A colorimetric biosensor for detecting escherichia coli and a preparation method thereof
By using a colorimetric biosensor based on G-quadruplex DNAzyme and AuNRs, and employing hairpin probes and electrostatic adsorption technology, the problems of time-consuming, costly, and low-sensitivity detection of E. coli have been solved, enabling rapid, low-cost, and highly sensitive qualitative and quantitative detection.
Patent Information
- Application Number
- CN202310197997.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-03
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2043-03-03
AI Technical Summary
Existing E. coli detection technologies are time-consuming, costly, and have low sensitivity. Common methods such as ELISA and PCR also suffer from problems such as complex preparation, high equipment requirements, and high false positive rates.
A colorimetric biosensor based on G-quadruplex DNAzyme and AuNRs was developed. Gold nanorods were modified with hairpin probes HAP, H1 hairpin, and H2 hairpin. Through electrostatic adsorption and HCR reaction, combined with heme and H2O2-catalyzed TMB oxidation to form a colorimetric reaction, a highly efficient and specific detection of Escherichia coli was achieved.
It enables rapid, low-cost, and highly sensitive qualitative and quantitative detection, with a low detection limit for E. coli and significant color changes, making it suitable for detection in grassroots units.
Smart Images

Figure CN116106547B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of sensor technology and relates to a colorimetric biosensor for detecting Escherichia coli based on G-quadruplexes and AuNRs. Background Technology
[0002] Escherichia coli ( Escherichia coli Escherichia coli (E. coli) is a facultative anaerobic bacterium in the human colonic flora. It can be widely dispersed in the environment after being excreted in feces, thus it is considered a hygienic indicator for waterborne pathogens and foodborne fecal contamination. E. coli O157:H7, having acquired virulence factors encoded by genetic elements, is a common pathogenic E. coli. Currently, common methods for detecting E. coli include: Enzyme-linked immunosorbent assay (ELISA), which is highly specific and efficient, and widely used in grassroots testing units; however, it has high preparation costs, complex production processes, limited availability of capture molecules for the target analyte, poor physical and chemical stability, and significant batch-to-batch variability. Polymerase chain reaction (PCR) primarily detects pathogenic genes in E. coli, offering advantages such as rapid detection and high sensitivity, but also suffers from drawbacks such as a high susceptibility to false positives, the need for complex equipment, and significant variations in reaction efficiency. Therefore, developing rapid, low-cost, highly sensitive, and selective detection technologies is of great significance for the prevention and timely diagnosis of foodborne pathogens. Summary of the Invention
[0003] To address the shortcomings of existing E. coli detection technologies, such as high time consumption, high cost, and low sensitivity, this invention provides a colorimetric biosensor for detecting E. coli based on G-quadruplex DNAzyme and AuNRs. This biosensor exhibits high reaction efficiency, good specificity, low detection limit, significant color change, and is suitable for qualitative and quantitative determination of E. coli count.
[0004] To achieve the above objectives, the present invention adopts the following technical solution.
[0005] A biosensor for detecting Escherichia coli includes gold nanorods modified with H1 and H2 hairpins, hairpin probes (HAP), ST composite probes, heme, potassium ions, H2O2, and tetramethylbenzidine.
[0006] The nucleotide sequences of the hairpin probes HAP, H1 hairpin, and H2 hairpin are shown in SEQ ID NO:1-3;
[0007] The ST composite probe is formed by complementary pairing of the S and T chains of nucleotide sequences as shown in SEQ ID NO:4-5;
[0008] H1 and H2 hairpins are electrostatically adsorbed onto the AuNRs surface.
[0009] The gold nanorods are prepared as follows:
[0010] (1) Seed liquid is obtained by reacting HAuCl4 solution, CTAB solution and NaBH4 solution;
[0011] (2) After mixing HAuCl4 solution and CTAB solution, AgNO3 solution, ascorbic acid and seed liquid were added to react and the reaction solution was obtained. After centrifuging the reaction solution, the precipitate was washed to obtain gold nanorods (AuNRs).
[0012] In step (1), the molar ratio of CTAB to HAuCl4 is 400:1; the molar ratio of HAuCl4 to NaBH4 is 1:2.4.
[0013] In step (1), the reaction temperature is 20℃-30℃ and the reaction time is 1h.
[0014] In step (2), the molar ratio of CTAB to HAuCl4 is 20:1; the molar ratio of AgNO3 to HAuCl4 is 24:1000; and the molar ratio of ascorbic acid to HAuCl4 is (0.1-0.12):1.
[0015] In step (2), the reaction temperature is 20℃-30℃ and the reaction time is 6-10h.
[0016] In step (2), the centrifugation speed is 8500 rpm.
