SgRNA for knocking down hs3st5 gene and a knocking down vector and application thereof

By designing sgRNA targeting the HS3ST5 gene and constructing a CRISPR/Cas9 system, the HS3ST5 gene was knocked out, solving the problem of insufficient regulation of HS3ST5 in viral infection in existing technologies. This significantly inhibited viral replication and proliferation, providing a new method for antiviral infection.

CN116179546BActive Publication Date: 2026-03-31LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211248564.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-12
Publication Date
2026-03-31
Estimated Expiration
2042-10-12

AI Technical Summary

Technical Problem

There is limited research on the HS3ST5 gene in existing technologies, which has prevented the effective design of novel antiviral drugs and has not fully utilized the regulatory role of HS3ST5 in viral infection.

Method used

We designed and constructed sgRNA targeting the HS3ST5 gene, knocked down the HS3ST5 gene using the CRISPR/Cas9 system, and achieved gene knockout in cells using recombinant vectors and recombinant lentiviruses to prepare recombinant cell lines with stable HS3ST5 knockdown for use in preparing cells that reduce viral proliferation or drugs that fight viral infections.

Benefits of technology

It significantly reduces HS3ST5 gene expression in cells, thereby reducing the virus's gene replication and proliferation capacity in cells, providing a new approach to antiviral infection and significantly inhibiting viral replication and proliferation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179546B_ABST
    Figure CN116179546B_ABST
Patent Text Reader

Abstract

The present application provides an sgRNA for knocking down HS3ST5 gene and a knocking down vector and application thereof, and belongs to the technical field of gene knockout. The present application constructs a recombinant vector for knocking down HS3ST5 by using an sgRNA for targeting HS3ST5 gene, and after being packaged by a lentivirus, infects a BHK-21 cell line to obtain a BHK-21 recombinant cell line for knocking down HS3ST5. Experiments show that the BHK-21 recombinant cell line after knocking down HS3ST5 is significantly reduced in the replication ability and proliferation ability of FMDV. Therefore, the sgRNA for stably knocking down HS3ST5 can be used as an effective tool in the treatment of virus infection using HS as a receptor, and provides a new idea for anti-viral infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene knockout technology, specifically relating to an sgRNA for knocking down the HS3ST5 gene, its knockdown vector, and its applications. Background Technology

[0002] With the emergence and rapid development of gene-editing tools such as CRISPR, TALENs, and ZFNs, it has become possible to artificially manipulate cellular genomes to develop cost-effective recombinant cell lines. These gene-editing tools are sequence-specific endonucleases that help manipulate the activation or silencing of DNA at specific sites on the target genome. Depending on the practical needs of scientific research and industrial production, gene-editing tools allow for the integration or deletion of single or multiple sites on target genes, enabling researchers to directly edit or regulate the DNA function of any type of cell, ultimately identifying and revealing genome function at the system level. Gene-editing technology has advanced the development of next-generation therapeutic drugs and the emergence of gene therapy, and has also become a potential method for antiviral therapy.

[0003] CRISPR was discovered in the genomes of prokaryotes such as bacteria and archaea. The sequence originates from a fragment of bacteriophage DNA and is used to detect and destroy phage-like DNA. CRISPR-associated protein (Cas9) is a protease that uses the CRISPR sequence as a guide to recognize and cleave specific DNA complementary to the CRISPR sequence. Cas9 has two cleavage domains, called RuvC and HNH. These two nuclease domains mediate the breakage of the target DNA, leaving blunt ends at the break. The CRISPR / Cas9 system contains the Cas9 enzyme, as well as crRNA and transcriptional activation crRNA (tracrRNA). crRNA and tracrRNA combine to form a chimeric RNA structure called gRNA or sgRNA, which effectively activates and guides Cas9 to a specific motif downstream of the 20-nucleotide sequence targeted by the sgRNA, namely the protospacer adjacent motif (PAM), thereby cleaving the target DNA sequence in invading DNA. The targeting specificity of the CRISPR / Cas9 system is determined by the 20-nucleotide sequence at the 5' end of the sgRNA. For the CRISPR / Cas9 system targeting Streptococcus pyogenes, the required target sequence must immediately precede the 5'-NGG PAM motif. CRISPR / Cas9 gene editing technology boasts advantages such as low off-target effects and high knockdown efficiency. This technology utilizes sgRNA to specifically recognize viral genomes or host target gene sites, precisely cleaving complementary double-stranded DNA to exert antiviral effects. sgRNA has already been applied to inhibit various viruses, including the novel coronavirus, human immunodeficiency virus, and influenza virus, demonstrating that sgRNA can serve as a broad-spectrum antiviral tool in combating viral infections.

