A genetically engineered yeast strain for increasing 7-DHC production and its construction and application
Saccharomyces cerevisiae strains were constructed through metabolic engineering, strengthening enzyme expression and knocking out related genes, and achieving extracellular secretion synthesis of 7-DHC, solving the problems of low 7-DHC synthesis efficiency and intracellular accumulation, improving yield and simplifying the isolation and purification process.
Patent Information
- Application Number
- CN202310058515.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-18
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2043-01-18
AI Technical Summary
In the prior art, the synthesis efficiency of 7-DHC is low, the source is limited, intracellular accumulation leads to product inhibition effect, industrial production application is challenging, and downstream isolation and purification are complex.
Through metabolic engineering technology, a genetically engineered strain of Saccharomyces cerevisiae is constructed, the expression of key enzymes is strengthened and related genes is knocked out, and sterol transporter heterologously is expressed, thereby achieving extracellular secretion synthesis of 7-DHC.
It increases the total yield and extracellular secretion of 7-DHC, simplifies the downstream separation and purification process, reduces production costs, and has broad industrial application prospects.
Smart Images

Figure CN116179384B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a genetically engineered strain of saccharomyces cerevisiae capable of synthesizing 7-DHC by exocytosis, as well as a construction method and application thereof. Background Art
[0002] 7-dehydrocholesterol (7-DHC) has multiple biological functions. Under ultraviolet light, it can be directly converted into vitamin D3, which is crucial for maintaining calcium homeostasis in bones and protecting them. 7-DHC also plays a role in the treatment of hyperlipidemia, and the accumulation of high concentrations of 7-DHC helps prevent it. Due to its diverse biological activities, 7-DHC is widely used in the food, pharmaceutical, and other industries. However, 7-DHC has a complex structure and limited sources. It is primarily obtained through lanolin extraction and semi-chemical synthesis, which are resource-intensive and have low extraction and synthesis efficiency.
[0003] Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) As a model edible fungus, it has a natural synthesis pathway for ergosterol, which involves about 30 enzymes. The entire pathway includes three modules: mevalonate biosynthesis, farnesyl pyrophosphate biosynthesis, and ergosterol biosynthesis. In addition, Saccharomyces cerevisiae has a short growth cycle, strong fermentation ability, and a complete genetic operating system, making it an ideal chassis for the de novo synthesis of sterol compounds. The current mainstream strategy is to utilize metabolic engineering transformation strategies to reconstruct the ergosterol pathway by knocking out the erg5 / 6 genes and heterologously expressing C-24 reductase DHCR24 to achieve the accumulation of 7-DHC. At present, through the strengthening of the key limiting steps of 7-DHC in the synthesis pathway, combined with strategies based on modular integration and rational organelle transformation strategies to enhance intracellular accumulation capacity, in recent years, GUO et al. have further screened the source of DHCR24 and knocked out endoplasmic reticulum membrane-related genes on the basis of enhancing the expression of these genes. PAH1 , and found that these are beneficial to the synthesis of sterols. Lisha Qiu et al. mentioned in their work that Δ GDH1 , which not only increases the titer of 7-DHC but also enhances the growth rate of the strain. In order to optimize the carbon metabolic flow, they used CRISPRi technology to reduce the expression of ERG6. Wenqian Wei et al. focused on the post-squalene pathway and noticed that there is an inhibitor of ERG2 expression, namely MOT3 . MOT3 After the inhibition, CTT1 It is integrated into the genome, protecting cells from damage by hydrogen peroxide, ultimately improving the synthesis of sterols and significantly enhancing the synthesis capacity of 7-DHC. Combined with the high-density culture process of yeast, it achieves a fermentation level of more than 3 g / L. It has become an important alternative path to traditional extraction processes and has good market application prospects.
[0004] As the exploration of the intracellular transport and storage mechanisms of esters deepens, a variety of endogenous lipid transport proteins have been successively analyzed, which can achieve cytosolic secretion by combining with sterol-directed transport proteins through non-vesicular transport pathways. Cholesterol and other sterols are unevenly distributed in eukaryotic cells. This phenomenon is most evident in the plasma membrane (PM), which contains 60-80% of cellular free cholesterol and about 35-45% of lipids in the PM. This is a key aspect of intracellular homeostasis, because changes in the concentration of sterols in the membrane may greatly change the physical properties of the membrane (such as fluidity), affecting different processes such as signal transduction, membrane transport, or the function of intact proteins. It is becoming increasingly clear that maintaining this intracellular distribution of sterols depends on a strictly controlled synthesis, transport, and storage system. Pathogen-related yeast (PRY) proteins, as a class of sterol-binding proteins, have three Pry family members in Saccharomyces cerevisiae. Studies by Roger Schneiter et al. have shown that Pry1 and Pry2 Involved in sterol transport and secretion Pry3 It is a cell wall-bound protein. In addition, Saccharomyces cerevisiae contains another endogenous sterol transport mechanism that localizes to late nuclei and lysosomes. NPC2 and NCR1 Based on DHE live cell imaging experiments, it was found that NCR1 and NPC2 It is essential for transporting sterols to the vacuole membrane, especially when cells are starving. Furthermore, among the numerous ester exchange proteins, there are also plasma membrane sterol transporters such as Aus1p and Pdr11p, which are widely used in the efferocytic transport of hydrophobic ester compounds such as carotene. Furthermore, in yeast cells, the lipid exchange family proteins Lam1p-Lam6p, anchored at membrane contact sites, possess ester exchange domains. Their water-transporting pockets can specifically recognize a variety of sterol compounds and play an important role in mediating the non-vesicular transport of sterols. Recently, Sokolov et al. reviewed the synthesis of ergosterol in Saccharomyces cerevisiae and the conversion of its transport pathways, highlighting the important functions of Oshp and Lamp in promoting the non-vesicular transport pathway of sterols.
[0005] As a lipophilic compound, excess 7-DHC easily accumulates within the limited yeast cell space, leading to product inhibition and a significant factor limiting the sterol biosynthesis capacity of each cell. Current research focuses on enhancing intracellular product accumulation. However, the extraction process, which requires cell centrifugation, disruption, organic extraction, and byproduct separation, is complex and presents significant challenges for industrial production. Transport engineering is considered one of the most promising strategies. Given the known transport proteins for various ester compounds and their complex transport pathways, constructing an efficient extracellular secretion pathway to achieve 7-DHC synthesis would not only mitigate product toxicity, alleviate the metabolic pressure caused by intracellular accumulation, and alleviate the limitations of limited synthetic space, but also simplify downstream separation and purification, potentially reducing separation costs. This holds great significance for advancing industrial production of de novo synthesis routes using simple carbon sources. Summary of the Invention
[0006] The purpose of the present invention is to provide a genetically engineered strain of Saccharomyces cerevisiae that can transport 7-DHC synthesized de novo within the cell out of the cell through metabolic engineering technology, as well as a construction method and application thereof.
