Vibrio binding protein of cynoglossus semilaevis and application thereof

CN116102636BActive Publication Date: 2026-06-30YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
Filing Date
2022-07-04
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In the farming of half-smooth tongue sole, infectious diseases caused by Vibrio species such as Vibrio harveyi and Vibrio anguillarum lead to a decrease in farming yield, and existing technologies are insufficient to effectively block the adhesion and infection of Vibrio pathogens.

Method used

We provide type VI collagen α2 (COL6A2) from the tongue sole, which has the ability to bind to various Vibrio species. As a target protein to block the adhesion and infection of Vibrio pathogens, it can be used to develop strategies for the prevention and control of vibrio infection. The expression level of COL6A2 protein was detected by real-time quantitative PCR to screen individuals resistant to vibrio infection.

Benefits of technology

Effectively blocking Vibrio adhesion and infection provides a new strategy for preventing and controlling Vibrio diseases in half-smooth tongue sole, and offers a new approach for developing novel antibacterial drugs, thereby enhancing the healthy and sustainable development of the aquaculture industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116102636B_ABST
    Figure CN116102636B_ABST
Patent Text Reader

Abstract

This invention provides the application of Vibrio receptor protein type VI collagen α2 from the tongue sole as a target protein for blocking Vibrio pathogen adhesion and infection of tongue sole cells, providing an important foundation for the research and development of strategies and disease control technologies for the prevention and treatment of vibrio infections in tongue sole. This invention discovers that tongue sole type VI collagen α2 can mediate the binding of various Vibrio pathogens to tongue sole, and can serve as a candidate protein for blocking Vibrio adhesion and infection of tongue sole cells, thus providing a new strategy for the prevention and treatment of vibrio diseases in tongue sole. This invention also provides a new approach for the development of novel antibacterial drugs, which has application value in the prevention and treatment of tongue sole diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of aquatic organism immune and disease-resistant protein technology, and particularly relates to a Vibrio-binding protein of the tongue sole and its application. Background Technology

[0002] Half-smooth tongue sole (Cynoglossus semilaevis) belongs to the order Pleuronectiformes, family Cynoglossidae, and genus Cynoglossus. Due to its delicious taste and high nutritional value, it has significant economic value and is one of the leading species in my country's turbot aquaculture industry. In recent years, the half-smooth tongue sole aquaculture industry has suffered from serious disease problems, particularly infectious diseases caused by Vibrio species such as Vibrio harveyi and Vibrio anguillarum, leading to a large-scale decline in aquaculture yields and severely limiting the healthy and sustainable development of the half-smooth tongue sole aquaculture industry.

[0003] The complex interactions between pathogenic microorganisms and host cells form the basis of infectious diseases. These processes include pathogen adhesion to the host surface, infection, signal transduction, and interactions between pathogens and the immune system. Among these, pathogen adhesion and invasion of the host surface are the first steps in bacterial infection, crucial for bacteria to invade the host and exert their virulence. The extracellular matrix (ECM) is widely distributed in the body and is composed of proteins, polysaccharides, and water. ECM proteins mainly include collagen, laminin, and fibronectin. The ECM structure is largely similar across different animals and participates extensively in various cellular functions, including maintaining cellular homeostasis, inflammatory responses, and bacterial infection responses. Previous studies have reported that the extracellular matrix is ​​a potential site for bacterial-cell interactions, and that various extracellular matrix proteins have bacterial binding capabilities, acting as Vibrio receptors to mediate Vibrio adhesion and infection of cells.

[0004] Screening and identifying receptor proteins in the extracellular matrix of half-smooth tongue sole that mediate the binding of Vibrio to Vibrio, and elucidating the interaction between Vibrio and cells, are important foundations for studying anti-Vibrio strategies and controlling infectious diseases caused by Vibrio. This has significant research value and application value for the prevention and control of diseases in half-smooth tongue sole and the cultivation of disease-resistant varieties. Summary of the Invention

[0005] The purpose of this invention is to provide a Vibrio receptor protein, type VI collagen α2 (COL6A2), for the tongue sole. The provided protein has the ability to bind to various Vibrio species and can serve as a target protein to block the adhesion and infection of Vibrio pathogens to tongue sole cells. This provides an important foundation for the research and development of strategies for the prevention and control of vibrio infection in tongue sole and for disease control technologies.