[0004] Heparan sulfate (HS) is a linear sulfated isopolysaccharide capable of binding a large number of ligands, including growth factors, morphogenetic factors, cytokines, chemokines, enzymes, matrix proteins, and viral particles, thereby exerting regulatory activity in various cellular biological processes, such as receptor activation, signal transduction, cytoskeleton assembly, and extracellular matrix remodeling. Simultaneously, HS can recognize and bind positively charged viral particles through weak interactions, increasing the number of viruses adsorbed on the cell surface and enhancing the infectivity of viral particles on host cells. Heparan sulfate 3-O-sulfate transferase 5 (HS3ST5) is an HS biosynthetic enzyme that catalyzes the transfer of sulfate groups from the sulfate donor to the 3-OH position of glucosamine to form 3-O-sulfated HS, thereby regulating the biological functions of HS. Currently, research on the effects of HS3ST5 on viral infection is limited, and there are no reports of using HS3ST5 as a target for designing novel antiviral drugs. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide an sgRNA that knocks down the HS3ST5 gene, which has a strong function of knocking down the HS3ST5 gene, providing a new approach for antagonizing viral infections that utilize HS as a receptor.

[0006] This invention provides an sgRNA for knocking down the HS3ST5 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] This invention provides a recombinant vector for knocking down the HS3ST5 gene, wherein the recombinant vector is a LentiCRISPRV2 vector containing the sgRNA.

[0008] This invention provides a recombinant lentivirus that knocks down the HS3ST5 gene, which is obtained by co-transfecting cells with the recombinant vector and helper plasmid.

[0009] Preferably, the helper plasmids are psPAX2 helper plasmid and pMD2.G helper plasmid;

[0010] During co-transfection, the mass ratio of the recombinant vector, psPAX2 helper plasmid, and pMD2.G helper plasmid is 4:3:1.

[0011] Preferably, the co-transfection is performed using the transfection reagent Lipofectamine 2000.

[0012] This invention provides the application of the sgRNA, the recombinant vector, or the recombinant lentivirus in the HS3ST5 gene of knockdown cells.

[0013] This invention provides a recombinant BHK-21 cell line with stable HS3ST5 knockdown mediated by the aforementioned sgRNA.

[0014] This invention provides an application of a reagent for knocking down the HS3ST5 gene in the preparation of cells that reduce viral proliferation or in the preparation of drugs for antiviral infection.

[0015] Preferably, the reagent is the sgRNA, the recombinant vector, the recombinant lentivirus, or the recombinant BHK-21 cell line;

[0016] The viruses include those that use HS receptors to invade cells.

[0017] The present invention provides an antiviral drug, wherein the sgRNA, the recombinant vector or the recombinant lentivirus is the active ingredient, and further comprises pharmaceutically acceptable excipients.

[0018] This invention provides an sgRNA for knocking down the HS3ST5 gene, the nucleotide sequence of which is shown in SEQ ID NO:1. Using the HS3ST5 gene as a template, this invention designs an sgRNA targeting HS3ST5. The sgRNA is introduced into cells via lentivirus to target and knock out the HS3ST5 gene. Compared with the blank control group, the sgRNA significantly reduces HS3ST5 gene expression in cells.