[0017] The method for preparing the gold nanorods modified with H1 and H2 hairpins includes the following steps:
[0018] (a) Mix the solutions of H1 hairpins and H2 hairpins with the gold nanorod suspension and incubate at room temperature;
[0019] (b) Add NaCl solution to the suspension obtained in step (a), react at room temperature, centrifuge the suspension after reaction, wash the precipitate, and obtain gold nanorods modified with H1 hairpins and H2 hairpins.
[0020] The molar ratio of the H1 hairpin, H2 hairpin, and gold nanorod is 8:8:1.
[0021] The centrifugation speed is 6000 rpm.
[0022] A kit comprising the aforementioned biosensor for detecting Escherichia coli.
[0023] The detection principle of this invention is as follows: Figure 1 As shown, the nucleotide sequences of each element are as follows:
[0024] Hairpin probe HAP (underlined portion is the E. coli aptamer sequence)
[0025] 5'- CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGT GACGGTGTAACTGC CCGTCACACC-3'
[0026] S-Chain
[0027] 5'-GCAGTTACATACTTAAACACCTTCTT-3'
[0028] T-Chain
[0029] 5'-AAGAAGGTGTTTAAGTA-3'
[0030] H1 hairpin (underlined part is the toehold sequence)
[0031] 5'-AGGGCGGGTGGGTGTTTAAGTTGGAGAATTG TACTTAAACACCTT CTTCTTGGGT-3'
[0032] H2 hair clip
[0033] 5'-TGGGTCAATTCTCCAACTTAAACTAG AAGAAGGTGTTTAAG TTGGGTAGGCGGG-3'
[0034] The HAP in this invention is a DNA hairpin containing an aptamer portion of *E. coli*. When the target *E. coli* is absent, the HAP is in a stable state. In the presence of *E. coli*, the aptamer portion of the HAP specifically recognizes and binds to it, causing the hairpin structure of the HAP to open, thereby exposing the complementary pairing region with the S strand.
[0035] The S chain contains regions that are complementary to the T chain, which can form the ST composite probe. The HAP promotes the chain substitution reaction by binding to the unpaired single chain in the ST, thereby replacing the T chain.
[0036] AuNRs enrich hairpins H1 and H2 through electrostatic adsorption; the replaced T chain acts as a trigger chain, opening the hairpin structure of H1 through the toehold region of H1, exposing the part of H1 that binds to H2. The exposed part of H2, in turn, can open H1, thus generating a highly efficient HCR reaction, ultimately forming a long double-chain HCR product.
[0037] The tails of H1 and H2 contain split G-quadruplex sequences. The resulting long double-chain products shorten the distance between the split G-quadruplexes, thus enabling the formation of a complete G-quadruplex structure. In the presence of heme intercalation and H2O2, TMB is catalyzed to oxidize into TMB oxide. This reaction is accompanied by a color change visible to the naked eye.
[0038] The present invention has the following advantages:
[0039] In the biosensor provided by this invention, the hairpin probe HAP is stable in the absence of E. coli, thus preventing subsequent reactions and ensuring the specificity of the sensing platform. Signal amplification based on HCR technology greatly improves the detection limit of this colorimetric sensing platform. AuNRs enrich the hairpins through electrostatic adsorption, increasing reaction efficiency. The TMB colorimetric reaction is used to detect E. coli, providing a visually perceptible color change for qualitative determination. The number of E. coli can also be quantitatively determined by measuring absorbance. Attached Figure Description
[0040] Figure 1 This is a schematic diagram of the present invention;
[0041] Figure 2 TEM characterization images of AuNRs;
[0042] Figure 3 Optimization diagram of ST composite probe addition amount;
[0043] Figure 4 The image shows the optimized detection results for heme.
[0044] Figure 5 Figure showing the optimized detection results for reaction time.
[0045] Figure 6 The UV-Vis spectra are those corresponding to different concentrations of Escherichia coli added to the system. Detailed Implementation
[0046] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.
[0047] Example 1: Construction of Biosensors
[0048] (1) Hairpin probes HAP, H1 hairpin, H2 hairpin, S chain and T chain were synthesized according to the sequence SEQ ID NO:1-5, and solutions were prepared.
[0049] (2) Incubate 10 μM HAP, H1 and H2 in a 95℃ water bath for 5 min to denature them, then quickly transfer them to an ice water bath for about 40 min, cool them and store them at 4℃ for later use.
[0050] (3) Incubate 10 μM S chain and 10 μM T chain in Tris-HCl buffer (50 mM Tris, 0.5 M NaCl 100 mM KCl, pH 7.4) in a 95°C water bath for 5 min, then slowly cool to room temperature to form ST composite probes, and store at 4°C for later use.