[0007] The technical solution adopted in the present invention is:
[0008] A 7-DHC exocytosis and synthesis yeast strain is constructed by the following method: the genome of the bottom fungus yeast Saccharomyces cerevisiae is enhanced to express truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1 , squalene epoxidase ERG1 , NADH kinase POS5 , lanosterol demethylase ERG11 , squalene synthase ERG9 Isopentenyl pyrophosphate isomerase IDI1 phosphotyrosine kinase ERG8 Mevalonate kinase ERG12 Farnesyl pyrophosphate synthase ERG20 , mevalonate diphosphate decarboxylase ERG19 , and heterologously express 24-sterol reductase from Gallus Gallus DHCR24 , knocking out the C-22 sterol desaturase required for ergosterol synthesis ERG5 , galactose / lactose metabolism regulatory protein GAL80 and in GAL4 Cysteine proteases that act as inhibitors in the system GAL6 and MIG1 , knockout NADP + Glutamate dehydrogenase GDH1 , knockout of diacylglycerol pyrophosphate phosphatase DPP1 , knocking out the enzyme that dehydrogenates alcohols ADH3, and heterologously express sterol transporters ST1 and PR-1 , and obtain the cerevisiae yeast strain that synthesizes the 7-DHC through exocytosis and secretion.
[0009] Preferably, the chassis bacteria is Saccharomyces cerevisiae CEN.PK2-1C.
[0010] The enhanced expression refers to the enhanced expression of multiple copies of the yeast on the genome of Saccharomyces cerevisiae. tHMG1 (3-Hydroxy-3-methylglutaryl Coenzyme A reductase tHMG1 Integration into the multi-copy site Ty1 at both ends of the repeated δ sequence), and a copy number of enhanced expression on the genome ERG1 , 1 copy number ERG11 , 1 copy number POS5 , 1 copy number ERG9 , 1 copy number ERG8 , 1 copy number ERG12 , 1 copy number IDI1 , 1 copy number ERG20 , 1 copy number ERG19 The heterologous expression refers to the expression of multiple copies of the gene on the Saccharomyces cerevisiae CEN.PK2-1C genome. DHCR24 The multi-copy sites are the repeated δ sequences at both ends of Ty3.
[0011] described tHMG1 The Gene ID is 42650. IDI1 The Gene ID is 855986. ERG9 The Gene ID is 856597. POS5 The Gene ID is 855913. ERG8 The Gene ID is 855260. ER12 The GeneID is 855248. ERG1 The Gene ID is 853086. ER11 The Gene ID is 856398. ERG20 The Gene ID is 853272. ERG19 The Gene ID is 855779. GAL80 The Gene ID is 854954. GAL6 The Gene ID is 855482. MIG1 The Gene ID is 852848. GDH1 The Gene ID is 854557. ERG5 The Gene ID is 855029. DPP1The Gene ID is 851878. ADH3 The Gene ID is 855107.
[0012] Specifically, the present invention is through P GAP Promoter-enhanced expression tHMG1 , through P GAL2 Promoter-enhanced expression ERG1 , through P GAL1 Promoter-enhanced expression ERG11 , through P GAL1 Promoter-enhanced expression POS5 , through P GAL1,10 Bidirectional promoter enhances expression ERG8 and ERG12 , through P GAL1,10 Bidirectional promoter enhances expression ERG20 and ERG9 , through P GAL1,10 Bidirectional promoter enhances expression IDI1 and ERG19 , through P GAP Promoter heterologous expression DHCR24 , through P GAL1 Promoter heterologous expression ST1 and PR-1.
[0013] More specifically:
[0014] By P GAL2 Promoter-enhanced expression ERG1 integrated into the Saccharomyces cerevisiae genome GAL6 site, the GAL6 The Gene ID of the locus is 855482;
[0015] By P GAL1 Promoter-enhanced expression ERG11 integrated into the Saccharomyces cerevisiae genome GDH1 site, the GDH1 The Gene ID is 854557;
[0016] By P GAL1 Promoter-enhanced expression POS5 integrated into the Saccharomyces cerevisiae genome MIG1 site, the MIG1 The Gene ID is 852848;
[0017] By P GAL1,10 Bidirectional promoter enhances expression ERG8 and ERG12 integrated into the Saccharomyces cerevisiae genome GAL80 site, the GAL80The Gene ID is 854954;
[0018] By P GAL1 ,10 Bidirectional promoter enhances expression ERG9 and ERG20 integrated into the Saccharomyces cerevisiae genome DPP1 site, the DPP1 The Gene ID is 851878;
[0019] By P GAL1 ,10 Bidirectional promoter enhances expression IDI1 and ERG19 integrated into the Saccharomyces cerevisiae genome ADH3 site, the ADH3 The Gene ID is 855107;
[0020] The Gallus Gallus source, and through P GAP Promoter heterologous expression DHCR24 integrated into the Saccharomyces cerevisiae genome ERG5 site, the ERG5 The Gene ID is 855029, and it is integrated into the repeated δ sequences at both ends of the multicopy site Ty3.
[0021] The present invention also relates to a method for constructing the yeast strain, which comprises the following steps:
[0022] (1) Knockout of C-22 sterol desaturase required for ergosterol synthesis ERG5 , and P GAP - DHCR24 -T CYC1 The fragment was integrated into the genome of Saccharomyces cerevisiae CEN.PK2-1C ERG5 enzyme site, and the constructed Saccharomyces cerevisiae strain was named sc1;
[0023] (2) P GAL2 - ERG1 -T CYC1 The fragment was integrated into the genome of the sc1 strain and integrated into GAL6 Site ( GAL6 The Gene ID of the locus is 855482), and the resulting Saccharomyces cerevisiae strain was named sc2;
[0024] (3) P GAL1 - tHMG1 -T CYC1 The fragment was integrated into the delta sequence at both ends of Ty1 in the genome of the sc2 strain (the guide sequence is TGTTGGAATAGAAATCAACT), and the resulting Saccharomyces cerevisiae strain was named sc3 strain;
[0025] (4) T TEF -T ADH1 - ERG8 -P GAL10 -P GAL1 - ERG12 -T CYC1 The fragment was integrated into the GAL80 enzyme site on the sc3 strain genome (the Gene ID of GAL80 is 854954), and the resulting Saccharomyces cerevisiae strain was named sc4 strain;
[0026] (5) T TEF -P GAL1 - POS5 -T CYC1 The fragment was integrated into the genome of the sc4 strain MIG1 Site (the MIG1 The Gene ID is 852848), and the resulting Saccharomyces cerevisiae strain was named sc5;
[0027] (6) T TEF -T ADH1 - ERG9 -P GAL10 -P GAL1 - ERG20 -T CYC1 The fragment was integrated into the genome of the sc5 strain DPP1 Site (the DPP1 The Gene ID is 851878), and the resulting Saccharomyces cerevisiae strain was named sc6;
[0028] (7) T TEF -P GAL1 - ERG11 -T CYC1 The fragment was integrated into the genome of the sc6 strain GDH1 Site (the GDH1 The Gene ID is 854557), and the resulting Saccharomyces cerevisiae strain was named sc7;
[0029] (8) T TEF -T ADH1 - IDI1 -P GAL10 -P GAL1 - ERG19 -T CYC1 The fragment was integrated into the genome of the sc7 strain ADH3 Site (the ADH3 The Gene ID is 855107), and the resulting Saccharomyces cerevisiae strain was named sc8;
[0030] (9) P GAL1 - DHCR24 -TCYC1 The fragment was integrated into the Ty3 site of the sc8 strain genome (the guide sequence was ACGTTCATAAAACACATATG), and the resulting Saccharomyces cerevisiae strain was named sc9;
[0031] (10) H1-P GAL1 - ST1 -P GAL1 - PR1 -H2 was introduced into the genome of the sc9 strain to construct a Saccharomyces cerevisiae strain named sc13, which is the Saccharomyces cerevisiae strain that synthesizes 7-DHC through exocytosis. ST1 ) has a Genebank sequence number of XP_717917.2, Fusarium odoratissimum NRRL54006-derived PR-1 The Genebank sequence number is XP_031058987.1.