[0019] This invention provides the application of a reagent for knocking down the HS3ST5 gene in the preparation of cells that reduce viral proliferation or in the preparation of drugs for antiviral infection. Experiments of this invention show that by knocking down the expression level of the HS3ST5 gene in cells, the viral gene replication and proliferation capabilities of those cells decrease. Therefore, this invention, by knocking down the HS3ST5 gene, can be used to prepare cells that reduce viral proliferation or to prepare drugs for antiviral infection, providing a new approach to antiviral infection control. Attached Figure Description

[0020] Figure 1 The results of HS3ST5 expression level analysis in the BHK-21 recombinant cell line with HS3ST5 knockdown are as follows: (a) HS3ST5 protein level in the BHK-21 recombinant cell line with HS3ST5 knockdown; (b) HS3ST5 mRNA level in the BHK-21 recombinant cell line with HS3ST5 knockdown. * indicates that the HS3ST5 gene expression level in the experimental group cells was significantly reduced compared with the NC group (P<0.05).

[0021] Figure 2The results of HS3ST5 expression level analysis in HS3ST5 knockdown recombinant monoclonal cells are as follows: (a) HS3ST5 protein level in HS3ST5 knockdown recombinant monoclonal cells; (b) HS3ST5 mRNA level in HS3ST5 knockdown recombinant monoclonal cells; *** indicates that the relative expression level of HS3ST5 protein in the HS3ST5 knockdown recombinant cell line was significantly reduced compared with BHK-21 cells, P<0.01;

[0022] Figure 3 Results of the effect of sgRNA-42 knockdown of HS3ST5 on FMDV gene replication;

[0023] Figure 4 The results show the effect of sgRNA-42 knockdown of HS3ST5 on FMDV proliferation. ** indicates that the relative expression level of HS3ST5 gene was significantly reduced in the HS3ST5 knockdown recombinant cell line compared with BHK-21 cells (P<0.01). Detailed Implementation

[0024] This invention provides an sgRNA for knocking down the HS3ST5 gene, the nucleotide sequence of which is shown in SEQ ID NO:1 (CACCGGTACTGGGAAGCCTTGCCGT).

[0025] In this invention, the sgRNA has the characteristic of targeting and knocking down the HS3ST5 gene. Compared with the blank control group, the sgRNA treatment group can effectively reduce the expression level of the HS3ST5 gene in cells.

[0026] This invention provides a recombinant vector for knocking down the HS3ST5 gene, wherein the recombinant vector is a LentiCRISPRV2 vector containing the sgRNA.

[0027] In this invention, the preferred method for constructing the recombinant vector is to anneal the forward and reverse sequences of the sgRNA to obtain a double-stranded DNA fragment.

[0028] The double-stranded DNA fragment was ligated to a linearized LentiCRISPRV2 vector to obtain the ligation product.

[0029] The ligation product was identified to obtain a recombinant vector.

[0030] In this invention, the forward and reverse sequences of the sgRNA are preferably as shown in SEQ ID NO:1 and SEQ ID NO:2. The annealing reaction procedure is preferably as follows: 37℃ for 30 min, 95℃ for 5 min, and then decreasing at 5℃ / min for 25 min.

[0031] In this invention, the linearized LentiCRISPRV2 vector is preferably linearized by BsmB I digestion. The ligation method is preferably performed using T4 ligase. This invention does not impose any particular limitation on the T4 ligase ligation method; any ligation scheme well-known in the art can be used. The preferred method for identification is to transform the ligation product into *E. coli* for culture, then extract the recombinant plasmid, and send the recombinant plasmid that is positive by agarose gel electrophoresis to a sequencing company. The primers used for sequencing preferably have nucleotide sequences as shown in SEQ ID NO:5. The presence of an sgRNA sequence in the obtained sequence indicates successful construction of the recombinant vector.

[0032] This invention provides a recombinant lentivirus that knocks down the HS3ST5 gene, which is obtained by co-transfecting cells with the recombinant vector and helper plasmid.

