular marker are as follows: collecting bactrian camel tissue samples or blood samples, extracting bactrian camel genomic DNA, detecting the sequence of the 5th chromosome 48754135 nucleotide of the bactrian camel as C or A, determining the genotype of the bactrian camel to be tested as CC, CA or AA type, and selecting bactrian camels with AA genotype or CC genotype according to needs for next step of breeding and / or breeding.
[0011] Further, the non-fat solid rate of the bactrian camel with CC genotype is higher than that of the bactrian camel with CA genotype, and the non-fat solid rate of the bactrian camel with CA genotype is higher than that of the bactrian camel with AA genotype.
[0012] The application also provides a method for identifying the SNP molecular marker as described above, and the specific steps are as follows:
[0013] 1) Record the milk production trait:
[0014] Collect and obtain the milk production trait of bactrian camels, record the milk fat rate and its influencing factors, including population, year, parity, age, feeding method, sampling date;
[0015] 2) Obtain bactrian camel samples:
[0016] Take the corresponding Bactrian ear tissue samples, collect them in centrifuge tubes, immerse the samples in anhydrous ethanol, seal and number them, and store them at -80°C for standby use;
[0017] 3) Genomic DNA extraction:
[0018] According to the procedure of the animal tissue DNA extraction kit, camel genomic DNA samples were extracted, the concentration and quality of the DNA samples were detected using NanoDrop 2000, and the integrity of the DNA was detected by agarose gel electrophoresis;
[0019] 4) Genomic resequencing
[0020] The Illumina standard library preparation process was used to prepare sequencing libraries, and the Hiseq sequencing platform was used for Bactrian genomic resequencing, with a sequencing depth of 4x;
[0021] 5) Detection of variant sites:
[0022] The PLINK software was used to filter the raw library data to reduce the impact of base errors on the results, and the filtering criteria were as follows: (1) remove sequences with adapters; (2) remove sequences with indeterminate base information; (3) when a single-end sequence contains a quality less than 5, the pair of sequences needs to be removed; (4) only keep double-end sequences;
[0023] 6) Whole genome association analysis:
[0024] The Vcftools software was used to filter the SNPs in the variation according to the population variation distribution, and the filtering threshold included: (1) the number of minor alleles was greater than 3; (2) the SNP deletion rate was more than 5%; (3) the SNP quality was greater than 30; (4) the minimum sequencing depth was 5; (5) the minimum allele frequency was less than 0.05; finally, the filtered SNPs were used for whole genome association analysis, the rMVP software was applied, the general linear model (GLM), the mixed linear model (MLM), and the fixed and random model circulating probability unified method (FarmCPU) were used for whole genome association analysis, and the key candidate genes and sites affecting milk production traits were identified.
[0025] Further, in step 5) of detecting variant sites, the specific method is:
[0026] The genomic sequence is aligned to the camel reference genome (BCGSAC_Cfer_1.0 assembly) using BWA-mem software, and the alignment results are sorted and indexed using Samtools software; then, GATK software is used for downstream analysis: first, GATK MarkDuplicates is used to remove sequence repeats caused by PCR; then, GATK HaplotypeCaller is used to search for variations in the whole genome range; finally, GATKVariantFiltration is used for hard filtering of the variation sites, wherein the threshold for SNP filtering is set as "QD < 2.0, MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0", and the threshold for INDEL filtering is set as "QD < 2.0, FS > 200.0, SOR > 10.0, MQRankSum < -12.5, ReadPosRankSum < -8.0".
[0027] The application further provides a breeding method of Bactrian camels, comprising the following steps:
[0028] The genotype of the test Bactrian camel based on the SNP molecular marker is detected, and the Bactrian camel is selected according to the genotype, the sequence of the 48754135 nucleotide of the 5th chromosome of the Bactrian camel is C or A, the genotype of the to-be-tested Bactrian camel is determined to be CC, CA or AA type, the non-fat solid rate of the Bactrian camel with the CC genotype is higher than that of the Bactrian camel with the CA type, and the non-fat solid rate of the Bactrian camel with the CA genotype is higher than that of the Bactrian camel with the AA genotype.
[0029] The application discloses a gene related to a milk production trait of a Bactrian camel EVX2 , and a breeding method and application of using a single nucleotide polymorphism site (SNP) of the gene as a molecular marker for assisted selection. EVX2 The application first finds that the gene is related to high / low non-fat solid rate in a milk production trait of a Bactrian camel, thereby providing a candidate gene for breeding a Bactrian camel variety with excellent traits and improving the milk quality of camel milk.