[0032] The present invention also relates to the application of the saccharomyces cerevisiae strain in preparing 7-DHC by microbial fermentation.
[0033] Specifically, the application is: inoculating the brewer's yeast strain into a fermentation medium, adding 5-10% of the volume of n-dodecane of the initial medium as an extractant, fermenting and culturing at 28-32° C. for 48-96 hours, and separating and purifying the fermentation broth to obtain the 7-DHC.
[0034] Typically, recombinant Saccharomyces cerevisiae is first inoculated into a seed culture medium to prepare a seed solution. This seed solution is then inoculated into a fermentation medium at a 1-10% (v / v) inoculum. The seed culture medium is typically YPD medium. In the present invention, the YPD medium used has the following composition: 20 g / L peptone, 10 g / L yeast extract, and 20 g / L anhydrous glucose.
[0035] The beneficial effects of the present invention are mainly reflected in: the present invention constructs a recombinant strain that can efficiently transport 7-DHC to the extracellular space S. cerevisiae strain sc 13 In a 500mL shake flask biphasic fermentation, the total 7-DHC production reached 28.189 mg / g (secretion rate 11.701 mg / g). Compared with the control sc1 strain, the total 7-DHC production increased by 14.54 times, and the total extracellular secretion increased by 13.77 times, of which the extracellular secretion accounted for 41.51%. The recombinant strain constructed by this invention has stronger exocytosis ability and higher yield, providing guidance for the synthesis of 7-DHC and simplifying the isolation and extraction of 7-DHC, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 To compare the production of 7-DHC, ergo-5,8-diene-3β-ol and lanosterol in the starting strain sc1 and the high-yielding strain sc9;
[0037] Figure 2 Figure 5 is the difference in intracellular and extracellular sterol distribution and quantitative analysis of biphasic fermentation; AB is the gas chromatography test results; CD is the fermentation yield of the engineered strain;
[0038] Figure 3 The promoting effects of overexpression of CAP family transporter (A) and overexpression of NPC2 family transporter ST (B) on the intracellular and extracellular production of 7-DHC (mg / g);
[0039] Figure 4 After molecular modification of overexpression of Saccharomyces cerevisiae sc9 PR-1 The intracellular and extracellular production of 7-DHC (mg / g). DETAILED DESCRIPTION
[0040] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:
[0041] The culture medium involved in the embodiment is as follows:
[0042] SOB medium: Each liter contains 20g tryptone, 0.5g NaCl, 5g yeast extract, 0.186g KCl, and 1g MgCl2.
[0043] SD-Leu2 medium: Each liter contains 20 mg of uracil, 20 mg of tryptophan, 20 mg of histidine, 6.7 g of amino-free yeast nitrogen source, and 20 g of anhydrous glucose.
[0044] SD-Ura3 medium: Each liter contains 20 mg of leucine, 20 mg of tryptophan, 20 mg of histidine, 6.7 g of amino-free yeast nitrogen source, and 20 g of anhydrous glucose.
[0045] Fermentation medium: Each liter contains 20g tryptone, 40g anhydrous glucose, and 10g yeast extract.
[0046] SOB+Amp plates: Each liter contains 20 g tryptone, 0.5 g NaCl, 5 g yeast extract, 0.186 g KCl, 1 g MgCl2, and 20 g agar powder.
[0047] YPD+NAT plates: 2% tryptone, 1% yeast extract, 2% anhydrous glucose, 2% agar powder, add 1 mL of 20 mg / mL NAT resistance stock solution per 100 mL.
[0048] YPD+G418 plates: 2% tryptone, 1% yeast extract, 2% anhydrous glucose, 2% agar powder, add 1 mL of 20 mg / mL G418 resistance stock solution per 100 mL.
[0049] Detection of 7-DHC content:
[0050] After fermentation, the bacterial liquid was centrifuged, and the upper oil phase was filtered through a membrane filter into a liquid phase flask. The remaining cells were disrupted with 3N hydrochloric acid, and the cell fragments were collected by centrifugation. The intracellular sterols were extracted by saponification with a 1.5 mol / L KOH methanol solution in a 60°C water bath. After the reaction, the liquid was extracted with n-hexane, and the resulting n-hexane was evaporated to dryness in a 75°C water bath. A certain amount of ethyl acetate was added for reconstitution, and the solution was filtered through a membrane filter into a liquid phase flask.
[0051] The gas phase column used was the Thermo Fisher HP-5 (30 m*0.25 mm*0.25 μm); the gas phase program was set as follows: inlet temperature: 300°C; program temperature: 190°C (1 min) 10°C / min 300°C (10 min); injection volume: 1 μL, split ratio 20:1; carrier gas: N2, flow rate 1.0 mL / min; transfer rod temperature: 250°C.
[0052] Recombinant Saccharomyces cerevisiae OD 600 Detection method:
[0053] The yeast seed liquid cultured for 16-24 hours was inoculated into a 500 mL shake flask containing 100 mL fermentation medium and 10 mL dodecane at a 1% inoculum volume and incubated at 30°C and 220 rpm. When sampling, the OD value was measured using a UV spectrophotometer after dilution in an appropriate ratio. 600 .
[0054] The construction of the plasmids involved in the examples was carried out in E. coli Dh5α, and after the plasmid construction was completed, it was used as a template to amplify the expression cassette.
[0055] For the plasmids involving PAM site mutations in the examples, sequencing of the corresponding positions is required after construction to ensure that the pdc5 plasmid with the correct mutation at the PAM site is obtained.