[0033] In this invention, the helper plasmids are preferably psPAX2 and pMD2.G. During co-transfection, the mass ratio of the recombinant vector, psPAX2, and pMD2.G is 4:3:1. Co-transfection is performed using Lipofectamine 2000. Six hours after co-transfection, the treated cells are cultured in DMEM complete medium for 48 hours. The cell supernatant is collected, and the lentivirus titer is measured to rescue the recombinant lentivirus. The culture temperature is preferably 37°C. The lentivirus titer is preferably measured using a lentivirus rapid detection card. In this embodiment, the lentivirus rapid detection card was purchased from Beijing Biolong Immunotherapy Co., Ltd.

[0034] This invention provides the application of the sgRNA, the recombinant vector, or the recombinant lentivirus in the HS3ST5 gene of knockdown cells.

[0035] This invention provides a recombinant BHK-21 cell line with stable HS3ST5 knockdown mediated by the aforementioned sgRNA.

[0036] This invention provides an application of a reagent for knocking down the HS3ST5 gene in the preparation of cells that reduce viral proliferation or in the preparation of drugs for antiviral infection.

[0037] In this invention, the reagent is preferably the sgRNA, the recombinant vector, or the recombinant lentivirus.

[0038] In this invention, the virus preferably includes a virus that invades cells using the HS receptor. In an embodiment of this invention, foot-and-mouth disease virus is used as an example to illustrate the effect of knocking down the HS3ST5 gene on viral gene replication and proliferation in cells.

[0039] In this invention, the method for reducing viral proliferation in cells is preferably to clone the sgRNA into the knockout plasmid LentiCRISPRV2 to obtain a recombinant vector;

[0040] The recombinant vector was packaged into a recombinant lentivirus;

[0041] The recombinant lentivirus was used to infect cells, and after resistance screening, the cells obtained were cells with knocked-down HS3ST5 gene.

[0042] In this invention, the cells are preferably the BHK-21 cell line. The resistance screening is preferably performed using a culture medium containing puromycin. The concentration of puromycin is preferably 4 μg / mL. The cell infection time is preferably 6–7 days.

[0043] Given that knocking down the expression of the HS3ST5 gene in cells can reduce the gene replication and proliferation capacity of viruses in cells, the present invention provides an antiviral drug, with the sgRNA, the recombinant vector or the recombinant lentivirus as the active ingredient, and also includes pharmaceutically acceptable excipients.

[0044] This invention does not impose any special limitations on the excipients used; any excipients for gene therapy drugs well-known in the art can be used. This invention also does not impose any special limitations on the preparation method of the drug; any preparation method for gene therapy drugs well-known in the art can be used.

[0045] The following detailed description, in conjunction with embodiments, illustrates an sgRNA for knocking down the HS3ST5 gene, its knockout vector, and its applications provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] A method for constructing an sgRNA for knocking down the HS3ST5 gene and its knockout vector.

[0048] 1. Materials

[0049] 1.1 Cells, Plasmids, and Viruses

[0050] BHK-21 and HEK-293T cells were obtained from the China Center for Type Culture Collection. pMD2.G, psPAX2, and pLKO.1 plasmids were purchased from Invitrogen. The classic O-type foot-and-mouth disease vaccine strain O / HN / CHA / 93 (Cathay) was provided by the National Foot-and-Mouth Disease Reference Laboratory of China.

[0051] 1.2 Main Reagents

[0052] Rabbit-derived HS3ST5 polyclonal antibody was purchased from Novus, mouse-derived β-actin monoclonal antibody from Kangwei Century, RNeasy Mini Kit from Qiagen, high-glucose DMEM, MEM medium, Lipofectamine 2000, Opti-MEM medium and trypsin from Invitrogen, fetal bovine serum (FBS) and puromycin from Gibco, lentivirus rapid detection card from Beijing Bio-Long Immunotherapy Co., Ltd., and ChamQ SYBR qPCR Master Mix from Novizan.