[0030] Specifically, the application performs genome resequencing on 162 Bactrian camels by using a second-generation sequencing technology, identifies a molecular marker related to high / low non-fat solid rate in camel milk of a Bactrian camel in the gene through whole genome association analysis on the non-fat solid rate trait of a camel, and the marker is located at a 48754135 bp site of the 5th chromosome, and a C>A single base mutation (g.48754135C>A) occurs. EVX2 The mutation site can improve the non-fat solid rate of camel milk, and the marker can be used for carrying out molecular marker assisted selection on the non-fat solid rate trait of a Bactrian camel.
[0031] wherein, EVX2 The nucleotide sequence of the gene is shown as SEQ ID NO. 1.
[0032] The specific information of the 5 chromosome 48754135 bp site is as follows:
[0033] > ref|NC_045700.1|:48754038-48754235 Camelus ferus isolate YT-003-Echromosome 5, BCGSAC_Cfer_1.0, whole genome shotgun sequence
[0034] TTTTTCTCTTCCTGACCCAACCTTTCCTCCCCTTCCCGTTACCGCCCCCTCTTCCCTGGGCTCGCTGAGA
[0035] ACCCATGTCTCAATCCCTGGATTTGCACGGGGATTCTAGGCCTCTTTTGAAGAGAGGCTGCCGCTGCAGC
[0036] TTTTGTAAAAAGCTGCACGAAGTCACCGCACGAAGTCTTGAGTCCTCTGAGCTACAAG
[0037] In conclusion, due to the adoption of the above technical scheme, the beneficial effects of the present application are:
[0038] The present application first studies and finds that EVX2 The gene is associated with the site of high non-fat solid rate in lactation of Bactrian camel, and provides an effective candidate gene for breeding Bactrian camel varieties with excellent traits. Meanwhile, the present application identifies EVX2In the gene, one SNP (g.48754135C>A) is significantly associated with the non-fat solid rate of Bactrian camel. The site can be applied to the association analysis related to the milk production traits of Bactrian camel, and provides a new genetic marker resource for the molecular marker assisted selection of high / low non-fat solid rate of Bactrian camel. In short, the present application adopts the method of whole genome association analysis to screen and identify the genes related to the milk production of Bactrian camel. For the identified candidate genes, the present application further adopts the candidate gene method strategy to determine whether there is a site associated with the milk production traits of Bactrian camel in the researched gene, so as to further verify the relationship between the candidate gene and the lactation performance. In addition, through the candidate gene method, the SNP site identified in association with the milk production traits can be used as a molecular marker for the selection of excellent traits of Bactrian camel, which is helpful for the genetic progress of the milk production performance of Bactrian camel. The present application has the characteristics of simple operation, short time consumption, high accuracy of selected markers and the like, and also provides technical support for the genetic analysis of other important economic traits of livestock and poultry. BRIEF DESCRIPTION OF DRAWINGS
[0039] Figure 1 : The whole genome association analysis screens the genes and SNP sites related to the high and low non-fat solid rate of Bactrian camel. EVX2 DETAILED DESCRIPTION
[0040] The present application provides a kind of Bactrian camel milk production trait related gene EVX2 As the application of molecular genetic marker related to the milk production traits of Bactrian camel. The milk production traits specifically refer to the non-fat solid rate of Bactrian camel.
[0041] The SNP molecular marker related to the non-fat solid rate of Bactrian camel is located at the nucleic acid site of 48754135 of Bactrian camel chromosome 5, the base of the site is C or A, and is contained in EVX2 The intron of gene, wherein, EVX2 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0042] The present application also provides a method for selecting or assisting in selecting Bactrian camel lactation related varieties or strains using the SNP molecular marker, specifically for selecting or assisting in selecting Bactrian camel with high / low non-fat solid rate. The detailed steps for selecting or assisting in selecting Bactrian camel with high / low non-fat solid rate based on the SNP molecular marker are as follows: collecting Bactrian camel tissue samples or blood samples, extracting Bactrian camel genomic DNA, detecting the sequence of nucleotide 48754135 of the 5th chromosome of Bactrian camel as C or A, determining the genotype of the Bactrian camel to be tested as CC, CA or AA type, and selecting AA genotype or CC genotype of Bactrian camel according to the needs for next step selection and / or breeding. The non-fat solid rate of the Bactrian camel with CC genotype is higher than that of the Bactrian camel with CA genotype, and the non-fat solid rate of the Bactrian camel with CA genotype is higher than that of the Bactrian camel with AA genotype.
[0043] The whole genome association analysis screens out genes and SNP sites associated with the high and low non-fat solid content of Bactrian camels EVX2 as shown in Figure 1 .