[0006] The type VI collagen α2 (COL6A2) from the tongue sole provided by this invention has the following amino acid sequence: SEQ ID NO:1:

[0007]

[0008] The nucleotide sequence of its encoding gene is SEQ ID NO:2:

[0009]

[0010] Another aspect of the present invention also provides an use of the COL6A2 protein, wherein the use is in Vibrio binatus;

[0011] The Vibrio species include Vibrio parahaemolyticus, Vibrio anguillarum, or Vibrio harveyi.

[0012] In another aspect, the present invention also provides the use of the COL6A2 protein as a screening marker for vibrio-resistant families in half-smooth tongue sole;

[0013] The present invention also provides a method for screening individuals of half-smooth tongue sole with anti-vibrio disease potential, which is to screen individuals of half-smooth tongue sole by detecting the expression level of the COL6A2 protein.

[0014] The detection of COL6A2 protein expression level refers to the detection of the expression level of the gene encoding COL6A2 protein in the kidneys and skin of the tongue sole.

[0015] The method described is a real-time PCR detection method, and the sequence information of the detection primers used is as follows:

[0016] Upstream primer: 5′-TGTAGACTCCCAGACATAAACAGAG-3′ (SEQ ID NO:3)

[0017] Downstream primer: 5′-GCGGAGAGTTTATGGAAGTTTATGG-3′ (SEQ ID NO:4);

[0018] The present invention also provides an article for the prevention or treatment of vibrio semismooth tongue infection, said article comprising a reagent for inhibiting the expression of COL6A2 protein, and / or a reagent for competitively binding COL6A2 protein.

[0019] This invention discovers that type VI collagen α2 from half-smooth tongue sole can mediate the binding of various Vibrio pathogens to the tongue sole, serving as a candidate protein for blocking Vibrio adhesion and infection of tongue sole cells, thus providing a new strategy for the prevention and control of Vibrio diseases in half-smooth tongue sole. This invention also provides a new approach for the development of novel antibacterial drugs, which has application value in the prevention and control of diseases in half-smooth tongue sole. Attached Figure Description

[0020] Figure 1Figure 1: Induction, isolation, purification and identification of recombinant protein COL6A2 from tongue sole; lane 1: recombinant protein induction expression, lanes 2 and 3: recombinant protein after purification and dialysis, M: protein marker.

[0021] Figure 2 Western blot analysis of the binding of the recombinant protein COL6A2 from the tongue sole to three Vibrio species, where VA: Vibrio anguillarum; VH: Vibrio harveyi; VP: Vibrio parahaemolyticus.

[0022] Figure 3 : Vibrio cell adhesion analysis diagram, where pcDNA3.1 is HEK293T cells overexpressing the col6a2 gene; pcDNA3.1 is the control HEK293T cells; * indicates significant difference (p<0.05).

[0023] Figure 4 Expression levels of the col6a2 gene in the kidneys and skin tissues of resistant and susceptible families in the half-smooth tongue sole (qPCR quantitative detection), where Ki: kidney; Sk: skin. * indicates a significant difference in expression levels between resistant and susceptible families (p<0.05), and ** indicates an extremely significant difference (p<0.01). Detailed Implementation

[0024] This invention has discovered that the Vibrio receptor protein type VI collagen α2 (alpha-2 subunit of type VI collagen, col6a2, abbreviated as COL6A2 protein in this specification) of half-smooth tongue sole has the ability to bind to various Vibrio species and can serve as a target protein to block the adhesion and infection of Vibrio pathogens to half-smooth tongue sole cells.

[0025] As a specific example, the amino acid sequence of Vibrio receptor protein type VI collagen α2 (alpha-2 subunit of type VI collagen, COL6A2) is SEQ ID NO:1; however, it can also be obtained by substituting, deleting, or adding one or more amino groups to the amino acid sequence SEQ ID NO:1, and also has alleles that bind to various Vibrio species.

[0026] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0027] Example 1: Preparation of recombinant protein COL6A2 from half-smooth tongue sole

[0028] 1. Construction of the recombinant expression vector for COL6A2 protein

[0029] Based on the half-smooth tongue sole col6a2 gene coding sequence in the NCBI database, specific primers with EcoRI restriction sites and histone (His) tags were designed using Primer Premier 5.0 software.