[0053] 2. Methods

[0054] 2.1 Design and synthesis of sgRNA for knocking down HS3ST5

[0055] Based on the HS3ST5 gene sequence, sgRNAs targeting the HS3ST5 gene were designed using CRISPOR software. The sequences are shown in Table 1. The designed sgRNAs were synthesized by Genewiz Biotechnology Co., Ltd.

[0056] Table 1 sgRNA sequences

[0057]

[0058] 2.2 Construction of Lenti-sgRNA recombinant lentiviral plasmid

[0059] The synthesized sgRNA was annealed to form double-stranded DNA. The annealing system is shown in Table 2. The annealing conditions were: 37℃ for 30 min, 95℃ for 5 min, and then decreasing to 25 min at 5℃ / min. This operation phosphorylates the sgRNA and anneals it to double-stranded DNA. The annealing product was diluted 1:200 with ddH2O and ligated into the BsmB I linearized LentiCRISPRV2 vector. The ligation product was then transformed into a plasmid, and the plasmid was extracted. The constructed sgRNA recombinant lentiviral plasmid was initially identified by enzyme digestion. The positive plasmids were then sent to Genewiz Biotechnology Co., Ltd. for sequencing. The sequencing primers were 5'-ATGGACTATCATATGCTTACCGTA-3' (SEQ ID NO:3). The correctly identified plasmids, along with the helper plasmids pMD2.G and psPAX2, were used to extract large quantities of plasmid DNA.

[0060] Table 2 Annealing system for sgRNA

[0061]

[0062] Construction and identification results of Lenti-sgRNA recombinant lentiviral plasmid

[0063] The linearized product of the LentiCRISPRV2 vector was identified by agarose gel electrophoresis. A fragment of approximately 13,000 bp was recovered from the gel and then ligated to the double-stranded DNA product of sgRNA. After preliminary identification of the ligation product by agarose gel electrophoresis, positive clones were sent to the company for sequencing. The results showed that the Lenti-sgRNA-42 recombinant lentiviral plasmid was successfully constructed. The positive plasmids with correct sequencing were extracted and stored for future use.

[0064] Example 2

[0065] Rescue of Recombinant Lentiviral Viruses

[0066] HEK-293T cells were seeded in 10cm cell culture dishes. When the cells were in good condition and the density reached 70%, plasmid transfection was performed using Lipofectamine 2000 (10μg Lenti-sgRNA-42 recombinant lentiviral plasmid prepared in Example 1 + 7.5μg psPAX2 helper plasmid + 2.5μg pMD2.G helper plasmid). After 6 hours, 4ml of DMEM complete medium was added, and the cells were incubated at 37°C. After 48 hours, the cell supernatant was collected, and the lentiviral titer was determined using a lentiviral rapid detection card. The lentiviral solution was then filtered through a 0.45μm filter and stored for later use.

[0067] HEK-293T cells were transfected with the positive Lenti-sgRNA-42 recombinant lentiviral plasmid. After 48 hours, the cell supernatant was added to a lentiviral rapid detection card. The lentiviral rapid detection card turned dark red, and the calculated lentiviral titer was approximately 1.25 x 10⁻⁶. 6-7 TU / ml indicates successful packaging of the recombinant lentivirus.

[0068] Example 3

[0069] 1. Determination of puromycin screening concentration

[0070] BHK-21 cells were seeded into six-well plates. Once the cell density reached 80%, puromycin at concentrations of 1, 2, 3, 4, 5, and 6 μg / mL was added for treatment. The treatment was repeated every 24 hours, and cell viability was observed for 7 consecutive days. The lowest drug concentration at which no cells survived was selected as the optimal concentration for puromycin screening.