[0056] The primer sequences involved in the examples are shown in Table 1:
[0057] Table 1: Primer list
[0058] Primer name Primer sequences pY-G1F AGTCCGATCCGGGGTTTTTTTGTTTGTTTATGTGTGTTTATTCGA pY-G1R GTGGGGATGATCCACTAGTATCATTATCAATACTGCCATTCAAAGA rERG5-HOMO1F CAATTACCAATCTCCGCATTGAC rERG5-HOMO1R GTATTCTGGGCCTCCATGTCTTTGTTAAAAGGTATTTATTGTCTATTGGAATAGC rERG5-HOMO2 F CAGAACTTTGTCCAGACAATAAATCATATT rERG5-HOMO2 R ACTCTGAAGAGAATGAACCAAGG rNAT F GACATGGAGGCCCAGAATAC rNAT-G R AATGGCAGTATTGATAATGACAGTATAGCGACCAGCATTCA fGAP-D F TCATTATCAATACTGCCATTTCAAAGAAT rD24-ERG5 R ATTGTCTGGACAAAGTTCTGGCAAATTAAAGCCTTCGAGC VER H1 F GTCTGCGAAGTCTCGTACCT VER H2 R TAGCAGATCATTAGCTGTAGCGTATG NCG6 F TCAACATTTAAGTAAATCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA NCG6 R GATTTACTTAAATGTTGACGATCATTTATCTTTCACTGCGGAG CE6 F AGATTTCTATGAATATGGTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA CE6 R AACCATATTCATAGAAATCTGATCATTTATCTTTCACTGCGGAG P-G6 F ATCTACTAGTCATATGGATTGTCCTCTTCCATCGATATCAGTAAGA P-G6 R TCGGTACCCGGGGATCCGATGGCCAAAGCACCCATTGG PG2 F AGGTTGCAATTTCTTTTTCTATTAGTAGC PG2 R GCTTGGGGTTGCTGTGAAAC LpYES2 F AAGCTGCGGCCCTGCATT LpYES2 R GGAGCTTCCAGGGGGAAAC emp F TAACGTCAAGGAGTCTAGAGGGCCGCATCATGTAATTAGTTATGTCACGC emp R TGCGGCCCTCTAGACTCCTTGACGTTAAAGTATAG VG2 F GCGTGGGGATGATCCACTAGTA VG2 R TGTAAGCGTGACATAACTAATTACATGA ERG1 F ATGTCTGCTGTTAACGTTGCACC ERG1 R TTAACCAATCAACTCACCAAACAAA LP2 F TCATGTAATTAGTTATGTCACGCTTACA LP2 R TACTAGTGGATCATCCCCACGC LHP F CGGATTAGAAGCCGCCGA LPH2 R GCAAATTAAAGCCTTCGAGCG HPP R GCTCGGCGGCTTCTAATCCGCAGTATAGCGACCAGCATTCACA PH2-P F GCTCGAAGGCTTTAATTTGCCTAAAGGACCCGTCTAACTCTAGTATCG HPP F GTGGGGATGATCCACTAGTACGATGGCTAAGATTCCCGTCT PH2-P R TTAATGCAGGGCCGCAGCTTGGTGACAATAATAACGGGGTTGT VG1 F CGGATTAGAAGCCGCCGAG VG1 R ACGCTCGAAGGCTTTAATTTGC T1t F ATGGAATCCCAACAATTATCTCAACATTCACA T1t R CATTTAAACTATTAACTAACAAATGGATTCATTAG E8E20 R ATGGACTACAACAAGAGATCTTCGGTC E8E20 R ACATTAAACGTTAGCAATATCTCGCATTATAG MP5 F GCAAAGCCCATATCCAATGACACA MP5 R ACCAAGGGTGAATATGATTAATACTGC E9E20 F CGTTTATTAAAACGCCTTTCAACATAGGG E9E20 F ATCAGAGGATCCCGGATGAGG E11G F CATACAATTCAGAGTCACCTGGGA E11G R CACTAAGGACGGTAAGGTCTTGCCA IDE19 F GCAATCCACAGCTGCAATCCCTA IDE19 R AGGTATTCTCTCATGTGGTGAAGTCC T3D24 F GTCCTGTGTCCTGTGGTAGA T3D24 R CACAATACGACTGGCATCATTC 125 F GTTGAAGCTAGATATGGTTTCATTAAGTTGATTCATCA 125 R CCATATCTAGCTTCAACTTCAACATAAGCACCTTCTT 127 F TTTGGCTGTTGCTAGAGCTTATACCAAAGATGATG 127 R CTCTAGCAACAGCCAAATATTTACCAGGTGGAACTTCTT
[0059] Example 1: Construction of tool plasmids
[0060] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C as a template, PG2 F and PG2 R were used to obtain the gene fragment P GAL2 ;
[0061] Using the pYES2 plasmid as a template, primers LpYES2 F and LpYES2 R were used to obtain the linearized pYES2 plasmid;
[0062] The gene fragment P GAL2 Connect with the linearized pYES2 plasmid and introduce into competent Dh5α, and verify with primers VG2F and VG2 R to obtain P GAL1 The promoter was replaced by P GAL2 P GAL2 -pYES2 plasmid.
[0063] Using pYES2 plasmid as template, primers emp F and emp R were used to obtain linearized plasmid, which was transformed into Dh5α competent cells to obtain P-only plasmid. GAL1 -T CYC1 Plasmid emp with empty expression cassette.
[0064] Example 2: Construction of a 7-DHC-producing Saccharomyces cerevisiae chassis
[0065] The specific steps are as follows:
[0066] (1) Synthesis of fragments:
[0067] Artificially synthesized gene fragments DHCR24 (SEQ ID No. 1), ligated to the multiple cloning site of pYES2.
[0068] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C as a template, the primers described in Table 1 were used to obtain the gene fragment GAP using primers pY-G1F and pY-G1R, and the fragment was replaced with the fragment on the plasmid pYES2. GAL1 Promoter.
[0069] Using the genome of Saccharomyces cerevisiae CEN.PK2-1C as a template, the primers described in Table 1 were used to obtain the gene fragment using primers rERG5-HOMO1F and rERG5-HOMO1R. ERG5 -HOMO1;
[0070] The gene fragment was obtained using primers rERG5-HOMO2F and rERG5-HOMO2R. ERG5 -HOMO2;
[0071] Using plasmid pcfb2312 as a template, primers rNAT F and rNAT-G R were used to obtain fragment natMX;
[0072] The primers fGAP-DF and rD24-ERG5R were used to obtain P GAP - DHCR24 -T CYC1 Gene fragment.
[0073] (2) Put the four fragments in step (1) ERG5 -HOMO1, ERG5 -HOMO2, natMX, P GAP - DHCR24 -T CYC1 Fusion PCR was performed using PCR, and the correct bands obtained by running the gel were cut and recovered to obtain ERG5 Fusion gene fragment of upstream and downstream homology arms Δ ERG5 -natMX-P GAP - DHCR24 -T CYC1 .
[0074] (3) The fusion gene fragment in step (2) was transformed into the competent strain of Saccharomyces cerevisiae CEN.PK2-1C, cultured on YPD+NAT plates at 30°C for 2-3 days, and verified by single colony PCR using primers VER H1 F and VER H2 R described in Table 1. The single colony with the correct band was selected to obtain the strain CEN.PK2-1CΔ ERG5 -P GAP - DHCR24 -T CYC1 , named Saccharomyces cerevisiae sc1.
[0075] Example 3: Construction of a high-yield 7-DHC Saccharomyces cerevisiae chassis
[0076] (1) Construction of sgRNA:
[0077] Using plasmid pdc5 as a template, the primers described in Table 1 were used, and primers NCG6 R and NCG6 F were used to obtain a linearized pdc5 plasmid, which was then introduced into competent Dh5α, spread on SOB+Amp plates, and cultured at 37°C to obtain a pdc5-NCG6 plasmid.