[0044] The application also provides a method for identifying the SNP molecular marker, and the specific steps are as follows:
[0045] 1) Record the milk production traits:
[0046] The milk production traits of Bactrian camels are collected and obtained, and the milk fat content and influencing factors are recorded, including population, year, parity, age, feeding mode, sampling date;
[0047] 2) Obtain the Bactrian camel sample:
[0048] The corresponding ear tissue sample of the Bactrian camel is taken, collected in a centrifuge tube, and immersed in anhydrous ethanol. After sealing and numbering, it is stored at -80℃ for standby;
[0049] 3) Genomic DNA extraction:
[0050] According to the process of the animal tissue DNA extraction kit instruction book, the camel genomic DNA sample is extracted, the concentration and quality of the DNA sample are detected by NanoDrop 2000, and the integrity of the DNA is detected by agarose gel electrophoresis;
[0051] 4) Genomic resequencing
[0052] The Illumina standard library preparation process is used to prepare the sequencing library, and the Hiseq sequencing platform is used for Bactrian camel genomic resequencing, and the sequencing depth is 4x;
[0053] 5) Detecting variation sites:
[0054] The PLINK software is used to filter the measured raw library data to reduce the influence of base errors on the results, and the filtering standards are as follows: (1) remove the sequences with adapters; (2) remove the sequences with indeterminate base information; (3) when the single-end sequence contains a quality lower than 5, the sequence pair needs to be removed; (4) only keep the double-end sequence;
[0055] 6) Whole genome association analysis:
[0056] The Vcftools software is used to filter the SNP in the variation according to the population variation distribution, and the filtering threshold includes: (1) the number of secondary alleles is greater than 3; (2) the SNP deletion rate is more than 5%; (3) the SNP quality is greater than 30; (4) the minimum sequencing depth is 5; (5) the minimum allele frequency is less than 0.05; finally, the filtered SNP is used for whole genome association analysis, and the rMVP software is used to perform whole genome association analysis by using a general linear model (GLM), a mixed linear model (MLM), a fixed and random model cycle probability unified method (FarmCPU), so as to identify key candidate genes and sites affecting milk yield traits.
[0057] Further, when detecting the variation site in step 5), the specific method is as follows: the BWA-mem software is used to align the genome sequence to the camel reference genome (BCGSAC_Cfer_1.0 assembly), and the Samtools software is used to sort and index the alignment results; then, the GATK software is used for downstream analysis: first, GATK MarkDuplicates is used to remove sequence repeats caused by PCR; subsequently, GATK HaplotypeCaller is used to search for variations in the whole genome range; finally, GATK VariantFiltration is used for hard filtering of the variation site, wherein the threshold for SNP filtering is set as “QD < 2.0, MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0”, and the threshold for INDEL filtering is set as “QD < 2.0, FS > 200.0, SOR > 10.0, MQRankSum < -12.5, ReadPosRankSum < -8.0”.
[0058] The application further provides a breeding method of Bactrian camel, which comprises the following steps:
[0059] The genotype of the test Bactrian camel based on the SNP molecular marker is detected, and the Bactrian camel is selected according to the genotype, the sequence of the nucleotide 48754135 of the 5th chromosome of the Bactrian camel is C or A, the genotype of the to-be-tested Bactrian camel is determined to be CC, CA or AA type, the non-fat solid rate of the Bactrian camel with the CC genotype is higher than that of the Bactrian camel with the CA type, and the non-fat solid rate of the Bactrian camel with the CA genotype is higher than that of the Bactrian camel with the AA genotype.
[0060] The application discloses a gene related to milk yield traits of Bactrian camel EVX2 , and a breeding method and application of using a single nucleotide polymorphism site (SNP) as a molecular marker for assisted selection. EVX2The gene associated with high / low non-fat solid rate in the milk production trait of Bactrian camel provides a candidate gene for breeding Bactrian camel varieties with excellent traits and improving the milk quality of camel.
[0061] Specifically, the application utilizes the second-generation sequencing technology to perform genome resequencing on 162 Bactrian camels, performs whole genome association analysis on the non-fat solid rate trait of camels, identifies EVX2 The molecular marker associated with high / low non-fat solid rate in the milk of Bactrian camel in the gene. The marker is located at the 48754135 bp site of chromosome 5, and a C>A single base mutation (g.48754135C>A) occurs. The mutation site can improve the non-fat solid rate of camel milk, and the marker can be used for molecular marker assisted selection for the non-fat solid rate trait of Bactrian camel.
[0062] The application will be described in detail below in combination with the drawings and specific embodiments.
[0063] Embodiment 1
[0064] Select 162 Bactrian camels with detailed milk production records, and the non-fat solid rate determination data are shown in Table 1. Take 30-50 mg of ear tissue of the corresponding Bactrian camel, collect in a 5 mL centrifuge tube, add anhydrous ethanol to immerse the sample, seal and number, and store at -80℃ for standby.