[0030] 9k-col6a2F:

[0031] GCTGAAGCTTACGTAGAATTCTCAGAGTGCAGTAAGAAAAACGAATG

[0032] 9k-col6a2R:

[0033] CGCGGCCGCCCTAGGGAATTCCTAGTGGTGATGGTGATGATGGC

[0034] Amplification of CDS-encoded cDNA lacking the Col6a2 signal peptide, using cloning The Ultra One Step Cloning Kit (Vazyme, Nanjing) was used to treat His-tagged PCR products with T4 ligase, insert them into the peasyE1 prokaryotic expression vector, and transform them into *E. coli* DH5α. Positive clones were identified by sequencing, and the recombinant expression plasmid was extracted from the positive clones. This recombinant expression plasmid was then transformed into the *Pichia pastoris* GS115 eukaryotic expression strain. The positive clones are the engineered yeast strain pic9K-Col6a2-GS115 containing the recombinant plasmid.

[0035] 2. Induction and purification of recombinant proteins

[0036] Single clones of the gene strain were inoculated into YDPH liquid medium and cultured at 37°C with shaking until the OD600 reached 0.6, followed by 12 hours of induction culture. 12% SDS-PAGE electrophoresis showed that a band of the target protein appeared at approximately 113 kDa. Figure 1 ).

[0037] The induced bacterial culture was centrifuged at 8000 rpm for 10 min at 4 °C, and the bacterial cells were collected. The bacterial pellet was denatured with 7 M urea, and the supernatant was collected by centrifugation. After filtration through a 0.45 μm microporous membrane, the protein was purified using a HisTrap FF crude purification column. First, the purification column was incubated with 5 mL of binding buffer (20 mM / L Na3PO4, 0.5 M NaCl, 20 mM / L imidazole). The supernatant containing the target protein was slowly passed through the purification column at a flow rate of 1 mL / min. Then, the purification column was washed with 5 mL of binding buffer, and the target protein was eluted with 5 mL of elution buffer (20 mM / L Na3PO4, 0.5 M NaCl, 500 mM / L imidazole). The purified target protein was collected and its size was determined by 12% SDS-PAGE electrophoresis. The confirmed target protein was dialyzed with a decreasing concentration of urea to assist protein folding, obtaining renatured protein. The electrophoresis result showed a single band. Figure 1 The BCA protein quantification kit was used to quantify the protein after dialysis.

[0038] Example 2: Adhesion of recombinant COL6A2 protein from half-smooth tongue sole to bacteria.

[0039] Three types of Vibrio bacteria—Vibrio parahaemolyticus, Vibrio anguillarum, and Vibrio harveyi—were cultured overnight. Then, 900 μL of the bacterial suspension was mixed with 100 μL of recombinant COL6A2 protein solution and incubated at room temperature (25 °C) for 40 min. The precipitate was recovered by centrifugation at 2000 rpm for 2 min and analyzed by Western blotting. Samples were separated by SDS-PAGE and then transferred to a nitrocellulose membrane (300 mA, 40 min). After electroporation, the membrane was blocked with 5% (w / v) skim milk blocking buffer for 2 hours. The membrane was then washed three times with TBST (TBS containing 0.05% Tween-20), and incubated overnight at 4°C with mouse anti-His-tag antibody (primary antibody, 1:1000 dilution). Next, it was incubated at 37°C for 1 hour with HRP-labeled goat anti-mouse IgG (secondary antibody, 1:1000 dilution). Finally, it was stained with DAB (3,3'-diaminobenzidine) solution for 10 minutes. The results are as follows: Figure 2 As shown, the COL6A2 recombinant protein can directly bind to three types of Vibrio bacteria: Vibrio parahaemolyticus, Vibrio anguillarum, and Vibrio harveyi.

[0040] Example 3: Cell-bacterial adhesion experiment with overexpression of the col6a2 gene in half-smooth tongue sole

[0041] Human embryonic kidney cell line HEK293T was identified by the American Type Culture Collection (ATCC) (purchased from Procell, China) and cultured in DMEM medium (supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin) at 37°C. A pcDNA3.1-col6a2 plasmid with a GFP tag was constructed for col6a2 gene overexpression. Lipo8000 was used to... TM The recombinant vector (pcDNA3.1-col6a2) was transfected using transfection reagents (2 μg DNA and 6 μL Lipo8000). Following transfection, cells were treated with 500 μg / mLG418 for 4 weeks to obtain cells with stable expression.