[0051] (4) Preparation of gold nanorods (DNA-AuNRs) modified with H1 hairpins and H2 hairpins
[0052] (a) Preparation of gold seeds: 5 mL of CTAB solution (0.2 M), 5 mL of HAuCl4 (0.0005 M) and 0.6 mL of freshly prepared NaBH4 (0.01 M) were added sequentially and incubated in a water bath at 26 °C for 1 h;
[0053] (b) Growth of gold nanorods: 100 mL of HAuCl4 (0.01 M) was added to 100 mL of 0.2 M CTAB solution, followed by 6 mL of AgNO3 (0.004 M), 1.4 mL of 0.0788 M ascorbic acid, and 240 μL of the seed solution prepared in (1). The mixture was grown at 28 °C for 8 h. The prepared AuNRs solution was centrifuged at 8500 rpm for 15 min and washed twice. Its morphology is shown in the figure. Figure 2 As shown, it has a short rod-like structure with a length of 30-80 nm and a diameter of 15-40 nm;
[0054] (c) DNA functionalization of AuNRs: 10 μL of H1 (10 μM) and 10 μL of H2 (100 μM) were mixed with 1 mL of AuNRs (1.25 nM) to enrich H1 and H2 on the AuNRs, and incubated at room temperature for at least 6 hours. 10 µL of NaCl (5 M) was slowly added to the reaction solution in 10 portions over 20 h, and the solution was incubated at room temperature for 24 h. Subsequently, the DNA-AuNRs were purified by centrifugation at 6000 rpm, 3 times for 20 min each time, to remove excess DNA strands; after each centrifugation, the supernatant was discarded, and the DNA-AuNRs were resuspended in 1×TBE buffer; the prepared DNA-AuNRs were stored at 4 °C.
[0055] (5) Prepare a 1 μM solution of heme and a 200 mM solution of potassium chloride. Purchase a TMB colorimetric kit (containing TMB colorimetric solution and H2O2 solution).
[0056] Example 2: Optimization of Biosensor Detection Conditions
[0057] (1) Optimization of ST composite probe concentration
[0058] The detection system was constructed in Tris-HCl buffer (50 mM, pH 7.9): 10×Tris-HCl buffer (3 μL), DNA-AuNRs (3 μL), HAP (3 μL, 1 μM), ST composite probes (3 μL, 0 μM, 2 μM, 4 μM, 6 μM, 8 μM, 10 μM), KCl (3 μL, 200 mM), Hemin (3 μL, 1 μM), H2O2 (9 μL), and 3 μL of E. coli (5×10⁻⁶ mM). 5 (cfu / mL) Incubate at 37℃ for 80 min;
[0059] The reacted system was added to TMB colorimetric solution and reacted at room temperature for 30 min. The reaction was then terminated by adding 1 M H₂SO₄. The absorbance was measured using UV-Vis scanning at 450 nm.
[0060] See results Figure 3 As the concentration of the ST composite probe gradually increases, the absorbance also gradually increases. The absorbance reaches its maximum when the concentration of the ST composite probe reaches 6 μM. After 6 μM, the absorbance no longer increases. Therefore, the addition amount of 6 μM ST composite probe is taken as the optimal reaction concentration.
[0061] (2) Optimization of heme concentration
[0062] The detection system was constructed in Tris-HCl buffer (50 mM, pH 7.9): 10×Tris-HCl buffer (3 μL), DNA-AuNRs (3 μL), HAP (3 μL, 1 μM), ST composite probe (3 μL, 6 μM), KCl (3 μL, 200 mM), Hemin (3 μL, 0 μM, 0.1 μM, 0.5 μM, 0.7 μM, 0.9 μM, 1.5 μM, 2.5 μM), H2O2 (9 μL) and 3 μL of Escherichia coli (5×10⁻⁶ mM). 5 (cfu / mL) Incubate at 37℃ for 80 min;
[0063] The reacted system was added to TMB colorimetric solution and reacted at room temperature for 30 min. The reaction was then terminated by adding 1 M H₂SO₄. The absorbance was measured using UV-Vis scanning at 450 nm.
[0064] See results Figure 4 As the concentration of heme gradually increases, the absorbance also gradually increases. The absorbance reaches its maximum when the heme concentration reaches 0.90 μM. After 0.90 μM, the absorbance no longer changes. Therefore, the heme concentration of 0.90 μM is taken as the optimal reaction concentration.
[0065] (3) Optimization of reaction time
[0066] The detection system was constructed in Tris-HCl buffer (50 mM, pH 7.9): 10×Tris-HCl buffer (3 μL), DNA-AuNRs (3 μL), HAP (3 μL, 1 μM), ST composite probe (3 μL, 6 μM), KCl (3 μL, 200 mM), Hemin (3 μL, 0.9 μM), H2O2 (9 μL), and 3 μL of Escherichia coli (5×10⁻⁶ mM). 5 (cfu / mL) Incubate at 37℃ for 0 min, 20 min, 40 min, 60 min, 80 min, 100 min, and 120 min;
[0067] The reacted system was added to TMB colorimetric solution and reacted at room temperature for 30 min. The reaction was then terminated by adding 1 M H₂SO₄. The absorbance was measured using UV-Vis scanning at 450 nm.