[0065] Table 1 Non-fat solid rate of 162 Bactrian camels
[0066]
[0067] Cut about 30 mg of Bactrian camel ear tissue sample in a centrifuge tube, add 1 ml of PBS to wash to basically remove ethanol, transfer the tissue to a new centrifuge tube and cut as much as possible. Take 200 μl of proteinase K in a centrifuge tube, mix well by inverting, and shake in a 56℃ shaking water bath or metal bath until the tissue is completely dissolved (about 6 hours). Extract the camel genomic DNA sample according to the procedure of the animal tissue sample DNA extraction kit instruction. Use the spectrophotometer NanoDrop 2000 to detect the concentration and quality of the DNA sample. Use agarose gel electrophoresis to detect the integrity of the DNA.
[0068] For the qualified genomic DNA samples, use the Illumina standard library preparation process to prepare the sequencing library, use the Hiseq sequencing platform to perform genome resequencing of Bactrian camel, and the sequencing depth is 4x.
[0069] For the raw data obtained by sequencing, the method introduced in the patent is installed, first, the PLINK software is used for filtering processing. Then, the BWA-mem software is used to align the genome sequence to the camel reference genome. Secondly, the Samtools software is used to sort and index the alignment results, and the GATK software is used for hard filtering of the variant sites. Further, the Vcftools software is used to filter the SNPs in the variation according to the population variation distribution. After quality control, 3,102,334 SNP variant sites are finally obtained, which can be used for whole genome association analysis of milk fat percentage traits.
[0070] The rMVP software is used to perform whole genome association analysis by using general linear model (GLM), mixed linear model (MLM), fixed and random model cycle probability unified method (FarmCPU), respectively. 36 significant SNP sites related to Bactrian camel non-fat solid rate are screened and identified, and the significant marker level is P<1.61×10 -8 The significant site is located in the EVX2 gene, and the corresponding P value is 4.94×10 -9 identified by the FarmCPU model.
[0071] Finally, the genotype corresponding to the target site g.48754135C>A is compared and analyzed with the non-fat solid rate of Bactrian camel: 150 Bactrian camels with CC genotype, and the non-fat solid rate is 9.42 ± 0.05%; 7 Bactrian camels with CA genotype, and the non-fat solid rate is 8.78 ± 0.23%; 5 Bactrian camels with AA genotype, and the non-fat solid rate is 8.40 ± 0.27%. Among them, the non-fat solid rate of Bactrian camel with CC genotype is higher than that of Bactrian camel with CA genotype and AA genotype. Therefore, g.48754135C>A is identified as a variation site that can improve the non-fat solid rate of camel milk, and therefore, Bactrian camels with CC genotype can be selected for further selection or breeding to improve the non-fat solid rate of camel milk.
[0072] The above description of the embodiments is for the convenience of those skilled in the art to understand and use the invention. Those skilled in the art can easily make various modifications to these embodiments, and apply the general principles described herein to other embodiments without having to go through creative labor. Therefore, the present application is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art within the scope of the present application without departing from the scope of the present application should be within the scope of protection of the present application.
Claims
1. The application of a reagent for detecting SNP molecular markers associated with the non-fat solids content trait of Bactrian camels in the preparation or assisted selection of Bactrian camels with high non-fat solids content, characterized in that: The SNP molecular marker is the SNP variant site g.48754135 C>A in the EVX2 gene. The reference genome sequence of Bactrian camel is shown in NC_045700.1, and the nucleotide sequence of the EVX2 gene is shown in SEQ ID NO.
1. Among them, the non-fat solids content of Bactrian camels with the CC genotype is higher than that of Bactrian camels with the CA genotype, and the non-fat solids content of Bactrian camels with the CA genotype is higher than that of Bactrian camels with the AA genotype.
2. The application of a reagent for detecting SNP molecular markers associated with the non-fat solids content trait of Bactrian camels in the breeding or assisted breeding of Bactrian camel breeds with high non-fat solids content, characterized in that: The SNP molecular marker is the SNP variant site g.48754135 C>A in the EVX2 gene. The reference genome sequence of Bactrian camel is shown in NC_045700.1, and the nucleotide sequence of the EVX2 gene is shown in SEQ ID NO.
1. Among them, the non-fat solids content of Bactrian camels with the CC genotype is higher than that of Bactrian camels with the CA genotype, and the non-fat solids content of Bactrian camels with the CA genotype is higher than that of Bactrian camels with the AA genotype.
Citation Information
Patent Citations
Marking method for indicating and distinguishing domestic and wild Bactrian camel DNA microsatellites
CN101445830A
Two-humped camel polymorphism primer, screening method of polymorphism primer and method for identifying parenthood
CN104630383A