[0078] (2) Construction of donor fragment
[0079] Using Saccharomyces cerevisiae CEN.PK2-1C as a template, primers ERG1 F and ERG1 R were used to obtain the gene fragment ERG1;
[0080] The linearized plasmid P was obtained using primers LP2 F and LP2 R. GAL2 -pYES2;
[0081] Gene fragments ERG1 With linearized plasmid P GAL2-pYES2 was connected and introduced into competent Dh5α, and colony PCR was performed with primers PG2 F and ERG1 R to verify the gene fragment P using primers LHP F and LPH2 R. GAL2 - ERG1 -T CYC1 ;
[0082] The target gene fragment GAL6 was knocked out using primers P-G6 F and P-G6 R;
[0083] It was ligated with the linearized plasmid pMD20 and verified directly with primers HPPR and PH2-P F. The newly obtained pMD20- GAL6 Plasmid linearization;
[0084] Then the gene fragment P GAL2 - ERG1 -T CYC1 With the linearized plasmid pMD20- GAL6 The connection was performed and PCR verification was performed using primers HPPF and PH2-PR. The donor H1-P was amplified using the same primers. GAL2 - ERG1 -T CYC1 -H2.
[0085] (3) The sgRNA dc5-NCG6 and donor H1-P constructed in (1) and (2) were GAL2 - ERG1 -T CYC1 -H2 was simultaneously introduced into the competent cell of Saccharomyces cerevisiae sc1 and cultured on YPD+G418 plates at 30°C for 2-3 days. PCR verification was performed using P-G6 F and VG1 R to obtain the Saccharomyces cerevisiae chassis sc2.
[0086] The subsequent chassis construction method is the same as the above method, that is, primers are used to mutate the pam site of the pdc5 plasmid to obtain sgRNA, and then the genes to be overexpressed and knocked out are cloned from Saccharomyces cerevisiae using primers. The genes to be overexpressed are then inserted between the promoter and terminator on the plasmid pYES2. The target knockout gene is ligated to the plasmid pMD20. The complete expression cassette on pYES2 is cloned using primers and inserted into pMD20 containing the target knockout gene to obtain the knockout replacement fragment. Finally, the two fragments obtained above are introduced into Saccharomyces cerevisiae competent cells and cultured on YPD+G418 plates at 30°C for 2-3 days. This will obtain the subsequent Saccharomyces cerevisiae chassis, and ultimately the high-yielding 7-DHC Saccharomyces cerevisiae chassis sc9 is constructed as follows:
[0087] (1) P GAL1 -tHMG1 -T CYC1 The fragment was integrated into the δ sequences at both ends of Ty1 in the genome of the sc2 strain using primers T1t F / R (the guide sequence is TGTTGGAATAGAAATCAACT), and the resulting Saccharomyces cerevisiae strain was named sc3;
[0088] (2) T TEF -T ADH1 - ERG8 -P GAL10 -P GAL1 - ERG12 -T CYC1 The fragment was integrated into the GAL80 enzyme site (Gene ID of GAL80 is 854954) on the genome of the sc3 strain using primers E8E20 F / R to construct a Saccharomyces cerevisiae strain named sc4 strain;
[0089] (3) T TEF -P GAL1 - POS5 -T CYC1 The fragment was integrated into the genome of the sc4 strain using primers MP5 F / R. MIG1 Site (the MIG1 The Gene ID is 852848), and the resulting Saccharomyces cerevisiae strain was named sc5;
[0090] (4) T TEF -T ADH1 - ERG9 -P GAL10 -P GAL1 - ERG20 -T CYC1 The fragment was integrated into the genome of the sc5 strain using primers E9E20 F / R. DPP1 Site (the DPP1 The Gene ID is 851878), and the resulting Saccharomyces cerevisiae strain was named sc6;
[0091] (5) T TEF -P GAL1 - ERG11 -T CYC1 The fragment was integrated into the genome of the sc6 strain using primers E11G F / R. GDH1 Site (the GDH1 The Gene ID is 854557), and the resulting Saccharomyces cerevisiae strain was named sc7;
[0092] (6) T TEF -T ADH1 - IDI1 -P GAL10-P GAL1 - ERG19 -T CYC1 The fragment was integrated into the genome of the sc7 strain using primers IDE19 F / R. ADH3 Site (the ADH3 The Gene ID is 855107), and the resulting Saccharomyces cerevisiae strain was named sc8;
[0093] (7) P GAL1 - DHCR24 -T CYC1 The fragment was integrated into the Ty3 site on the genome of the sc8 strain using primers T3D24 F / R (the guide sequence was ACGTTCATAAAACACATATG), and the resulting Saccharomyces cerevisiae strain was named sc9.
[0094] Example 4: Analysis of sterol exocytotic products of Saccharomyces cerevisiae in an oil-water biphasic fermentation system
[0095] In order to further enrich 7-DHC, the oil-water biphasic fermentation method was used here. The specific operation method is as follows:
[0096] The recombinant Saccharomyces cerevisiae strains sc1 and sc9 were cultured for 16 to 24 hours, respectively, to prepare seed solutions. The prepared seed solutions were inoculated at a 2% (v / v) inoculation rate into a 500-mL conical flask containing 100 mL of fermentation medium and 10 mL of dodecane. The solutions were cultured at 30°C and 220 rpm for 96 hours to prepare fermentation broth.
[0097] The gas phase analysis method was as described above. When analyzing the intracellular products, in addition to 7-DHC, fuccasterol, ergo-5,7-diene-3β-ol, ergo-5,8-diene-3β-ol, and lanosterol were found. When analyzing the extracellular products, only 7-DHC and fuccasterol were found. This, combined with the structural differences between fuccasterol and the other three byproducts, suggests that only cholesterol-like sterols can be transported out of the cell (see Figure 1 、 Figure 2 ).
[0098] Example 5: Construction and characterization of the Saccharomyces cerevisiae transport and exocytosis pathway
[0099] (1) Contain ST1 (SEQ ID No. 2), ST2 (SEQ ID No. 3), ST3 (SEQ ID No. 4), ST4 (SEQ ID No. 5), ST5The pYES2 (SEQ ID No. 6) plasmid was introduced into the competent cells of Saccharomyces cerevisiae sc9 and cultured on SC-URA plates at 30°C for 4-5 days. PCR verification was performed using VG1 F and VG1 R in Table 1 to obtain the Saccharomyces cerevisiae chassis sc9- ST1 、sc9- ST2 、sc9- ST3 、sc9- ST4 、sc9- ST5 .
[0100] The sterol transporter ( ST1 ) is XP_717917.2, the Candida viswanathii Source ST2 The Genebank sequence number is RCK66207.1, Candida parapsilosis Source ST3 The Genebank sequence number is XP_036664935.1, Scheffersomyces stipitis Source ST4 The Genebank sequence number is KAG2730877.1, Pachysolen tannophilus NRRL Y-2460 source ST5 The Genebank sequence number is ODV98224.1.