[0068] See results Figure 5 As time gradually increases, the absorbance also gradually increases. The absorbance reaches its maximum at 80 min. After 80 min, the absorbance no longer changes. Therefore, 80 min is taken as the optimal reaction time.
[0069] Application Example 1: Detection of Escherichia coli using a biosensor
[0070] The biosensor constructed in Example 1 was used to measure different concentrations of Escherichia coli:
[0071] The detection system was constructed in Tris-HCl buffer (50 mM, pH 7.9): 10×Tris-HCl buffer (3 μL), DNA-AuNRs (3 μL), HAP (3 μL, 1 μM), ST composite probe (3 μL, 6 μM), KCl (3 μL, 200 mM), Hemin (3 μL, 0.9 μM), H2O (9 μL) and 3 μL of Escherichia coli (0, 5, 50, 5×10⁻⁶ mM) were added. 2 5×10 3 5×10 4 5×10 5 Incubate at 37°C for 80 min (cfu / mL);
[0072] The reacted system was added to TMB colorimetric solution and reacted at room temperature for 30 min. The reaction was then terminated by adding 1 M H₂SO₄. The absorbance was detected using UV-Vis scanning in the range of 400–800 nm.
[0073] The results are as follows Figure 6 As shown, when the concentration of *E. coli* is in the range of 0-1 cfu / mL, the absorbance at 450 nm gradually increases with increasing *E. coli* concentration, and there is a good linear correlation between UV absorbance and *E. coli* concentration. The calculated linear regression equation is A = -0.057 + 0.17 × lgC, and the correlation coefficient R0 is [missing value]. 2 The value is 0.995, where A represents the UV-Vis absorption intensity and C represents the concentration of E. coli. Based on this, the lowest detection value of this sensor can be calculated to be 0.5 cfu / mL.
Claims
1. A biosensor for detecting Escherichia coli, characterized by comprising: The gold nanorods modified with H1 hairpin and H2 hairpin, hairpin probe HAP, S-T complex probe, hematin, potassium ion, H2O2, tetramethyl benzidine; The nucleotide sequence of the hairpin probe HAP, H1 hairpin and H2 hairpin is shown as SEQ ID NO: 1-3. The S-T complex probe is formed by complementary pairing of S chain and T chain with nucleotide sequence shown as SEQ ID NO: 4-5. The H1 hairpin and H2 hairpin are electrostatically adsorbed on the surface of AuNRs.
2. The biosensor of claim 1, wherein, The preparation method of the gold nanorods modified with H1 hairpin and H2 hairpin comprises the following steps: (a) mixing the solution of H1 hairpin and H2 hairpin with the suspension of gold nanorods, and incubating at room temperature; (b) adding NaCl solution to the suspension obtained in step (a), and reacting at room temperature, centrifuging the reaction suspension, washing the precipitate, and obtaining the gold nanorods modified with H1 hairpin and H2 hairpin.
3. The biosensor of claim 2, wherein, The molar ratio of the H1 hairpin, H2 hairpin and gold nanorods is 8:8:
1.
4. The biosensor of claim 2, wherein, The centrifugal speed is 6000 rpm.
5. The biosensor of claim 1, wherein, The preparation method of gold nanorods is as follows: (1) mixing HAuCl4 solution, CTAB solution and NaBH4 solution to obtain seed solution; (2) mixing HAuCl4 solution and CTAB solution, adding AgNO3 solution, ascorbic acid and seed solution to obtain reaction solution, centrifuging the reaction solution, washing the precipitate, and obtaining gold nanorods.
6. The biosensor of claim 5, wherein, In step (1), the molar ratio of CTAB and HAuCl4 is 400:1; the molar ratio of HAuCl4 and NaBH4 is 1:2.
4.
7. The biosensor of claim 5, wherein, In step (1), the reaction temperature is 20-30℃, and the reaction time is 1h; in step (2), the reaction temperature is 20-30℃, and the reaction time is 6-10h.
8. The biosensor of claim 5, wherein, In step (2), the molar ratio of CTAB and HAuCl4 is 20:1; the molar ratio of AgNO3 and HAuCl4 is 24:1000; the molar ratio of ascorbic acid and HAuCl4 is (0.1-0.12):
1.
9. The biosensor of claim 5, wherein, In step (2), the centrifugal speed is 8500 rpm.
10. A kit comprising the biosensor according to any one of claims 1-9.