[0042] Then, bacterial and col6a2 gene-expressing cell adhesion assays were performed. HEK293T cells (2×10⁻⁶) were used. 5 Inoculate 10 cells / well into 24-well cell culture plates. After overnight culture, collect Vibrio parahaemolyticus, Vibrio anguillarum, and Vibrio harveyi (10 cells / well). 2 -10 3 50 μL of CFU / mL was added to each cell well and incubated for 30 min. Then, the culture plate was gently washed with PBS to remove unattached bacteria. Adherent cells were collected. Cells bound to Vibrio parahaemolyticus and Vibrio anguillarum were transferred to LB agar plates and incubated at 28°C for 12 h; cells bound to Vibrio harveyi were transferred to trypsin-soybean fermentation broth plates and incubated at 37°C for 12 h. Colony counting was performed under a microscope. One-way ANOVA showed statistical significance (p < 0.05). The results showed that the number of Vibrio parahaemolyticus, Vibrio anguillarum, and Vibrio harveyi bound in cells overexpressing the col6a2 gene was significantly higher than that in the control group. Figure 3 This indicates that the protein encoded by the col6a2 gene has the ability to bind to Vibrio.

[0043] Example 4: Transcriptional expression analysis of the col6a2 gene in disease-resistant and susceptible families of the half-smooth tongue sole.

[0044] 1. Breeding of disease-resistant and susceptible families of half-smooth tongue sole

[0045] First, the genetic sex of the parent fish was identified using sex-specific AFLP markers, and full-sib families were constructed by pairing one male with one female. Each family was injected with a visible fluorescent dye. When the average total length of the tongue sole was 10-12 cm, artificial infection with Vibrio harveyi was performed by intraperitoneal injection of the median lethal dose (LD50). The mortality rate of each family after infection was recorded, and families with survival rates above 80% and below 30% were identified as resistant and susceptible families, respectively.

[0046] 2. Determination of the expression level of the col6a2 gene in disease-resistant and susceptible families of half-smooth tongue sole

[0047] Skin and kidney tissues were collected from disease-resistant and susceptible families, respectively. Total RNA was first extracted using the Trizol method and then reverse transcribed into cDNA using the Takara reverse transcription kit. Specific primers, col6a2-F: 5'-TGTAGACTCCCAGACATAAACAGAG-3' (SEQ ID NO:3) and col6a2-R: 5'-GCGGAGAGTTTATGGAAGTTTATGG-3' (SEQ ID NO:4), were designed based on the col6a2 gene sequence. The expression levels of the col6a2 gene in the tissues of both disease-resistant and susceptible families were detected using real-time quantitative PCR (qPCR). The total qPCR reaction volume was 20 μl, containing 1×SYBR Premix Ex Taq, a single primer at 200 nM, 1×ROX Reference Dye II (Takara, Japan), and 1 μl of cDNA template. Each sample was tested in triplicate. The reaction conditions were: denaturation at 95℃ for 30 s, followed by 40 cycles of 95℃ for 5 s and 60℃ for 33 s. After the reaction, the relative expression was analyzed using the 2-ΔΔCt method. One-way ANOVA was used to determine whether the statistical significance was achievable (p < 0.05), followed by Dunnett's test.

[0048] The results showed that the expression level of the col6a2 gene in the skin and kidneys of resistant half-smooth tongue sole families was significantly lower than that in susceptible families, indicating that there is a negative correlation between the expression level of the col6a2 gene in the skin and kidneys of half-smooth tongue sole and disease resistance. Therefore, the col6a2 gene can be used as a marker gene for screening half-smooth tongue sole families resistant to vibrio infection.

Claims

1. A method for screening individuals of the half-smooth tongue sole with potential resistance to vibrio disease, characterized in that, The method described above is to screen individuals of the tongue sole by detecting the expression level of type VI collagen α2 with the amino acid sequence SEQ ID NO:1 in the kidneys and skin of the tongue sole. The Vibrio species mentioned are Vibrio parahaemolyticus, Vibrio anguillarum, or Vibrio harveyi.

2. The method as described in claim 1, characterized in that, The detection method described is quantitative real-time PCR.

3. The method as described in claim 2, characterized in that, The primer pair used in the method has the sequence of the upstream primer as SEQ ID NO:3 and the sequence of the downstream primer as SEQ ID NO:4.