[0101] The specific steps of fermentation are as follows:
[0102] (1) The above-mentioned recombinant Saccharomyces cerevisiae strains sc1, emp, sc9, sc9- ST1 、sc9- ST2 、sc9- ST3 、sc9- ST4 、sc9- ST5 The culture was carried out at 30°C and 220 rpm for 16 to 24 hours to prepare a seed solution, and the prepared seed solution was inoculated into a 500-mL conical flask containing 100 mL of fermentation medium and 10 mL of dodecane at an inoculum amount of 2% (v / v). The culture was carried out at 30°C and 220 rpm for 96 hours to prepare a fermentation broth.
[0103] (2) Quantitative analysis of extracellular 7-DHC:
[0104] After centrifugation, the upper dodecane layer was removed and filtered through a membrane into a liquid injection bottle for gas chromatography detection. The fermentation yield of the engineered strain was calculated by converting the peak area with that of the 7-DHC standard. The remaining fermentation liquid was resuspended, and the fermentation liquid was diluted 10 times and then the OD was measured using a UV spectrophotometer. 600 .
[0105] The results are shown in Table 2 and Figure 3 As shown in B, overexpression ST1 sc9-protein ST1 The 7-DHC content in the extracellular dodecane of the strain reached 6.486 mg / g, and the OD 600 Reached 10.11.
[0106] (3) Calculate the intracellular 7-DHC production:
[0107] 8 mL of resuspended fermentation liquid was taken, washed and resuspended with deionized water, and then placed in a 10 mL ep tube with 3 mL of 3N hydrochloric acid, and broken in boiling water for 5 minutes. After centrifugation, the supernatant was removed and washed with deionized water. Intracellular sterols were saponified with 1.5 mol / L KOH methanol solution in a 60°C water bath. After the reaction, the above liquid was extracted with n-hexane, and the obtained n-hexane was evaporated to dryness in a 75°C water bath, and a certain amount of ethyl acetate was added to dissolve it again, and filtered with a filter membrane into a liquid phase bottle. Gas chromatography was performed, and the fermentation yield of the engineered strain was obtained by converting it with the peak area of the 7-DHC standard. The results are shown in Table 2 and Figure 3 As shown in B.
[0108] Table 2: Intracellular and extracellular 7-DHC production in Saccharomyces cerevisiae overexpressing the NPC2 transporter family and OD after fermentation 600
[0109] strains Extracellular 7-DHC (mg / g) Intracellular 7-DHC (mg / g) <![CDATA[OD 600 ]]> sc1 0.861 0.488 7.11 sc9 3.376 7.186 8.17 emp 3.255 6.412 9.07 sc9- 6.486 6.729 10.11 sc9-2 4.675 6.057 10.54 sc9-3 5.273 2.642 9.89 sc9-4 4.966 2.668 9.37 sc9-5 4.365 4.415 10.32
[0110] Among them, the highest yield is recombinant S. cerevisiae strain sc9- ST1 When the strain was used for 500mL shake flask biphasic fermentation, the total 7-DHC production reached 13.215mg / g (secretion amount 6.486mg / g). ST transporter, which increased the total secretion and production of 7-DHC to 6.81 and 7.63 times that of the control sc1 strain (1.94 mg / g and 0.85 mg / g), respectively.
[0111] (ii) The pYES2 plasmid containing PRY1, Bacterial Pry (Bac Pry gene sequence, see SEQ ID No.10), Vertebrate CRISP2 protein (Vcp gene sequence, see SEQ ID No.9), Apolipoprotein Eisoform b precursor (AEp gene sequence, see SEQ ID No.8), Plant-PR-1 (Pr-1 gene sequence, see SEQ ID No.7), and NPC intracellular cholesterol transporter 1 homolog 1b isoformX4 (NPCX4 gene sequence, see SEQ ID No.11) was introduced into Saccharomyces cerevisiae sc9 competent cells, and the cells were cultured on SC-URA plates at 30°C for 4-5 days. PCR verification was performed using VG1 F and VG1 R in Table 1 to obtain the Saccharomyces cerevisiae chassis sc9- PRY1 、sc9- Bac Pry 、sc9- VCp 、sc9- AEp 、sc9- PR1 、sc9- NPCX4 .
[0112] described Fusarium odoratissimum NRRL 54006 source PR-1 The Genebank sequence number is XP_031058987.1, Yarrowia lipolytica Source Bacterial Pry The Genebank sequence number is KAB8284425.1, Homo sapiens The Genebank sequence number of the Vertebrate CRISP2 protein is AAI07708.1. Homo sapiens The Genebank sequence number of the Apolipoprotein E isoform b precursor is NP_001289620.1. Rosa chinensis The sequence number of the NPC intracellular cholesterol transporter 1 homolog 1b isoform X4 is NC_037093.1.
[0113] The above-mentioned recombinant Saccharomyces cerevisiae strains sc1, emp, sc9, sc9- PRY1 、sc9- Bac Pry 、sc9- VCp 、sc9- AEp 、sc9- PR1 、sc9- NPCX4 The culture was carried out at 30°C and 220 rpm for 16 to 24 hours to prepare a seed solution, and the prepared seed solution was inoculated into a 500-mL conical flask containing 100 mL of fermentation medium and 10 mL of dodecane at an inoculum amount of 2% (v / v). The culture was carried out at 30°C and 220 rpm for 96 hours to prepare a fermentation broth.
[0114] Calculate the extracellular 7-DHC production:
[0115] After centrifugation, the upper dodecane layer was removed and filtered through a membrane into a liquid injection bottle for gas chromatography detection. The fermentation yield of the engineered strain was calculated by converting the peak area with that of the 7-DHC standard. The remaining fermentation liquid was resuspended, and the fermentation liquid was diluted 10 times and then the OD was measured using a UV spectrophotometer. 600 .
[0116] The results are shown in Table 3 and Figure 3 As shown in A.
[0117] Calculate the intracellular 7-DHC production:
[0118] 8 mL of resuspended fermentation liquid was taken, washed and resuspended with deionized water, and then placed in a 10 mL ep tube with 3 mL of 3N hydrochloric acid, and broken in boiling water for 5 minutes. After centrifugation, the supernatant was removed and washed with deionized water. Intracellular sterols were saponified with 1.5 mol / L KOH methanol solution in a 60°C water bath. After the reaction, the above liquid was extracted with n-hexane, and the obtained n-hexane was evaporated to dryness in a 75°C water bath, and a certain amount of ethyl acetate was added to dissolve it again, and filtered with a filter membrane into a liquid phase bottle. Gas chromatography was performed to detect the fermentation yield of the engineered strain by converting it with the peak area of the 7-DHC standard product. The results are shown in Table 3 and Figure 3 As shown in A.