[0071] Construction of BHK-21 recombinant cell line with stable HS3ST5 knockdown using 2sgRNA

[0072] The recombinant lentivirus constructed in Example 2 was mixed with complete cell culture medium at a 1:1 volume ratio to prepare a mixed culture medium. Normal BHK-21 cells were seeded in six-well plates and cultured in the mixed culture medium. After the cells reached confluence, they were transferred to T25 cell culture flasks, and the mixed culture medium was added and changed every 24 hours. After 7 days, the lentivirus-infected cells were treated with the optimal concentration of puromycin, and the complete culture medium containing puromycin was changed every 24 hours. After 7 days, cell samples were collected, and the expression level of HS3ST5 was detected using real-time quantitative PCR (RT-qPCR) and Western blotting. The digested positive recombinant cells were counted, diluted with culture medium to form single cells, and added to 96-well plates. After the cells reached confluence, the single-clonal recombinant cells were expanded and cryopreserved, and the expression of HS3ST5 in the single-clonal recombinant cells was detected using RT-qPCR and Western blotting. The primers used in the HS3ST5 gene qPCR detection reagent were as follows: the upstream primer was 5'-CCATTTGCCCTGTTGAAAGCC-3' (SEQ ID NO:4), and the downstream primer was 5'-CCGGAATTCATGCAGCAGAC-3' (SEQ ID NO:5). The upstream primer for the internal control primer GAPDH was 5'-CAAGAAGGTGGTGAAGCA-3' (SEQ ID NO:6), and the downstream primer was 5'-AAGTGGAAGAGTGAGTGTC-3' (SEQ ID NO:7). These primers were synthesized by Genewiz Biotechnology Co., Ltd. The reverse transcription system for the RT-qPCR method is shown in Table 3. The reverse transcription program was 37℃ for 15 min and 85℃ for 5 s. The amplification system for the RT-qPCR method is shown in Table 4. The amplification reaction program was: 95℃ for 30 s pre-denaturation; 95℃ for 5 s, 60℃ for 30 s, 72℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 1 min, 95℃ for 30 s, 60℃ for 15 s. The relative mRNA copy number of HS3ST5 was calculated using the ΔΔCT method. The primary antibodies used in the Western blot assay were rabbit-derived HS3ST5 polyclonal antibody and mouse-derived β-actin monoclonal antibody. The secondary antibodies used were HRP-labeled goat anti-mouse IgG and HRP-labeled goat anti-rabbit IgG.

[0073] Table 3 RT-qPCR reverse transcription system for HS3ST5

[0074]

[0075]

[0076] Table 4. Amplification system of HS3ST5 RT-qPCR

[0077]

[0078] Establishment and identification of BHK-21 recombinant cell line with stable sgRNA knockdown of HS3ST5

[0079] BHK-21 cells were seeded in six-well plates and, after reaching 80% confluence, were treated with gradient concentrations of puromycin. It was observed that after 7 days of selection with a minimum concentration of 4 μg / mL of puromycin, all BHK-21 cells died. Therefore, 4 μg / mL is the optimal concentration of puromycin for screening the BHK-21 recombinant cell line.

[0080] After BHK-21 cells were infected with recombinant lentivirus and selected with the optimal concentration of puromycin for 7 days, Western blotting and RT-qPCR were used to identify whether the recombinant cell line had been successfully established. Results are as follows: Figure 1 Western blotting and RT-qPCR results showed a significant decrease in HS3ST5 protein and mRNA levels in BHK-sgHS3ST5-42-KD cells, indicating the successful establishment of the HS3ST5 knockdown BHK-21 recombinant cell line. Subsequently, 50 monoclonal cell lines were selected from the recombinant cell line and seeded into 12-well plates. After collecting the samples, the expression levels of HS3ST5 protein and mRNA in the recombinant monoclonal BHK-21 cells were detected using Western blotting and RT-qPCR.

[0081] Figure 2 The images show three monoclonal recombinant cell lines selected from the BHK-sgHS3ST5-42-KD recombinant cell line. The levels of HS3ST5 protein and mRNA in these cell lines were significantly lower than those in normal BHK-21 cells. These results indicate that BHK-21 monoclonal recombinant cell lines with HS3ST5 knockdown were successfully constructed using sgRNA, with the BHK-sgHS3ST5-42-35-KD recombinant cell line showing the best knockdown effect.