[0119] Table 3: Intracellular and extracellular 7-DHC production in Saccharomyces cerevisiae overexpressing CAP transporter family and OD after reaction 600
[0120] strains Extracellular 7-DHC (mg / g) Intracellular 7-DHC (mg / g) <![CDATA[OD 600 ]]> sc1 0.850 1.086 7.11 sc9 3.376 7.186 8.17 emp 3.255 6.412 9.07 sc9- 3.739 5.944 10.65 sc9- 2.338 4.912 10.84 sc9- 3.064 5.466 11.03 sc9- 2.378 5.121 9.77 sc9- 4.306 6.539 9.81 sc9- 3.118 5.682 10.16
[0121] Among them, the highest yield is recombinant S. cerevisiae strain sc9- PR1 When the strain was used for 500mL shake flask biphasic fermentation, the total 7-DHC production reached 10.845mg / g (secretion amount 4.306mg / g). PR-1 transporter, which increased the total secretion and production of 7-DHC to 5.59 and 5.07 times that of the control sc1 strain, respectively.
[0122] Example 6: Molecular modification of transporter PR-1 and characterization of its overexpression in Saccharomyces cerevisiae fermentation
[0123] (1) Using plasmid pYES2-PR1 as a template, the primers in Table 1 (95 F / R, 112 F / R, 125 F / R, 127 F / R) were used to obtain linearized pYES2- PR1 The plasmid was transformed into Dh5α competent cells, spread on SOB+Amp plates, and cultured at 37℃ to obtain site-mutated plasmids. PR-1 , 112 PR-1 , 125 PR-1 , 127 PR-1 plasmid.
[0124] (2) The plasmid constructed in (1) was introduced into the competent cell of Saccharomyces cerevisiae sc9 and cultured on SD-Leu2 plates at 30°C for 4-5 days. PCR verification was performed using VG1 F and VG1 R in Table 1 to obtain the Saccharomyces cerevisiae strain sc9-95. PR-1 、sc9-112 PR-1 、sc9-125 PR-1 、sc9-127 PR-1 .
[0125] The specific steps of fermentation are as follows:
[0126] (1) The above-mentioned recombinant Saccharomyces cerevisiae strains emp, sc9, sc9- PR-1 、sc9-95 PR-1 、sc9-112 PR-1 、sc9-125 PR-1 、sc9-127 PR-1 The culture was carried out at 30°C and 220 rpm for 16 to 24 h to prepare a seed solution, which was inoculated into a 500-mL conical flask containing 100 mL of fermentation medium and 10 mL of dodecane at a 2% (v / v) inoculation rate. The culture was carried out at 30°C and 220 rpm for 96 h to prepare a fermentation broth.
[0127] (2) Calculate the extracellular 7-DHC production:
[0128] After centrifugation, the upper dodecane layer was removed and filtered through a membrane into a liquid injection bottle for gas chromatography detection. The fermentation yield of the engineered strain was calculated by converting the peak area with that of the 7-DHC standard. The remaining fermentation liquid was resuspended, and the fermentation liquid was diluted 10 times and then the OD was measured using a UV spectrophotometer. 600 .
[0129] The results are shown in Table 4 and Figure 4shown.
[0130] (3) Calculate the intracellular 7-DHC production:
[0131] 8 mL of resuspended fermentation liquid was taken, washed and resuspended with deionized water, and then placed in a 10 mL ep tube with 3 mL of 3N hydrochloric acid, and broken in boiling water for 5 minutes. After centrifugation, the supernatant was removed and washed with deionized water. Intracellular sterols were extracted by saponification with 1.5 mol / L KOH methanol solution in a 60°C water bath. After the reaction, the above liquid was extracted with n-hexane, and the obtained n-hexane was evaporated to dryness in a 75°C water bath, and a certain amount of ethyl acetate was added to dissolve it again, and filtered with a filter membrane into a liquid phase bottle. Gas chromatography was performed to detect the fermentation yield of the engineered strain by converting it with the peak area of the 7-DHC standard product. The results are shown in Table 4 and Figure 4 shown.
[0132] Table 4: Different PR-1 The intracellular and extracellular 7-DHC production and OD after fermentation of recombinant Saccharomyces cerevisiae 600
[0133] strains Extracellular 7-DHC (mg / g) Intracellular 7-DHC (mg / g) <![CDATA[OD 600 ]]> sc9 3.376 7.039 8.17 emp 3.614 7.079 9.07 sc9-PR-1 5.170 7.572 9.81 sc9-95 PR-1 4.642 7.408 10.69 sc9-112 PR-1 5.951 9.239 11.03 sc9-125 PR-1 5.746 9.848 10.87 sc9-127 PR-1 5.605 7.638 10.46
[0134] Example 7: Enhancement and characterization of the 7-DHC extracellular secretion pathway
[0135] (1) Using plasmid pdc as a template, primers CE6 F and CE6 R were used to obtain a linearized plasmid, which was transformed into Dh5α competent cells, spread on SOB+Amp plates, and cultured at 37°C to obtain a gRNA PAM site mutated plasmid, pdc5-CE6 plasmid.
[0136] (2) Using Saccharomyces cerevisiae CEN.PK2-1C as a template, primers E6 F and E6 R were used to obtain the gene fragment. ERG6 ; Use primers VG1 F and VG1 R to obtain expression cassette P GAL1 - ST1 and P GAL1 - PR1 ;
[0137] Gene fragments ERG6 Connect with the linearized plasmid pMD20 and introduce into competent Dh5α to obtain plasmid pMD20- ERG6 ;
[0138] The expression box P GAL1 - ST 1 and P GAL1 - PR1 Separately with the linearized plasmid pMD20- ERG6 By connecting, a single knockout overexpression fragment H1-P can be obtained. GAL1 - ST1 -H2, H1-P GAL1 - PR1 -H2, and the simultaneous overexpression knockout fragment H1-P GAL1 - ST1 -P GAL1 - PR1 -H2.
[0139] (3) The sgRNA pdc5-CE6 and H1-P constructed in (1) and (2) were GAL1 - ST1 -H2, H1-P GAL1 - PR1 -H2, H1-P GAL1 - ST1 -P GAL1 - PR1 -H2 were simultaneously introduced into the competent cell of Saccharomyces cerevisiae sc9, cultured on YPD+G418 plates at 30°C for 2-3 days, and PCR verification was performed using E6 F and E6 R to obtain Saccharomyces cerevisiae sc10, sc11, sc12, and sc13.
[0140] The specific steps of fermentation are as follows:
[0141] (1) The recombinant Saccharomyces cerevisiae strains sc9, sc10, sc11, sc12, and sc13 were cultured at 30°C and 220 rpm for 16 to 24 h to prepare seed solutions. The prepared seed solutions were inoculated into a 500-mL conical flask containing 100 mL of fermentation medium and 10 mL of dodecane at a 2% (v / v) inoculation rate and cultured at 30°C and 220 rpm for 96 h to prepare fermentation broth.
[0142] (2) Calculate the extracellular 7-DHC production:
[0143] After centrifugation, the upper dodecane layer was removed and filtered through a membrane into a liquid injection bottle for gas chromatography detection. The fermentation yield of the engineered strain was calculated by converting the peak area with that of the 7-DHC standard. The remaining fermentation liquid was resuspended, and the fermentation liquid was diluted 10 times and then the OD was measured using a UV spectrophotometer. 600 .