[0082] Example 4

[0083] 1. Effect of stable sgRNA knockdown of HS3ST5 on FMDV gene replication

[0084] In Example 3, recombinant BHK-21 cells and normal BHK-21 cells were seeded into 12-well plates. When the cell density reached 90%, both cell types were seeded with FMDV at an MOI of 1 and incubated at 37°C. Samples were collected at 4, 8, 10, 12, and 16 hours. RNA was extracted from the samples, and the FMDV 3D mRNA level was detected by RT-qPCR, using the same method as described in Example 3.

[0085] The results are as follows Figure 3 As shown, FMDV infection of normal BHK-21 cells and the BHK-sgHS3ST5-42-35-KD recombinant cell line resulted in peak viral mRNA levels at 12 hours. At this time, the FMDV mRNA level in BHK-sgHS3ST5-42-35-KD cells was 50% lower than that in normal cells. Furthermore, for samples at all time points, the FMDV mRNA level in the HS3ST5 knockdown BHK-sgHS3ST5-42-35-KD recombinant cell line was significantly lower than that in normal BHK-21 cells. These results indicate that stable sgRNA knockdown of HS3ST5 significantly inhibits FMDV gene replication.

[0086] Example 5

[0087] Effect of stable sgRNA knockdown of HS3ST5 on FMDV proliferation

[0088] Recombinant BHK-21 cells and normal BHK-21 cells were seeded into 12-well plates. When the cell density reached 90%, the two types of cells were seeded with FMDV at an MOI of 1 and placed in a 37°C incubator. Samples were collected after 4, 8, 10, 12 and 16 hours, and the plaque forming units (PFU) of the collected samples were determined by plaque assay.

[0089] Samples were collected from normal BHK-21 cells and BHK-sgHS3ST5-42-35-KD recombinant cells infected with FMDV, and the progeny viruses generated were quantified using a plaque formation assay. Results are as follows: Figure 4 The number of FMDV plaques in the 12-hour sample reached its peak. At this time, compared with control cells, the number of viral plaques in the BHK-HS3ST5-KD recombinant cell line with HS3ST5 knockdown was reduced by 45%. For samples collected at all time points, the number of FMDV plaques in the BHK-sgHS3ST5-42-35-KD recombinant cell line with HS3ST5 knockdown was significantly reduced compared with normal BHK-21 cells. These results indicate that stable sgRNA knockdown of HS3ST5 significantly inhibits FMDV proliferation.

[0090] As shown in the results of the above embodiments, this invention utilizes sgRNA targeting HS3ST5 to construct a BHK-21 recombinant cell line with HS3ST5 knockdown. The effect of sgRNA knockdown of HS3ST5 on FMDV replication and proliferation was evaluated by infecting the HS3ST5-knockdown BHK-21 recombinant cell line with FDMV. The results showed that sgRNA knockdown of HS3ST5 significantly inhibited FMDV replication and proliferation. Therefore, sgRNA with stable HS3ST5 knockdown can serve as an effective tool for the treatment of infections caused by various viruses, including FMDV, that utilize HS as a receptor.

[0091] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of a reagent for knocking down HS3ST5 gene in the preparation of a cell for reducing virus proliferation or a medicine for resisting virus infection, wherein the reagent is sgRNA, a recombinant vector, a recombinant lentivirus or a recombinant BHK-21 cell line for stably knocking down HS3ST5 mediated by the sgRNA; the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1; the recombinant vector is a LentiCRISPR V2 vector containing the sgRNA; the recombinant lentivirus is obtained by co-transfecting cells with the recombinant vector and helper plasmids; the virus is foot-and-mouth disease virus.

2. Use according to claim 1, characterized in that, the helper plasmids are psPAX2 helper plasmid and pMD2.G helper plasmid; when co-transfected, the mass ratio of the recombinant vector, psPAX2 helper plasmid and pMD2.G helper plasmid is 4:3:

1.

3. Use according to claim 1, characterized in that, when co-transfected, a transfection reagent Lipofectamine2000 is used.

Citation Information

Patent Citations

  • Use of engineered packaging cell lines for producing recombinant virus particles

    EP3822346A1