[0144] The results are shown in Table 5. ERG6 and overexpression ST1 and PR The extracellular 7-DHC content of the sc13 strain with the -1 transporter reached 11.701 mg / g, and the OD 600 Reach 7.78. (3) Calculate the intracellular 7-DHC production:
[0145] 8 mL of the resuspended fermentation broth was aspirated, washed with deionized water, and resuspended. The mixture was then added to a 10 mL EP tube with 3 mL of 3N hydrochloric acid and disrupted in boiling water for 5 minutes. After centrifugation, the supernatant was removed and the tube was washed again with deionized water. Intracellular sterols were extracted by saponification using a 1.5 mol / L KOH methanol solution in a 60°C water bath. After the reaction, the liquid was extracted with n-hexane, then evaporated to dryness in a 75°C water bath. The resulting n-hexane was reconstituted with a suitable amount of ethyl acetate, filtered through a filter membrane, and transferred to a liquid chromatography flask. Gas chromatography was performed, and the fermentation yield of the engineered strain was calculated by comparing the peak area with that of a 7-DHC standard. The results are shown in Table 5.
[0146] Table 5: PR-1 and ST1 replace ERG6 Intracellular and extracellular 7-DHC production of the strain and OD after fermentation 600
[0147] strains Extracellular 7-DHC (mg / g) Intracellular 7-DHC (mg / g) <![CDATA[OD 600 ]]> sc9 3.870 11.531 5.94 Sc10 5.241 18.784 7.82 Sc11 9.832 18.214 7.67 Sc12 11.124 16.392 7.89 Sc13 11.701 16.497 7.78
[0148] Among them, the highest yield is recombinant S. cerevisiae strain sc 13 When it was used for 500mL shake flask biphasic fermentation, the total 7-DHC production reached 28.198mg / g (secretion amount 11.701mg / g). Compared with the control sc1 strain, the total 7-DHC production increased by 14.54 times, and the total extracellular secretion increased by 13.77 times, of which the extracellular 7-DHC secretion production accounted for 41.51%.
Claims
1. A method for constructing a genetically engineered yeast strain for increasing the extracellular secretion yield of 7-DHC, characterized in that: The method comprises the following steps: (1) Knockout of C-22 sterol desaturase required for ergosterol synthesis ERG5 , and P GAP - DHCR24 -T CYC1 The fragment was integrated into the genome of Saccharomyces cerevisiae CEN.PK2-1C ERG5 The constructed Saccharomyces cerevisiae strain was named sc1; DHCR24 The sequence is shown in SEQ ID No. 1; (2) P GAL2 - ERG1 -T CYC1 The fragment was integrated into the genome of the sc1 strain and integrated into GAL6 site, through P GAL2 Promoter-enhanced expression ERG1 , the resulting Saccharomyces cerevisiae strain was named sc2; (3) P GAL1 - tHMG1 -T CYC1 The fragment was integrated into the δ sequence at both ends of Ty1 on the genome of the sc2 strain, and the GAL1 Promoter-enhanced expression tHMG1 , the Saccharomyces cerevisiae strain was constructed and named as sc3 strain; tHMG1 The Gene ID is 42650; (4) T TEF -T ADH1 - ERG8 -P GAL10 -P GAL1 - ERG12 -T CYC1 The fragment was integrated into the GAL80 site on the sc3 strain genome by P GAL1,10 Bidirectional promoter enhances expression ERG8 and ERG12 , the Saccharomyces cerevisiae strain was constructed and named sc4 strain; (5) T TEF -P GAL1 - POS5 -T CYC1 The fragment was integrated into the genome of the sc4 strain MIG1 site, through P GAL1 Promoter-enhanced expression POS5 , the Saccharomyces cerevisiae strain was constructed and named sc5 strain; (6) T TEF -T ADH1 - ERG9 -P GAL10 -P GAL1 - ERG20 -T CYC1 The fragment was integrated into the genome of the sc5 strain DPP1 site, through P GAL1,10 Bidirectional promoter enhances expression ERG20 and ERG9 , the Saccharomyces cerevisiae strain was constructed and named sc6 strain; (7) T TEF -P GAL1 - ERG11 -T CYC1 The fragment was integrated into the genome of the sc6 strain GDH1 site, through P GAL1 Promoter-enhanced expression ERG11 , the Saccharomyces cerevisiae strain was constructed and named sc7 strain; (8) T TEF -T ADH1 - IDI1 -P GAL10 -P GAL1 - ERG19 -T CYC1 The fragment was integrated into the genome of the sc7 strain ADH3 site, through P GAL1,10 Bidirectional promoter enhances expression IDI1 and ERG19 , the Saccharomyces cerevisiae strain was constructed and named sc8 strain; (9) P GAL1 - DHCR24 -T CYC1 The fragment was integrated into the Ty3 site of the sc8 strain genome by P GAL1 Promoter heterologous expression DHCR24 , the Saccharomyces cerevisiae strain was constructed and named sc9 strain; (10) The expression box P GAL1 - ST 1. P GAL1 - PR1 With the linearized plasmid pMD20- ERG6 Connect and obtain the simultaneously overexpressed knockout fragment H1-P GAL1 - ST1 -P GAL1 - PR1 -H2, H1-P GAL1 - ST1 -P GAL1 - PR1 -H2 was introduced into the genome of the sc9 strain to construct a knockout ERG6 and overexpression ST1 and PR The Saccharomyces cerevisiae strain that produces the 1 transport protein is named sc13 strain, which is the genetically engineered Saccharomyces cerevisiae strain that improves the extracellular secretion yield of 7-DHC; ST 1 is XP_717917.2 in the Genebank sequence number. PR1 The Genebank sequence number is XP_031058987.
1.
2. A genetically engineered yeast strain of Saccharomyces cerevisiae that increases the extracellular secretion yield of 7-DHC, constructed by the method of claim 1.
3. Use of the genetically engineered yeast Saccharomyces cerevisiae according to claim 2 in the production of 7-DHC by microbial fermentation.
4. The use according to claim 3, characterized in that The application comprises the following steps: inoculating the genetically engineered yeast Saccharomyces cerevisiae into a fermentation medium, adding n-dodecane which is 5-10% of the volume of the initial medium, fermenting and culturing at 28-32° C. for 48-96 hours, and separating and purifying the fermentation liquid to obtain the 7-DHC.
Citation Information
Patent Citations
Recombinant saccharomyces cerevisiaes for producing 7-dehydrocholesterol and construction method thereof
CN113151027A
Recombinant yeast strain having sterol productivity, preparation method therefor and use thereof
CN114072511A
Cited By
Saccharomyces cerevisiae genetically engineered bacterium for de novo synthesis of 7-DHC as well as construction method and application thereof
CN119842507A
A de novo synthesis of 7-DHC Saccharomyces cerevisiae genetically engineered strain, its construction method and application
CN119842507B
Fermentation culture medium and application thereof in fermentation process for improving yield of 7-DHC in saccharomyces cerevisiae
CN122303054A